1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de Quant- it PicoGreen dsaadnssay Kit (Invitrogen ).

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamaño: px
Comenzar la demostración a partir de la página:

Download "1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de Quant- it PicoGreen dsaadnssay Kit (Invitrogen )."

Transcripción

1 1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de QuantiT PicoGreen dsaadnssay Kit (Invitrogen ). 2. Finalidad. El presente documento describe el Procedimiento Normalizado de Trabajo (PNT) para la cuantificación de librerías o de ADN genómico mediante el uso de espectrofluorometría utilizando el equipamiento GLOMAX Multi+ DetectionSystem (Promega) y los reactivos necesarios para ello, presentes en el kit QuantiT PicoGreen dsaadnssay Kit (Invitrogen ). 3. Contenido. 1. Título. 2. Finalidad. 3. Contenido 4. Definiciones. 5. Resumen. 6. Ámbito de aplicación y sustancias analizables. 7. Material e instrumental 8. Reactivos 9. Seguridad. 10. Condiciones preanalíticas de las muestras. 11. Preparación de las muestras: Protocolo 12. Condiciones instrumentales. 13. Resultados Expresión de resultados y cálculos Parámetros de control de calidad Evaluación de resultados. 14. Archivo. 4. Definiciones. No procede 5. Resumen. Este procedimiento permite la cuantificación de la cantidad total de ADN presente en una muestra, tanto si se trata de productos de PCR amplificados para la creación de librerías, como para la cuantificación de ADNs genómicos. El proceso implica la creación de una recta patrón a partir de diluciones seriadas de ADN de concentración inicial conocida y la interpolación en esta recta de los valores obtenidos para las muestras a cuantificar.

2 6. Ámbito de aplicación y sustancias analizables. El procedimiento se aplica a muestras de ADN genómico humano, originario de muestras humanas de sangre periférica, saliva, o inclusiones en parafina de tejido tumoral, así como para productos de amplificación de reacción en cadena de polimerasa (PCR) cuando el protocolo se integra dentro del protocolo general de creación de librerías de ADN por PCR. 7. Material e instrumental Guantes de nitrilo Pipeta de volumen variable de 0,5 a 10 µl. Pipeta de volumen variable de 10 a 100 µl. Pipeta de volumen variable de 100 µl a 1 ml. Pipeta multicanal de volumen variable de 0,5 a 10 µl Pipeta multicanal de volumen variable de 10 a 100 µl Pipeta multicanal de volumen variable de 50a 1000 µl Puntas con filtro para pipetas de volúmenes variables de 0,5 µl a 10 µl Puntas con filtro para pipetas de volúmenes variables de 10 µl a 100 µl. Puntas con filtro para pipetas de volúmenes variables de 50 µl a 1 ml Tubos de plástico de 1,5ml. Placas para cuantificación por fluorimetría: Plate black 96 well, flat bottom, medium binding (Greiner bioone). Espectrofluorímetro GLOMAX Multi+ DetectionSystem (Promega) Centrífuga de placas. Vortex Campana de flujo laminar 8. Reactivos. QuantiT PicoGreen dsaadnssay Kit (Invitrogen ): Compuesto por dos reactivos a usar, DNA standar de concentración conocida y el propio reactivo fluorescente (picogreen). Tampon TE 1X Agua para biología molecular (libre de DNA, DNsas y RNasas) 9. Seguridad. Se recomienda el empleo de guantes desechables durante todo el proceso, y tomar todas las precauciones necesarias para la manipulación de muestras biológicas con riesgo de contagio.

3 10. Condiciones preanalíticas de muestras y reactivos. Las muestras a analizar y todos los reactivos deben estar a temperatura ambiente para realizar la determinación. 11. Preparación de las muestras: PROTOCOLO 1. Preparar la recta patrón con el DNA estándar del kit de PicoGreen. 2. Marca 11 eppendorfs del 1 al 11 y añade las siguientes cantidades de TE 1X (campana): a. Tubo 1: 594 µl b. Tubos 211: 300 µl 3. Transfiere 6 µl del DNA estándar al tubo 1 y vortexea durante 10 seg.(campana) 4. Transfiere 300 µl del tubo 1 al tubo 2 y vortexea durante 10 seg y continua la serie de diluciones. El tubo 8 (ó 11) es el control negativo, no hay que pasarle nada desde el tubo 7 (ó 10). (campana): 5. Transfiere 100 µl de cada tubo a la placa de cuantificación. (campana) 6. Transfiere 99µl de TE 1X a cada pocillo de la placa en tantas posiciones como muestras tengas.(campana) 7. Transfiere 1 µl de cada muestra. Si has hecho la purificación por Pippin tienes que cargar tanto la muestra original como la purificada por Pippin. 8. Mezcla con la pipeta. 9. Añade 100 µl de una dilución 1:200 del reactivo PicoGreen a cada pocillo Lectura de Picogreen. Preparar el Excel con los tamaños de los fragmentos para medir concentraciones. 10. Comprueba las concentraciones en la plantilla correspondiente. 11. Diluye las muestras con los volúmenes indicados en la plantilla para alcanzar la concentración y mezcla las muestras para formar el pool en caso de diagnóstico, en caso de investigación se cuantifica el pool antes del pippin y después del pippin. También se hará un Qiaxcel de los dos pools para verificar que se han eliminado los dímeros. Las diluciones del punto 12 y 13 se preparan cuando ya estemos preparando la empcr. 12. Diluye el pool de muestras de hasta (2 µl del pool en 198 µl de TE 1X). 13. Diluye el pool de muestras de hasta (4 µl del pool en 16 µl de TE 1X). Doc. De picogreen

4 Selecciónà Datos. Texto en columnas Delimitado por comas y tab Reemplazar. por, 12. Condiciones instrumentales Procedimiento de manejo del florimetro GLOMAX Multi+ DetectionSystem (Promega) Encender el instrumento. Verificar su operatividad. Una vez ha arrancado, en la pantalla táctil, seleccionar el tipo de protocolo: Select protocol: Fluorescence protocol Optical kit: BLUE (490/510570). Presionar OK. Presionar sobre el icono de la placa. Seleccionar los pocillos ocupados en la lectura. Presionar OK. Presionar DOOR. Se abrirá la puerta del instrumento. Colocar la placa de lectura en la disposición correcta (indicada en el soporte) Volver a presionar DOOR para cerrar la puerta. Presionar start. Una vez terminada la lectura, guardar los datos en el pendrive. Analizar los resultados (creación de la recta patrón e interpolación de las medidas tomadas para las muestras) en una hoja Excel en cualquier ordenador. 13. Resultados. No está contemplada la comunicación definitiva de resultados en este protocolo. La observación correcta de lo obtenido permitirá continuar con el proceso siguiente. Si las cantidades de ADN medidas lo permiten, se puede continuar con el paso subsiguiente dentro del protocolo en el que esté integrada la medición descrita en este PNT Parámetros de control de calidad interno. El control de calidad en el análisis de cada muestra se realiza mediante los criterios descritos habituales: Observación de resultado positivo en los controles positivos, y observación de resultado no positivo en los controles negativos si procede. En este caso se verifica en cada medición que los reactivos cumplen con los requisitos necesarios al verificar la calidad de la curva de regresión obtenida a partir de los productos surtidos por el kit.

5 13.2. Evaluación de resultados. 1. Comprobar que los parámetros de control de calidad interno se cumplen. Si no se cumplen, se comunicará a la persona responsable del ensayo. 2. La evaluación de resultados se registrará convenientemente. 3. Los resultados de evaluación serán comunicados a la persona responsable. 4. La documentación analítica será archivada según se describe en el apartado 14 de este PNT. 14. Archivo. 1. Toda la documentación analítica se introducirá en una carpeta identificada con el código o el nombre del procedimiento, las muestras contenidas y fecha. Los archivos electrónicos serán guardados en copias de seguridad.

TaqMan GMO Maize Quantification Kit. Part No: 4481972

TaqMan GMO Maize Quantification Kit. Part No: 4481972 TaqMan GMO Maize Quantification Kit Part No: 4481972 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan

Más detalles

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Para la purificación de ADN genómico de todos los kits de colección Oragene y ORAcollect. Visite nuestro sitio

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. info@atgen.com.uy www.atgen.com.uy

Más detalles

TaqMan GMO Screening Kit. Part No: 4466334

TaqMan GMO Screening Kit. Part No: 4466334 TaqMan GMO Screening Kit Part No: 4466334 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan mayor

Más detalles

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN 5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN Materiales - Eppendorf de 1,5 ml estériles - Eppendorf de pared fina para PCR - Puntas de pipeta estériles desechables - Guantes

Más detalles

MANUAL DE PROCEDIMIENTOS DE LOS TERMOCICLADORES DE PCR EN TIEMPO REAL: STEP-ONE-PLUS Y QUANTSTUDIO 12K FLEX de Applied Biosystems

MANUAL DE PROCEDIMIENTOS DE LOS TERMOCICLADORES DE PCR EN TIEMPO REAL: STEP-ONE-PLUS Y QUANTSTUDIO 12K FLEX de Applied Biosystems MANUAL DE PROCEDIMIENTOS DE LOS TERMOCICLADORES DE PCR EN TIEMPO REAL: STEP-ONE-PLUS Y QUANTSTUDIO 12K FLEX de Applied Biosystems INDICE I. Introducción II. Objetivo General del Manual III. Políticas de

Más detalles

DANAGENE RNA PURIFICATION KIT

DANAGENE RNA PURIFICATION KIT DANAGENE RNA PURIFICATION KIT REF.0801.1 100 EXTRACCIONES REF.0801.2 500 EXTRACCIONES 1.INTRODUCCION Este kit permite la permite la obtención de ARN total a partir de cultivos celulares, tejidos animales,

Más detalles

ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA

ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA FACULTAD DE VETERINARIA DEPARTAMENTO DE SANIDAD ANIMAL ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA GUIÓN DE PRÁCTICAS DE LABORATORIO CURSO 2014 2015 MÓDULO: PORCINO Síndrome respiratorio y reproductor

Más detalles

Materiales para la secuenciación de ADN

Materiales para la secuenciación de ADN Introduccion La Secuenciación Sanger es un método de secuenciación de ADN en el que el ADN diana se desnaturaliza y se hibrida con un cebador de oligonucleótidos, que se extiende entonces gracias a la

Más detalles

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

Tecnología HaloPlex by Genycell Biotech España

Tecnología HaloPlex by Genycell Biotech España Paneles de genes custom-made Tecnología HaloPlex by Genycell Biotech España SERVICIO NGS CLÍNICA HALO: OVERVIEW 1. DISEÑO DEL PANEL DE GENES Y DEL KIT DE CAPTURA 2. PREPARACIÓN DE LA MUESTRA EN EL LABORATORIO

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

PLIEGO DE PRESCRIPCIONES TÉCNICAS CONTRATO DE SUMINISTROS. ADQUISICIÓN DE EQUIPOS Nº EXPEDIENTE: 2/2013

PLIEGO DE PRESCRIPCIONES TÉCNICAS CONTRATO DE SUMINISTROS. ADQUISICIÓN DE EQUIPOS Nº EXPEDIENTE: 2/2013 PLIEGO DE PRESCRIPCIONES TÉCNICAS CONTRATO DE SUMINISTROS. ADQUISICIÓN DE EQUIPOS Nº EXPEDIENTE: 2/2013 REF/ PROYECTO: PROMIS 2012 NÚMERO DE LOTES: UNICO Este pliego contempla la adquisición de un sistema

Más detalles

SwabSolution Kit INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC8271.

SwabSolution Kit INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC8271. Technical Manual SwabSolution Kit INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC8271. IMPRESO EN ESTADOS UNIDOS Nro. de pieza: TMD037 SwabSolution Kit Toda la bibliografía técnica está disponible en Internet,

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN.

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. PROGRAMA CONTROL DE CALIDAD DE MUESTRAS El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. El programa completo de control de calidad de muestras de ADN y ARN engloba diferentes

Más detalles

UNIDAD DE SECUENCIACIÓN HOSPITAL UNIVERSITARIO SANT JOAN DE DEU

UNIDAD DE SECUENCIACIÓN HOSPITAL UNIVERSITARIO SANT JOAN DE DEU UNIDAD DE SECUENCIACIÓN HOSPITAL UNIVERSITARIO SANT JOAN DE DEU La Unidad de secuenciación del Hospital Universitario Sant Joan de Déu, es una unidad de reciente creación que nace con el objetivo de prestar

Más detalles

DETERMINACIÓN DEL FACTOR Rh por PCR

DETERMINACIÓN DEL FACTOR Rh por PCR Ref.PCRRh DETERMINACIÓN DEL FACTOR Rh por PCR 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

PROSPECTO. Para uso diagnóstico in vitro. Para uso en la preparación y aislamiento de linfocitos purificados directamente de sangre entera.

PROSPECTO. Para uso diagnóstico in vitro. Para uso en la preparación y aislamiento de linfocitos purificados directamente de sangre entera. Para uso en la preparación y aislamiento de linfocitos purificados directamente de sangre entera. PROSPECTO Para uso diagnóstico in vitro PI-TT.610-ES-V5 Información e instrucciones Uso previsto El reactivo

Más detalles

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa?

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa? 2º BIOQUÍMICA CUESTIONES 1. Por qué la PCR convencional no es cuantitativa? En la PCR convencional, la cuantificación del ADN de la muestra es complicada debido a que la eficacia de amplificación va disminuyendo

Más detalles

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR)

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) Centro de de Microscopía Electrónica Facultad de de Ciencias Médicas Universidad Nacional de de Córdoba

Más detalles

Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala

Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala IICA/Red SICTA-CIAT INFORME DE AVANCE Gerardo Gallego - Harold

Más detalles

Universidad Tecnológica de Panamá Centro de Investigaciones Hidráulicas e Hidrotécnicas Laboratorio de Sistemas Ambientales

Universidad Tecnológica de Panamá Centro de Investigaciones Hidráulicas e Hidrotécnicas Laboratorio de Sistemas Ambientales Página: 1 de 5 1. Introducción: La prueba de Demanda Química de Oxígeno (DQO) se basa en la oxidación química de la materia orgánica e inorgánica, presente en las muestras de agua, con dicromato de potasio

Más detalles

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a Introducción Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a los investigadores verificar la expresión de una proteína, determinar la cantidad relativa

Más detalles

III. METODOLOGÍA EXPERIMENTAL

III. METODOLOGÍA EXPERIMENTAL III. METODOLOGÍA EXPERIMENTAL 3.1 Análisis Previos Se utilizaron los filtros con muestra de partículas suspendidas en el aire PM 10 que el Instituto Municipal de Ecología (IME) proporcionó para llevar

Más detalles

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS Prácticas docentes en la COD: 10-71 APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS FUNDAMENTO TEÓRICO La PCR es una técnica que permite llevar a cabo la síntesis in vitro de fragmentos de ADN. Está basada

Más detalles

TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO

TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO TEST de PATERNIDAD Este experimento introduce a los alumnos en el uso del ADN y la PCR para simular una determinación de paternidad. Los estudiantes

Más detalles

Protocolos de secuenciación de ADN

Protocolos de secuenciación de ADN 1 Protocolos de secuenciación de ADN Introducción El método de secuenciación utilizado aquí es el desarrollado por Sanger en 1975. Este consiste en la incorporación de didesixinucleótidos marcados fluorescentemente

Más detalles

PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN DE LAS COMPETENCIAS PROFESIONALES CUESTIONARIO DE AUTOEVALUACIÓN PARA LAS TRABAJADORAS Y TRABAJADORES

PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN DE LAS COMPETENCIAS PROFESIONALES CUESTIONARIO DE AUTOEVALUACIÓN PARA LAS TRABAJADORAS Y TRABAJADORES MINISTERIO DE EDUCACIÓN SECRETARÍA DE ESTADO DE EDUCACIÓN Y FORMACIÓN PROFESIONAL DIRECCIÓN GENERAL DE FORMACIÓN PROFESIONAL INSTITUTO NACIONAL DE LAS CUALIFICACIONES PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN

Más detalles

Guía de PCR en tiempo real

Guía de PCR en tiempo real Guía de PCR en tiempo real Michelle C. Chirinos-Arias michelle.christine16@gmail.com Índice Introducción. 2 Algunos conceptos. 2 PCR (reacción en cadena de la polimerasa)... 2 PCR en tiempo real (qpcr)..

Más detalles

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G.

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G. C825T Sistema para la detección de la mutación C825T en el gene de la proteína G. Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. Info@atgen.com.uy www.atgen.com.uy

Más detalles

AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO

AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO E l estudio del genoma de los seres vivos a sido uno d los principales objetivos de la Biología. Desde los trabajos de Mendel (1866),

Más detalles

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml)

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml) PCR SIMULADA Ref.PCR Simulada (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

25. Perfil lipídico. Isaac Túnez Fiñana 1, Aurora Galván Cejudo 2 RESUMEN

25. Perfil lipídico. Isaac Túnez Fiñana 1, Aurora Galván Cejudo 2 RESUMEN 25. Perfil lipídico Isaac Túnez Fiñana 1, Aurora Galván Cejudo 2 1 Departamento de Bioquímica y Biología Molecular, Avda. Menéndez Pidal s/n, 14071- Córdoba, 2 Campus de Rabanales, Edif. Severo Ochoa 14071-Córdoba

Más detalles

NORMAS DE TRABAJO EN BIOLOGÍA MOLECULAR Y GUÍA DE PROBLEMAS HABITUALES Y SU SOLUCIÓN

NORMAS DE TRABAJO EN BIOLOGÍA MOLECULAR Y GUÍA DE PROBLEMAS HABITUALES Y SU SOLUCIÓN NORMAS DE TRABAJO EN BIOLOGÍA MOLECULAR Y GUÍA DE PROBLEMAS HABITUALES Y SU SOLUCIÓN 1. PROCEDIMIENTOS BÁSICOS: En este apartado pretendemos detallar algunos factores muy importantes a la hora de realizar

Más detalles

TP1: Diluciones. Objetivos. Introducción. Introducción a la Biología Celular y Molecular

TP1: Diluciones. Objetivos. Introducción. Introducción a la Biología Celular y Molecular TP1: Diluciones Objetivos Familiarizarse con las unidades mas utilizadas en biología molecular y ser capaces de intercambiar ágilmente las distintas unidades. Familiarizarse con el material de uso corriente

Más detalles

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles

PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN DE LAS COMPETENCIAS PROFESIONALES CUESTIONARIO DE AUTOEVALUACIÓN PARA LAS TRABAJADORAS Y TRABAJADORES

PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN DE LAS COMPETENCIAS PROFESIONALES CUESTIONARIO DE AUTOEVALUACIÓN PARA LAS TRABAJADORAS Y TRABAJADORES MINISTERIO DE EDUCACIÓN SECRETARÍA DE ESTADO DE EDUCACIÓN Y FORMACIÓN PROFESIONAL DIRECCIÓN GENERAL DE FORMACIÓN PROFESIONAL INSTITUTO NACIONAL DE LAS CUALIFICACIONES PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN

Más detalles

SISTEMAS DE DETECCIÓN DE PATÓGENOS POR PCR A TIEMPO REAL. Guía de interpretación de resultados

SISTEMAS DE DETECCIÓN DE PATÓGENOS POR PCR A TIEMPO REAL. Guía de interpretación de resultados SISTEMAS DE DETECCIÓN DE PATÓGENOS POR PCR A TIEMPO REAL Guía de interpretación de resultados Sistemas de detección de patógenos por PCR a tiempo real Microbial ofrece sistemas para la detección de patógenos

Más detalles

Lección 16. INTRODUCCIÓN AL ANÁLISIS CUANTITATIVO.

Lección 16. INTRODUCCIÓN AL ANÁLISIS CUANTITATIVO. Lección 16. INTRODUCCIÓN AL ANÁLISIS CUANTITATIVO. Análisis cuantitativo: Conceptos básicos. Propiedades analíticas de interés. Trazabilidad. Materiales de referencia. Calibración instrumental y metodológica.

Más detalles

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles

Abbott RealTime HIV-1

Abbott RealTime HIV-1 6L18 51-605130/R1 Abbott RealTime HIV-1 Nota: consulte las modificaciones marcadas es 6L18 51-605130/R1 Símbolos utilizados Fabricante referencia lote Producto sanitario para diagnóstico in vitro Control

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles

PCR a tiempo real. Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia

PCR a tiempo real. Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia PCR a tiempo real Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia PCR a tiempo real (PCRrt) Aplicaciones: - Cuantificación de ácidos nucleicos (AQ). - Estudio

Más detalles

imegen Alfa-1-AT Manual de Usuario Referencia: IMG-211

imegen Alfa-1-AT Manual de Usuario Referencia: IMG-211 Manual de Usuario imegen Alfa-1-AT Genotipado de las mutaciones Glu342Lys (PI-Z) y Glu264Val (PI-S) del gen SERPINA1 mediante PCR a tiempo real Referencia: Fabricado en España Garantías y responsabilidades

Más detalles

RESOLUCIÓN OIV-OENO 521-2013 MÉTODO DE DETECCIÓN DE FTALATOS EN LAS BEBIDAS ESPIRITUOSAS POR CROMATOGRAFÍA DE GASES/ESPECTROMETRÍA DE MASAS

RESOLUCIÓN OIV-OENO 521-2013 MÉTODO DE DETECCIÓN DE FTALATOS EN LAS BEBIDAS ESPIRITUOSAS POR CROMATOGRAFÍA DE GASES/ESPECTROMETRÍA DE MASAS RESOLUCIÓN OIV-OENO 521-2013 MÉTODO DE DETECCIÓN DE FTALATOS EN LAS BEBIDAS ESPIRITUOSAS POR CROMATOGRAFÍA DE GASES/ESPECTROMETRÍA DE MASAS LA ASAMBLEA GENERAL, Visto el artículo 2 párrafo 2 iv del acuerdo

Más detalles

CROMATOGRAFÍA DE GASES ACOPLADO A UN DETECTOR DE MASAS GC/MS

CROMATOGRAFÍA DE GASES ACOPLADO A UN DETECTOR DE MASAS GC/MS CROMATOGRAFÍA DE GASES ACOPLADO A UN DETECTOR DE MASAS GC/MS La cromatografía es una técnica para separar las sustancias químicas que se basa en las diferencias en conductas partitivas de una fase móvil

Más detalles

CATÁLOGO ROCHE EQUIPOS 2013, AKRALAB

CATÁLOGO ROCHE EQUIPOS 2013, AKRALAB CATÁLOGO ROCHE EQUIPOS 2013, AKRALAB Pulsar Aquí 1.- ANALIZADORES DE ORINA / SISTEMAS DE URIANÁLISIS - URISYS 1100 - COBAS u411 ( URISYS 1800 ) - URISYS 2400 2.- ANALIZADORES DE QUÍMICA CLÍNICA - COBAS

Más detalles

DETERMINACIÓN ESPECTROFOTOMÉTRICA DE KMnO 4, CuSO 4 y K 2 Cr 2 O 7

DETERMINACIÓN ESPECTROFOTOMÉTRICA DE KMnO 4, CuSO 4 y K 2 Cr 2 O 7 DETERMINACIÓN ESPECTROFOTOMÉTRICA DE KMnO 4, CuSO 4 y K 2 Cr 2 O 7 El objetivo de esta investigación es la determinación cuantitativa de la concentración de KMnO 4 en una muestra problema mediante espectroscopía

Más detalles

Técnicas moleculares.

Técnicas moleculares. Técnicas moleculares. DMTV Carolina Acevedo Curso de Microbiología 2015 SÍNTESIS IN VITRO DE UNA GRAN CANTIDAD DE COPIAS DE UN SEGMENTO DE ADN EXISTENTE EN UNA MUESTRA. O sea. Amplificamos en forma exponencial

Más detalles

CALIBRACIÓN Y CALIDAD

CALIBRACIÓN Y CALIDAD CALIBRACIÓN Y CALIDAD La preocupación por la calidad de los datos que se obtienen con la química analítica es responsabilidad de los científicos y técnicos. Éstos deben mantener en todo momento una actitud

Más detalles

FICHA DE DATOS DE SEGURIDAD (MSDS) KIT CLART CMA KRAS BRAF PI3K

FICHA DE DATOS DE SEGURIDAD (MSDS) KIT CLART CMA KRAS BRAF PI3K 1. Identificación de la sustancia y proveedor Nombre comercial CLART CMA KRAS BRAF PI3K Referencias: Amplificación KRAS 8 determinaciones Ref.: CS-0412-8 24 determinaciones Ref.: CS-0412-24 Amplificación

Más detalles

Características del kit:

Características del kit: ! La detección de clonalidad mediante análisis molecular por PCR de reordenamientos de los genes de las inmunoglobulinas (Ig) y TCR, es un instrumento de gran valor en el diagnóstico de los procesos linfoproliferativos

Más detalles

COMBINAR CORRESPONDENCIA EN MICROSOFT WORD

COMBINAR CORRESPONDENCIA EN MICROSOFT WORD COMBINAR CORRESPONDENCIA EN MICROSOFT WORD Combinar documentos consiste en unir dos documentos diferentes sin que se modifiquen los datos que aparecen en ellos. Esta operación es muy útil y muy frecuente

Más detalles

ELECTROFORESIS BASICA

ELECTROFORESIS BASICA Ref.ELECBASICA (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO ELECTROFORESIS BASICA El objetivo de este experimento es introducir a los alumnos en el conocimiento de la teoría electroforética y familiarizarse

Más detalles

PET-RPLA KIT para DETECCIÓN de TOXINAS. Código: TD0930

PET-RPLA KIT para DETECCIÓN de TOXINAS. Código: TD0930 PET-RPLA KIT para DETECCIÓN de TOXINAS Código: TD0930 Kit para detección de enterotoxina tipo A de Clostridium perfringens en muestras fecales o en filtrados de cultivos por aglutinación pasiva de látex

Más detalles

1. OBJETO. 3.1. DOCUMENTOS UTILIZADOS EN LA ELABORACIÓN. 3.2. DOCUMENTOS (PNTs) A UTILIZAR CONJUNTAMENTE. 5.1. MATERIALES Y REACTIVOS.

1. OBJETO. 3.1. DOCUMENTOS UTILIZADOS EN LA ELABORACIÓN. 3.2. DOCUMENTOS (PNTs) A UTILIZAR CONJUNTAMENTE. 5.1. MATERIALES Y REACTIVOS. Página 1 de 5 CENTRO DE INVESTIGACION EN SANIDAD ANIMAL (CISA-INIA) Laboratorio de Referencia de la UE de PPA (EURL-ASF) Centro de Investigación en Sanidad Animal CISA-INIA, Valdeolmos 28130, Madrid, Spain.

Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

Nota Técnica Números Generadores OPUS CAD. Números Generadores OPUS CAD. OPUS PLANET Como utilizar OPUS CAD. Ninguna.

Nota Técnica Números Generadores OPUS CAD. Números Generadores OPUS CAD. OPUS PLANET Como utilizar OPUS CAD. Ninguna. TITULO: INFORMACIÓN GENERAL: Versiones: Resumen: Referencias a otras notas técnicas: Palabras clave: OPUS PLANET Como utilizar OPUS CAD. Ninguna. Medir, cuantificar, crear, números generadores, en OPUS

Más detalles

38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa

38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa 38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa José Luis Caballero Repullo, Enriqueta Moyano, Juan Muñoz Blanco Departamento de Bioquímica y Biología Molecular, Campus

Más detalles

Manual para validación de comprobantes fiscales digitales

Manual para validación de comprobantes fiscales digitales Manual para validación de comprobantes fiscales digitales Contenido Obtener el archivo XML... 2 MaxiComercio y Déminus... 2 FactuDesk... 2 Validación de CFD... 3 Validación de CFDI... 9 1 Obtener el archivo

Más detalles

TEMA 2 WINDOWS XP Lección 3 PROGRAMA WORDPAD

TEMA 2 WINDOWS XP Lección 3 PROGRAMA WORDPAD TEMA 2 WINDOWS XP Lección 3 PROGRAMA WORDPAD 1) TRATAMIENTO DE TEXTOS Uno de los programas accesorios más útiles entre los que vienen con Windows XP es WordPad: un tratamiento de textos pequeño, pero potente,

Más detalles

ELISA PeliClass human IgG subclass kit REF M1551

ELISA PeliClass human IgG subclass kit REF M1551 Sanquin Reagents Plesmanlaan 5 0 CX Amsterdam The Netherlands Phone: +.0.5.599 Fax: +.0.5.570 Email: reagents@sanquin.nl Website: www.sanquinreagents.com M55/ November 007 ELISA PeliClass human IgG subclass

Más detalles

GARANTIAS MINIMAS DE CALIDAD Y SEGURIDAD EXIGIBLES PARA LA UTILIZACION DE PLASMA RICO EN PLAQUETAS (PRP) EN LA COMUNIDAD AUTONOMA DE LA REGION DE

GARANTIAS MINIMAS DE CALIDAD Y SEGURIDAD EXIGIBLES PARA LA UTILIZACION DE PLASMA RICO EN PLAQUETAS (PRP) EN LA COMUNIDAD AUTONOMA DE LA REGION DE GARANTIAS MINIMAS DE CALIDAD Y SEGURIDAD EXIGIBLES PARA LA UTILIZACION DE PLASMA RICO EN PLAQUETAS (PRP) EN LA COMUNIDAD AUTONOMA DE LA REGION DE MURCIA 1 GARANTIAS MINIMAS DE CALIDAD Y SEGURIDAD EXIGIBLES

Más detalles

EVALUACION EXTERNA DEL DESEMPEÑO PARA LA DETECCION DEL VIRUS DE INFLUENZA TIPO A MEDIANTE LA TÉCNICA DE RT- PCR PANEL x (20xx)

EVALUACION EXTERNA DEL DESEMPEÑO PARA LA DETECCION DEL VIRUS DE INFLUENZA TIPO A MEDIANTE LA TÉCNICA DE RT- PCR PANEL x (20xx) 1. OBJETIVO Evaluar el desempeño de los Laboratorios de Salud Pública participantes en cuanto a la detección del virus de la Influenza A mediante la técnica de RT PCR. 2. ALCANCE Este documento se tomo

Más detalles

versus PCR en Tiempo Real PCR convencional no es cuantitativo

versus PCR en Tiempo Real PCR convencional no es cuantitativo PCR convencional o PCR de punto final versus PCR en Tiempo Real PCR convencional no es cuantitativo S Lobos C - U de Chile 1 PCR clásico La cantidad de producto no está relacionada con la cantidad de DNA

Más detalles

PROCEDIMIENTO PARA DETERMINACIÓN DE SODIO, POTASIO y CALCIO EN ALIMENTOS. Método Espectrofotometría de Absorción Atómica de llama. Método AOAC 985.

PROCEDIMIENTO PARA DETERMINACIÓN DE SODIO, POTASIO y CALCIO EN ALIMENTOS. Método Espectrofotometría de Absorción Atómica de llama. Método AOAC 985. Página 1 de 8 1. OBJETIVO Determinar la concentración de sodio, potasio y calcio en muestras de alimentos con bajo contenido de grasa. 2. CAMPO DE APLICACIÓN Y ALCANCE El método es aplicable a alimentos

Más detalles

TALLER COMPUTACIÓN II

TALLER COMPUTACIÓN II Prof. Martín Ferreyra TALLER COMPUTACIÓN II MANEJO AVANZADO DE MS WORD COMBINAR CORRESPONDENCIA Combinar Correspondencia Instituto Secundario John Kennedy Unidad 2. Combinar correspondencia (I) Mediante

Más detalles

Protocolo del CDC para el RT-PCR en tiempo real para el nuevo subtipo del virus de influenza A(H1N1) 1

Protocolo del CDC para el RT-PCR en tiempo real para el nuevo subtipo del virus de influenza A(H1N1) 1 Protocolo del CDC para el RT-PCR en tiempo real para el nuevo subtipo del virus de influenza A(H1N1) 1 28 de abril de 2009 Revisión 1 (30 de abril e 2009) El Centro Colaborador para la Influenza de la

Más detalles

5. MATERIALES Y MÉTODOS

5. MATERIALES Y MÉTODOS 5. MATERIALES Y MÉTODOS 5.1 Equipos Los siguientes termocicladores se emplearon para la amplificación por PCR: - Perkin Elmer, GeneAmp PCR System 2400. - Perkin Elmer, GeneAmp PCR System 9600. - Applied

Más detalles

C V C. Instrucciones de uso de Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02. Revisión 2. Julio de 2014

C V C. Instrucciones de uso de Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02. Revisión 2. Julio de 2014 DOT142v1 Instructions for Use Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Página 1 de 7 Instrucciones de uso de Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Revisión 2 Julio de

Más detalles

CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL

CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL LIBRO DE MEMORIAS 2 CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL Santiago de Cali, 23 al 28 de agosto de 2010 3 Libro de memorias

Más detalles

PowerPlex Fusion System INSTRUCCIONES PARA UTILIZAR LOS PRODUCTOS DC2402 Y DC2408.

PowerPlex Fusion System INSTRUCCIONES PARA UTILIZAR LOS PRODUCTOS DC2402 Y DC2408. Technical Manual PowerPlex Fusion System INSTRUCCIONES PARA UTILIZAR LOS PRODUCTOS DC2402 Y DC2408. IMPRESO EN ESTADOS UNIDOS PowerPlex Fusion System Toda la bibliografía técnica está disponible en Internet,

Más detalles

Normalización de soluciones de NaOH 0,1N y HCl 0,1N.

Normalización de soluciones de NaOH 0,1N y HCl 0,1N. Laboratorio N 1: Normalización de soluciones de NaOH 0,1N y HCl 0,1N. Objetivos: - Determinar la normalidad exacta de una solución de hidróxido de sodio aproximadamente 0,1 N, utilizando biftalato de potasio

Más detalles

APLICACIONES INFORMÁTICAS de BASE de DATOS

APLICACIONES INFORMÁTICAS de BASE de DATOS APLICACIONES INFORMÁTICAS de BASE de DATOS AUTOR: Juan Carlos Cambero Palmero EDITA: ACADEMIA BALANUS Reservados todos los derechos. Queda prohibido, sin el permiso del autor o editor, la reproducción

Más detalles

Kit PunchSolution INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC9271.

Kit PunchSolution INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC9271. Technical Manual Kit PunchSolution INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC9271. IMPRESO EN ESTADOS UNIDOS 5/12 Kit PunchSolution Toda la bibliografía técnica está disponible en Internet, en el sitio

Más detalles

PROTOCOLOS DE OBTENCIÓN, CONSERVACIÓN Y ENVÍO DE MUESTRAS BIOLÓGICAS

PROTOCOLOS DE OBTENCIÓN, CONSERVACIÓN Y ENVÍO DE MUESTRAS BIOLÓGICAS PROTOCOLOS DE OBTENCIÓN, CONSERVACIÓN Y ENVÍO DE MUESTRAS BIOLÓGICAS ESTUDIO TRASLACIONAL PROSPECTIVO DE DETERMINACIÓN DE FACTORES PREDICTIVOS DE EFICACIA Y TOXICIDAD EN PACIENTES CON CÁNCER ÍNDICE 1 INTRODUCCIÓN....

Más detalles

Avances Tecnológicos en PCR para la Detección Rápida de Patógenos en Alimentos y Medio Ambiente

Avances Tecnológicos en PCR para la Detección Rápida de Patógenos en Alimentos y Medio Ambiente Avances Tecnológicos en PCR para la Detección Rápida de Patógenos en Alimentos y Medio Ambiente M.Sc. Viviana Fino - DuPont N&H ACHIPIA 2015 8 de octubre de 2015 Santiago, Chile Necesidades de la Industria

Más detalles

FUNDAMENTOS DE ANÁLISIS INSTRUMENTAL. 4ª RELACIÓN DE PROBLEMAS.

FUNDAMENTOS DE ANÁLISIS INSTRUMENTAL. 4ª RELACIÓN DE PROBLEMAS. FUNDAMENTOS DE ANÁLISIS INSTRUMENTAL. 4ª RELACIÓN DE PROBLEMAS. 1.- Para determinar el contenido en plomo en una muestra de leche contaminada, se toma 1.0 ml de la leche y se diluye a un volumen final

Más detalles

B Fig. 2. Ley de Lambert

B Fig. 2. Ley de Lambert INTRODUCCION TEORICA FUNDAMENTOS DE ESPECTROFOTOMETRÍA Introducción : La espectrofotometría es uno de los métodos de análisis más usados, y se basa en la relación que existe entre la absorción de luz por

Más detalles

17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico

17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico 17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico Carmen Alicia Padilla Peña, Jesús Diez Dapena, Emilia Martínez Galisteo, José

Más detalles

CLART ENTHERPEX DETECCIÓN Y TIPADO DE HERPES Y ENTEROVIRUS HUMANOS MEDIANTE IDENTIFICACIÓN GENÓMICA PARA DIAGNÓSTICO IN VITRO - 1 -

CLART ENTHERPEX DETECCIÓN Y TIPADO DE HERPES Y ENTEROVIRUS HUMANOS MEDIANTE IDENTIFICACIÓN GENÓMICA PARA DIAGNÓSTICO IN VITRO - 1 - CLART ENTHERPEX DETECCIÓN Y TIPADO DE HERPES Y ENTEROVIRUS HUMANOS MEDIANTE IDENTIFICACIÓN GENÓMICA PARA DIAGNÓSTICO IN VITRO - 1 - CLART ENTHERPEX Extracción 24 determinaciones Ref: AT-0908-24 48 determinaciones

Más detalles

MANEJO DEL SOFTWARE ADMINISTRADOR DE ALMACEN. Este software fue creado en Visual Basic, utilizando una base de datos creada en Excel.

MANEJO DEL SOFTWARE ADMINISTRADOR DE ALMACEN. Este software fue creado en Visual Basic, utilizando una base de datos creada en Excel. MANEJO DEL SOFTWARE ADMINISTRADOR DE ALMACEN Este software fue creado en Visual Basic, utilizando una base de datos creada en Excel. Como primer paso, al abrir el archivo INVENTARIOS (ING).xls, hay que

Más detalles

CURSO DE PROGRAMACIÓN WEB CON PHP

CURSO DE PROGRAMACIÓN WEB CON PHP CURSO DE PROGRAMACIÓN WEB CON PHP INSTALACIÓN DE XAMPP, NETBEANS Y XDEBUG EN WINDOWS 1. Descarga de XAMPP Se puede descargar la versión más actual de la página: http://www.apachefriends.org/en/xampp-windows.html

Más detalles

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA BIOLOGIA MOLECULAR Hemos elaborado un programa en 3 niveles, en función del tipo de estudiante y las posibilidades del centro educativo: 1. NIVEL BASICO 2. NIVEL MEDIO DANAEXTRACTOR KIT Práctica que constituye

Más detalles

INTRODUCCIÓN A LA METODOLOGÍA MOLECULAR. 2002 `Derechos Reservados Pontificia Universidad Javeriana Instituto de Genética Humana Bogotá COLOMBIA

INTRODUCCIÓN A LA METODOLOGÍA MOLECULAR. 2002 `Derechos Reservados Pontificia Universidad Javeriana Instituto de Genética Humana Bogotá COLOMBIA INTRODUCCIÓN A LA METODOLOGÍA MOLECULAR 2002 `Derechos Reservados Pontificia Universidad Javeriana Instituto de Genética Humana Bogotá COLOMBIA Equipos de Laboratorio Un equipo de laboratorio es un conjunto

Más detalles

Manual de uso del kit therascreen EGFR Plasma RGQ PCR

Manual de uso del kit therascreen EGFR Plasma RGQ PCR Diciembre de 2014 Manual de uso del kit therascreen EGFR Plasma RGQ PCR Versión 1 24 Para uso en diagnóstico in vitro Para uso con equipos Rotor-Gene Q MDx 870311 QIAGEN Manchester Ltd, Skelton House,

Más detalles

PLIEGO DE PRESCRIPCIONES TÉCNICAS

PLIEGO DE PRESCRIPCIONES TÉCNICAS PLIEGO DE PRESCRIPCIONES TÉCNICAS Expediente : 2015/000023 Titulo Localidad : Suministro e instalación de Sistema robotizado de ampliación y cuantificación de ácitos nucleicos en tiempo real, financiado

Más detalles

CROMATOGRAFÍA DE FILTRACIÓN EN GEL

CROMATOGRAFÍA DE FILTRACIÓN EN GEL 1.- FUNDAMENTO TEÓRICO CROMATOGRAFÍA DE FILTRACIÓN EN GEL Filtración en gel - 1 (Farmacia) La cromatografía de exclusión o filtración en gel es una clase de cromatografía sólido-líquido que permite la

Más detalles

Prácticas de Análisis Instrumental

Prácticas de Análisis Instrumental Prácticas de Análisis Instrumental Asignatura: Análisis Instrumental Alumno: Daniel González Mancebo Practica 1. DETERMINACIÓN DE CONSTANTES DE EQUILIBRIO MEDIANTE ESPECTROFOTOMETRÍA UV- VISIBLE. Lo primero

Más detalles

Configuración de Correo Electrónico con Mail en Mac

Configuración de Correo Electrónico con Mail en Mac Configuración de Correo Electrónico con Mail en Mac Para configurar tu cuenta de correo de Infinitum Mail, cuentas con las siguientes opciones: 1. Configuración IMAP 2. Configuración POP3 1.- Configuración

Más detalles

PROCEDIMIENTO ALMACENAMIENTO DE UNIDADES DE SANGRE TOTAL PARA SU POSTERIOR TRANSPORTE AL CENTRO DE SANGRE DE VALPARAÍSO

PROCEDIMIENTO ALMACENAMIENTO DE UNIDADES DE SANGRE TOTAL PARA SU POSTERIOR TRANSPORTE AL CENTRO DE SANGRE DE VALPARAÍSO DE UNIDADES DE SANGRE TOTAL PARA SU POSTERIOR TRANSPORTE AL CENTRO DE SANGRE DE VALPARAÍSO Página: 1 1.- OBJETIVO Almacenar las unidades de sangre total extraídas, de acuerdo a los estándares de calidad,

Más detalles

Determinación del diagrama de fase líquido-vapor

Determinación del diagrama de fase líquido-vapor Determinación del diagrama de fase líquido-vapor para el sistema acetona cloroformo. Mezcla azeotrópica. Objetivo Determinar el diagrama temperatura vs composición (líquido y vapor) para un sistema de

Más detalles

Maxwell 16 Blood DNA Purification System

Maxwell 16 Blood DNA Purification System Manual técnico Maxwell 16 Blood DNA Purification System Precaución: Maneje los cartuchos con cuidado, los bordes del sistema de sellado podrían estar afilados. 2800 Woods Hollow Rd. Madison, WI USA Dispositivo

Más detalles

Manual de Usario de XEDIGenerator Instalación

Manual de Usario de XEDIGenerator Instalación Manual de Usario de XEDIGenerator Instalación Para iniciar con la instalación nada más necesitamos tener un servidor instalado. Al tener esto, lo único que debemos hacer es correr el programa de instalación

Más detalles

Acción Enzimática: Actividad de la Catalasa

Acción Enzimática: Actividad de la Catalasa Acción Enzimática: Actividad de la Catalasa Experimento 3 Muchos organismos pueden descomponer el peróxido de hidrógeno (H 2 O 2 ) por la acción de las enzimas. Las enzimas son proteínas globulares responsables

Más detalles

MANUAL DEL INSTALADOR

MANUAL DEL INSTALADOR MANUAL DEL INSTALADOR Índice Índice... 2 Instalación... 3 Extracción de archivos... 3 Actualización de los archivos de sistema... 3 Pantalla inicial... 4 Selección de la ruta de instalación... 4 Selección

Más detalles

fjweb@hotmail.es http://www.fjweb.es

fjweb@hotmail.es http://www.fjweb.es GASTOS CASA Archivo Excel (Control de Gastos Mensual y Anual) El archivo GASTOS 2015 - V2003.xls ó GASTOS 2015 - V2007.xlsm, está pensado para llevar los gastos, que tenemos cada mes, durante todo el Año.

Más detalles

MÓDULO 1: FrontPage 2003 Parte 1ª

MÓDULO 1: FrontPage 2003 Parte 1ª MÓDULO 1: FrontPage 2003 Parte 1ª TEMA 1. Introducción a la Web Internet y el World Wide Web Hipertexto HTML Servidores, Clientes y Redes Protocolos de Comunicación Direcciones, Dominios y Accesos TEMA

Más detalles

Procedimiento de calibración para sensores del Sistema Portátil de Monitoreo de Emisiones (PEMS)

Procedimiento de calibración para sensores del Sistema Portátil de Monitoreo de Emisiones (PEMS) Procedimiento de calibración para sensores del Sistema Portátil de Monitoreo de Emisiones (PEMS) Laboratorio de Innovación y Evaluación en Estufas de Biomasa Laboratorio de Innovación y Evaluación en Estufas

Más detalles