Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Save this PDF as:

Tamaño: px
Comenzar la demostración a partir de la página:

Download "Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa."


1 Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba ª Jornada de Actualización en Especialidades Bioquímicas 2ª Jornada: El Rol del Bioquímico y la Formación de los Futuros Profesionales

2 Tendencia en la utilización de la Biología Molecular como herramienta para el diagnóstico. Desarrollo de metodos más rápidos y efectivos, altamente especificos. Los metodos convencionales son laboriosos y llevan demasiado tiempo. El éxito de la implementación de la PCR para la identificación de microorganismos patógenos es la elección correcta de secuencias blanco.

3 Fundamento del PCR La PCR es una metodología que consiste en la amplificación enzimática en ciclos repetidos de un fragmento específico de ADN o ARN utiliza la enzima ADN polimerasa, a partir de pequeñas cantidades de moléculas de ADN o ARN. Dos oligonucleótidos son utilizados como cebadores Primers. Estos son cadenas de nucleótidos que se unen a secuencias complementarias en el extremo 5 de cada hebra de ADN a amplificar.


5 Pasos a realizar en una PCR Obtener el ADN templado Preparación de la mezcla de la reacción. Agregar el templado a la mezcla de reacción. Ciclado. Electroforesis en gel de agarosa. Visualización / registro de resultados.

6 Obtención de Templados Estandarizar el método de extracción de acuerdo a la matriz. Para el aislamiento bacteriano, solo es necesario el proceso de hervido. En cambio para el aislamiento en muestras mas complejas que pueden llegar a contener inhibidores o poca carga bacteriana, es necesario un enriquecimiento bacteriano previo y en algunos casos la necesidad de eliminar los inhibidores. Para la realización de una simple PCR no es necesario un ADN tan limpio y purificado, pero para realizar una secuenciación si es necesario que este ADN este limpio y purificado.

7 Preparación de la mezcla de reacción Buffer Tris-HCl 20mM y 50nM KCl ph es necesario para la adecuada actividad enzimática. Cloruro de Magnesio: cofactor indispensable (Taq polimerasa) y afecta el annealing de los primers. Los rangos de concentración utilizados son de (1 a 3) mm. Altas concentraciones disminuyen la especificidad de la reacción. Bajas concentraciones disminuyen la eficiencia de la reacción.

8 Deoxirribonucleotidos: ATP, CTP, GTP Y TTP, (dntps). Agregados en iguales proporciones para minimizar falsas incorporaciones en la polimerización. Se ajusta la concentración para optimizar la especificidad y fidelidad de la reacción. Generalmente 100 um en el ensayo. Primers o cebadores: Preferentemente entre 15 y 30 pb de longitud. No deben ser complementarios entre si. Deben tener similar contenido de (G + C) y en baja conc. en el extremo 3. No deben contener estructuras secundarias. El rango de concentración en el ensayo varía desde (0.3 a 1) um. Altas concentraciones disminuyen la especificidad de la reacción. Bajas concentraciones disminuyen la eficiencia de amplificación.

9 Enzima ADN polimerasa: Enzima Taq polimerasa. Tienen actividad de polimerasa y exonucleasa 5-3. Debe agregarse al final de la preparación de la máster mix. El rango habitual en cada ensayo es de ( ) U. baja concentración disminuye el rendimiento de la reacción altas concentraciones generan productos inespecíficos. La concentración en la que se utilizan cada uno de los reactivos va a afectar la sensibilidad y especificidad de la reacción. Todos los reactivos deben ser conservados a -20 C.

10 ADN blanco, La secuencia a amplificar debe contener desde menor a 0.1 a unas pocas kilobases. La cantidad total de ADN usado normalmente es de 0.05 a 1.0 ug. No es necesario que la muestra conteniendo la secuencia a amplificar esté altamente purificada. Controles Blanco de Templado: Reactivos solos, sin templado. Control positivo: templado de una cepa patrón que se sabe + (positiva). Control negativo: - templado de una cepa patrón que se sabe (negativa)

11 Pasos del termociclado El ciclado, consiste en una serie de pasos descriptos a continuación: Desnaturalización inicial: (94-96) C, (2-5) min Desnaturalización (94-96) C, 30 seg 1 min Annealing: (variable) C, 30 seg 1 min Extensión: 72 C, 30 seg 1 min. (Temperatura óptima de la polimerasa) Extensión final: 72 C, 10 min. Generalmente pueden ir de 25 a 35 ciclos



14 Temperatura Melting 94 o C PCR Annealing Primers 50 o C Extension 72 o C Melting 94 o C 30ciclos 3 0 Tiempo 3

15 PCR Temperatura Melting 94 o C Annealing Primers 50 o C Extension 72 o C Melting 94 o C 30ciclos 3 0 Tiempo 3 Fragmentos de tamaño definido

16 PCR Temperatura Melting 94 o C Annealing Primers 50 o C Extension 72 o C Melting 94 o C 30ciclos 3 0 Tiempo 3 Calor Calor

17 Producción de productos inespecíficos Altas concentraciones de nucleótidos. Bajas temperaturas de annealing. Bajas temperaturas de extensión.

18 Electroforesis en gel de agarosa Se utilizan soluciones de agarosa a variadas concentraciones % P/V utilizando como solvente Buffer Tris Acético EDTA (TAE) 1X o Tris Borato EDTA (TBE) 0.5X. La concentración de la solución de agarosa a preparar va a depender del tamaño de los fragmentos a separar en la electroforesis Agarosa % (P/V) Rango de separación de fragmentos de ADN (kb)


20 Condiciones de corrida electroforética Dependiendo del número y tamaño de los fragmentos a separar, se ajusta el voltaje y tiempo aplicado a la cuba electroforética en donde se realizará la corrida. Generalmente en varias aplicaciones se utiliza un fuente con voltaje de 100V durante un tiempo aproximado de 30 minutos.

21 Visualización del gel de agarosa Posterior a la corrida electroforética el gel puede teñirse, sumergiéndolo en una solución de Bromuro de Etidio por el transcurso de un tiempo. Luego este es observado bajo una lámpara ultravioleta, en donde se notaran las diferentes bandas separadas mediante la corrida electroforética. Para un posterior análisis y una documentación del ensayo realizado puede tomarse una fotografía del gel.


23 PCR simple Tipos de PCR Sensibilidad analítica alta (100 a 1000 copias de genoma, detectable). PCR Anidado - Nested PCR Consta de dos ciclos de amplificación (2 PCR) con cuatro cebadores, denominados cebadores externos e internos La primera amplificación da 2 fragmentos resultantes. La segunda reacción trabaja sobre los fragmentos obtenidos en la 1ra reacción. Sensibilidad analítica: menor a 10 copias de genoma. Muy sensible. Este modo es mas especifico, ya que cuando la Taq trabaja con grandes cantidades de DNA, su fidelidad disminuye. En cambio con este método, se trabaja con fragmentos cortos desde la segunda reacción, lo que hace mas efectivo el proceso. La especificidad también aumenta porque cuatro oligonucleótidos tienen que unirse específicamente


25 PCR Multiple ( Chamberlain 1988) Se lleva a cabo la reacción de PCR tradicional, pero con mas de un par de primers, para amplificar varias regiones al mismo tiempo.

26 PCR Invertido o PCR con transcriptasa inversa (RT-PCR) Es una variante de la PCR en la que usamos ARN como molde inicial en vez de ADN, y emplea una transcriptasa inversa para realizar la síntesis de un ADN complementario al ARN (ADNc). De esta forma, el desarrollo inicial de una RT-PCR sería: 1er paso: retrotranscripción a partir del ARN. 2º paso: amplificación a partir de la primera hebra de ADNc. 3er paso: PCR estándar.

27 Real Time PCR (r t PCR) Los productos de amplificación se detectan de forma directa durante los ciclos de amplificación, utilizando sondas marcadas con fluorescencia, TaqMan o Molecular Beacon. La fluorescencia se mide a través de la tapa o del lado del recipiente de reacción

28 Se puede dividir en las técnicas basadas: 1- En fluorocromos no específicos. 2- En sondas específicas. 1- Utiliza el SYBR Green, que es un fluoróforo que se intercala en el DNA de doble hebra. Por ende, mientras mas DNA amplificado exista en el medio, mas SYBR green se intercalara y la luminiscencia aumentara proporcionalmente a los fragmentos amplificados. -Ventaja : Utilizar cebadores normales. Más económica que la que usa sondas específicas. - Desventaja: Permite cuantificar sólo una secuencia por reacción.



31 2- Utilizan una sonda unida a dos fluorocromos que hibrida en la zona intermedia entre el iniciador directo (forward) y el inverso (reverse). Esto permite monitorizar el cambio de patrón de fluorescencia y deducir el nivel de amplificación del gen. - Ventaja: Muy Precisos y evita posibles secuencias inespecíficas. Permite cuantificar el ADN amplificado. - Desventaja: Mas laborioso y costoso (diseño de secuencias específicas como sondas).

32 Hairpin Probes (Molecular Beacons) Sondas con secuencias repetidas invertidas en sus extremos Permitiendo forme una estructura de horquilla. Ventaja: Mas específica que las sondas TaqMan. Puede combinar varias Molecular Beacons en una única reacción. (Multiplex PCR). Desventaja: Diseño riguroso de las regiones tallo y asa de la horquilla.

33 Sondas Hidrolizadas (TaqMan) reportero quencher Actividad exonucleasa


35 Hybridization Probes :

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa?

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa? 2º BIOQUÍMICA CUESTIONES 1. Por qué la PCR convencional no es cuantitativa? En la PCR convencional, la cuantificación del ADN de la muestra es complicada debido a que la eficacia de amplificación va disminuyendo

Más detalles



Más detalles


ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles

Reacción en cadena de la polymerasa (PCR)

Reacción en cadena de la polymerasa (PCR) Reacción en cadena de la polymerasa (PCR) 1 PCR Que es? Es una técnica in vitro diseñada para amplificar una región específica de DNA. Es extremadamente sensible, con la capacidad de amplificar millones

Más detalles

PCR. Técnica inventada por Kary Mullis :1987. Premio Nobel 1993. Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN

PCR. Técnica inventada por Kary Mullis :1987. Premio Nobel 1993. Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN PCR PCR Técnica inventada por Kary Mullis :1987 Premio Nobel 1993 Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN Aprovecha los requerimientos de la replicación Templete ADN Nucleótidos

Más detalles

Técnicas moleculares.

Técnicas moleculares. Técnicas moleculares. DMTV Carolina Acevedo Curso de Microbiología 2015 SÍNTESIS IN VITRO DE UNA GRAN CANTIDAD DE COPIAS DE UN SEGMENTO DE ADN EXISTENTE EN UNA MUESTRA. O sea. Amplificamos en forma exponencial

Más detalles

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática.

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Departamento de Bioquímica Médica y Biología Molecular Práctica 3 Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Curso 1 Medicina (Abril) 2012 BIOQUÍMICA

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica TÉCNICAS GENÓMICAS Utilidad/Objetivos: 1) Detección de microorganismos directamente en muestras clínicas identificando un fragmento específico del genoma del microorganismo concreto 2) Cuantificación del

Más detalles

Experiencias en Q-PCR para la aplicación y diagnóstico en Medicina Humana

Experiencias en Q-PCR para la aplicación y diagnóstico en Medicina Humana Experiencias en Q-PCR para la aplicación y diagnóstico en Medicina Humana MSc. Gonzalo Manrique Laboratorio de Biología Molecular Asociación Española Junio de 2009 INDICE INTRODUCCION (conceptos básicos,

Más detalles

P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA"

P.C.R. Técnica de amplificación enzimática de secuencias específicas de DNA P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA" Paso 1: Desnaturalización del DNA Paso 2: Hibridación de los "Primers" Paso 3: Extensión Paso 1: Desnaturalización del DNA

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60.

Más detalles



Más detalles

Reacción en cadena de la Polimerasa (PCR)

Reacción en cadena de la Polimerasa (PCR) Explicación de TP Nº 2 Reacción en cadena de la Polimerasa (PCR) Química Biológica Patológica Dra. Mariana L. Ferramola Dra. Gabriela Lacoste 2015 Definición de PCR Es la amplificación enzimática de un

Más detalles


APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS Prácticas docentes en la COD: 10-71 APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS FUNDAMENTO TEÓRICO La PCR es una técnica que permite llevar a cabo la síntesis in vitro de fragmentos de ADN. Está basada

Más detalles

3/22/2010. Iván Ferrer Rodríguez, PhD Catedrático. En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR.

3/22/2010. Iván Ferrer Rodríguez, PhD Catedrático. En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR. Iván Ferrer Rodríguez, PhD Catedrático En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR. Síntesis "in vitro" de secuencias específicas de ADN son amplificadas.

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

Materiales para la secuenciación de ADN

Materiales para la secuenciación de ADN Introduccion La Secuenciación Sanger es un método de secuenciación de ADN en el que el ADN diana se desnaturaliza y se hibrida con un cebador de oligonucleótidos, que se extiende entonces gracias a la

Más detalles

Práctico: Genética bacteriana 2007.

Práctico: Genética bacteriana 2007. Práctico: Genética bacteriana 2007. Actividad integrada Departamento de Genética Departamento de Bacteriología y Virología. OBJETIVOS Objetivos generales El estudiante al terminar la actividad práctica

Más detalles

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico.

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. AQUAGESTION ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. Noviembre 2011 ACTUALIDAD Este año Sernapesca confirma

Más detalles

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now.

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now. Unidad Curricular: Virología y Micología Veterinaria 1 TRABAJO PRÁCTICO No. 3 AMPLIFICACIÓN DE GENES VIRALES Reacción en Cadena de la Polimerasa, conocida como PCR (por sus siglas en inglés: Polimerase

Más detalles


CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 DEFINICIÓN PCR: Constituye la técnica más importante para amplificar ácidos nucleicos in vitro. Ambas hebras del DNA de interés son replicadas

Más detalles



Más detalles

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri OBJETIVO Desarrollar un banco de datos a partir de plantas de origen indudable y del uso

Más detalles

Guía de PCR en tiempo real

Guía de PCR en tiempo real Guía de PCR en tiempo real Michelle C. Chirinos-Arias Índice Introducción. 2 Algunos conceptos. 2 PCR (reacción en cadena de la polimerasa)... 2 PCR en tiempo real (qpcr)..

Más detalles

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras METODOLOGIA DEL PCR Lic. Jorge Mato Luis Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras Desnaturalización del DNA 5 A G G T T A G T G G A C C C T T G A T 3 3 T C C A

Más detalles

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas ELEMENTOS BÁSICOS DE LA INVESTIGACIÓN EN GENES Análisis

Más detalles


DETERMINACIÓN DEL FACTOR Rh por PCR Ref.PCRRh DETERMINACIÓN DEL FACTOR Rh por PCR 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón

Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón Reacción en Cadena de la INTRODUCCION: Polimerasa (RCP) Década de los 70: Grandes

Más detalles


DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino DIAGNOSTICO VIROLOGICO MOLECULAR Dr. Gerardo Andino DIAGNÓSTICO MOLECULAR La tecnología empleada para la detección de genomas virales mediante la amplificación de secuencias específicas (PCR y reacciones

Más detalles

versus PCR en Tiempo Real PCR convencional no es cuantitativo

versus PCR en Tiempo Real PCR convencional no es cuantitativo PCR convencional o PCR de punto final versus PCR en Tiempo Real PCR convencional no es cuantitativo S Lobos C - U de Chile 1 PCR clásico La cantidad de producto no está relacionada con la cantidad de DNA

Más detalles

Protocolos de secuenciación de ADN

Protocolos de secuenciación de ADN 1 Protocolos de secuenciación de ADN Introducción El método de secuenciación utilizado aquí es el desarrollado por Sanger en 1975. Este consiste en la incorporación de didesixinucleótidos marcados fluorescentemente

Más detalles


PRÁCTICAS DE MICROBIOLOGIA CLINICA PRÁCTICAS DE MICROBIOLOGIA CLINICA Juan Carlos Rodríguez Hospital General Universitario de Alicante E-mail: CASO CLINICO: Rubéola Evolución

Más detalles

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN.

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. PROGRAMA CONTROL DE CALIDAD DE MUESTRAS El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. El programa completo de control de calidad de muestras de ADN y ARN engloba diferentes

Más detalles

Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional

Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional BIOQ. LILIANA DI TULLIO BUDASSI FAC. CS.BIOQUÍMICAS Y FARMACÉUTICAS UNIVERSIDAD NACIONAL DE ROSARIO

Más detalles

Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares. Técnicas Moleculares. Técnicas Moleculares 8/13/13

Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares. Técnicas Moleculares. Técnicas Moleculares 8/13/13 8/13/13 Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares CAF516 O Recursos Genéticos y Biotecnología 14 Agosto 2013 Técnicas Moleculares Aplicaciones en muchas disciplinas Generan

Más detalles

Reacción en cadena de la polimerasa (PCR)

Reacción en cadena de la polimerasa (PCR) Dr. Alejandro Leal Reacción en cadena de la polimerasa (PCR) La reacción en cadena de la polimerasa (PCR, por sus siglas en inglés de "polymerase chain reaction") es un método de amplificación in vitro

Más detalles

N 1 Reacción n en Cadena de la Polimerasa

N 1 Reacción n en Cadena de la Polimerasa Trabajo Práctico N 1 Reacción n en Cadena de la Polimerasa Definición n e importancia. Usos y aplicaciones. Optimización. Tipos de PCR. Electroforesis. Fundamentos. Asociado al Programa Teórico: Tema 2.

Más detalles

Tipos de Muestras. Técnicas de Biología Molecular. Extracción de ácidos nucleicos. Extracción de DNA genómico. Muestra de sangre en papel filtro

Tipos de Muestras. Técnicas de Biología Molecular. Extracción de ácidos nucleicos. Extracción de DNA genómico. Muestra de sangre en papel filtro Técnicas de Biología Molecular Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO 2004 Tipos de Muestras Extracción de ácidos nucleicos o DNA o RNA Sangre total (EDTA) Saliva Líquido Amniótico Bulbo

Más detalles


5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN 5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN Materiales - Eppendorf de 1,5 ml estériles - Eppendorf de pared fina para PCR - Puntas de pipeta estériles desechables - Guantes

Más detalles

Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez

Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez 1 Objetivos Entender la técnica: Reacción de Polimerasa en Cadena (PCR por sus siglas en inglés)

Más detalles

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR Módulo 1 Amplificación de un fragmento de ADN genómico por PCR En este primer módulo se amplificará por PCR, mediante el uso de oligonucleótidos específicos, un fragmento de ADN genómico de Aspergillus

Más detalles

CAPÍTULO VI. Expresión de genes relacionados con apoptosis

CAPÍTULO VI. Expresión de genes relacionados con apoptosis CAPÍTULO VI Expresión de genes relacionados con apoptosis 1.- Introducción 2.- Protocolos para análisis genéticos 3.- Resultados en MCF-7 4.- Discusión 1.- Introducción Como se ha descrito anteriormente,

Más detalles

Técnica de PCR. Beatriz Bellosillo. Servei de Patologia, Hospital del Mar, Barcelona, Spain

Técnica de PCR. Beatriz Bellosillo. Servei de Patologia, Hospital del Mar, Barcelona, Spain Técnica de PCR Beatriz Bellosillo Servei de Patologia, Hospital del Mar, Barcelona, Spain Biología Molecular Estudio de los procesos que se desarrollan en los seres vivos desde un punto de vista molecular

Más detalles


FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

- Clonar un gen (molde ADN o ARN)

- Clonar un gen (molde ADN o ARN) APLICACIONES PCR Aplicaciones de la PCR - Clonar un gen (molde ADN o ARN) - Secuencia conocida - Genes homólogos en especies próximas (primers degenerados) - Información de secuencia proteica (primers

Más detalles

PCR A TIEMPO REAL. María Maiques R4-Bioquímica Clínica 25-Abril-07

PCR A TIEMPO REAL. María Maiques R4-Bioquímica Clínica 25-Abril-07 PCR A TIEMPO REAL María Maiques R4-Bioquímica Clínica 25-Abril-07 VEAMOS Herramientas para detectar mutaciones Moléculas fluorescentes y tecnología FRET PCR a tiempo real: equipos y métodos de detección

Más detalles

velocidades de movimiento mediante la aplicación de un campo eléctrico a través de una matriz porosa

velocidades de movimiento mediante la aplicación de un campo eléctrico a través de una matriz porosa INTRODUCCIÓN En general, la electroforesis es una técnica que separa las moléculas en base a sus diferentes velocidades de movimiento mediante la aplicación de un campo eléctrico a través de una matriz

Más detalles

PCR? PCR en el diagnóstico? Objetivo: Obtener un gran número de copias de un fragmento particular de ADN a partir de una cantidad mínima original.

PCR? PCR en el diagnóstico? Objetivo: Obtener un gran número de copias de un fragmento particular de ADN a partir de una cantidad mínima original. PCR? Objetivo: Obtener un gran número de copias de un fragmento particular de ADN a partir de una cantidad mínima original. PCR en el diagnóstico? A partir de una mezcla compleja de ADN, se puede realizar

Más detalles

Técnicas de Biología Molecular

Técnicas de Biología Molecular Técnicas de Biología Molecular DNA I. Enzimas de restricción Análisis Las enzimas de restricción fueron aisladas de bacterias; su función natural es proteger contra DNA extraño II. Separación electroforética

Más detalles

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental.

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Gemma Saucedo. Laboratorio Aguas de Barcelona 22-23 de noviembre de 2006 Introducción PCR: Polymerase Chain Reaction

Más detalles

Practica la genética Ficha didáctica del profesorado Bachillerato

Practica la genética Ficha didáctica del profesorado Bachillerato Ficha didáctica del profesorado Bachillerato Extracción de ADN Cuál es la función de cada uno de los ingredientes utilizados para realizar la disolución tampón para la visualización

Más detalles

Clonación molecular. Clonar significa hacer copias idénticas

Clonación molecular. Clonar significa hacer copias idénticas INGENIERÍA GENÉTICA Clonación molecular Clonar significa hacer copias idénticas Este término originalmente fue aplicado al procedimiento de aislar una célula y permitirle reproducirse creando una población

Más detalles

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada La PCR La Reacción en Cadena de la Polimerasa es la herramienta más utilizada PCR- Ventajas y Usos Amplificación ilimitada de secuencias de interés. Rápida, Sencilla y Eficaz. Técnica altamente sensible

Más detalles

PCR a tiempo real. Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia

PCR a tiempo real. Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia PCR a tiempo real Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia PCR a tiempo real (PCRrt) Aplicaciones: - Cuantificación de ácidos nucleicos (AQ). - Estudio

Más detalles


DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082 Página 1 de 5 1. OBJETIVO Detectar la presencia de Campylobacter jejuni en hamburguesa de pollo mediante técnica de PCR. 2. CAMPO DE APLICACIÓN Y ALCANCE Aplicar este procedimiento a muestras de hamburguesa

Más detalles

TaqMan GMO Maize Quantification Kit. Part No: 4481972

TaqMan GMO Maize Quantification Kit. Part No: 4481972 TaqMan GMO Maize Quantification Kit Part No: 4481972 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan

Más detalles



Más detalles



Más detalles


REACCIÓN EN CADENA DE LA POLIMERASA (PCR) REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Microbiología General Microbiología M de los Alimentos Licenciatura en Bioquímica i Ingeniería en alimentos c Microbiología r 2015 Licenciatura en Biotecnología

Más detalles


TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO TEST de PATERNIDAD Este experimento introduce a los alumnos en el uso del ADN y la PCR para simular una determinación de paternidad. Los estudiantes

Más detalles



Más detalles



Más detalles

Biotina: se usa uno de los dntps biotinilado. Detección: Streptavidina conjugada con enzima (ALP) o anti-biotina. Usos: NB, SB, hibridación in situ

Biotina: se usa uno de los dntps biotinilado. Detección: Streptavidina conjugada con enzima (ALP) o anti-biotina. Usos: NB, SB, hibridación in situ Northern blot Marcación no radioactiva: Digoxigenina: se usa uno de los dntps marcado con digoxigenina Detección: Anticuerpo conjugado con enzima (ALP) o fluorocromo Biotina: se usa uno de los dntps

Más detalles

Técnicas de Biología Molecular. Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO

Técnicas de Biología Molecular. Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO Técnicas de Biología Molecular Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO 2004 Extracción de ácidos nucleicos o o DNA RNA Tipos de Muestras Sangre total (EDTA) Saliva Líquido Amniótico Bulbo

Más detalles

Investigación en genes. Tecnología del ADN recombinante

Investigación en genes. Tecnología del ADN recombinante Investigación en genes Tecnología del ADN recombinante Tecnología del ADN recombinante 1º parte: Conocimientos básicos que posibilitaron su desarrollo 2º parte: Instrumentos básicos 3º parte Ejemplos Conocimientos

Más detalles

La expresión fenotípica de las

La expresión fenotípica de las Panorama Métodos Rápidos y Automatizados Aplicados al Análisis Microbiológico de los Alimentos Rosario Martín de Santos* Se describen los métodos rápidos susceptibles de atomatización y que emplean las

Más detalles



Más detalles

CAPÍTULO III. Metodología e instrumentación de análisis celular

CAPÍTULO III. Metodología e instrumentación de análisis celular CAPÍTULO III Metodología e instrumentación de análisis celular 1.- Hemocitómetro y test de exclusión de colorante Trypan blue 2.- Citometría de flujo 3.- PCR 4.- Electroforesis en gel 5.- Secuenciación

Más detalles


LA REACCION EN CADENA DE LA POLIMERASA LA REACCION EN CADENA DE LA POLIMERASA ADN super enrollado Secuencia Blanco Hebra de ADN ADN doble cadena Cromosoma Dra. Cristina Gutiérrez García Lab.. Virología a Molecular INHRR ESTRUCTURA DEL ADN.

Más detalles

Extracción y purificación de los ácidos nucleicos

Extracción y purificación de los ácidos nucleicos Extracción y purificación de los ácidos nucleicos Todos los tipos de macromoléculas biológicas tienen una característica en común que va a permitir el desarrollo de un método de separación especifico para

Más detalles


III. METODOLOGÍA EXPERIMENTAL III. METODOLOGÍA EXPERIMENTAL 3.1 Análisis Previos Se utilizaron los filtros con muestra de partículas suspendidas en el aire PM 10 que el Instituto Municipal de Ecología (IME) proporcionó para llevar

Más detalles

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante BIOTECNOLOGÍA 1.- Ingeniería Genética, ADN recombinante Técnica del ADN recombinante: es la más usada en ingeniería genética, esta basada en el uso de las enzimas de restricción o endonucleasas de restricción

Más detalles

imegen Alfa-1-AT Manual de Usuario Referencia: IMG-211

imegen Alfa-1-AT Manual de Usuario Referencia: IMG-211 Manual de Usuario imegen Alfa-1-AT Genotipado de las mutaciones Glu342Lys (PI-Z) y Glu264Val (PI-S) del gen SERPINA1 mediante PCR a tiempo real Referencia: Fabricado en España Garantías y responsabilidades

Más detalles

Técnicas descritas en el curso 7.28

Técnicas descritas en el curso 7.28 Técnicas descritas en el curso 7.28 Técnica: Clase 1 Experimento de incorporación de dntps Ensayo de extensión del cebador Ensayo de unión en filtro Electroforesis en gel Análisis de ADN Helicasa Polaridad

Más detalles


ELECTROFORESIS EN GELES DE AGAROSA. Agustín Garrido. 1 ELECTROFORESIS EN GELES DE AGAROSA Agustín Garrido Introducción En este trabajo práctico se utilizó la técnica de electroforesis. Este proceso se basa en la migración de las moléculas

Más detalles



Más detalles



Más detalles


5. MATERIALES Y MÉTODOS 5. MATERIALES Y MÉTODOS 5.1 Equipos Los siguientes termocicladores se emplearon para la amplificación por PCR: - Perkin Elmer, GeneAmp PCR System 2400. - Perkin Elmer, GeneAmp PCR System 9600. - Applied

Más detalles


FACULTAD REGIONAL ROSARIO FACULTAD REGIONAL ROSARIO CATEDRA BIOTECNOLOGIA ROFESOR: Ing. Eduardo Santambrosio JTP: Ing. Marta Ortega AUX 1ª : Ing. Pablo Garibaldi PCR (Polymerase chain reaction) Reacción en cadena de la polimerasa

Más detalles


CURSO DE PRIMAVERA PATOLOGÍA MOLECULAR DEL CÁNCER CURSO DE PRIMAVERA PATOLOGÍA MOLECULAR DEL CÁNCER Conceptos básicos sobre ADN y ARN Técnicas de amplificación (PCR y variantes) Aplicaciones principales Dr. Juan C. Cigudosa Madrid 29 y 30 de mayo, 2014

Más detalles


SISTEMAS DE DETECCIÓN DE PATÓGENOS POR PCR A TIEMPO REAL. Guía de interpretación de resultados SISTEMAS DE DETECCIÓN DE PATÓGENOS POR PCR A TIEMPO REAL Guía de interpretación de resultados Sistemas de detección de patógenos por PCR a tiempo real Microbial ofrece sistemas para la detección de patógenos

Más detalles


MATERIALES Y MÉTODOS. Cepas Utilizadas MATERIALES Y MÉTODOS Cepas Utilizadas Para el presente trabajo se utilizaron tres cepas Tipo: Mycobacterium aviumintracellulare (proporcionada al Laboratorio Estatal de Salud Pública por el Instituto Nacional

Más detalles

ELECTROFORESIS. Agarosa. Poliacrilamida

ELECTROFORESIS. Agarosa. Poliacrilamida ELECTROFORESIS DE ADN ELECTROFORESIS Agarosa Poliacrilamida Finalidad de la electroforesis Separar Identificar Purificar 1 2 3 4 5 Tinción del ADN Bromuro de etidio Absorbancia a 302 y 366 y emisión a

Más detalles

PCR: Reacción en cadena de la polimerasa Gonzalo Greif. Unidad de Biología Molecular. Institut Pasteur Montevideo

PCR: Reacción en cadena de la polimerasa Gonzalo Greif. Unidad de Biología Molecular. Institut Pasteur Montevideo Índice: PCR: Reacción en cadena de la polimerasa Gonzalo Greif. Unidad de Biología Molecular. Institut Pasteur Montevideo Historia La Reacción en cadena de la polimerasa (PCR) Algunos tips experimentales

Más detalles


3.- TECNOLOGIA EN EL DIAGNOSTICO MOLECULAR 3.- TECNOLOGIA EN EL DIAGNOSTICO MOLECULAR 3.1.- INTRODUCCIÓN Pocas áreas de la Biología Molecular han permanecido inalteradas con la aparición de una serie de técnicas englobadas dentro del término genérico

Más detalles

Tema 11. Herramientas de la genética molecular

Tema 11. Herramientas de la genética molecular Tema 11. Herramientas de la genética molecular Genética CC. Mar 2004-05 Objetivos Técnicas de clonación Construcción de genotecas e identificación de secuencias Mapas de restricción Amplificación (PCR)

Más detalles



Más detalles



Más detalles

PCR. Qué es la PCR? T a de fusión de oligonucleótidos (t m )

PCR. Qué es la PCR? T a de fusión de oligonucleótidos (t m ) % a de fusión de oligonucleótidos (t m ) Qué es la PCR? La reacción en cadena de la polimerasa (PCR: polymerase chain reaction) es una técnica de amplificación de secuencias de DNA in vitro t m = 2 (A

Más detalles

El laboratorio de Microbiología y Parasitología en el diagnóstico de las enfermedades tropicales importadas

El laboratorio de Microbiología y Parasitología en el diagnóstico de las enfermedades tropicales importadas El laboratorio de Microbiología y Parasitología en el diagnóstico de las enfermedades tropicales importadas Juan Carlos Rodríguez S. Microbiología Hospital General Universitario de Alicante Universidad

Más detalles

REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Microbiología de los Alimentos Ingeniería en alimentos

REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Microbiología de los Alimentos Ingeniería en alimentos REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Microbiología de los Alimentos Ingeniería en alimentos 2015 Desarrollada por Kary Mullis en 1986 Técnica in vitro que permite amplificar enzimáticamente una región

Más detalles

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml)

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml) PCR SIMULADA Ref.PCR Simulada (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles



Más detalles

ADN y RNA caracterización y métodos de estudio

ADN y RNA caracterización y métodos de estudio ADN y RNA caracterización y métodos de estudio Separación por centrifugación de equilibrio en gradiente de densidad de en CsCl Separación por centrifugación de equilibrio en gradiente de densidad de en

Más detalles



Más detalles


PLIEGO DE PRESCRIPCIONES TÉCNICAS PLIEGO DE PRESCRIPCIONES TÉCNICAS Expediente : 2015/000023 Titulo Localidad : Suministro e instalación de Sistema robotizado de ampliación y cuantificación de ácitos nucleicos en tiempo real, financiado

Más detalles

PCR Punto de No Retorno de la Biología Molecular

PCR Punto de No Retorno de la Biología Molecular TÉCNICAS DE ANÁLISIS EN BIOLOGÍA MOLECULAR CURSO DE BIOTECNOLOGÍA ELEMENTAL Biotechnology Explorer Julio 2012 PCR Punto de No Retorno de la Biología Molecular Qué es un gen Técnicas de aislamiento y estudio

Más detalles