CIENCIA Y VIDA COTIDIANA

Tamaño: px
Comenzar la demostración a partir de la página:

Download "CIENCIA Y VIDA COTIDIANA"

Transcripción

1 CIENCIA Y VIDA COTIDIANA Genética para andar por casa... y 3 Murcia, 17 de diciembre de Genética. Gen. ADN. Información genética. Cromosomas. Genética forense. Ingeniería genética. Clonación/Transgénicos. Células madre. Selección embriones

2 Células madre - Qué son - Para qué sirven Las células madre, o células troncales, son un tipo especial de células indiferenciadas que tienen la capacidad de dividirse indefinidamente, sin perder sus propiedades, y de llegar a producir células especializadas.

3 Mujer óvulo Una célula cigoto embrión Cientos de miles de millones de células : más de 200 tipos distintos de células esperma Hombre Desarrollo embrionario Fases tempranas del desarrollo embrionario humano

4 Fases tempranas del desarrollo embrionario humano Día células totipotentes (indiferenciadas) Células totipotentes

5 Totipotentes (indiferenciadas) Pluripotentes Células madre Multipotentes Unipotentes (diferenciadas) Embrión temprano Embrión en estado de Blastocisto Tipos de células madre Feto Células Madre pluripotentes Adulto Clonación terapéutica Células Núcleo somáticas Ovocito anucleado Células Totipotentes Embrión en estado de Blastocisto

6 Células madre embrionarias Células madre adultas Terapia Celular o Medicina Regenerativa Terapia celular Medicina regenerativa Reparar o restaurar tejidos y órganos dañados como consecuencia de lesiones traumáticas o enfermedades degerativas. Para ello utiliza mecanismos similares a los que, de forma natural, usa el organismo para la renovación de las poblaciones celulares que van envejeciendo y que deben ser sustituidas por otras que suplen su función

7 Células madre El País, 24 noviembre 2011

8 Blastocisto Médula espinal dañada

9 Terapia contra la degeneración macular

10 Aspectos éticos de la utilización de embriones para la obtención de células madre Células madre sin embriones Aplicaciones de las células ips (células madre pluripotentes inducidas) reprogramación Células somáticas del paciente Células nerviosas Células cardíacas Hepatocitos Células beta Medicina regenerativa (uso in vivo) Estudios toxicológicos (uso in vitro)

11 Clonación reproductiva Clonación terapéutica

12 Diagnóstico genético preimplantacional (DGP) Selección de embriones Diagnóstico genético preimplantacional (DGP) La técnica consiste en extraer una o dos células de un embrión de más de seis células, para analizar su material genético

13 Fecundación in vitro DGP emedicine.medscape.com/article/ overview

14 Se extrae una célula de varios embriones, para analizar afectado (o no compatible) no afectado (o compatible) no afectado afectado afectado afectado Se utilizan sólo los embriones no afectados

15 Qué se puede analizar en las células extraídas de los embriones?. Alteraciones cromosómicas (monosomías, trisomías, triploidías). Enfermedades de base molecular conocida y analizable por PCR Qué se puede analizar en las células extraídas de los embriones?. Alteraciones cromosómicas (monosomías, trisomías, triploidías). Enfermedades de base molecular conocida y analizable por PCR

16 Autosomas Cromosomas sexuales

17 ANOMALÍAS CROMOSÓMICAS (autosomas) 46, XX 46, XY 47, XY (XX), , XY (XX), , XY (XX), +21 normal normal Síndrome de Patau Síndrome de Edwards Síndrome de Down PGD Monosomía Trisomía

18 ANOMALÍAS CROMOSÓMICAS (cromosomas sexuales) 46, XX 46, XY 45, X 47, XXY normal normal Síndrome de Turner Síndrome de Klinefelter

19 mujer X Y hombre FISH: hibridación in situ con sondas fluorescentes de ADN Qué se puede analizar en las células extraídas de los embriones?. Alteraciones cromosómicas (monosomías, trisomías, triploidías). Enfermedades de base molecular conocida y analizable por PCR

20 DNA PCR Fibrosis quística La fibrosis quística (abreviatura FQ), también conocida como mucoviscidosis es una enfermedad hereditaria frecuente que afecta al organismo en forma generalizada, causando discapacidad progresiva y muerte prematura.

21 La dificultad para respirar, como consecuencia de infecciones pulmonares crónicas, es el síntoma más común. La FQ es un trastorno multisistémico que causa la formación y acumulación de un moco espeso y pegajoso, afectando fundamentalmente pulmones, intestinos, páncreas e hígado. Aproximadamente, una de cada 25 personas de ascendencia europea es portadora asintomática de un gen para FQ, siendo la enfermedad genética más frecuente entre esta población. ó (Enfermedad autosómica recesiva)

22 TAGTATCCTTTGTGGTTTCTACTAT ATCATAGGAAACACCAAAGATGATA.. pérdida de tres bases TAGTATCCTTTGTGGTTACTAT ATCATAGGAAACACCAATGATA.. pérdida de un aminoácido? DGP

23 Se extrae una célula de varios embriones, para analizar afectado (o no compatible) no afectado (o compatible) no afectado afectado afectado afectado Se utilizan sólo los embriones no afectados EL PAÍS Art. 1.b) Regular la aplicación de las técnicas de reproducción humana asistida en la prevención y tratamiento de enfermedades de origen genético, siempre que existan las garantías diagnósticas y terapéuticas suficientes y sean debidamente autorizadas en los términos previstos en esta Ley.

24 Qué enfermedad ha podido curar Javier? β-talasemia (mayor) La talasemia mayor es la forma más severa de anemia y es una forma hereditaria de la anemia hemolítica, caracterizada por anomalías en la producción de los glóbulos rojos sanguíneos (hemoglobina). La disminución del oxígeno en el organismo se manifiesta desde los 6 meses de edad y si no se le da tratamiento generalmente produce la muerte en unos pocos años. Aquí se pueden observar los glóbulos rojos sanguíneos de forma anormal, pálidos (hipocrómicos) y pequeños asociados con esta enfermedad. Las células más oscuras probablemente representan los glóbulos rojos normales de una transfusión de sangre. Qué enfermedad ha podido curar Javier? β-talasemia mayor

CIENCIA Y VIDA COTIDIANA

CIENCIA Y VIDA COTIDIANA CIENCIA Y VIDA COTIDIANA La clonación, el ADN y cosas de la genética Santiago Torres Martínez Departamento Genética y Microbiología Universidad de Murcia Murcia 25 febrero y 3 marzo, 2008 . Genética. Gen.

Más detalles

Tipos de células madre

Tipos de células madre Biología Bachillerato IES Fuentesnuevas 1 CÉLULAS MADRE O TRONCALES (STEM CELLS) Las células madre son células que tienen capacidad de renovarse continuamente por sucesivas divisiones por mitosis y de

Más detalles

DIAGNÓSTICO GENÉTICO DE PREIMPLANTACIÓN (PGD)

DIAGNÓSTICO GENÉTICO DE PREIMPLANTACIÓN (PGD) DIAGNÓSTICO GENÉTICO DE PREIMPLANTACIÓN (PGD) Las alteraciones genéticas son una importante causa de esterilidad e infertilidad y pueden ser responsables de algunos defectos congénitos. Estas alteraciones

Más detalles

RETRASANDO EL RELOJ CELULAR DE LAS CELULAS MADRE INDUCIDAS (IPS)

RETRASANDO EL RELOJ CELULAR DE LAS CELULAS MADRE INDUCIDAS (IPS) RETRASANDO EL RELOJ CELULAR DE LAS CELULAS MADRE INDUCIDAS (IPS) Madrid, 6 de febrero de 2009. La prestigiosa revista Cell Stem Cell publica hoy en su edición digital un trabajo del grupo de Telómeros

Más detalles

Evolución de la donación de órganos en España. Europa: 19,2 EEUU: 25,8

Evolución de la donación de órganos en España. Europa: 19,2 EEUU: 25,8 Evolución de la donación de órganos en España Europa: 19,2 EEUU: 25,8 REQUISITOS PARA EL TRASPLANTE Muerte encefálica Criterios médicos distribución Equipo médico independiente del trasplante Donación

Más detalles

clonación humana Monografías de Comunicación Científica Museos Científicos Coruñeses Una informació n elaborada por

clonación humana Monografías de Comunicación Científica Museos Científicos Coruñeses Una informació n elaborada por Una informació n elaborada por Museos Científicos Coruñeses Monografías de Comunicación Científica 04 Edición realizada con el patrocinio de clonación humana El 13 de febrero de 2004 todos los medios de

Más detalles

SANAR, REPONER O REGENERAR?

SANAR, REPONER O REGENERAR? SANAR, REPONER O REGENERAR? DR. JOSÉ VICENTE CASTELL DIRECTOR DE LA FUNDACIÓN PARA LA INVESTIGACIÓN LA FE Gran parte del amplio elenco de las enfermedades que afectan hoy día al ser humano, tienen su origen

Más detalles

En función de la relación existente entre el donante y el receptor se diferencian varios tipos de trasplantes:

En función de la relación existente entre el donante y el receptor se diferencian varios tipos de trasplantes: TEMA 4: AVANCES BIOMÉDICOS 1.- TRASPLANTES DE ÓRGANOS Trasplante o injerto en medicina es un tratamiento médico complejo que consiste en trasladar órganos, tejidos o células de una persona a otra. El órgano

Más detalles

UNIDAD 7 LA DIGNIDAD DE LA VIDA

UNIDAD 7 LA DIGNIDAD DE LA VIDA UNIDAD 7 LA DIGNIDAD DE LA VIDA A) EL EMBRIÓN: fecundación Espermatozoides llegando al ovocito Concepción La carrera por la vida... "Desde el momento mismo de la fecundación, desde el instante en que a

Más detalles

Proyecto GENOMA HUMANO

Proyecto GENOMA HUMANO CÉLULAS MADRE Proyecto GENOMA HUMANO PROYECTO GENOMA HUMANO PROYECTO GENOMA HUMANO TIPOS DE ADN EN EL GENOMA HUMANO Intrones, promotores y regiones reguladoras (40 %) DNA intergénico con funciones desconocidas(68,3

Más detalles

Qué es una célula troncal?

Qué es una célula troncal? Introducción -La célula es la unidad básica y funcional de todos los organismos vivos. -El cuerpo humano está formado por millones de células. -Las células tienen formas específicas y diferentes funciones.

Más detalles

Claus per a comprendre la genètica

Claus per a comprendre la genètica Curs: 2011-2012 Diploma Sènior de la UOM. Primer curs. Obligatòria. Claus per a comprendre la genètica Tema 8: Clonació i cel.lules mare Dr. José Aurelio Castro Ocón Universitat de les Illes Balears La

Más detalles

A la vanguardia en la prevención de enfermedades genéticas

A la vanguardia en la prevención de enfermedades genéticas MEDICINA GENÓMICA TEST GENÉTICO DE PORTADORES A la vanguardia en la prevención de enfermedades genéticas Ref. 167/ Abril 2013 Si quieres recibir información más detallada, ponte en contacto con nuestro

Más detalles

MARCO GARNIQUE MONCADA Máster en Reproducción Humana Ginecólogo del Servicio de Medicina Reproductiva del INMP Ginecólogo de CREA, Centro de

MARCO GARNIQUE MONCADA Máster en Reproducción Humana Ginecólogo del Servicio de Medicina Reproductiva del INMP Ginecólogo de CREA, Centro de MARCO GARNIQUE MONCADA Máster en Reproducción Humana Ginecólogo del Servicio de Medicina Reproductiva del INMP Ginecólogo de CREA, Centro de Reproducción Asistida TRAS LA UNIÓN DE LOS GAMETOS EN ESTADÍO

Más detalles

DE LA FECUNDACIÓ IN VITRO A LES CÈL LULES MARE

DE LA FECUNDACIÓ IN VITRO A LES CÈL LULES MARE DE LA FECUNDACIÓ IN VITRO A LES CÈL LULES MARE Anna Veiga Servei de Medicina de la Reproducció - Institut Universitari Dexeus Centre de Medicina Regenerativa de Barcelona Barcelona HISTORIA 1878 Primeros

Más detalles

DGP: Para tus hijos, evita riesgos

DGP: Para tus hijos, evita riesgos DGP: Para tus hijos, evita riesgos Ahora, con el Diagnóstico Genético Preimplantacional (DGP) podrás evitar los riesgos genéticos en tu descendencia. Salud de la mujer Dexeus Salud de la mujer Dexeus DEPARTAMENTO

Más detalles

Definición: cariotipo y características

Definición: cariotipo y características Prof. Oswaldo Javier Loreto Marzo 2014 Definición: cariotipo y características El cariotipo es el ordenamiento de los cromosomas de una célula metafásica de acuerdo a su morfología, tales como el tamaño,

Más detalles

regenerativa Medicina Especial Preguntas frecuentes Número 7 Tipos de células madre Preguntas Frecuentes Glosario

regenerativa Medicina Especial Preguntas frecuentes Número 7 Tipos de células madre Preguntas Frecuentes Glosario Medicina regenerativa Número 7 Tipos de células madre Preguntas Frecuentes Glosario Especial Todos hemos oído hablar de la extraordinaria promesa que constituye la investigación con células madre para

Más detalles

CAP ITULO XII HERENCIA

CAP ITULO XII HERENCIA CAP ITULO XII HERENCIA Algunas enfermedades son genéticas en origen y por lo tanto son transmitidas en familias. La mayoría de las enfermedades de inmunodeficiencia son heredades en alguno de los dos diferentes

Más detalles

El diagnóstico genético preimplantacional (DGP), una oportunidad en cáncer hereditario?

El diagnóstico genético preimplantacional (DGP), una oportunidad en cáncer hereditario? Se han revisado sus beneficios y limitaciones en una jornada de Unidades de Consejo Genético en Cáncer Familiar, organizada por la SEOM con el apoyo del Instituto Roche El diagnóstico genético preimplantacional

Más detalles

Por: Pablo Fonseca Licenciado en Química y Biotecnología. Bioterio, Hospital Posadas.

Por: Pablo Fonseca Licenciado en Química y Biotecnología. Bioterio, Hospital Posadas. CELULAS MADRES Por: Pablo Fonseca Licenciado en Química y Biotecnología. Bioterio, Hospital Posadas. Son células que tienen la capacidad de diferenciarse y originar células de la sangre y del sistema inmunológico

Más detalles

Stem Cells Células Madre HÉCTOR R. PÉREZ, MS, DVM, LAP

Stem Cells Células Madre HÉCTOR R. PÉREZ, MS, DVM, LAP Stem Cells Células Madre HÉCTOR R. PÉREZ, MS, DVM, LAP Qué son Células Madre? Células Madre son células primitivas con un potencial y habilidad infinita para renovación Y diferenciación a otro tipo de

Más detalles

Charla "Biotecnología y salud en el 2020"

Charla Biotecnología y salud en el 2020 Charla "Biotecnología y salud en el 2020" Dra. Mariela Bollati Post-doctorado, Experimental Immunology Group, Helmholtz Centre for Infectious Diseases, Alemania. Jefa de la Unidad de Biología Celular,

Más detalles

PATIENT EDUCATI The American College of Obstetricians and Gynecologists

PATIENT EDUCATI The American College of Obstetricians and Gynecologists PATIENT EDUCATI N The American College of Obstetricians and Gynecologists WOMEN S HEALTH CARE PHYSICIANS El Embarazo SP094 Los trastornos genéticos La mayoría de los niños en Estados Unidos nacen saludables.

Más detalles

EL CUERPO HUMANO (Anatomía, fisiología, higiene y salud para maestros)

EL CUERPO HUMANO (Anatomía, fisiología, higiene y salud para maestros) Departamento de Biología Ambiental y Salud Pública EL CUERPO HUMANO (Anatomía, fisiología, higiene y salud para maestros) Acabo de nacer: Qué haya suerte! Todo se lo debo a mis padres: fecundación y formación

Más detalles

CÉLULAS MADRE ASUNCION CATALINA G.VALADÉS/DPTO.CCNN/C.NUESTRA SRA DEL CARMEN/MÓSTOLES/BG 4º

CÉLULAS MADRE ASUNCION CATALINA G.VALADÉS/DPTO.CCNN/C.NUESTRA SRA DEL CARMEN/MÓSTOLES/BG 4º CÉLULAS MADRE 1 1 Términos como: célula madre, fecundación in vitro, cordón umbilical, terapia celular, biotecnología, manipulación genética, clonación, aparecen cada vez más en nuestra vida cotidiana.

Más detalles

ENFERMEDADES GENÉTICAS

ENFERMEDADES GENÉTICAS ENFERMEDADES GENÉTICAS Inicio INDICE 1 Que es una enfermedad genética? 1.1Enfermedades cromosómicas 1.2Enfermedades monogenicas 2. como se heredan? 2.1 Herencia dominante 2.2 Herencia recesiva 2.3 Herencia

Más detalles

Una prueba genética fetal sin riesgos, ni para ti ni para tu bebé

Una prueba genética fetal sin riesgos, ni para ti ni para tu bebé OBSTETRICIA TEST EN SANGRE MATERNA PARA DETECTAR SÍNDROME DE DOWN Una prueba genética fetal sin riesgos, ni para ti ni para tu bebé Salud de la mujer Dexeus ATENCIÓN INTEGRAL EN OBSTETRICIA, GINECOLOGÍA

Más detalles

Test de Cribado Prenatal No Invasivo en sangre materna

Test de Cribado Prenatal No Invasivo en sangre materna Test de Cribado Prenatal No Invasivo en sangre materna Detecta las trisomías fetales de los cromosomas 21, 13 y 18 Detecta síndromes de microdeleción Informa del sexo fetal y de las aneuploidías de cromosomas

Más detalles

DESCRIPCIÓN GENERAL DE LAS ANOMALÍAS CROMOSÓMICAS

DESCRIPCIÓN GENERAL DE LAS ANOMALÍAS CROMOSÓMICAS ANOMALÍAS CROMOSÓMICAS INTRODUCCION Cualquier alteración en el número y/o en la morfología de los cromosomas constituye una alteración cromosómica. Cuando existen uno o más juegos de cromosomas completos,

Más detalles

Genealogías y clonación.

Genealogías y clonación. Curso: Biología Mención Material Nº 6 Unidad V. Variabilidad y Herencia. Genealogías y clonación.. GENEALOGÍAS. El hombre, sin haber tenido conocimiento alguno de genética, siempre se ha preocupado de

Más detalles

Las células madre o progenitoras

Las células madre o progenitoras Capítulo 35 Las células madre o progenitoras Dra. M.ª Teresa Pérez de Prada Bióloga especialista en Biotecnología. Unidad de Investigación Cardiovascular del Instituto Cardiovascular del Hospital Clínico

Más detalles

Biología y Geología Genética Humana 4º ESO ACTIVIDADES FINALES: GENÉTICA HUMANA

Biología y Geología Genética Humana 4º ESO ACTIVIDADES FINALES: GENÉTICA HUMANA ACTIVIDADES FINALES: GENÉTICA HUMANA 1.- Un varón de ojos azules, cuyos padres tenían ojos oscuros, se casa con una mujer de ojos oscuros, cuyo padre tenía ojos azules. Esta mujer tiene un hermano de ojos

Más detalles

LOS RETOS DE LA BIOMEDICINA: ENTRE LA CIENCIA Y LA ÉTICA

LOS RETOS DE LA BIOMEDICINA: ENTRE LA CIENCIA Y LA ÉTICA AULA DE MAYORES Y DE LA EXPERIENCIA F.Córdoba, R.Torronteras, A.Canalejo Departamento de Biología Ambiental y Salud Pública LOS RETOS DE LA BIOMEDICINA: ENTRE LA CIENCIA Y LA ÉTICA Tema 1.4. La transmisión

Más detalles

PATIENT EDUCATI The American College of Obstetricians and Gynecologists

PATIENT EDUCATI The American College of Obstetricians and Gynecologists PATIENT EDUCATI N The American College of Obstetricians and Gynecologists WOMEN S HEALTH CARE PHYSICIANS El Embarazo SP165 Exámenes de detección de defectos congénitos Los exámenes de detección pueden

Más detalles

Test de Cribado Prenatal No Invasivo en sangre materna

Test de Cribado Prenatal No Invasivo en sangre materna Test de Cribado Prenatal No Invasivo en sangre materna Software de resultados BGI con marcado CE para la trisomía 21 Detecta las trisomías fetales de los cromosomas 21, 13 y 18 Informa de 3 síndromes de

Más detalles

LA BIOTECNOLOGÍA HACE TU VIDA MEJOR Y MÁS FÁCIL

LA BIOTECNOLOGÍA HACE TU VIDA MEJOR Y MÁS FÁCIL LA BIOTECNOLOGÍA HACE TU VIDA MEJOR Y MÁS FÁCIL BIOTECNOLOGÍA APLICADA A LA SALUD La Biotecnología está presente en la Medicina y en la Salud animal, ya que participa en el diagnóstico y en el tratamiento

Más detalles

Antes del embarazo Pre - concepción

Antes del embarazo Pre - concepción Antes del embarazo Pre - concepción Cariotipo en la pareja con dificultades para concebir Qué es un cariotipo? Es el estudio que permite detectar anomalías en el número o en la forma de los cromosomas.

Más detalles

Curs de genètica aplicada a Medicina Fetal

Curs de genètica aplicada a Medicina Fetal Curs de genètica aplicada a Medicina Fetal MA Sánchez Durán Diciembre 2015 Introducción Detección de defectos congénitos Desarrollo Genética 2 7 7 Infecciones Monogénicos 55 25 Cromosómicos Poligénico

Más detalles

PONENCIA. Diagnóstico prenatal de cromosomopatías y retraso mental.

PONENCIA. Diagnóstico prenatal de cromosomopatías y retraso mental. PONENCIA Diagnóstico prenatal de cromosomopatías y retraso mental. Conceptos básicos Conceptos básicos DIAGNÓSTICO PRENATAL. El término "diagnóstico prenatal" agrupa todas aquellas acciones diagnósticas

Más detalles

Detección prenatal no invasiva para embarazos de alto riesgo

Detección prenatal no invasiva para embarazos de alto riesgo Detección prenatal no invasiva para embarazos de alto riesgo Información para su tranquilidad. Su embarazo debe ser un acontecimiento para disfrutar. Sin embargo, si su médico ha determinado algún riesgo

Más detalles

Paralelismo entre cromosomas y la teoria de Mendel

Paralelismo entre cromosomas y la teoria de Mendel Paralelismo entre cromosomas y la teoria de Mendel Cromosomas sexuales Autosomas Herencia ligada al sexo Cromosomas heteromorfos Nettie Stevens, 1909 Estudios en Drosophila, mosca del vinagre Thomas Hunt

Más detalles

CUARTA JORNADA DE BIOÉTICA

CUARTA JORNADA DE BIOÉTICA CUARTA JORNADA DE BIOÉTICA La reducción del embrión humano a objeto manipulable. Investigación, procreación artificial y aborto. Dra. Damasia Becú de Villalobos Florencio Varela, 29/6/2002 Instituto de

Más detalles

FUNDAMENTOS BIOLÓGICOS DEL APRENDIZAJE Y LA MEMORIA

FUNDAMENTOS BIOLÓGICOS DEL APRENDIZAJE Y LA MEMORIA Departamento de Biología Ambiental y Salud Pública FUNDAMENTOS BIOLÓGICOS DEL APRENDIZAJE Y LA MEMORIA INTRODUCCIÓN. Genes y ambiente. Las cualidades heredadas y los efectos de la experiencia. El sustrato

Más detalles

CÉLULAS TRONCALES Y TERAPIA CELULAR

CÉLULAS TRONCALES Y TERAPIA CELULAR CÉLULAS TRONCALES Y TERAPIA CELULAR Juan-Ramón Lacadena COLEGIO LIBRE DE EMÉRITOS Madrid, 13 marzo 2012 REPROGRAMACIÓN NUCLEAR Gametos Cigoto Células totipotentes (hasta mórula 16 células) Células pluripotentes

Más detalles

FERTILIZACIÓN ASISTIDA TÉCNICAS y CONCEPTOS MODERNOS

FERTILIZACIÓN ASISTIDA TÉCNICAS y CONCEPTOS MODERNOS FERTILIZACIÓN ASISTIDA TÉCNICAS y CONCEPTOS MODERNOS El tratamiento de la esterilidad mediante la Reproducción ó Fertilización Asistida es una de las áreas de la medicina moderna en las que se ha registrado

Más detalles

TEMA 4 CMC BIOTECNOLOGÍA

TEMA 4 CMC BIOTECNOLOGÍA Conceptos Tema 4 TEMA 4 CMC BIOTECNOLOGÍA Células eucariotas: Células con núcleo. Núcleo: Un compartimento en el interior de la célula que alberga el material genético. Citoplasma: En una célula eucariota,

Más detalles

La MEDICINA del SIGLO XXI

La MEDICINA del SIGLO XXI La MEDICINA del SIGLO XXI Ginés Morata Pérez Ex-Director del Centro de Biología Molecular del CSIC Carlos Martínez-A. Jefe del Departamento de Inmunología y Oncología del Centro Nacional de Biotecnología

Más detalles

Métodos de Reproducción Asistida más Usados

Métodos de Reproducción Asistida más Usados Métodos de Reproducción Asistida más Usados Entendemos por métodos de reproducción asistida, al conjunto de técnicas médicas, que tienen la finalidad de facilitar o substituir, los procesos naturales que

Más detalles

ISSN 1988-6047 DEP. LEGAL: GR 2922/2007 Nº 17 ABRIL DE 2009 CÉLULAS MADRE

ISSN 1988-6047 DEP. LEGAL: GR 2922/2007 Nº 17 ABRIL DE 2009 CÉLULAS MADRE CÉLULAS MADRE AUTORÍA MARIA LUISA MORALES GALLEGO TEMÁTICA BIOLOGÍA CELULAR ETAPA BACHILLERATO Resumen El artículo trata de explicar de forma clara qué son las células madre, cuáles son los tipos de células

Más detalles

SÍNDROME DE DOWN. Pedro Rodríguez Expósito Terapeuta Ocupacional Anda Alicante. terapiaocupacional@andalicante.org

SÍNDROME DE DOWN. Pedro Rodríguez Expósito Terapeuta Ocupacional Anda Alicante. terapiaocupacional@andalicante.org SÍNDROME DE DOWN Pedro Rodríguez Expósito Terapeuta Ocupacional Anda Alicante terapiaocupacional@andalicante.org El síndrome de Down es una alteración genética producida por la presencia de un cromosoma

Más detalles

Cosas en qué pensar Las células madre pueden hacer copias de sí mismas. Esto se conoce como auto-renovación.

Cosas en qué pensar Las células madre pueden hacer copias de sí mismas. Esto se conoce como auto-renovación. Diferenciación = Haciendo células especializadas Qué es una célula madre? Lo que muestra la foto Un bloque de metal y una variedad de tornillos que pueden hacerse a partir del bloque. Cosas en qué pensar

Más detalles

SITUACIÓN ACTUAL EN INVESTIGACIONES CON CÉLULAS TRONCALES

SITUACIÓN ACTUAL EN INVESTIGACIONES CON CÉLULAS TRONCALES 1 ACADEMIA DEL PLATA. Sesión del día 2 de septiembre de 2005. SITUACIÓN ACTUAL EN INVESTIGACIONES CON CÉLULAS TRONCALES La conformación de un nuevo organismo, a partir de la fecundación, en cualquier especie

Más detalles

Genética, Medicina y Sociedad (Síntesis).

Genética, Medicina y Sociedad (Síntesis). Genética, Medicina y Sociedad (Síntesis). Biología. Curtis, et al. (2008). Editorial Médica Interamericana. 7ª Ed. Cap. 16. Por lo general, los principios de la genética son los mismos para cualquier ser

Más detalles

Mediante el cariotipado se pueden analizar anomalías numéricas y estructurales, cosa que sería muy difícil de observar mediante genética mendeliana.

Mediante el cariotipado se pueden analizar anomalías numéricas y estructurales, cosa que sería muy difícil de observar mediante genética mendeliana. Cariotipo El cariotipo es el ordenamiento de los cromosomas de una célula metafásica de acuerdo a su tamaño y morfología. El cariotipo es característico de cada especie y, el ser humano tiene 46 cromosomas

Más detalles

Montserrat Milà Sección Genética Molecular Hospital Clínic de barcelona

Montserrat Milà Sección Genética Molecular Hospital Clínic de barcelona Montserrat Milà Sección Genética Molecular Hospital Clínic de barcelona Diagnóstico Genético Diagnóstico de una enfermedad causada por una alteración en el material genético Constitucional: afecta a todas

Más detalles

SIGNOS DE ALARMA DURANTE EL EMBARAZO

SIGNOS DE ALARMA DURANTE EL EMBARAZO SIGNOS DE ALARMA DURANTE EL EMBARAZO MG. María Tello D., RN. Universidad Católica Santo Toribio de Mogrovejo CHICLAYO-PERÚ SIGNOS DE ALARMA DURANTE EL EMBARAZO Si bien la mayoría a de los embarazos y partos

Más detalles

La nueva generación de Diagnóstico Prenatal No Invasivo. De m o dл lí н nó co P atal

La nueva generación de Diagnóstico Prenatal No Invasivo. De m o dл lí н nó co P atal La nueva generación de Diagnóstico Prenatal No Invasivo De m o dл lí н nó co P atal LABCO siempre contigo Cerca del 1% de los fetos presentan algún tipo de anomalía cromosómica. El diagnóstico prenatal

Más detalles

EL ADN y la INGENIERÍA GENÉTICA

EL ADN y la INGENIERÍA GENÉTICA IES LAS VIÑAS MANILVA. MÁLAGA. CMC. Susana Serradilla EL ADN y la INGENIERÍA GENÉTICA EL GENOMA HUMANO GENOMA: Conjunto de genes de un ser vivo. GENOMA HUMANO: Conjunto de genes de la especie humana PROYECTO

Más detalles

Formación de una nueva vida:concepción,herencia y ambiente. Janette Orengo Puig,Ed.D.

Formación de una nueva vida:concepción,herencia y ambiente. Janette Orengo Puig,Ed.D. Formación de una nueva vida:concepción,herencia y ambiente Janette Orengo Puig,Ed.D. Cambios en la teoría de concepción Concepción- (fertilización)-es el proceso por medio del cual el espermatozoide y

Más detalles

Cultura Cientí fica 1 Bachillerato

Cultura Cientí fica 1 Bachillerato Cultura Cientí fica 1 Bachillerato 3. La revolución genética: biotecnología Actividades de consolidación 1. Cualquier molécula de ADN formada por la unión de segmentos de ADN de origen diferente es: a)

Más detalles

LEGISLACIÓN CONSOLIDADA. TEXTO CONSOLIDADO Última modificación: 15 de diciembre de 2014

LEGISLACIÓN CONSOLIDADA. TEXTO CONSOLIDADO Última modificación: 15 de diciembre de 2014 Ley 7/2003, de 20 de octubre, por la que se regula la investigación en Andalucía con preembriones humanos no viables para la fecundación in vitro. Comunidad Autónoma de Andalucía «BOJA» núm. 210, de 31

Más detalles

Terapia Génica. Dra. Lizbeth Salazar-Sànchez Escuela de Medicina Universidad de Costa Rica

Terapia Génica. Dra. Lizbeth Salazar-Sànchez Escuela de Medicina Universidad de Costa Rica Terapia Génica Dra. Lizbeth Salazar-Sànchez Escuela de Medicina Universidad de Costa Rica 5/8/2015 Gen Esta en un cromosoma Es la unidad base de la Herencia Codificación, proteína DNA RNA proteins Proteínas,

Más detalles

Trabajo realizado por : Álvaro Moya Víctor Moya Fran Moyano

Trabajo realizado por : Álvaro Moya Víctor Moya Fran Moyano Trabajo realizado por : Álvaro Moya Víctor Moya Fran Moyano ÍNDICE ADN - Historia del ADN - Qué es el ADN? - De qué está formado? - Qué función tiene? Ingeniería genética - Qué es la ingeniería genética?

Más detalles

P R O V I D A P R E S S Nº 219 7 DE ABRIL 2006

P R O V I D A P R E S S Nº 219 7 DE ABRIL 2006 P R O V I D A P R E S S Nº 219 7 DE ABRIL 2006 C/Joaquín Costa, 24 bajo derecha 46005 Valencia Teléfono : 963331131 / Fax: 963201258 ASOCIACIÓN VALENCIANA PARA LA DEFENSA DE LA VIDA O.N.G. DECLARADA DE

Más detalles

Got es de color negro y es idéntico que su padre que se llamaba Vasito. El segundo toro clonado del proyecto llamado Glass nació muerto.

Got es de color negro y es idéntico que su padre que se llamaba Vasito. El segundo toro clonado del proyecto llamado Glass nació muerto. Noticia: Got, el primer toro bravo clonado Nace en Palencia Científicos españoles han clonado con éxito a un semental de la ganadería de toros de lidia de Alfonso Guardiola. Ya está aquí el primer animal

Más detalles

LEY 42/1988, de 28 de diciembre, de donación y utilización de embriones y fetos humanos o de sus células, tejidos u órganos.

LEY 42/1988, de 28 de diciembre, de donación y utilización de embriones y fetos humanos o de sus células, tejidos u órganos. LEY 42/1988, de 28 de diciembre, de donación y utilización de embriones y fetos humanos o de sus células, tejidos u órganos. Juan Carlos I, Rey de España A todos los que la presente vieren y entendieren.

Más detalles

Diagnóstico genético de preimplantación (DGP)

Diagnóstico genético de preimplantación (DGP) Avances EFICAZ OPCIÓN PARA PACIENTES QUE PRESENTAN ALTO RIESGO DE INFERTILIDAD O ESTERILIDAD Diagnóstico genético de preimplantación (DGP) Equipo Diagnóstico Genético de Preimplantación Dra Claudia Perandones

Más detalles

LEY 14/2006 del 26 de mayo, sobre TÉCNICAS DE REPRODUCCIÓN ASISTIDA

LEY 14/2006 del 26 de mayo, sobre TÉCNICAS DE REPRODUCCIÓN ASISTIDA Fecha: 13 de Abril de 2011 Nombre: Dra. Ana Cardo Maza R3 Tipo de Sesión: Seminario LEY 14/2006 del 26 de mayo, sobre TÉCNICAS DE REPRODUCCIÓN ASISTIDA CAPÍTULO 1- DISPOSICIONES GENERALES Objeto de la

Más detalles

APLICACIONES DE BIOTECNOLOGÍA EN MEDICINA Y REPRODUCCIÓN

APLICACIONES DE BIOTECNOLOGÍA EN MEDICINA Y REPRODUCCIÓN APLICACIONES DE BIOTECNOLOGÍA EN MEDICINA Y REPRODUCCIÓN APLICACIONES EN MEDICINA Y REPRODUCCIÓN TERAPIA GÉNICA CLONACIÓN TERAPÉUTICA CÉLULAS MADRE DIAGNÓSTICO GENÉTICO DIAGNÓSTICO GENÉTICO PREIMPLANTACIONAL

Más detalles

con número de expediente MIDTF/2011/212

con número de expediente MIDTF/2011/212 La investigación biomédica es una actividad necesaria para el éxito de cualquier estrategia que se proponga mejorar la salud de los ciudadanos. En este sentido, IVI VALENCIA, S.L. apuesta fuertemente por

Más detalles

Una empresa valenciana implanta una técnica para analizar el ADN del esperma

Una empresa valenciana implanta una técnica para analizar el ADN del esperma 26/03/2013 Una empresa valenciana implanta una técnica para analizar el ADN del esperma Valencia, 26 mar (EFE).- La empresa valenciana Sistemas Genómicos ha implantado una técnica de análisis que utiliza

Más detalles

Programa de Detección Prenatal de Anomalías Cromosómicas. Memoria 2013

Programa de Detección Prenatal de Anomalías Cromosómicas. Memoria 2013 MEMORIA 2013 1 1- CONTEXTO DEMOGRÁFICO Descenso mantenido del número de partos La situación demográfica de nuestra Comunidad pone de manifiesto un descenso mantenido de la natalidad, que se traduce en

Más detalles

STEM CELLS: PLANTEADAS PARA ORIGINAR Y REGENERAR TEJIDOS Y ÓRGANOS PRESENTADO POR: ANA CRISTINA ESTRADA TERCER SEMESTRE MEDICINA

STEM CELLS: PLANTEADAS PARA ORIGINAR Y REGENERAR TEJIDOS Y ÓRGANOS PRESENTADO POR: ANA CRISTINA ESTRADA TERCER SEMESTRE MEDICINA STEM CELLS: PLANTEADAS PARA ORIGINAR Y REGENERAR TEJIDOS Y ÓRGANOS PRESENTADO POR: ANA CRISTINA ESTRADA TERCER SEMESTRE MEDICINA INSTITUTO DE GENETICA HUMANA PONTIFICIA UNIVERSIDAD JAVERIANA BOGOTA MAYO

Más detalles

Módulo 10 Unidad Temática 10

Módulo 10 Unidad Temática 10 Universidad Nacional del Nordeste Facultad de Medicina Especialización en Bacteriología Clínica Módulo 10 Unidad Temática 10 Fibrosis quística Neumonías atípicas Fibrosis Quística Originalmente se denomina

Más detalles

Consejería genética. Dra. Elena Alvarado León Area de Genética y Biología Molecular y Celular Dpto. de Morfología Humana FAC.

Consejería genética. Dra. Elena Alvarado León Area de Genética y Biología Molecular y Celular Dpto. de Morfología Humana FAC. Consejería genética Dra. Elena Alvarado León Area de Genética y Biología Molecular y Celular Dpto. de Morfología Humana FAC. DE MEDICINA - UNT Es un proceso de comunicación por el cual se pretende dar

Más detalles

Terapia celular: presente y futuro, realidades y falsedades

Terapia celular: presente y futuro, realidades y falsedades Terapia celular: presente y futuro, realidades y falsedades Gregorio Garrido Jefe de Servicio Área Médica Organización Nacional de Trasplantes Oviedo 1 de Abril de 2011 El mito de Prometeo TERAPIA CELULAR

Más detalles

Universidad de Universidad Cádiz de Cádiz Aula de Mayores Aula de M

Universidad de Universidad Cádiz de Cádiz Aula de Mayores Aula de M Programa Teórico 1.- La herencia de los seres vivos. Base genética de la herencia. Dogma central de la Biología Molecular. Herencia de los caracteres: Mendelismo. 2.- Genética y evolución. Evolución de

Más detalles

La importancia de la sangre

La importancia de la sangre La importancia de la sangre La sangre es un fluido vital, transporta nutrientes esenciales y oxígeno a todos los tejidos y órganos del cuerpo Cerca del 45% del volumen total de la sangre está compuesta

Más detalles

CAPÍTULO VIII EL SÍNDROME HIPER IgM LIGADO AL X

CAPÍTULO VIII EL SÍNDROME HIPER IgM LIGADO AL X CAPÍTULO VIII EL SÍNDROME HIPER IgM LIGADO AL X Los pacientes con el Síndrome Hiper IgM ligado al x tienen deficiencia de una proteína, Ligando CD40, que se encuentra en la superficie de los linfocitos

Más detalles

CÉLULA MADRE. Célula que es capaz de. Autorenovarse indefinidamente. Diferenciarse STEM CELL = CÉLULA TRONCAL

CÉLULA MADRE. Célula que es capaz de. Autorenovarse indefinidamente. Diferenciarse STEM CELL = CÉLULA TRONCAL CÉLULA MADRE STEM CELL = CÉLULA TRONCAL Célula que es capaz de Autorenovarse indefinidamente Diferenciarse La diferenciación debe de producirse a tipos de células especializadas, tanto desde el punto de

Más detalles

IVI Santiago Dossier de Prensa

IVI Santiago Dossier de Prensa www.ivinet.cl IVI Santiago Dossier de Prensa Donde nace la vida Instituto Valenciano de Infertilidad El Instituto Valenciano de Infertilidad nace en el año 1990 como la primera institución médica en España

Más detalles

Vivir más y mejor: Medicina hoy

Vivir más y mejor: Medicina hoy Vivir más y mejor: Medicina hoy Nuestra vida, tal y como la vivimos ahora, depende en gran medida de las condiciones sanitarias en las que nos encontramos. La medicina, que avanza sin descanso, está alargando

Más detalles

LEGISLACIÓN CONSOLIDADA. TEXTO CONSOLIDADO Última modificación: 15 de diciembre de 2014

LEGISLACIÓN CONSOLIDADA. TEXTO CONSOLIDADO Última modificación: 15 de diciembre de 2014 Ley 1/2007, de 16 de marzo, por la que se regula la investigación en reprogramación celular con finalidad exclusivamente terapéutica. Comunidad Autónoma de Andalucía «BOJA» núm. 63, de 29 de marzo de 2007

Más detalles

Clonación de seres humanos con fines de reproducción: informe sobre los debates de la Asamblea General de las Naciones Unidas

Clonación de seres humanos con fines de reproducción: informe sobre los debates de la Asamblea General de las Naciones Unidas ORGANIZACIÓN MUNDIAL DE LA SALUD CONSEJO EJECUTIVO EB115/INF.DOC./2 115ª reunión 16 de diciembre de 2004 Punto 9.5 del orden del día provisional Clonación de seres humanos con fines de reproducción: informe

Más detalles

LEY NÚM. 42/1988, DE 28 DE DICIEMBRE, DE DONACIÓN Y UTILIZACIÓN DE EMBRIONES Y FETOS HUMANOS O DE SUS CÉLULAS, TEJIDOS U ÓRGANOS 1

LEY NÚM. 42/1988, DE 28 DE DICIEMBRE, DE DONACIÓN Y UTILIZACIÓN DE EMBRIONES Y FETOS HUMANOS O DE SUS CÉLULAS, TEJIDOS U ÓRGANOS 1 LEY NÚM. 42/1988, DE 28 DE DICIEMBRE, DE DONACIÓN Y UTILIZACIÓN DE EMBRIONES Y FETOS HUMANOS O DE SUS CÉLULAS, TEJIDOS U ÓRGANOS 1 EXPOSICIÓN DE MOTIVOS La Ley 30/1979, de 27 de octubre, de extracción

Más detalles

LA CLONACIÓN EN SU CONTEXTO BIOMÉDICO Y ÉTICO César Nombela, Catedrático de Microbiología. Facultad de Farmacia. Universidad Complutense.

LA CLONACIÓN EN SU CONTEXTO BIOMÉDICO Y ÉTICO César Nombela, Catedrático de Microbiología. Facultad de Farmacia. Universidad Complutense. 30/11/2006 Nº 35 CIENCIA LA CLONACIÓN EN SU CONTEXTO BIOMÉDICO Y ÉTICO César Nombela, Catedrático de Microbiología. Facultad de Farmacia. Universidad Complutense. FOTO: BIGSTOCKPHOTO.COM El término clonación

Más detalles

Cuáles son las características únicas de todas las células madre?

Cuáles son las características únicas de todas las células madre? Células Madre Conceptos fundamentales I. Introducción y alcance de este documento II. III. Cuáles son las características únicas de todas las células madre? Cuáles son células madre embrionarias? IV. Cuáles

Más detalles

Ambas noticias están relacionadas con la manipulación génica de los animales y su relación con el ser humano.

Ambas noticias están relacionadas con la manipulación génica de los animales y su relación con el ser humano. TRABAJO PRÁCTICO SOBRE DOS NOTICIAS RELACIONADAS CON LA MODIFICACIÓN GÉNICA DE ANIMALES Principios básicos de la manipulación genética. INGENIERÍA GENÉTICA Programa de Formación del Profesorado UNED Mayo

Más detalles

Herencia Ligada al Cromosoma X

Herencia Ligada al Cromosoma X 12 Su clínica local: www.aegh.org/docs/encuesta-aegh-2005-centros-y-personasde-contacto.pdf Herencia Ligada al Cromosoma X www.aegh.org/docs/encue sta-aegh-2005-servicios-degenetica-clinica.pdf Elaborado

Más detalles

Nació en Hellín (Albacete), en 1960.

Nació en Hellín (Albacete), en 1960. Biografía de Juan Carlos Izpisúa Belmonte Bioquímico e investigador, experto en biología del desarrollo, es profesor de investigación y ejerce la cátedra Roger Guillemin en el Laboratorio de Expresión

Más detalles

GENÉTICA. 4º de ESO Mercedes Macías

GENÉTICA. 4º de ESO Mercedes Macías GENÉTICA 4º de ESO Mercedes Macías Contenidos Los cromosomas: Cromosomas homólogos Autosomas y heterocromosomas, el cariotipo Anomalías cromosómicas. Las mutaciones. Los genes: Los alelos: Dominantes,

Más detalles

La anemia y tu salud

La anemia y tu salud La anemia y tu salud Programa de Promoción y Educación en Salud Rev. 2014 2014, MMM Healthcare, Inc. - PMC Medicare Choice, Inc. Se prohíbe la reproducción de este material. MP-HEP-PPT-769-01-050514-S

Más detalles

Nace, por primera vez en España, un hijo libre de la enfermedad genética CADASIL gracias a un diagnóstico genético preimplantacional previo

Nace, por primera vez en España, un hijo libre de la enfermedad genética CADASIL gracias a un diagnóstico genético preimplantacional previo Dossier de prensa Nace, por primera vez en España, un hijo libre de la enfermedad genética CADASIL gracias a un diagnóstico genético preimplantacional previo Sumario: Páginas 2 y 3: Nota de prensa Página

Más detalles

SÍNDROME de HIPERIgM

SÍNDROME de HIPERIgM SÍNDROME de HIPERIgM Este folleto está pensado para el uso de pacientes y de sus familias y no reemplaza los consejos de un inmunólogo clínico. 1 Tambien disponible: AGAMMAGLOBULINEMIA LIGADA AL CROMOSOMA

Más detalles

ABERRACIONES CROMOSÓMICAS NUMÉRICAS Y ESTRUCTURALES. DRA. BEATRIZ E. DE LA FUENTE CORTEZ 3 AGOSTO 2015

ABERRACIONES CROMOSÓMICAS NUMÉRICAS Y ESTRUCTURALES. DRA. BEATRIZ E. DE LA FUENTE CORTEZ 3 AGOSTO 2015 ABERRACIONES CROMOSÓMICAS NUMÉRICAS Y ESTRUCTURALES. DRA. BEATRIZ E. DE LA FUENTE CORTEZ 3 AGOSTO 2015 Caso Clínico 1 Recién nacido masculino de 4 días de vida, valorado por presentar rasgos dismórficos

Más detalles

Herencia. Realización de árbol genealógico

Herencia. Realización de árbol genealógico Herencia. Realización de árbol genealógico Octubre 2014 Dra. Alonso Cerezo Genética Clínica Índice 1. Herencia. 2. Realización de árbol genealógico 3. Ejemplo Herencia Alteraciones cromosómicas Enfermedades

Más detalles

Células troncales: Orígenes, fenotipos y su aplicación en investigación básica y clínica!"#$%&'"()*+#%,#-.#/

Células troncales: Orígenes, fenotipos y su aplicación en investigación básica y clínica!#$%&'()*+#%,#-.#/ Células troncales: Orígenes, fenotipos y su aplicación en investigación básica y clínica!"#$%&'"()*+#%,#-.#/ 2011 Células troncales: Orígenes, fenotipos y su aplicación en investigación básica y clínica

Más detalles

TEMA4. La Sangre El mejor Regalo

TEMA4. La Sangre El mejor Regalo Historia TEMA4. La Sangre El mejor Regalo Las primeras noticias sobre la transfusión de sangre surgieron en 1492, con el Papa Inocencio VIII. Este papa debido a que estaba a punto de morir, recibió sangre

Más detalles

En este cuadro, se representa un calendario semanal del desarrollo humano antes del embarazo, y su relación con el momento del parto.

En este cuadro, se representa un calendario semanal del desarrollo humano antes del embarazo, y su relación con el momento del parto. 1 of 6 21/05/2014 12:20 Desarrollo prenatal Contenido 1 Fertilización e implantación 2 Periodo embrionario 2.1 Semana 3 2.2 Semanas 4 a 5 2.3 Semana 6 2.4 Semana 7 2.5 Semana 8 3 Desarrollo fetal 3.1 Semanas

Más detalles