CIENCIA Y VIDA COTIDIANA

Save this PDF as:

Tamaño: px
Comenzar la demostración a partir de la página:

Download "CIENCIA Y VIDA COTIDIANA"

Transcripción

1 CIENCIA Y VIDA COTIDIANA Genética para andar por casa... y 3 Murcia, 17 de diciembre de Genética. Gen. ADN. Información genética. Cromosomas. Genética forense. Ingeniería genética. Clonación/Transgénicos. Células madre. Selección embriones

2 Células madre - Qué son - Para qué sirven Las células madre, o células troncales, son un tipo especial de células indiferenciadas que tienen la capacidad de dividirse indefinidamente, sin perder sus propiedades, y de llegar a producir células especializadas.

3 Mujer óvulo Una célula cigoto embrión Cientos de miles de millones de células : más de 200 tipos distintos de células esperma Hombre Desarrollo embrionario Fases tempranas del desarrollo embrionario humano

4 Fases tempranas del desarrollo embrionario humano Día células totipotentes (indiferenciadas) Células totipotentes

5 Totipotentes (indiferenciadas) Pluripotentes Células madre Multipotentes Unipotentes (diferenciadas) Embrión temprano Embrión en estado de Blastocisto Tipos de células madre Feto Células Madre pluripotentes Adulto Clonación terapéutica Células Núcleo somáticas Ovocito anucleado Células Totipotentes Embrión en estado de Blastocisto

6 Células madre embrionarias Células madre adultas Terapia Celular o Medicina Regenerativa Terapia celular Medicina regenerativa Reparar o restaurar tejidos y órganos dañados como consecuencia de lesiones traumáticas o enfermedades degerativas. Para ello utiliza mecanismos similares a los que, de forma natural, usa el organismo para la renovación de las poblaciones celulares que van envejeciendo y que deben ser sustituidas por otras que suplen su función

7 Células madre El País, 24 noviembre 2011

8 Blastocisto Médula espinal dañada

9 Terapia contra la degeneración macular

10 Aspectos éticos de la utilización de embriones para la obtención de células madre Células madre sin embriones Aplicaciones de las células ips (células madre pluripotentes inducidas) reprogramación Células somáticas del paciente Células nerviosas Células cardíacas Hepatocitos Células beta Medicina regenerativa (uso in vivo) Estudios toxicológicos (uso in vitro)

11 Clonación reproductiva Clonación terapéutica

12 Diagnóstico genético preimplantacional (DGP) Selección de embriones Diagnóstico genético preimplantacional (DGP) La técnica consiste en extraer una o dos células de un embrión de más de seis células, para analizar su material genético

13 Fecundación in vitro DGP emedicine.medscape.com/article/ overview

14 Se extrae una célula de varios embriones, para analizar afectado (o no compatible) no afectado (o compatible) no afectado afectado afectado afectado Se utilizan sólo los embriones no afectados

15 Qué se puede analizar en las células extraídas de los embriones?. Alteraciones cromosómicas (monosomías, trisomías, triploidías). Enfermedades de base molecular conocida y analizable por PCR Qué se puede analizar en las células extraídas de los embriones?. Alteraciones cromosómicas (monosomías, trisomías, triploidías). Enfermedades de base molecular conocida y analizable por PCR

16 Autosomas Cromosomas sexuales

17 ANOMALÍAS CROMOSÓMICAS (autosomas) 46, XX 46, XY 47, XY (XX), , XY (XX), , XY (XX), +21 normal normal Síndrome de Patau Síndrome de Edwards Síndrome de Down PGD Monosomía Trisomía

18 ANOMALÍAS CROMOSÓMICAS (cromosomas sexuales) 46, XX 46, XY 45, X 47, XXY normal normal Síndrome de Turner Síndrome de Klinefelter

19 mujer X Y hombre FISH: hibridación in situ con sondas fluorescentes de ADN Qué se puede analizar en las células extraídas de los embriones?. Alteraciones cromosómicas (monosomías, trisomías, triploidías). Enfermedades de base molecular conocida y analizable por PCR

20 DNA PCR Fibrosis quística La fibrosis quística (abreviatura FQ), también conocida como mucoviscidosis es una enfermedad hereditaria frecuente que afecta al organismo en forma generalizada, causando discapacidad progresiva y muerte prematura.

21 La dificultad para respirar, como consecuencia de infecciones pulmonares crónicas, es el síntoma más común. La FQ es un trastorno multisistémico que causa la formación y acumulación de un moco espeso y pegajoso, afectando fundamentalmente pulmones, intestinos, páncreas e hígado. Aproximadamente, una de cada 25 personas de ascendencia europea es portadora asintomática de un gen para FQ, siendo la enfermedad genética más frecuente entre esta población. ó (Enfermedad autosómica recesiva)

22 TAGTATCCTTTGTGGTTTCTACTAT ATCATAGGAAACACCAAAGATGATA.. pérdida de tres bases TAGTATCCTTTGTGGTTACTAT ATCATAGGAAACACCAATGATA.. pérdida de un aminoácido? DGP

23 Se extrae una célula de varios embriones, para analizar afectado (o no compatible) no afectado (o compatible) no afectado afectado afectado afectado Se utilizan sólo los embriones no afectados EL PAÍS Art. 1.b) Regular la aplicación de las técnicas de reproducción humana asistida en la prevención y tratamiento de enfermedades de origen genético, siempre que existan las garantías diagnósticas y terapéuticas suficientes y sean debidamente autorizadas en los términos previstos en esta Ley.

24 Qué enfermedad ha podido curar Javier? β-talasemia (mayor) La talasemia mayor es la forma más severa de anemia y es una forma hereditaria de la anemia hemolítica, caracterizada por anomalías en la producción de los glóbulos rojos sanguíneos (hemoglobina). La disminución del oxígeno en el organismo se manifiesta desde los 6 meses de edad y si no se le da tratamiento generalmente produce la muerte en unos pocos años. Aquí se pueden observar los glóbulos rojos sanguíneos de forma anormal, pálidos (hipocrómicos) y pequeños asociados con esta enfermedad. Las células más oscuras probablemente representan los glóbulos rojos normales de una transfusión de sangre. Qué enfermedad ha podido curar Javier? β-talasemia mayor

CIENCIA Y VIDA COTIDIANA

CIENCIA Y VIDA COTIDIANA CIENCIA Y VIDA COTIDIANA La clonación, el ADN y cosas de la genética Santiago Torres Martínez Departamento Genética y Microbiología Universidad de Murcia Murcia 25 febrero y 3 marzo, 2008 . Genética. Gen.

Más detalles

CIENCIA Y VIDA COTIDIANA

CIENCIA Y VIDA COTIDIANA CIENCIA Y VIDA COTIDIANA La clonación, el ADN y otras cosas Genética para andar por casa. Segunda parte Murcia, 21 noviembre de 2011 . Genética. Gen. ADN. Información genética. Cromosomas. Genética forense.

Más detalles

Tipos de células madre

Tipos de células madre Biología Bachillerato IES Fuentesnuevas 1 CÉLULAS MADRE O TRONCALES (STEM CELLS) Las células madre son células que tienen capacidad de renovarse continuamente por sucesivas divisiones por mitosis y de

Más detalles

RETRASANDO EL RELOJ CELULAR DE LAS CELULAS MADRE INDUCIDAS (IPS)

RETRASANDO EL RELOJ CELULAR DE LAS CELULAS MADRE INDUCIDAS (IPS) RETRASANDO EL RELOJ CELULAR DE LAS CELULAS MADRE INDUCIDAS (IPS) Madrid, 6 de febrero de 2009. La prestigiosa revista Cell Stem Cell publica hoy en su edición digital un trabajo del grupo de Telómeros

Más detalles

Evolución de la donación de órganos en España. Europa: 19,2 EEUU: 25,8

Evolución de la donación de órganos en España. Europa: 19,2 EEUU: 25,8 Evolución de la donación de órganos en España Europa: 19,2 EEUU: 25,8 REQUISITOS PARA EL TRASPLANTE Muerte encefálica Criterios médicos distribución Equipo médico independiente del trasplante Donación

Más detalles

UNIDAD 7 LA DIGNIDAD DE LA VIDA

UNIDAD 7 LA DIGNIDAD DE LA VIDA UNIDAD 7 LA DIGNIDAD DE LA VIDA A) EL EMBRIÓN: fecundación Espermatozoides llegando al ovocito Concepción La carrera por la vida... "Desde el momento mismo de la fecundación, desde el instante en que a

Más detalles

Definición: cariotipo y características

Definición: cariotipo y características Prof. Oswaldo Javier Loreto Marzo 2014 Definición: cariotipo y características El cariotipo es el ordenamiento de los cromosomas de una célula metafásica de acuerdo a su morfología, tales como el tamaño,

Más detalles

DIAGNÓSTICO GENÉTICO DE PREIMPLANTACIÓN (PGD)

DIAGNÓSTICO GENÉTICO DE PREIMPLANTACIÓN (PGD) DIAGNÓSTICO GENÉTICO DE PREIMPLANTACIÓN (PGD) Las alteraciones genéticas son una importante causa de esterilidad e infertilidad y pueden ser responsables de algunos defectos congénitos. Estas alteraciones

Más detalles

Proyecto GENOMA HUMANO

Proyecto GENOMA HUMANO CÉLULAS MADRE Proyecto GENOMA HUMANO PROYECTO GENOMA HUMANO PROYECTO GENOMA HUMANO TIPOS DE ADN EN EL GENOMA HUMANO Intrones, promotores y regiones reguladoras (40 %) DNA intergénico con funciones desconocidas(68,3

Más detalles

Una prueba genética fetal sin riesgos, ni para ti ni para tu bebé

Una prueba genética fetal sin riesgos, ni para ti ni para tu bebé OBSTETRICIA TEST EN SANGRE MATERNA PARA DETECTAR SÍNDROME DE DOWN Una prueba genética fetal sin riesgos, ni para ti ni para tu bebé Salud de la mujer Dexeus ATENCIÓN INTEGRAL EN OBSTETRICIA, GINECOLOGÍA

Más detalles

Detección prenatal no invasiva para embarazos de alto riesgo

Detección prenatal no invasiva para embarazos de alto riesgo Detección prenatal no invasiva para embarazos de alto riesgo Información para su tranquilidad. Su embarazo debe ser un acontecimiento para disfrutar. Sin embargo, si su médico ha determinado algún riesgo

Más detalles

Qué es una célula troncal?

Qué es una célula troncal? Introducción -La célula es la unidad básica y funcional de todos los organismos vivos. -El cuerpo humano está formado por millones de células. -Las células tienen formas específicas y diferentes funciones.

Más detalles

Test de Cribado Prenatal No Invasivo en sangre materna

Test de Cribado Prenatal No Invasivo en sangre materna Test de Cribado Prenatal No Invasivo en sangre materna Detecta las trisomías fetales de los cromosomas 21, 13 y 18 Detecta síndromes de microdeleción Informa del sexo fetal y de las aneuploidías de cromosomas

Más detalles

Stem Cells Células Madre HÉCTOR R. PÉREZ, MS, DVM, LAP

Stem Cells Células Madre HÉCTOR R. PÉREZ, MS, DVM, LAP Stem Cells Células Madre HÉCTOR R. PÉREZ, MS, DVM, LAP Qué son Células Madre? Células Madre son células primitivas con un potencial y habilidad infinita para renovación Y diferenciación a otro tipo de

Más detalles

Test de Cribado Prenatal No Invasivo en sangre materna

Test de Cribado Prenatal No Invasivo en sangre materna Test de Cribado Prenatal No Invasivo en sangre materna Software de resultados BGI con marcado CE para la trisomía 21 Detecta las trisomías fetales de los cromosomas 21, 13 y 18 Informa de 3 síndromes de

Más detalles

regenerativa Medicina Especial Preguntas frecuentes Número 7 Tipos de células madre Preguntas Frecuentes Glosario

regenerativa Medicina Especial Preguntas frecuentes Número 7 Tipos de células madre Preguntas Frecuentes Glosario Medicina regenerativa Número 7 Tipos de células madre Preguntas Frecuentes Glosario Especial Todos hemos oído hablar de la extraordinaria promesa que constituye la investigación con células madre para

Más detalles

El diagnóstico genético preimplantacional (DGP), una oportunidad en cáncer hereditario?

El diagnóstico genético preimplantacional (DGP), una oportunidad en cáncer hereditario? Se han revisado sus beneficios y limitaciones en una jornada de Unidades de Consejo Genético en Cáncer Familiar, organizada por la SEOM con el apoyo del Instituto Roche El diagnóstico genético preimplantacional

Más detalles

En función de la relación existente entre el donante y el receptor se diferencian varios tipos de trasplantes:

En función de la relación existente entre el donante y el receptor se diferencian varios tipos de trasplantes: TEMA 4: AVANCES BIOMÉDICOS 1.- TRASPLANTES DE ÓRGANOS Trasplante o injerto en medicina es un tratamiento médico complejo que consiste en trasladar órganos, tejidos o células de una persona a otra. El órgano

Más detalles

LOS CAMBIOS DEL SISTEMA CARDIOVASCULAR SON LOS RESPONSABLES DEL ENVEJECIMIENTO DR. MIGUEL GARBER

LOS CAMBIOS DEL SISTEMA CARDIOVASCULAR SON LOS RESPONSABLES DEL ENVEJECIMIENTO DR. MIGUEL GARBER LOS CAMBIOS DEL SISTEMA CARDIOVASCULAR SON LOS RESPONSABLES DEL ENVEJECIMIENTO DR. MIGUEL GARBER Vivimos en una sociedad envejecida y con tendencia a estarlo cada vez más. El índice de envejecimiento,

Más detalles

A la vanguardia en la prevención de enfermedades genéticas

A la vanguardia en la prevención de enfermedades genéticas MEDICINA GENÓMICA TEST GENÉTICO DE PORTADORES A la vanguardia en la prevención de enfermedades genéticas Ref. 167/ Abril 2013 Si quieres recibir información más detallada, ponte en contacto con nuestro

Más detalles

Mediante el cariotipado se pueden analizar anomalías numéricas y estructurales, cosa que sería muy difícil de observar mediante genética mendeliana.

Mediante el cariotipado se pueden analizar anomalías numéricas y estructurales, cosa que sería muy difícil de observar mediante genética mendeliana. Cariotipo El cariotipo es el ordenamiento de los cromosomas de una célula metafásica de acuerdo a su tamaño y morfología. El cariotipo es característico de cada especie y, el ser humano tiene 46 cromosomas

Más detalles

Biología y Geología Genética Humana 4º ESO ACTIVIDADES FINALES: GENÉTICA HUMANA

Biología y Geología Genética Humana 4º ESO ACTIVIDADES FINALES: GENÉTICA HUMANA ACTIVIDADES FINALES: GENÉTICA HUMANA 1.- Un varón de ojos azules, cuyos padres tenían ojos oscuros, se casa con una mujer de ojos oscuros, cuyo padre tenía ojos azules. Esta mujer tiene un hermano de ojos

Más detalles

CÉLULA MADRE. Célula que es capaz de. Autorenovarse indefinidamente. Diferenciarse STEM CELL = CÉLULA TRONCAL

CÉLULA MADRE. Célula que es capaz de. Autorenovarse indefinidamente. Diferenciarse STEM CELL = CÉLULA TRONCAL CÉLULA MADRE STEM CELL = CÉLULA TRONCAL Célula que es capaz de Autorenovarse indefinidamente Diferenciarse La diferenciación debe de producirse a tipos de células especializadas, tanto desde el punto de

Más detalles

Por: Pablo Fonseca Licenciado en Química y Biotecnología. Bioterio, Hospital Posadas.

Por: Pablo Fonseca Licenciado en Química y Biotecnología. Bioterio, Hospital Posadas. CELULAS MADRES Por: Pablo Fonseca Licenciado en Química y Biotecnología. Bioterio, Hospital Posadas. Son células que tienen la capacidad de diferenciarse y originar células de la sangre y del sistema inmunológico

Más detalles

CÉLULAS MADRE ASUNCION CATALINA G.VALADÉS/DPTO.CCNN/C.NUESTRA SRA DEL CARMEN/MÓSTOLES/BG 4º

CÉLULAS MADRE ASUNCION CATALINA G.VALADÉS/DPTO.CCNN/C.NUESTRA SRA DEL CARMEN/MÓSTOLES/BG 4º CÉLULAS MADRE 1 1 Términos como: célula madre, fecundación in vitro, cordón umbilical, terapia celular, biotecnología, manipulación genética, clonación, aparecen cada vez más en nuestra vida cotidiana.

Más detalles

Paralelismo entre cromosomas y la teoria de Mendel

Paralelismo entre cromosomas y la teoria de Mendel Paralelismo entre cromosomas y la teoria de Mendel Cromosomas sexuales Autosomas Herencia ligada al sexo Cromosomas heteromorfos Nettie Stevens, 1909 Estudios en Drosophila, mosca del vinagre Thomas Hunt

Más detalles

MARCO GARNIQUE MONCADA Máster en Reproducción Humana Ginecólogo del Servicio de Medicina Reproductiva del INMP Ginecólogo de CREA, Centro de

MARCO GARNIQUE MONCADA Máster en Reproducción Humana Ginecólogo del Servicio de Medicina Reproductiva del INMP Ginecólogo de CREA, Centro de MARCO GARNIQUE MONCADA Máster en Reproducción Humana Ginecólogo del Servicio de Medicina Reproductiva del INMP Ginecólogo de CREA, Centro de Reproducción Asistida TRAS LA UNIÓN DE LOS GAMETOS EN ESTADÍO

Más detalles

LEY 14/2006 del 26 de mayo, sobre TÉCNICAS DE REPRODUCCIÓN ASISTIDA

LEY 14/2006 del 26 de mayo, sobre TÉCNICAS DE REPRODUCCIÓN ASISTIDA Fecha: 13 de Abril de 2011 Nombre: Dra. Ana Cardo Maza R3 Tipo de Sesión: Seminario LEY 14/2006 del 26 de mayo, sobre TÉCNICAS DE REPRODUCCIÓN ASISTIDA CAPÍTULO 1- DISPOSICIONES GENERALES Objeto de la

Más detalles

ENFERMEDADES GENÉTICAS

ENFERMEDADES GENÉTICAS ENFERMEDADES GENÉTICAS Inicio INDICE 1 Que es una enfermedad genética? 1.1Enfermedades cromosómicas 1.2Enfermedades monogenicas 2. como se heredan? 2.1 Herencia dominante 2.2 Herencia recesiva 2.3 Herencia

Más detalles

Gracias por donar. Por eso, con esta donación (glóbulos rojos, plasma y plaquetas) estás salvando la vida de tres personas. Centro de Transfusión

Gracias por donar. Por eso, con esta donación (glóbulos rojos, plasma y plaquetas) estás salvando la vida de tres personas. Centro de Transfusión Gracias por donar En la Comunidad Valenciana cada día hacen falta 700 donaciones, y no siempre las obtenemos. Hoy el Centro de Transfusión puede recoger tú donación: una unidad de sangre de 450 ml. aproximadamente.

Más detalles

Charla "Biotecnología y salud en el 2020"

Charla Biotecnología y salud en el 2020 Charla "Biotecnología y salud en el 2020" Dra. Mariela Bollati Post-doctorado, Experimental Immunology Group, Helmholtz Centre for Infectious Diseases, Alemania. Jefa de la Unidad de Biología Celular,

Más detalles

Una empresa valenciana implanta una técnica para analizar el ADN del esperma

Una empresa valenciana implanta una técnica para analizar el ADN del esperma 26/03/2013 Una empresa valenciana implanta una técnica para analizar el ADN del esperma Valencia, 26 mar (EFE).- La empresa valenciana Sistemas Genómicos ha implantado una técnica de análisis que utiliza

Más detalles

Unidad 7. Ficha de trabajo I

Unidad 7. Ficha de trabajo I Unidad 7. Ficha de trabajo I Nombre y apellidos:. EL CICLO MENSTRUAL Observa la gráfica y contesta a las siguientes preguntas: Concentración de las hormonas 15 10 5 0 Estrógenos. 1 Progesterona. 2 Día

Más detalles

CUESTIONARIO ANALÍTICO DE BIOÉTICA

CUESTIONARIO ANALÍTICO DE BIOÉTICA CUESTIONARIO ANALÍTICO DE BIOÉTICA Preguntas breves de memoria y reflexión en base al libro de Ramón Lucas Lucas, Bioética para todos, Editorial Trillas, México 2008 3 (La respuesta se refiere al número

Más detalles

clonación humana Monografías de Comunicación Científica Museos Científicos Coruñeses Una informació n elaborada por

clonación humana Monografías de Comunicación Científica Museos Científicos Coruñeses Una informació n elaborada por Una informació n elaborada por Museos Científicos Coruñeses Monografías de Comunicación Científica 04 Edición realizada con el patrocinio de clonación humana El 13 de febrero de 2004 todos los medios de

Más detalles

SALVAVIDAS. Todas e todos somos vida ita,tania,antia,martin,pablo, Sergio,Cristian Ferro,ESA ¾

SALVAVIDAS. Todas e todos somos vida ita,tania,antia,martin,pablo, Sergio,Cristian Ferro,ESA ¾ SALVAVIDAS. Todas e todos somos vida ita,tania,antia,martin,pablo, Sergio,Cristian Ferro,ESA ¾ Trasplante de córnea: mirar con otros ojos El primer trasplante de córnea se realizó en 1940 en la Clínica

Más detalles

Programa de Detección Prenatal de Anomalías Cromosómicas. Memoria 2013

Programa de Detección Prenatal de Anomalías Cromosómicas. Memoria 2013 MEMORIA 2013 1 1- CONTEXTO DEMOGRÁFICO Descenso mantenido del número de partos La situación demográfica de nuestra Comunidad pone de manifiesto un descenso mantenido de la natalidad, que se traduce en

Más detalles

La MEDICINA del SIGLO XXI

La MEDICINA del SIGLO XXI La MEDICINA del SIGLO XXI Ginés Morata Pérez Ex-Director del Centro de Biología Molecular del CSIC Carlos Martínez-A. Jefe del Departamento de Inmunología y Oncología del Centro Nacional de Biotecnología

Más detalles

Se hereda el cáncer de mama?

Se hereda el cáncer de mama? Se hereda el cáncer de mama? Cáncer de mama y herencia El cáncer de mama consiste en el crecimiento descontrolado de células malignas en el tejido mamario. Existen dos tipos principales del tumor, el carcinoma

Más detalles

PATIENT EDUCATI The American College of Obstetricians and Gynecologists

PATIENT EDUCATI The American College of Obstetricians and Gynecologists PATIENT EDUCATI N The American College of Obstetricians and Gynecologists WOMEN S HEALTH CARE PHYSICIANS El Embarazo SP094 Los trastornos genéticos La mayoría de los niños en Estados Unidos nacen saludables.

Más detalles

DE LA FECUNDACIÓ IN VITRO A LES CÈL LULES MARE

DE LA FECUNDACIÓ IN VITRO A LES CÈL LULES MARE DE LA FECUNDACIÓ IN VITRO A LES CÈL LULES MARE Anna Veiga Servei de Medicina de la Reproducció - Institut Universitari Dexeus Centre de Medicina Regenerativa de Barcelona Barcelona HISTORIA 1878 Primeros

Más detalles

ASOCIACION ARGENTINA DE FIBROSIS QUISTICA

ASOCIACION ARGENTINA DE FIBROSIS QUISTICA ASOCIACION ARGENTINA DE FIBROSIS QUISTICA 1962 Primeros Padres forman un grupo 1977 Se obtiene la Personeria Juridica 2015 Seguimos luchando por UN DIAGNOSTICO PRECOZ, UN TRATAMIENTO ADECUADO Y LA MEJOR

Más detalles

Formación de una nueva vida:concepción,herencia y ambiente. Janette Orengo Puig,Ed.D.

Formación de una nueva vida:concepción,herencia y ambiente. Janette Orengo Puig,Ed.D. Formación de una nueva vida:concepción,herencia y ambiente Janette Orengo Puig,Ed.D. Cambios en la teoría de concepción Concepción- (fertilización)-es el proceso por medio del cual el espermatozoide y

Más detalles

Montserrat Milà Sección Genética Molecular Hospital Clínic de barcelona

Montserrat Milà Sección Genética Molecular Hospital Clínic de barcelona Montserrat Milà Sección Genética Molecular Hospital Clínic de barcelona Diagnóstico Genético Diagnóstico de una enfermedad causada por una alteración en el material genético Constitucional: afecta a todas

Más detalles

La nueva generación de Diagnóstico Prenatal No Invasivo. De m o dл lí н nó co P atal

La nueva generación de Diagnóstico Prenatal No Invasivo. De m o dл lí н nó co P atal La nueva generación de Diagnóstico Prenatal No Invasivo De m o dл lí н nó co P atal LABCO siempre contigo Cerca del 1% de los fetos presentan algún tipo de anomalía cromosómica. El diagnóstico prenatal

Más detalles

Claus per a comprendre la genètica

Claus per a comprendre la genètica Curs: 2011-2012 Diploma Sènior de la UOM. Primer curs. Obligatòria. Claus per a comprendre la genètica Tema 8: Clonació i cel.lules mare Dr. José Aurelio Castro Ocón Universitat de les Illes Balears La

Más detalles

SIGNOS DE ALARMA DURANTE EL EMBARAZO

SIGNOS DE ALARMA DURANTE EL EMBARAZO SIGNOS DE ALARMA DURANTE EL EMBARAZO MG. María Tello D., RN. Universidad Católica Santo Toribio de Mogrovejo CHICLAYO-PERÚ SIGNOS DE ALARMA DURANTE EL EMBARAZO Si bien la mayoría a de los embarazos y partos

Más detalles

DESCRIPCIÓN GENERAL DE LAS ANOMALÍAS CROMOSÓMICAS

DESCRIPCIÓN GENERAL DE LAS ANOMALÍAS CROMOSÓMICAS ANOMALÍAS CROMOSÓMICAS INTRODUCCION Cualquier alteración en el número y/o en la morfología de los cromosomas constituye una alteración cromosómica. Cuando existen uno o más juegos de cromosomas completos,

Más detalles

CAP ITULO XII HERENCIA

CAP ITULO XII HERENCIA CAP ITULO XII HERENCIA Algunas enfermedades son genéticas en origen y por lo tanto son transmitidas en familias. La mayoría de las enfermedades de inmunodeficiencia son heredades en alguno de los dos diferentes

Más detalles

Su utilidad terapéutica. Interés en el ámbito familiar

Su utilidad terapéutica. Interés en el ámbito familiar Su utilidad terapéutica Interés en el ámbito familiar Noticias sobre células madre Una sola célula madre puede regenerar el tejido muscular. Diario Médico. Nueva York. 19/09/2008 Novussanguis o el prometedor

Más detalles

Anomalías Cromosómicas

Anomalías Cromosómicas 12 Unique Grupo de apoyo para enfermedades cromosómicas raras del Reino Unido Teléfono: + 44 (0) 1883 330766 Email: info@rarechromo.org www.rarechromo.org Anomalías Cromosómicas Orphanet Información gratuita

Más detalles

SequentialScreen SM. Información de antemano y altas tasas de detección de anomalías congénitas

SequentialScreen SM. Información de antemano y altas tasas de detección de anomalías congénitas SequentialScreen SM Información de antemano y altas tasas de detección de anomalías congénitas SequentialScreen Cuando una mujer se entera de que está embarazada, debe tomar muchas decisiones. Es importante

Más detalles

CAPÍTULO VIII EL SÍNDROME HIPER IgM LIGADO AL X

CAPÍTULO VIII EL SÍNDROME HIPER IgM LIGADO AL X CAPÍTULO VIII EL SÍNDROME HIPER IgM LIGADO AL X Los pacientes con el Síndrome Hiper IgM ligado al x tienen deficiencia de una proteína, Ligando CD40, que se encuentra en la superficie de los linfocitos

Más detalles

Enfermedades asociadas a mutaciones estructurales

Enfermedades asociadas a mutaciones estructurales Enfermedades asociadas a mutaciones estructurales El cariotipo humano A partir de un cultivo de sangre periférica, y posterior tratamiento con Giemsa para obtener un bandeo G, puede obtenerse el cariotipo

Más detalles

REPRODUCCIÓN CELULAR (Tema 14)

REPRODUCCIÓN CELULAR (Tema 14) REPRODUCCIÓN CELULAR (Tema 14) 1) Cuándo se dice que una célula es haploide? y diploide? Qué células del cuerpo humano son diploides? y, cuáles haploides? 2) Diferencias entre cromosomas homólogos y cromátidas

Más detalles

Anomalías Cromosómicas

Anomalías Cromosómicas 12 Teléfono: + 44 (0) 1883 330766 Email: info@rarechromo.org www.rarechromo.org Anomalías Cromosómicas Orphanet Información gratuita sobre enfermedades raras, ensayos clínicos, medicamentos y enlaces a

Más detalles

Medicina Perinatal: riesgo, pérdida reproductiva

Medicina Perinatal: riesgo, pérdida reproductiva www.cerpo.cl Medicina Perinatal: riesgo, pérdida reproductiva CERPO Centro de Referencia Perinatal Oriente Servicio y Departamento de Obstetricia y Ginecología Hospital Santiago Oriente Dr. Luis Tisné

Más detalles

EL CUERPO HUMANO (Anatomía, fisiología, higiene y salud para maestros)

EL CUERPO HUMANO (Anatomía, fisiología, higiene y salud para maestros) Departamento de Biología Ambiental y Salud Pública EL CUERPO HUMANO (Anatomía, fisiología, higiene y salud para maestros) Acabo de nacer: Qué haya suerte! Todo se lo debo a mis padres: fecundación y formación

Más detalles

1. Cuáles son las diferencias en los componentes químicos del ADN y ARN?

1. Cuáles son las diferencias en los componentes químicos del ADN y ARN? ACTIVIDADES TEMA 4 - BIOTECNOLOGÍA 1. Cuáles son las diferencias en los componentes químicos del ADN y ARN? Las cadenas de ADN están formadas por fosfato y desoxirribosa y la del ARN por fosfato y ribosa.

Más detalles

Las células madre o progenitoras

Las células madre o progenitoras Capítulo 35 Las células madre o progenitoras Dra. M.ª Teresa Pérez de Prada Bióloga especialista en Biotecnología. Unidad de Investigación Cardiovascular del Instituto Cardiovascular del Hospital Clínico

Más detalles

LEGISLACIÓN CONSOLIDADA. TEXTO CONSOLIDADO Última modificación: 15 de diciembre de 2014

LEGISLACIÓN CONSOLIDADA. TEXTO CONSOLIDADO Última modificación: 15 de diciembre de 2014 Ley 7/2003, de 20 de octubre, por la que se regula la investigación en Andalucía con preembriones humanos no viables para la fecundación in vitro. Comunidad Autónoma de Andalucía «BOJA» núm. 210, de 31

Más detalles

DGP: Para tus hijos, evita riesgos

DGP: Para tus hijos, evita riesgos DGP: Para tus hijos, evita riesgos Ahora, con el Diagnóstico Genético Preimplantacional (DGP) podrás evitar los riesgos genéticos en tu descendencia. Salud de la mujer Dexeus Salud de la mujer Dexeus DEPARTAMENTO

Más detalles

con número de expediente MIDTF/2011/212

con número de expediente MIDTF/2011/212 La investigación biomédica es una actividad necesaria para el éxito de cualquier estrategia que se proponga mejorar la salud de los ciudadanos. En este sentido, IVI VALENCIA, S.L. apuesta fuertemente por

Más detalles

Tratamiento con Hidroxiurea contra la Enfermedad de Células Falciformes

Tratamiento con Hidroxiurea contra la Enfermedad de Células Falciformes Tratamiento con Hidroxiurea contra la Enfermedad de Células Falciformes antes de hidroxiurea después de hidroxiurea Tratamiento con Hidroxiurea contra la Enfermedad de Células Falciformes 1 Este documento

Más detalles

2 Inmunopatologías Concepto Tipos Autoinmunidad Modalidades de respuesta autoinmune. Principales enfermedades autoinmunes. Hipersensibilidad.

2 Inmunopatologías Concepto Tipos Autoinmunidad Modalidades de respuesta autoinmune. Principales enfermedades autoinmunes. Hipersensibilidad. 1 TEMA 25 INMUNOPATOLOGÍA 2 Inmunopatologías Concepto Tipos Autoinmunidad Modalidades de respuesta autoinmune. Principales enfermedades autoinmunes. Hipersensibilidad. Alergias. Inmunodeficiencia. SIDA.

Más detalles

Beneficios de la Ozonoterapia en la Diabetes Mellitus

Beneficios de la Ozonoterapia en la Diabetes Mellitus Beneficios de la Ozonoterapia en la Diabetes Mellitus Mundialmente afecta a más de 382 millones de personas, la Organización Mundial de la Salud estima que para el año 2030 el número de personas diagnosticadas

Más detalles

La importancia de la sangre

La importancia de la sangre La importancia de la sangre La sangre es un fluido vital, transporta nutrientes esenciales y oxígeno a todos los tejidos y órganos del cuerpo Cerca del 45% del volumen total de la sangre está compuesta

Más detalles

Terapia celular: presente y futuro, realidades y falsedades

Terapia celular: presente y futuro, realidades y falsedades Terapia celular: presente y futuro, realidades y falsedades Gregorio Garrido Jefe de Servicio Área Médica Organización Nacional de Trasplantes Oviedo 1 de Abril de 2011 El mito de Prometeo TERAPIA CELULAR

Más detalles

SerumIntegratedScreen SM

SerumIntegratedScreen SM SerumIntegratedScreen SM Ofrece la tasa más alta de detección de anomalías congénitas sin ultrasonografía SerumIntegratedScreen Cuando una mujer se entera de que está embarazada, debe tomar muchas decisiones.

Más detalles

Got es de color negro y es idéntico que su padre que se llamaba Vasito. El segundo toro clonado del proyecto llamado Glass nació muerto.

Got es de color negro y es idéntico que su padre que se llamaba Vasito. El segundo toro clonado del proyecto llamado Glass nació muerto. Noticia: Got, el primer toro bravo clonado Nace en Palencia Científicos españoles han clonado con éxito a un semental de la ganadería de toros de lidia de Alfonso Guardiola. Ya está aquí el primer animal

Más detalles

LEGISLACIÓN EN MÉXICO. Dr. Angel Guerra Márquez

LEGISLACIÓN EN MÉXICO. Dr. Angel Guerra Márquez LEGISLACIÓN EN MÉXICO Dr. Angel Guerra Márquez Antecedentes Regulación Leyes, reglamentos, normas Obligatorio Acreditación Criterios Opcional Antecedentes Células troncales Tipo celular primitivo e indiferenciado,

Más detalles

Herencia Ligada al Cromosoma X

Herencia Ligada al Cromosoma X 12 Su clínica local: www.aegh.org/docs/encuesta-aegh-2005-centros-y-personasde-contacto.pdf Herencia Ligada al Cromosoma X www.aegh.org/docs/encue sta-aegh-2005-servicios-degenetica-clinica.pdf Elaborado

Más detalles

Métodos de Reproducción Asistida más Usados

Métodos de Reproducción Asistida más Usados Métodos de Reproducción Asistida más Usados Entendemos por métodos de reproducción asistida, al conjunto de técnicas médicas, que tienen la finalidad de facilitar o substituir, los procesos naturales que

Más detalles

Actualizaciones. Eritropoyetina

Actualizaciones. Eritropoyetina Actualizaciones Eritropoyetina Acciones de la eritropoyetina. La eritropoyetina es una glicoproteína plasmática que estimula la eritropoyesis y actúa además sobre otras células de la sangre como los granulocitos,

Más detalles

LEGISLACIÓN CONSOLIDADA. TEXTO CONSOLIDADO Última modificación: 15 de diciembre de 2014

LEGISLACIÓN CONSOLIDADA. TEXTO CONSOLIDADO Última modificación: 15 de diciembre de 2014 Ley 1/2007, de 16 de marzo, por la que se regula la investigación en reprogramación celular con finalidad exclusivamente terapéutica. Comunidad Autónoma de Andalucía «BOJA» núm. 63, de 29 de marzo de 2007

Más detalles

Glosario: embarazo. Se diagnostica con la medición de la presión arterial y un examen de orina en los controles del embarazo.

Glosario: embarazo. Se diagnostica con la medición de la presión arterial y un examen de orina en los controles del embarazo. Glosario: Espermatozoides: son las semillas que se producen en los testículos del hombre y que se liberan con el semen o esperma. Contienen las características que transmite el padre a su hijo o hija y

Más detalles

Módulo 10 Unidad Temática 10

Módulo 10 Unidad Temática 10 Universidad Nacional del Nordeste Facultad de Medicina Especialización en Bacteriología Clínica Módulo 10 Unidad Temática 10 Fibrosis quística Neumonías atípicas Fibrosis Quística Originalmente se denomina

Más detalles

A diferencia de los hombres que producen espermatozoides

A diferencia de los hombres que producen espermatozoides Al igual que el resto de nuestro cuerpo, los ovarios también sufren el paso de los años. Es importante informarse sobre la calidad y la reserva ovocitaria, esto nos permite tener conocimiento acerca de

Más detalles

FirstScreen. Información de antemano acerca de su embarazo

FirstScreen. Información de antemano acerca de su embarazo FirstScreen Información de antemano acerca de su embarazo FirstScreen Cuando una mujer se entera de que está embarazada, debe tomar muchas decisiones. Es importante que decida si se realizará o no una

Más detalles

SANAR, REPONER O REGENERAR?

SANAR, REPONER O REGENERAR? SANAR, REPONER O REGENERAR? DR. JOSÉ VICENTE CASTELL DIRECTOR DE LA FUNDACIÓN PARA LA INVESTIGACIÓN LA FE Gran parte del amplio elenco de las enfermedades que afectan hoy día al ser humano, tienen su origen

Más detalles

Cuáles son las características únicas de todas las células madre?

Cuáles son las características únicas de todas las células madre? Células Madre Conceptos fundamentales I. Introducción y alcance de este documento II. III. Cuáles son las características únicas de todas las células madre? Cuáles son células madre embrionarias? IV. Cuáles

Más detalles

MINISTERIO DE SANIDAD SERVICIOS SOCIALES E IGUALDAD. Qué es la sangre del cordón umbilical y para qué sirve?

MINISTERIO DE SANIDAD SERVICIOS SOCIALES E IGUALDAD. Qué es la sangre del cordón umbilical y para qué sirve? RESPUESTAS A LAS PREGUNTAS MÁS COMUNES SOBRE SANGRE DE CORDÓN UMBILICAL, PLANTEADAS TRAS LA APROBACIÓN DEL REAL DECRETO 1301/2006 SOBRE CALIDAD Y SEGURIDAD DE CÉLULAS Y TEJIDOS. Qué es la sangre del cordón

Más detalles

Herencia Ligada al Cromosoma X

Herencia Ligada al Cromosoma X 12 Herencia Ligada al Cromosoma X Elaborado a partir de folletos originales de Guy s and St Thomas Hospital, Londres y London IDEAS Genetic Knowledge Park. Enero de 2008 Este trabajo se ha realizado bajo

Más detalles

Reprogenética. Aula de la Experiencia

Reprogenética. Aula de la Experiencia Reprogenética Aula de la Experiencia Manipulación de embriones Día 2º: Embrión de dos células Día 3º y 4º: 8 a 16 células totipotentes Inicio de la diferenciación celular Día 5º: Entrada del embrión en

Más detalles

CHRISTIAN OMAR ESTRELLA CANAZA.

CHRISTIAN OMAR ESTRELLA CANAZA. CHRISTIAN OMAR ESTRELLA CANAZA. PLANIFICACION DE LOS HIJOS. La planificación familiar permite a las personas tener el número de hijos que desean y determinar el intervalo entre embarazos. Se logra mediante

Más detalles

Unidad 1: Composición, organización y estructura de los ácidos nucleícos, funciones, replicación y transcripción.

Unidad 1: Composición, organización y estructura de los ácidos nucleícos, funciones, replicación y transcripción. FACULTAD CIENCIAS DE LA SALUD DEPARTAMENTO DE CIENCIAS BASICAS MÉDICAS Materia GENÉTICA Programa Semestre MEDICINA - Semestre 3 Número de créditos 3 créditos Periodo 2016-1 Intensidad semanal 4 Horas Profesor

Más detalles

Curs de genètica aplicada a Medicina Fetal

Curs de genètica aplicada a Medicina Fetal Curs de genètica aplicada a Medicina Fetal MA Sánchez Durán Diciembre 2015 Introducción Detección de defectos congénitos Desarrollo Genética 2 7 7 Infecciones Monogénicos 55 25 Cromosómicos Poligénico

Más detalles

CICLO MENSTRUAL RELACIÓN CON LA FECUNDIDAD

CICLO MENSTRUAL RELACIÓN CON LA FECUNDIDAD CICLO MENSTRUAL RELACIÓN CON LA FECUNDIDAD Cuando el ser humano alcanza la pubertad, inicia su capacidad reproductiva. En el caso de la mujer, se produce la maduración de los óvulos y los cambios del aparato

Más detalles

PROGRAMA DE DETECCIÓN PRENATAL DE ANOMALÍAS CROMOSÓMICAS

PROGRAMA DE DETECCIÓN PRENATAL DE ANOMALÍAS CROMOSÓMICAS GUÍA PARA LAS EMBARAZADAS PROGRAMA DE DETECCIÓN PRENATAL DE ANOMALÍAS CROMOSÓMICAS La decisión de realizar las pruebas incluidas en este Programa es una decisión voluntaria y personal, que debe tomar tras

Más detalles

DUDAS RELACIONADAS CON LA DONACIÓN. Todos podemos ser donadores?

DUDAS RELACIONADAS CON LA DONACIÓN. Todos podemos ser donadores? DUDAS RELACIONADAS CON LA DONACIÓN Todos podemos ser donadores? Con fundamento en la Ley General de Salud (LGS) los menores de edad están impedidos para donar en vida, exceptuando el caso de trasplantes

Más detalles

TEMA 4 CMC BIOTECNOLOGÍA

TEMA 4 CMC BIOTECNOLOGÍA Conceptos Tema 4 TEMA 4 CMC BIOTECNOLOGÍA Células eucariotas: Células con núcleo. Núcleo: Un compartimento en el interior de la célula que alberga el material genético. Citoplasma: En una célula eucariota,

Más detalles

LEY 42/1988, de 28 de diciembre, de donación y utilización de embriones y fetos humanos o de sus células, tejidos u órganos.

LEY 42/1988, de 28 de diciembre, de donación y utilización de embriones y fetos humanos o de sus células, tejidos u órganos. LEY 42/1988, de 28 de diciembre, de donación y utilización de embriones y fetos humanos o de sus células, tejidos u órganos. Juan Carlos I, Rey de España A todos los que la presente vieren y entendieren.

Más detalles

MUTACIONES. Son cambios en la información hereditaria como consecuencia de alteraciones en el material genético: ADN, genes, cromosomas, cariotipo,

MUTACIONES. Son cambios en la información hereditaria como consecuencia de alteraciones en el material genético: ADN, genes, cromosomas, cariotipo, MUTACIONES Son cambios en la información hereditaria como consecuencia de alteraciones en el material genético: ADN, genes, cromosomas, cariotipo, Pueden afectar a secuencias génicas o a secuencias reguladoras,

Más detalles

UNIDAD 13: LA REPRODUCCIÓN HUMANA

UNIDAD 13: LA REPRODUCCIÓN HUMANA UNIDAD 13: LA REPRODUCCIÓN HUMANA 1. FECUNDACIÓN Y DESARROLLO EMBRIONARIO En los humanos la fecundación es interna, es decir, ocurre dentro del cuerpo de la mujer después de realizar el acto sexual. Tiene

Más detalles

Radiación y Cáncer. Karel van Wely 23-10 - 2012. -) El cáncer, consecuencia de un problema biológico

Radiación y Cáncer. Karel van Wely 23-10 - 2012. -) El cáncer, consecuencia de un problema biológico Radiación y Cáncer Karel van Wely 23-10 - 2012 -) Una definición del cáncer -) El cáncer, consecuencia de un problema biológico -) el ambiente, donde aparece el cáncer? -) estadios diferentes de la carcinogénesis

Más detalles

LOS RETOS DE LA BIOMEDICINA: ENTRE LA CIENCIA Y LA ÉTICA

LOS RETOS DE LA BIOMEDICINA: ENTRE LA CIENCIA Y LA ÉTICA AULA DE MAYORES Y DE LA EXPERIENCIA F.Córdoba, R.Torronteras, A.Canalejo Departamento de Biología Ambiental y Salud Pública LOS RETOS DE LA BIOMEDICINA: ENTRE LA CIENCIA Y LA ÉTICA Tema 1.4. La transmisión

Más detalles

La ataxia es, en principio, un síntoma, no es una enfermedad específica o un diagnóstico. Ataxia quiere decir torpeza o pérdida de coordinación.

La ataxia es, en principio, un síntoma, no es una enfermedad específica o un diagnóstico. Ataxia quiere decir torpeza o pérdida de coordinación. DEFINICIÓN: La ataxia es, en principio, un síntoma, no es una enfermedad específica o un diagnóstico. Ataxia quiere decir torpeza o pérdida de coordinación. La ataxia puede afectar a los dedos, manos,

Más detalles

Qué es un Análisis Genético?

Qué es un Análisis Genético? 12 Qué es un Análisis Genético? Elaborado a partir de folletos originales de Guy s and St Thomas Hospital, London. Enero de 2008 Este trabajo se ha realizado bajo el auspicio de EuroGentest, Contrato Nº

Más detalles

Genética de las Neurofibromatosis

Genética de las Neurofibromatosis Genética de las Neurofibromatosis Cuaderno núm. 3 El texto de este cuaderno, ha sido cedido por The Neurofibromatosis Association (UK) y traducido por la Asociación Catalana de las Neurofibromatosis (Barcelona

Más detalles