DIAGNÓSTICO PRENATAL

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamaño: px
Comenzar la demostración a partir de la página:

Download "DIAGNÓSTICO PRENATAL"

Transcripción

1 DIAGNÓSTICO PRENATAL Dr. Justo Alonso Profesor Titular CLÍNICA GINECOTOCOLÓGICA C FACULTAD de MEDICINA DE MONTEVIDEO Universidad de la República Oriental del Uruguay

2 CONTROL DE EMBARAZO SALUD MATERNA SALUD FETAL DIAGNOSTICO PRENATAL

3 DIAGNOSTICO PRENATAL * DEFECTOS CONGENITOS * BIENESTAR FETAL

4 POSIBILIDAD DE DIAGNOSTICO PRENATAL DE LOS DEFECTOS CONGENITOS D

5 URUGUAY - TASA DE MORTALIDAD INFANTIL TASA MORTALIDAD INFANTIL MORTALIDAD INFANTIL ATRIBUIBLE A DEFECTOS CONGÉNITOS

6 Tasa de Defectos Congénitos Frecuentes Centro Hospitalario Pereira Rossell DTN Cardiopatías congénitas Síndrome Down Pie Bot Labio leporino Hipospadias y genitales ambiguos Digestivas Nefrológicas Gastroquisis /Onfalocele Hernia diafragmática Fuente: ECLAMC CASOS POR N.V.

7 TIPO DE DEFECTO INCIDENCIA POSIBILIDAD de por mil DIAGNOSTICO Alteraciones cromosómicas % Defectos del tubo neural 1-3 > 99 % Dismorfias en general 8-12 > 95 % Errores congénitos del metabolismo 1-3 < 30 % Hemoglobinopatías %

8 DIAGNOSTICO PRENATAL Métodos NO INVASIVOS - control clínico - ecografía - bioquímicos Métodos INVASIVOS - biopsia vellositaria - amniocentesis - cordocentesis

9 DIAGNOSTICO PRENATAL Clínico SCREENING Ecografico Bioquímico CONFIRMACIÓN Métodos invasivos Ecografía especializada Doppler RNM

10 ALTO RIESGO DE DEFECTOS CONGENITOS Edad materna avanzada Antecedentes obstétricos Enfermedad materna o paterna Antecedentes familiares Teratógenos RCIU Polihidramnios

11

12

13 SCREENING ECOGRAFICO MARCADORES de CROMOSOMOPATIAS DETECCION de DEFECTOS CONTROL de CRECIMIENTO VOLUMEN de LIQUIDO AMNIOTICO EMBARAZO MULTIPLE

14 MARCADORES ECOGRAFICOS DE DEFECTOS CONGENITOS TRANSLUCENCIA NUCAL OLIGOAMNIOS POLIHIDRAMNIOS VEJIGA ESTOMAGO RIÑONES HUESOS COLUMNA

15 MARCADORES ECOGRAFICOS DE CROMOSOMOPATIAS HUESO NASAL ALTERACIONES de MANOS y PIES HIPERECOGENICIDAD INTESTINAL CARDIOPATIAS PLIEGUE de NUCA OLIGOAMNIOS

16 MARCADORES ECOGRAFICOS DE CROMOSOMOPATIAS ARTERIA UMBILICAL UNICA HIPER o HIPOTELORISMO RETROGNATISMO CORTEDAD de HUESOS RCIU

17

18

19

20

21

22

23

24

25

26 VALORES DE AFP EN SM POR CADA SEMANA DE GESTACION EDAD GESTACIONAL (SEMANAS) MAS 2DE X MENOS2DE

27

28

29

30 SCREENING BIOQUIMICO ALFA-FETO PROTEINA Hcg beta ESTRIOL PAPPA

31 Screening bioquímico/ecográfico de alteraciones cromosómicas Translucencia nucal HCG beta PAPP - A

32 TECNICAS de OBTENCION de MUESTRAS FETALES Alvarez - Biopsia placentaria Saling - Cuero cabelludo Kazy - Biopsia vellositaria Valenti - Aspiración placenta Hobbins - Fetoscopía Bang - Punción cardíaca Daffos - Cordocentesis

33

34

35

36

37

38

39 CORDOCENTESIS riesgo 1% posibilidad de contaminación volemia fetal activación de sistema de coagulación OBTIENE SANGRE FETAL

40 METODOS INVASIVOS METODO EDAD RIESGO TIEMPO B.VELLOSITARIA 12 1/200 3 DIAS AMNIOCENTESIS 15 1/300 2 SEMANAS CORDOCENTESIS /100 1 DIA

41

42

43 TECNICAS GENETICAS ESPECIALES DIAGNOSTICO PREIMPLANTATORIO PINTADO CROMOSOMICO SONDAS DE ADN OBTENCION de CELULAS FETALES DE SANGRE MATERNA ADN FETAL LIBRE EN SANGRE MATERNA

44

45 Mojones en Diagnóstico Prenatal Linfocitos Fetales detectados en sangre materna Walknowska, J. et al. (1969) Lancet 1, ADN Fetal en Suero o Plasma Maternos Lo, Y.M. et al. (1997) Lancet 350(9076), Sangrado fetal a la circulación materna Chown, J. et al. (1954) Lancet Lancet. Jun 12;266(6824): Secuencias de DNA Fetal existen en sangre materna Simpson, J.L. & Elias, M.D. (1993) JAMA. 270: Diagnóstico No Invasivo de Aneuploidías Fetales por Secuenciación Masiva de ADN Fetal en sangre materna- Fan HC et al. (2008) PNAS

46 Prevalencia Prenatal de Anomalías Cromosómicas Porcentaje de Anomalías Cromosómicas 5% 5% 8% 16% 13% 53% 4 TRISOMÍAS FETALES MAYORES T21 T18 T13 45,X Sex trisomy Other rare Adaptado de: Wellesley, D, et al., Rare chromosome abnormalities, prevalence and prenatal diagnosis rates from population-based congenital anomaly registers in Europe. Eur J of Hum Gen, 11 January INTL PRESENTATION-0029 va

47 Avances en Screening Prenatal 1960 s 1980s Edad Materna MSAFP Triple Screen Tasa de Detección Edad Gestational Cuad Screen SPT TN/Suero NIPT Cuantitativo NIPT SM y D 27% 36% 60-74% 70-81% 80-95% 66->99% >99% N/C 15 sem+ 15 sem+ 15 sem sem+ 10sem+ 10 sem+ Anomalías Cromosomicas Buscadas Todas T21 T21 T18 T21 T18 T21 T18 T13 T21 T18 T13 45,X T21 T18 T13 45,X Trisomías Sexuales

48 Screening Prenatal y Tests Diagnósticos Hoy Screen del 1 st trimestre bioquímica + U/S Screening bioquímico del 2 o rimestre 1 er Trimestre 2 o Trimestre 3 er Trimestre FUMN 14 sem BVC sem amnio sem 27 sem 40 sem Término 12 sem 18 sem Medida de TN (anatomía limitada) Anatomía Completa

49 Qué nos informan hoy los resultados del Screening? Los resultados del Screening brindan estimaciones del riesgo. Un resultado negativo o de bajo riesgo puede ser mal interpretado como que el feto es normal. hcg AFP HN TN PAPP-A Screens Positivos, basados en riesgo pueden llevar a procedimientos invasivos no necesarios

50 Métodos de Screening Bioquímicos Falsos Positivos De cada 20 mujeres que presentan un screening bioquímico positivo, sólo 1 tendrá un T21 False Negative

51 Métodos de Screening Bioquímicos Falsos Positivos De cada 20 mujeres que presentan un screening bioquímico positivo, sólo 1 tendrá un T21 Falsos Negativos De cada 20 mujeres con una T21 3 a 4 presentarán un screening bioquímico negativo

52 Opciones Diagnósticas Invasivas Trimestre Test Sensibilidad Especificidad 1 o BV 99.25% % 1 2 o Amniocentesis 99.4% % 2 El GOLD STANDARD no es 100% sensible y especifico. 1. Hahnemann JM, Vejerslev LO. Accuracy of cytogenetic findings on chorionic villus sampling (CVS)--diagnostic consequences of CVS mosaicism and non-mosaic discrepancy in centres contributing to EUCROMIC Prenat Diagn Sep;17(9): Mid-trimester amniocentesis for prenatal diagnosis. Safety and accuracy. JAMA Sep 27; 236(13):

53

54 Dos fuentes de ADN fetal Células Fetales 1 en mil millones de la población celular total Requiere aislamiento por métodos mecánicos y/o bioquímicos ADN libre (cfdna) 2 20% del cfdna es fetal Requiere aislamiento y recuento de DNA Método de recuento desarrollado por el Dr. Stephen Quake, Stanford University

55 ADN libre de células (cfdna) Un marcador confiable durante el embarazo Liberado por apoptosis (muerte celular programada) Liberado a la sangre materna como pequeños fragmentos de ADN ( pb) Sangre materna contiente ambos cfdna, materno y fetal. Fetal: detectado luego de las 7 semanas de gestación Indetectable luego de 2 horas del parto

56 La determinación de la Ploidía depende de la 120 Fracción Fetal Cantidad Relativa de ADN indicadora del cromosoma buscado Disomía Fetal Trisomía Fetal Materno 0 15% 10% 8% 5% 3% % Fracción Fetal Tasa de detección >10% >99% <8% 75% Palomaki GE et al. DNA sequencing of maternal plasma to detect Down syndrome: an international clinical validation study. Genet Med Nov; 13(11):

57 Recuento Crom % del genoma Crom 3 6.2% del genoma

58 Recuento Crom % del genoma Crom 3 6.2% del genoma Relación esperada: 20% 80% Relación Observada: 25% 75%

59 MÉTODO de NIPT Sangre Materna Glóbulos Blancos = ADN Materno Plasma = ADN Materno + Fetal Secuenciación Secuenciación Genotipo Materno Genotipos Materno + Fetal Sustracción de ADN materno de la mezcla materna/fetal usando informática apropiada Genotipo Fetal

60 1/88 Embarazos del 2o Trimestre son afectados por Aneuploidías Frecuentes Incidencia en el 2o Trimestre 1/88 1/300 Triploidy 47,XYY 47,XXX 47,XXY 45,X T13 T18 T21 AUTOSOMAS Autosomes only AUTOSOMAS + CROM. SEXUALES Autosomes + Sex Chromosomes Smith's Recognizable Patters of Human Malformation by Kenneth Lyons Jones, MD. 6th Edition 2006.Published by Saunders, an imprint of Elsevier Science. Genetics in Obstetrics and Gynecology by Joe Leigh Simpson and Sherman Elias Published by Saunders, an imprint of Elsevier Science. Yaron Y et al First-trimester nuchal translucency and maternal serum free beta-hcg and PAPP-A can detect triploidy and determine the parental origin. Prenatal Diagnosis 24: The natural history of cytogenetically abnormal fetuses detected at midtrimester amniocentesis which are not terminated electively: new data and estimates of the excess and relative risk of late fetal death associated with 47,+21 and some other abnormal karyotypes. Hook EB et al. Am J Hum Genet. (1989)

61 FRECUENCIA DE CROMOSOMOPATÍAS AL NACER /250 Nacidos Vivos /500 Nacidos Vivos 47, XXX 47, XXY 45, X0 Trisomy 13 Trisomy 18 Trisomy 21 0 T21, T18, T13 Y XY T21 y T18 Natera T21 &T18 only La incidencia combinada al nacimiento de anomalías de los cromosomas sexuales es mayor que el de las trisomías autosómicas. No existen al presente métodos de screening para detectar anomalías de cromosomas sexuales. Smith's Recognizable Patters of Human Malformation by Kenneth Lyons Jones, MD. 6th Edition 2006.Published by Saunders, an imprint of Elsevier Science. Genetics in Obstetrics and Gynecology by Joe Leigh Simpson and Sherman Elias Published by Saunders, an imprint of Elsevier Science.

62 Secuenciación Masiva Paralela (SMP) Método de análisis de los diferentes tests Extraer y Preparar cfdna 1 2 Secuenciación

63 Secuenciación Masiva Paralela (SMP) Alineación de secuencias únicas de cfdna 3 Alineación NO a ESCALA Recuento: CGATTTAACT AGGTACCGAT CGATTTAACT GACTTCCAGG ACCACGATTTAACTGGAGTAAAGACTTCCAGGTACCGATCTAGCCT Genoma Humano millones de cuentas por muestra

64 Detección de Aneuploidía Fetal SMP Permite recuento molecular preciso cfdna Fetal (20%) NO a ESCALA 4 Recuento 10% más cfdna de Cr21 en T21 cfdna Materno Cromosomas: VS 21 Trisomía 21

65 NIPT para T21 No Diagnóstico SCREENING Los resultados del NIPT tienen que evaluarse en el contexto de la prevalencia de la enfermedad Ejemplo: 1,000 mujeres Exactitud del Test: 99% detección 0.1% falso positivo prevalencia de T21: 1 en T no-t21 Test + Test - Test + Test El test Positivo es correcto sólamente 2/3 de las veces

66 Trisomías 18 y 13 Mosaicismo Placentario cfdna se origina de la placenta Probablemente del trofoblasto Similar a la preparación directa de la BV Los Cromosomas de la placenta y el feto pueden ser diferentes Ocurre más frecuentemente con los cromosomas 13 y 18, y menos con el cromosoma 21 Puede determinar resultados falsos positivos y falsos negativos Kalousek et al, Am J Hum Genet, 1989; Wirtz et al, Prenat Diag, 1991; Smith et al, 1999

67 Tasas de Detección Tasas de detección de datos publicados T21 T18 T13 45X XXX/XXY % 99.9% 99.9% 99.9% 99.9% % % 100% 91.7% N/A N/A 3 100% 97.2% 78.6% 93.8% N/A 4 100% 98.0% N/A N/A N/A 1. Zimmerman B et al. Prenat. Diag Dec 2. Palomaki GE et al. Genet Med, 2011 Nov; and Palomaki GE et al. Genet Med, 2012 Mar 3. Bianchi DW et al. Obstet & Gynecol, 2012 Feb 4. Ashoor G et al. Am J Obstet &Gynecol 2012

68 El Futuro: Microdelecciones Microdelecciones 40% Anomalías Cromosómicas (13,18,21,X,Y) 17% Padre o Madre portador de gen anormal: feto afectado 36% Anomalías no cromosómicas DX por ecografía 3.5% Defectos del Tubo Neural 3.5%

69 CEREBRO CON DEFECTO CONGÉNITO

70

Cribado prenatal no invasivo

Cribado prenatal no invasivo Cribado prenatal no invasivo Detección T13, T18, T21, monosomía X y sexo fetal en sangre materna. Dra. Blanca Bermejo Barrera, Directora Desarrollo Área Molecular Evolución del cribado prenatal 1960 s

Más detalles

Pregunte a su médico

Pregunte a su médico Un análisis de sangre simple y seguro que ofrece resultados muy sensibles Prueba no invasiva para valorar el riesgo de alteraciones cromosómicas como el síndrome de Down, e incluye un análisis optativo

Más detalles

El valor de la prueba prenatal no invasiva (non-invasive prenatal testing, NIPT). Apéndice para la carpeta del asesor en genética

El valor de la prueba prenatal no invasiva (non-invasive prenatal testing, NIPT). Apéndice para la carpeta del asesor en genética El valor de la prueba prenatal no invasiva (non-invasive prenatal testing, NIPT). Apéndice para la carpeta del asesor en genética Las NIPT usan ADN libre de células. Muestra de sangre de la madre ADN libre

Más detalles

Pregunte a su médico

Pregunte a su médico Un análisis de sangre simple y seguro que ofrece resultados muy sensibles Un análisis avanzado no invasivo para detectar la trisomía fetal y evaluar el cromosoma Y Pregunte a su médico Los siguientes datos

Más detalles

Pregunte a su médico

Pregunte a su médico Un análisis de sangre simple y seguro que ofrece resultados muy acertados Un análisis no invasivo que evalúa el riesgo de problemas médicos relacionados con los cromosomas como el síndrome de Down e incluye

Más detalles

Diagnóstico prenatal no invasivo de aneuploidias mediante ADN libre fetal en sangre materna. Dr. Waldo Leiva L.

Diagnóstico prenatal no invasivo de aneuploidias mediante ADN libre fetal en sangre materna. Dr. Waldo Leiva L. Diagnóstico prenatal no invasivo de aneuploidias mediante ADN libre fetal en sangre materna Dr. Waldo Leiva L. Screening prenatal Screening combinado 1 er trimestre Screening prenatal Diagnóstico prenatal

Más detalles

Métodos de cribado prenatal. Dra. Raquel Salvador Vela MIR 3º Análisis Clínicos

Métodos de cribado prenatal. Dra. Raquel Salvador Vela MIR 3º Análisis Clínicos Métodos de cribado prenatal Dra. Raquel Salvador Vela MIR 3º Análisis Clínicos CRIBADO PRENATAL DE CROMOSOMOPATÍAS La Incidencia de las alteraciones cromosómicas es de un 4-5% de todas las gestaciones,

Más detalles

PONENCIA. Diagnóstico prenatal de cromosomopatías y retraso mental.

PONENCIA. Diagnóstico prenatal de cromosomopatías y retraso mental. PONENCIA Diagnóstico prenatal de cromosomopatías y retraso mental. Conceptos básicos Conceptos básicos DIAGNÓSTICO PRENATAL. El término "diagnóstico prenatal" agrupa todas aquellas acciones diagnósticas

Más detalles

para detectar anormalidades cromosómicas incluido el síndrome de Down Lo que USTED necesita saber

para detectar anormalidades cromosómicas incluido el síndrome de Down Lo que USTED necesita saber para detectar anormalidades cromosómicas incluido el síndrome de Down Lo que USTED necesita saber PerkinElmer Labs/NTD: líder innovador en pruebas prenatales desde hace más de 30 años Desde hace más de

Más detalles

Diagnóstico Genético Prenatal EGA-IGM

Diagnóstico Genético Prenatal EGA-IGM Diagnóstico Genético Prenatal Enfermedades Genéticas 1968: 1487 2009: 19554. 1/julio/09 2100 Síndromes y 400 problemas cromosómicos. El problema 80% de los productos con síndrome de Down y el 95

Más detalles

La nueva generación de Diagnóstico Prenatal No Invasivo. De m o dл lí н nó co P atal

La nueva generación de Diagnóstico Prenatal No Invasivo. De m o dл lí н nó co P atal La nueva generación de Diagnóstico Prenatal No Invasivo De m o dл lí н nó co P atal LABCO siempre contigo Cerca del 1% de los fetos presentan algún tipo de anomalía cromosómica. El diagnóstico prenatal

Más detalles

SEMINARIO 7: DIAGNÓSTICO DE ANOMALÍAS CROMOSÓMICAS 11-13+ 6 SEM: II. FACTORES BIOQUÍMICOS

SEMINARIO 7: DIAGNÓSTICO DE ANOMALÍAS CROMOSÓMICAS 11-13+ 6 SEM: II. FACTORES BIOQUÍMICOS SEMINARIO 7: DIAGNÓSTICO DE ANOMALÍAS CROMOSÓMICAS 11-13+ 6 SEM: II. FACTORES BIOQUÍMICOS Drs. Paula Vanhauwaert, Lorena Quiroz Villavicencio, Leonardo Zúñiga Ibaceta, Susana Aguilera Peña, Juan Guillermo

Más detalles

TEST PRENATAL NO INVASIVO (NIPT)

TEST PRENATAL NO INVASIVO (NIPT) TEST PRENATAL NO INVASIVO (NIPT) El Test VERIFI (Test Prenatal no Invasivo) permite la detección de anomalías cromosómicas como síndrome Down y 5 microdeleciones en la sangre materna mediante el análisis

Más detalles

Jornada SADIPT 2014 Rosario, 11 de octubre de 2014

Jornada SADIPT 2014 Rosario, 11 de octubre de 2014 Jornada SADIPT 2014 Rosario, 11 de octubre de 2014 Screeningde aneuplodíasen ADN fetal en plasma materno (NIPT: Non-Invasive Prenatal Testing) Lucas Otaño Servicio de Obstetricia Unidad de Medicina Fetal

Más detalles

Diagnóstico Prenatal No invasivo (NIPD)

Diagnóstico Prenatal No invasivo (NIPD) Dra. Derly Liseth Castro Rojas, MD Especialista en Genética Clínica - IGH PUJ / UNAB Directora Dto. Genética Clínica FOSCAL- Lab. Higuera Escalante Docente Asociado Facultad de Medicina UNAB Medicina fetal

Más detalles

APLICACIÓN DE NUEVA TECNOLOGÍA GENÉTICA EN EL LABORATORIO CLÍNICO.

APLICACIÓN DE NUEVA TECNOLOGÍA GENÉTICA EN EL LABORATORIO CLÍNICO. APLICACIÓN DE NUEVA TECNOLOGÍA GENÉTICA EN EL LABORATORIO CLÍNICO. Introducción Dra. D.G. Mayén Estudio prenatal no invasivo de primer y segundo trimestres del embarazo en sangre materna Dra. D.G. Mayén

Más detalles

Test de Cribado Prenatal No Invasivo en sangre materna

Test de Cribado Prenatal No Invasivo en sangre materna Test de Cribado Prenatal No Invasivo en sangre materna Detecta las trisomías fetales de los cromosomas 21, 13 y 18 Detecta síndromes de microdeleción Informa del sexo fetal y de las aneuploidías de cromosomas

Más detalles

SequentialScreen SM. Información de antemano y altas tasas de detección de anomalías congénitas

SequentialScreen SM. Información de antemano y altas tasas de detección de anomalías congénitas SequentialScreen SM Información de antemano y altas tasas de detección de anomalías congénitas SequentialScreen Cuando una mujer se entera de que está embarazada, debe tomar muchas decisiones. Es importante

Más detalles

FirstScreen. Información de antemano acerca de su embarazo

FirstScreen. Información de antemano acerca de su embarazo FirstScreen Información de antemano acerca de su embarazo FirstScreen Cuando una mujer se entera de que está embarazada, debe tomar muchas decisiones. Es importante que decida si se realizará o no una

Más detalles

SÍNDROME DE DOWN. Pedro Rodríguez Expósito Terapeuta Ocupacional Anda Alicante. terapiaocupacional@andalicante.org

SÍNDROME DE DOWN. Pedro Rodríguez Expósito Terapeuta Ocupacional Anda Alicante. terapiaocupacional@andalicante.org SÍNDROME DE DOWN Pedro Rodríguez Expósito Terapeuta Ocupacional Anda Alicante terapiaocupacional@andalicante.org El síndrome de Down es una alteración genética producida por la presencia de un cromosoma

Más detalles

Edita: Consejería de Salud y Servicios Sanitarios Dirección General de Organización de Prestaciones Sanitarias Diseño e ilustraciones: Asturgraf

Edita: Consejería de Salud y Servicios Sanitarios Dirección General de Organización de Prestaciones Sanitarias Diseño e ilustraciones: Asturgraf Edita: Consejería de Salud y Servicios Sanitarios Dirección General de Organización de Prestaciones Sanitarias Diseño e ilustraciones: Asturgraf Imprime: Asturgraf D.L. AS.- 2.922/06 Programa de detección

Más detalles

Avances genéticos en diagnóstico prenatal. Dr. David Poyatos Andújar. Especialista de producto Área Molecular

Avances genéticos en diagnóstico prenatal. Dr. David Poyatos Andújar. Especialista de producto Área Molecular Avances genéticos en diagnóstico prenatal Dr. David Poyatos Andújar. Especialista de producto Área Molecular 9 11 14 1er trimestre 2º trimestre 3er trimestre 2 Test Prenatal No Invasivo Detección T13,

Más detalles

Prueba de detección de anomalías cromosómicas

Prueba de detección de anomalías cromosómicas Prueba de detección de anomalías cromosómicas Las pruebas de detección son ofrecidas en el periodo inicial del embarazo para ver si los pacientes tienen mayor riesgo de anomalías cromosómicas Prueba de

Más detalles

Test de Cribado Prenatal No Invasivo en sangre materna

Test de Cribado Prenatal No Invasivo en sangre materna Test de Cribado Prenatal No Invasivo en sangre materna Software de resultados BGI con marcado CE para la trisomía 21 Detecta las trisomías fetales de los cromosomas 21, 13 y 18 Informa de 3 síndromes de

Más detalles

CONSENTIMIENTO INFORMADO PARA ANÁLISIS PRENATAL NO INVASIVO DE TRISOMÍAS FETALES

CONSENTIMIENTO INFORMADO PARA ANÁLISIS PRENATAL NO INVASIVO DE TRISOMÍAS FETALES Ejemplar para el Solicitante CONSENTIMIENTO INFORMADO PARA ANÁLISIS PRENATAL NO INVASIVO DE TRISOMÍAS FETALES Propósito El análisis prenatal no invasivo analiza ADN fetal libre, circulante en la sangre

Más detalles

ESTUDIO PRENATAL PARA SINDROME DE DOWN Y DEFECTOS DEL TUBO NEURAL En los últimos años se ha comenzado ha realizar, con gran aceptación en Europa y

ESTUDIO PRENATAL PARA SINDROME DE DOWN Y DEFECTOS DEL TUBO NEURAL En los últimos años se ha comenzado ha realizar, con gran aceptación en Europa y ESTUDIO PRENATAL PARA SINDROME DE DOWN Y DEFECTOS DEL TUBO NEURAL En los últimos años se ha comenzado ha realizar, con gran aceptación en Europa y EEUU, el método de screening prenatal en suero que permite

Más detalles

UOG Journal Club: Enero 2015

UOG Journal Club: Enero 2015 UOG Journal Club: Enero 2015 Screening de trisomía 21, 18 & 13 con DNAf en sangre materna a las 10 11 semanas y el test combinado a las 11 13 semanas. M. S. Quezada, M. M. Gil, C. Francisco, G. Oròsz and

Más detalles

ECOGRAFÍA DE PRIMER TRIMESTRE Y SCREENING DE ALTERACIONES CROMOSÓMICAS Y ESTRUCTURALES EN EL PRIMER TRIMESTRE DEL EMBARAZO

ECOGRAFÍA DE PRIMER TRIMESTRE Y SCREENING DE ALTERACIONES CROMOSÓMICAS Y ESTRUCTURALES EN EL PRIMER TRIMESTRE DEL EMBARAZO Protocolos UMF - Screening 1er trimestre 1 de 8 ECOGRAFÍA DE PRIMER TRIMESTRE Y SCREENING DE ALTERACIONES CROMOSÓMICAS Y ESTRUCTURALES EN EL PRIMER TRIMESTRE DEL EMBARAZO 1. INTRODUCCIÓN La prevalencia

Más detalles

SerumIntegratedScreen SM

SerumIntegratedScreen SM SerumIntegratedScreen SM Ofrece la tasa más alta de detección de anomalías congénitas sin ultrasonografía SerumIntegratedScreen Cuando una mujer se entera de que está embarazada, debe tomar muchas decisiones.

Más detalles

DIAGNÓSTICO PRENATAL CITOGENÉTICO TICO. Carolina Cruz Maricel Cuello Centro Nacional de Genética MédicaM

DIAGNÓSTICO PRENATAL CITOGENÉTICO TICO. Carolina Cruz Maricel Cuello Centro Nacional de Genética MédicaM DIAGNÓSTICO PRENATAL CITOGENÉTICO TICO Carolina Cruz Maricel Cuello Centro Nacional de Genética MédicaM DIAGNÓSTICO PRENATAL Todas aquellas acciones prenatales que tienen por objeto diagnosticar la ocurrencia

Más detalles

PROGRAMA DE DETECCIÓN PRENATAL DE ANOMALÍAS CROMOSÓMICAS

PROGRAMA DE DETECCIÓN PRENATAL DE ANOMALÍAS CROMOSÓMICAS GUÍA PARA LAS EMBARAZADAS PROGRAMA DE DETECCIÓN PRENATAL DE ANOMALÍAS CROMOSÓMICAS La decisión de realizar las pruebas incluidas en este Programa es una decisión voluntaria y personal, que debe tomar tras

Más detalles

Pruebas diagnósticas prenatales en el síndrome de Down

Pruebas diagnósticas prenatales en el síndrome de Down pruebas ok.qxd 09/12/2005 9:11 Página 1 Información Revista Síndrome de Down 22: 149-154, 2005 149 Pruebas diagnósticas prenatales en el síndrome de Down Redacción, FSDC RESUMEN Se exponen los diversos

Más detalles

Unidad de Diagnóstico Prenatal

Unidad de Diagnóstico Prenatal Unidad de Diagnóstico Prenatal FJD Av. Reyes Católicos nº 2, Madrid (28040) Tel. 91 550 48 00. At. Pacientes Sector Privado: 902111152 www.fjd.es Unidad de Diagnóstico Prenatal Unidad de Diagnóstico Prenatal

Más detalles

Antes del embarazo Pre - concepción

Antes del embarazo Pre - concepción Antes del embarazo Pre - concepción Cariotipo en la pareja con dificultades para concebir Qué es un cariotipo? Es el estudio que permite detectar anomalías en el número o en la forma de los cromosomas.

Más detalles

Resultado positivo de trisomía 18

Resultado positivo de trisomía 18 Programa de Detección Prenatal de California Los resultados de la prueba inicial del segundo trimestre Prueba inicial de marcador cuádruple o Prueba inicial integrada del suero o Prueba inicial integrada

Más detalles

CRIBADO CROMOSOMOPATÍAS EN EL PRIMER Y SEGUNDO TRIMESTRE

CRIBADO CROMOSOMOPATÍAS EN EL PRIMER Y SEGUNDO TRIMESTRE CRIBADO CROMOSOMOPATÍAS EN EL PRIMER Y SEGUNDO TRIMESTRE NATALIA DEL CASTILLO TATIANA B. GUERRERO FRANCISCA S. MOLINA Las anomalías cromosómicas son causas importantes de muerte perinatal y discapacidad

Más detalles

Resultado positivo del síndrome de Down

Resultado positivo del síndrome de Down Programa de Detección Prenatal de California Los resultados de la prueba inicial del primer trimestre Positive T21 1T Spanish El resultado de su prueba inicial de sangre es: Resultado positivo del síndrome

Más detalles

UTILIDAD DE LA ALFA-FETOPROTEINA COMO MARCADOR CARMEN M. CABRERA R2 SECCIÓN DE BIOQUÍMICA ANÁLISIS CLÍNICOS

UTILIDAD DE LA ALFA-FETOPROTEINA COMO MARCADOR CARMEN M. CABRERA R2 SECCIÓN DE BIOQUÍMICA ANÁLISIS CLÍNICOS UTILIDAD DE LA ALFA-FETOPROTEINA COMO MARCADOR CARMEN M. CABRERA R2 SECCIÓN DE BIOQUÍMICA ANÁLISIS CLÍNICOS ALFA-FETOPROTEÍNA: a1-glicoproteína de 70 KDa, con un 80% de homología estructural con la albúmina.

Más detalles

Programa de Detección Prenatal de Anomalías Cromosómicas. Memoria 2013

Programa de Detección Prenatal de Anomalías Cromosómicas. Memoria 2013 MEMORIA 2013 1 1- CONTEXTO DEMOGRÁFICO Descenso mantenido del número de partos La situación demográfica de nuestra Comunidad pone de manifiesto un descenso mantenido de la natalidad, que se traduce en

Más detalles

DEPARTAMENTO DE MEDICINA MATERNO-FETAL. CENTRO DE DIAGNOSTICO FETAL INTEGRAL BLVD. CAMPESTRE # 503 Colonia JARDINES DEL MORAL; León Guanajuato.

DEPARTAMENTO DE MEDICINA MATERNO-FETAL. CENTRO DE DIAGNOSTICO FETAL INTEGRAL BLVD. CAMPESTRE # 503 Colonia JARDINES DEL MORAL; León Guanajuato. DEPARTAMENTO DE MEDICINA MATERNO-FETAL. CENTRO DE DIAGNOSTICO FETAL INTEGRAL BLVD. CAMPESTRE # 503 Colonia JARDINES DEL MORAL; León Guanajuato. Teléfono y Fax: 01 (477) 7 17-46-85. INTRODUCCIÓN Sin duda

Más detalles

Programa de Detección Prenatal de California Resultados de la detección en el primer trimestre

Programa de Detección Prenatal de California Resultados de la detección en el primer trimestre Programa de Detección Prenatal de California Resultados de la detección en el primer trimestre El resultado de su prueba de detección es: TN grande positivo DETECCIÓN POSITIVA debido a una translucidez

Más detalles

Una prueba genética fetal sin riesgos, ni para ti ni para tu bebé

Una prueba genética fetal sin riesgos, ni para ti ni para tu bebé OBSTETRICIA TEST EN SANGRE MATERNA PARA DETECTAR SÍNDROME DE DOWN Una prueba genética fetal sin riesgos, ni para ti ni para tu bebé Salud de la mujer Dexeus ATENCIÓN INTEGRAL EN OBSTETRICIA, GINECOLOGÍA

Más detalles

Información para Envío de Muestras

Información para Envío de Muestras Información para Envío de Muestras 1 TRIPLE MARCADOR El Triple marcador sérico (TMS), es una prueba de tamizaje o screening y su objetivo principal es detectar embarazos con mayor riesgo del esperado.

Más detalles

ENFERMEDADES GENÉTICAS

ENFERMEDADES GENÉTICAS ENFERMEDADES GENÉTICAS Inicio INDICE 1 Que es una enfermedad genética? 1.1Enfermedades cromosómicas 1.2Enfermedades monogenicas 2. como se heredan? 2.1 Herencia dominante 2.2 Herencia recesiva 2.3 Herencia

Más detalles

Medicina Perinatal: riesgo, pérdida reproductiva

Medicina Perinatal: riesgo, pérdida reproductiva www.cerpo.cl Medicina Perinatal: riesgo, pérdida reproductiva CERPO Centro de Referencia Perinatal Oriente Servicio y Departamento de Obstetricia y Ginecología Hospital Santiago Oriente Dr. Luis Tisné

Más detalles

test prenatal no invasivo Información para profesionales de la salud

test prenatal no invasivo Información para profesionales de la salud test prenatal no invasivo Información para profesionales de la salud Sobre TOMORROW TOMORROW es el nuevo test de CGC Genetics que, a partir de una muestra de sangre materna y de una manera no invasiva,

Más detalles

Detección integral para una perspectiva más clara. Pruebas Prenatales No Invasivas para sus pacientes obstétricas de alto riesgo

Detección integral para una perspectiva más clara. Pruebas Prenatales No Invasivas para sus pacientes obstétricas de alto riesgo Detección integral para una perspectiva más clara Pruebas Prenatales No Invasivas para sus pacientes obstétricas de alto riesgo La prueba validada más completa de su clase Con la tecnología de ADN libre

Más detalles

PATIENT EDUCATI The American College of Obstetricians and Gynecologists

PATIENT EDUCATI The American College of Obstetricians and Gynecologists PATIENT EDUCATI N The American College of Obstetricians and Gynecologists WOMEN S HEALTH CARE PHYSICIANS El Embarazo SP165 Exámenes de detección de defectos congénitos Los exámenes de detección pueden

Más detalles

El diagnóstico molecular de trombofilia es un test genético que analiza variantes en genes implicados en el proceso de coagulación.

El diagnóstico molecular de trombofilia es un test genético que analiza variantes en genes implicados en el proceso de coagulación. Las alteraciones cromosómicas estructurales equilibradas (traslocación o inversión, por ejemplo) están asociadas tanto a infertilidad como a aumento del riesgo de perdida embriofetal. El estudio del cariotipo

Más detalles

ETAPAS DEL DESARROLLO EMBRIONARIO

ETAPAS DEL DESARROLLO EMBRIONARIO ETAPAS DEL DESARROLLO EMBRIONARIO Primera etapa: Gameto-Fecundación-Cigoto (1-4) días Segunda etapa: Cigoto-Mórula-Blastocisto-Anidación (5-14 días) Tercera etapa: Anidación-Feto (14 días- 8ª semana) -

Más detalles

Embarazo - Controles en el segundo cuatrimestre

Embarazo - Controles en el segundo cuatrimestre Embarazo - Controles en el segundo cuatrimestre Durante el segundo trimestre del embarazo te realizarán numerosas pruebas que te ayudarán a quedarte más tranquila al saber que todo va bien: Triple screening,

Más detalles

NIPT para Aneuploidías. En Alto o Bajo Riesgo?

NIPT para Aneuploidías. En Alto o Bajo Riesgo? NIPT para Aneuploidías En Alto o Bajo Riesgo? Vincenzo Cirigliano PhD Genética Molecular Labco, Barcelona vincenzo.cirigliano@labco.eu Cell-free DNA en Sangre Materna Cell-free DNA (cfdna) es presente

Más detalles

Diagnóstico prenatal

Diagnóstico prenatal Mª Pilar Ribate Molina Departamento de Pediatría, Facultad de Medicina, Universidad de Zaragoza Feliciano J. Ramos Fuentes Unidad de Genética Clínica, Servicio de Pediatría, Hospital Clínico Universitario

Más detalles

Información para Envío de Muestras

Información para Envío de Muestras Información para Envío de Muestras CARIOTIPO EN LÍQUIDO AMNIÓTICO Es el estudio de los cromosomas del feto en células de líquido amniótico. El estudio implica el cultivo de amniocitos, bandeo cromosómico

Más detalles

DIAGNÓSTICO PRENATAL: DEL MICROSCOPIO A LAS PLATAFORMAS DE ALTO RENDIMIENTO

DIAGNÓSTICO PRENATAL: DEL MICROSCOPIO A LAS PLATAFORMAS DE ALTO RENDIMIENTO DIAGNÓSTICO PRENATAL: DEL MICROSCOPIO A LAS PLATAFORMAS DE ALTO RENDIMIENTO María Orera U. de Genética HGU Gregorio Marañón CGCGenetics-CircaGen Oviedo 13 4 2011 cronograma 1966: STEELE: Estudio cromosómico

Más detalles

Diagnóstico Prenatal de Anomalías Cromosómicas Nuevos Métodos, Nuevas Indicaciones

Diagnóstico Prenatal de Anomalías Cromosómicas Nuevos Métodos, Nuevas Indicaciones Diagnóstico Prenatal de Anomalías Cromosómicas Nuevos Métodos, Nuevas Indicaciones Vincenzo Cirigliano PhD Genética Molecular y Unidad de Diagnóstico Prenatal Labco, Barcelona vincenzo.cirigliano@labco.eu

Más detalles

Síndrome de Down: Seminarios AETSA. programas de cribado poblacional o decisiones individuales? Jueves 6 de octubre. Román Villegas Portero

Síndrome de Down: Seminarios AETSA. programas de cribado poblacional o decisiones individuales? Jueves 6 de octubre. Román Villegas Portero Síndrome de Down: programas de cribado poblacional o decisiones individuales? Seminarios AETSA Jueves 6 de octubre Román Villegas Portero Para empezar La enfermedad es un problema sanitario importante.

Más detalles

La Ecografía de las 11-13+6 Semanas

La Ecografía de las 11-13+6 Semanas La Ecografía de las 11-13+6 Semanas La Ecografía de las 11-13+6 Semanas Uno de los principales avances de la última década es la inclusión de la ecografía entre las 11-13+6 semanas. A esta edad, el feto

Más detalles

Qué es una amniocentesis?

Qué es una amniocentesis? What is an Amniocentesis? www.cpmc.org/learning i learning about your health Qué es una amniocentesis? La amniocentesis es un procedimiento realizado durante el embarazo para examinar los cromosomas de

Más detalles

UOG Journal Club: Marzo 2015

UOG Journal Club: Marzo 2015 UOG Journal Club: Marzo 2015 Analisis de DNA fetal libre en sangre materna Para el tamizaje de aneuploidías: un meta-análsis al día. MM Gil, MS Quezada, R Revello, R Akolekar and KH Nicolaides Volume 45,

Más detalles

Detección prenatal no invasiva para embarazos de alto riesgo

Detección prenatal no invasiva para embarazos de alto riesgo Detección prenatal no invasiva para embarazos de alto riesgo Información para su tranquilidad. Su embarazo debe ser un acontecimiento para disfrutar. Sin embargo, si su médico ha determinado algún riesgo

Más detalles

Consejería genética. Dra. Elena Alvarado León Area de Genética y Biología Molecular y Celular Dpto. de Morfología Humana FAC.

Consejería genética. Dra. Elena Alvarado León Area de Genética y Biología Molecular y Celular Dpto. de Morfología Humana FAC. Consejería genética Dra. Elena Alvarado León Area de Genética y Biología Molecular y Celular Dpto. de Morfología Humana FAC. DE MEDICINA - UNT Es un proceso de comunicación por el cual se pretende dar

Más detalles

GPC. Guía de Referencia Rápida. Diagnóstico Prenatal del Síndrome de Down. Guía de Práctica Clínica

GPC. Guía de Referencia Rápida. Diagnóstico Prenatal del Síndrome de Down. Guía de Práctica Clínica Guía de Referencia Rápida Diagnóstico Prenatal del Síndrome de Down GPC Guía de Práctica Clínica Catálogo maestro de guías de práctica clínica: IMSS-494-11 Guía de Referencia Rápida 090 Síndrome de down

Más detalles

Ecografía de primer trimestre. Ecografía 11-13 +6 semanas

Ecografía de primer trimestre. Ecografía 11-13 +6 semanas Ecografía de primer trimestre. Ecografía 11-13 +6 semanas MA Sánchez Durán Curso sobre ecografía obstétrico-ginecológica. Hospital Vall d Hebron. Barcelona. Enero 2009 Introducción Ecografía vaginal 5-10

Más detalles

Todo lo que debe de saber acerca de las ecografías durante su embarazo! Dr. Jesús G. Lozano De La Garza. Ginecología-Obstetricia-Materno Fetal

Todo lo que debe de saber acerca de las ecografías durante su embarazo! Dr. Jesús G. Lozano De La Garza. Ginecología-Obstetricia-Materno Fetal Todo lo que debe de saber acerca de las ecografías durante su embarazo! Ginecología-Obstetricia-Materno Fetal Todo lo que debe de saber acerca de las ecografías durante su embarazo! Tal vez se pregunte

Más detalles

Arteria Umbilical Única Evaluación y Manejo

Arteria Umbilical Única Evaluación y Manejo Arteria Umbilical Única Evaluación y Manejo Dr. Felipe Jordán Urrutia Ginecología y Obstetricia HPH - UDD Cordón Umbilical Formación 4ª a 5ª semana Formada por 3 vasos: 2 arterias: Transporte sangre desoxigenada

Más detalles

GESTACIÓN ÚNICA EN SEMANA 12 CON TN DE 4,2 MM. ÁRBOL DE PROBABILIDADES

GESTACIÓN ÚNICA EN SEMANA 12 CON TN DE 4,2 MM. ÁRBOL DE PROBABILIDADES Fecha: 18/10/12 y 25/10/12 Nombre: Dra. Guadalupe Aguarón Benítez R4 Tipo de Sesión: Resolución caso clínico GESTACIÓN ÚNICA EN SEMANA 12 CON TN DE 4,2 MM. ÁRBOL DE PROBABILIDADES El aumento de la TN fetal

Más detalles

UNIVERSIDAD CATÓLICA DE VALENCIA. San Vicente Mártir CIENCIA Y ÉTICA EN EL DIAGNÓSTICO PRENATAL MASTER OFICIAL DE BIOÉTICA. Presentado por: Tutor/a:

UNIVERSIDAD CATÓLICA DE VALENCIA. San Vicente Mártir CIENCIA Y ÉTICA EN EL DIAGNÓSTICO PRENATAL MASTER OFICIAL DE BIOÉTICA. Presentado por: Tutor/a: UNIVERSIDAD CATÓLICA DE VALENCIA San Vicente Mártir CIENCIA Y ÉTICA EN EL DIAGNÓSTICO PRENATAL MASTER OFICIAL DE BIOÉTICA Presentado por: Dª María Teresa Alarcón Zahonero Tutor/a: Dr. D. José Ángel Mínguez

Más detalles

Ecografía de las semanas 11-13

Ecografía de las semanas 11-13 Ecografía de las semanas 11-13 Edición especial para INFOMED - Cuba Prof. Kypros Nicolaides Ecografía de las semanas 11-13 Bienvenidos a este curso de la Fetal Medicine en ecografía de las semanas 11-13

Más detalles

Incorporación del estudio de ADN fetal en sangre materna al cribado de cromosomopatías

Incorporación del estudio de ADN fetal en sangre materna al cribado de cromosomopatías REV CHIL OBSTET GINECOL 5; 8(): - Trabajos Originales Incorporación del estudio de ADN fetal en sangre materna al cribado de cromosomopatías Beatriz Rojas PE., Isabel González B., Amado Tapia L., Marta

Más detalles

Hasta hace poco tiempo, las mujeres embarazadas

Hasta hace poco tiempo, las mujeres embarazadas Reproducción 2013;6:83-89 Artículo de revisión Estudio prenatal no invasivo para la detección de aneuploidías mediante ADN fetal libre en sangre materna: descripción de tres metodologías Rafael Alfonso

Más detalles

FICHA DE RECOGIDA DE BUENAS PRÁCTICAS que respondan a los objetivos y recomendaciones de la EAPN y Salud Reproductiva del SNS

FICHA DE RECOGIDA DE BUENAS PRÁCTICAS que respondan a los objetivos y recomendaciones de la EAPN y Salud Reproductiva del SNS FICHA DE RECOGIDA DE BUENAS PRÁCTICAS que respondan a los objetivos y recomendaciones de la EAPN y Salud Reproductiva del SNS DATOS DE LA ENTIDAD Nombre de la entidad: Hospital Universitario Central de

Más detalles

Hallazgos ecográficos en fetos con alteraciones cromosómicas

Hallazgos ecográficos en fetos con alteraciones cromosómicas TRABAJOS ORIGINALES ALTERACIONES CROMOSÓMICAS Rev Obstet Ginecol Venez 2009;69(2):77-81 Hallazgos ecográficos en fetos con alteraciones cromosómicas Drs. Freddy González *, Ricardo Hernández *, María Elena

Más detalles

Amniocentesis para diagnostico prenatal: 6 años de experiencia en Paraguay. Amniocentesis for prenatal diagnosis: 6 years of experience in Paraguay

Amniocentesis para diagnostico prenatal: 6 años de experiencia en Paraguay. Amniocentesis for prenatal diagnosis: 6 years of experience in Paraguay Mem. Inst. Investig. Cienc. Salud, Vol. 1(1) 2001/02 28 REPORTE DE CASO Amniocentesis para diagnostico prenatal: 6 años de experiencia en Paraguay Amniocentesis for prenatal diagnosis: 6 years of experience

Más detalles

Aspectos esenciales en la detección del Síndrome de Down

Aspectos esenciales en la detección del Síndrome de Down 11 Aspectos esenciales en la detección del Síndrome de Down 8 min. asociados con formas leves o moderadas de retraso mental. Además, el trastorno se El síndrome de Down, conocido relaciona con una serie

Más detalles

EMBARAZO GEMELAR- RECOMENDACIONES GENERALES

EMBARAZO GEMELAR- RECOMENDACIONES GENERALES EMBARAZO GEMELAR- RECOMENDACIONES GENERALES Dr. Francisco Coppola franciscocoppola60@gmail.com.uy Clínica Ginecotocológica A-- Facultad de Medicina junio 2015 Las presentes recomendaciones surgen de la

Más detalles

ARTÍCULO ORIGINAL Ginecol Obstet Mex 2015;83:277-288. Mariana Hernández-Gómez 1 Eva Ramírez-Arroyo 2 Ricardo Meléndez-Hernández 3 3

ARTÍCULO ORIGINAL Ginecol Obstet Mex 2015;83:277-288. Mariana Hernández-Gómez 1 Eva Ramírez-Arroyo 2 Ricardo Meléndez-Hernández 3 3 ARTÍCULO ORIGINAL Ginecol Obstet Mex 2015;83:277-288. Prueba prenatal no invasiva (NIPT) en sangre materna a través de secuenciación masiva paralela (MPS). Experiencia inicial en mujeres mexicanas y revisión

Más detalles

La ecografía de las 11 13 +6 semanas

La ecografía de las 11 13 +6 semanas La ecografía de las 11 13 +6 semanas Kypros H. Nicolaides Orlando Falcón La ecografía de las 11 13 +6 semanas Fetal Medicine Foundation, Londres, 2004 Dedicado a Herodotos y Despina Contenidos Introducción

Más detalles

Reunión SADIPT. Ana Espinosa Bahía Blanca

Reunión SADIPT. Ana Espinosa Bahía Blanca Reunión SADIPT Ana Espinosa Bahía Blanca Salomon LJ, Alfirevic Z, Bilardo CM, Chalouhi GE, GhiT, KaganKO, LauTK, Papageorghiou AT, Raine-Fenning NJ, Stirnemann J, Suresh S, Tabor A, Timor-TritschIE, ToiA,

Más detalles

LABIO LEPORINO Girvent M., Palau J., Astor J., Álvarez V., Cano S., Lineros E., Ojeda F.

LABIO LEPORINO Girvent M., Palau J., Astor J., Álvarez V., Cano S., Lineros E., Ojeda F. LABIO LEPORINO Girvent M., Palau J., Astor J., Álvarez V., Cano S., Lineros E., Ojeda F. Servicio de Ginecología y Obstetricia del Hospital General de Granollers. Barcelona. mgirvent@fhag.com Introducción

Más detalles

Tema 8. Genética aplicada al diagnóstico prenatal

Tema 8. Genética aplicada al diagnóstico prenatal Tema 8 Genética aplicada al diagnóstico prenatal TÉCNICAS NO INVASIVAS Screening sérico (16-18) Ecografía de alta resolución (>18) Células fetales en sangre materna TIPO DE DIAGNÓST. alfa-feto proteína,

Más detalles

Estudio descriptivo del cribado de cromosomopatías en el primer trimestre de la gestación, en el Hospital Clínico San Carlos de Madrid, España

Estudio descriptivo del cribado de cromosomopatías en el primer trimestre de la gestación, en el Hospital Clínico San Carlos de Madrid, España 318 REV CHIL OBSTET GINECOL 2011; 76(5): 318-324 Trabajos Originales Estudio descriptivo del cribado de cromosomopatías en el primer trimestre de la gestación, en el Hospital Clínico San Carlos de Madrid,

Más detalles

Hospital Ginecobstétrico Ana Betancourt de Mora. Todos los derechos reservados. Fecha de publicación 25/05/09

Hospital Ginecobstétrico Ana Betancourt de Mora. Todos los derechos reservados. Fecha de publicación 25/05/09 Hospital Ginecobstétrico Ana Betancourt de Mora. Todos los derechos reservados Fecha de publicación 25/05/09 Título: Marcadores Ultrasonográficos para enfermedades genéticas Autores: Dra. Lianne González

Más detalles

ISOINMUNIZACIÓN AL FACTOR RH Y ANEMIA FETAL

ISOINMUNIZACIÓN AL FACTOR RH Y ANEMIA FETAL ISOINMUNIZACIÓN AL FACTOR RH Y ANEMIA FETAL ARTURO CARDONA OSPINA Ginecobstetra Universidad de Antioquia Fetólogo FETUS Brasil Coordinador de la Unidad Materno Fetal de la Clínica del Prado Medellín Colombia

Más detalles

CAP ITULO XII HERENCIA

CAP ITULO XII HERENCIA CAP ITULO XII HERENCIA Algunas enfermedades son genéticas en origen y por lo tanto son transmitidas en familias. La mayoría de las enfermedades de inmunodeficiencia son heredades en alguno de los dos diferentes

Más detalles

Estudio de coste-efectividad del cribado combinado del síndrome de Down en el primer trimestre de gestación

Estudio de coste-efectividad del cribado combinado del síndrome de Down en el primer trimestre de gestación Estudio de coste-efectividad del cribado combinado del síndrome de Down en el primer trimestre de gestación Tapia Lanuza A Servicio de Análisis Clínicos, Hospital de Barbastro. atapia@salud.aragon.es Resumen

Más detalles

GUÍA CLÍNICA DIAGNÓSTICO PRENATAL DE LAS ANOMALÍAS CROMOSÓMICAS Y MONOGÉNICAS: ESTIMACIÓN DE RIESGOS

GUÍA CLÍNICA DIAGNÓSTICO PRENATAL DE LAS ANOMALÍAS CROMOSÓMICAS Y MONOGÉNICAS: ESTIMACIÓN DE RIESGOS 1 GUÍA CLÍNICA DIAGNÓSTICO PRENATAL DE LAS ANOMALÍAS CROMOSÓMICAS Y MONOGÉNICAS: ESTIMACIÓN DE RIESGOS Unidad Clínica de Diagnóstico Prenatal, Área de Medicina Fetal, Servicio de Medicina Materno-Fetal.

Más detalles

ARTÍCULO DE REVISIÓN. Introducción

ARTÍCULO DE REVISIÓN. Introducción ARTÍCULO DE REVISIÓN Diagnóstico prenatal no invasivo basado en ADN libre fetal: actualización Walter Ricardo Ventura Laveriano 1,2 1 Past Fellow Harris Birthright Research Centre for Fetal Medicine, King

Más detalles

Screening de aneuploidías del primer trimestre

Screening de aneuploidías del primer trimestre Servicio de Obstetricia y Ginecología Hospital Universitario Virgen de las Nieves Granada Mariña Naveiro Fuentes. 5 de mayo de 2011 Introducción: Aneuploidía es una anomalía numérica que afecta a uno o

Más detalles

PALABRAS CLAVES Amniocentesis, Diagnóstico prenatal, Cariotipo, Bandas G.

PALABRAS CLAVES Amniocentesis, Diagnóstico prenatal, Cariotipo, Bandas G. DIAGNOSTICO PRENATAL DE ABERRACIONES CROMOSOMICAS EN CULTIVO DE LIQUIDO AMNIOTICO MEDIANTE TINCION DE BANDAS G 1 Moises Polo, 2 Carlos Ramos y 1 Luis Sotillo 1 Centro Nacional de Genética Médica de Panamá

Más detalles

GUIA CLINICA: MANEJO DE LA GESTACION CON TRANSLUCENCIA NUCAL AUMENTADA EN PRIMER TRIMESTRE.

GUIA CLINICA: MANEJO DE LA GESTACION CON TRANSLUCENCIA NUCAL AUMENTADA EN PRIMER TRIMESTRE. 1/7 GUIA CLINICA: MANEJO DE LA GESTACION CON TRANSLUCENCIA NUCAL AUMENTADA EN PRIMER TRIMESTRE. Unidad de Diagnóstico Prenatal. Servicio de Medicina Materno-Fetal. Institut Clínic de Obstetricia, Ginecología

Más detalles

DIAGNÓSTICO PRENATAL DE CROMOSOMOPATÍAS. Jessica Nogueira García R1 Ginecología y Obstetricia

DIAGNÓSTICO PRENATAL DE CROMOSOMOPATÍAS. Jessica Nogueira García R1 Ginecología y Obstetricia DIAGNÓSTICO PRENATAL DE CROMOSOMOPATÍAS Jessica Nogueira García R1 Ginecología y Obstetricia Qué es el diagnóstico prenatal? Acciones diagnósticas durante el embarazo para detectar un defecto congénito

Más detalles

Hada C. Macher Manzano FEA del Servicio de Bioquímica Clínica del Hospital Universitario Virgen del Rocío UGC LACUS

Hada C. Macher Manzano FEA del Servicio de Bioquímica Clínica del Hospital Universitario Virgen del Rocío UGC LACUS Hada C. Macher Manzano FEA del Servicio de Bioquímica Clínica del Hospital Universitario Virgen del Rocío UGC LACUS El ADN circulante es el que encontramos en plasma o suero, no unido a células, circulando

Más detalles

ABERRACIONES CROMOSÓMICAS NUMÉRICAS Y ESTRUCTURALES. DRA. BEATRIZ E. DE LA FUENTE CORTEZ 3 AGOSTO 2015

ABERRACIONES CROMOSÓMICAS NUMÉRICAS Y ESTRUCTURALES. DRA. BEATRIZ E. DE LA FUENTE CORTEZ 3 AGOSTO 2015 ABERRACIONES CROMOSÓMICAS NUMÉRICAS Y ESTRUCTURALES. DRA. BEATRIZ E. DE LA FUENTE CORTEZ 3 AGOSTO 2015 Caso Clínico 1 Recién nacido masculino de 4 días de vida, valorado por presentar rasgos dismórficos

Más detalles

VALORACIÓN DEL HUESO NASAL, DUCTUS VENOSO Y REGURGITACIÓN TRICUSPÍDEA PARA EL CRIBADO DEL SÍNDROME DE DOWN. SU UTILIDAD EN RIESGOS INTERMEDIOS

VALORACIÓN DEL HUESO NASAL, DUCTUS VENOSO Y REGURGITACIÓN TRICUSPÍDEA PARA EL CRIBADO DEL SÍNDROME DE DOWN. SU UTILIDAD EN RIESGOS INTERMEDIOS UNIVERSIDAD AUTÓNOMA DE MADRID FACULTAD DE MEDICINA Departamento de Obstetricia y Ginecología VALORACIÓN DEL HUESO NASAL, DUCTUS VENOSO Y REGURGITACIÓN TRICUSPÍDEA PARA EL CRIBADO DEL SÍNDROME DE DOWN.

Más detalles

ECOGRAFÍA DE LA SEMANA 12. MARCADORES ECOGRÁFICOS. M. Teresa Aguilar Romero

ECOGRAFÍA DE LA SEMANA 12. MARCADORES ECOGRÁFICOS. M. Teresa Aguilar Romero Servicio de Obstetricia y Ginecología Hospital Universitario Virgen de las Nieves Granada ECOGRAFÍA DE LA SEMANA 12. MARCADORES ECOGRÁFICOS. M. Teresa Aguilar Romero INTRODUCCIÓN Las anomalías cromosómicas

Más detalles

Sistemática del diagnóstico prenatal de malformaciones fetales

Sistemática del diagnóstico prenatal de malformaciones fetales Sistemática del diagnóstico prenatal de malformaciones fetales Dr. Pedro Morales Servicio de Obstetricia y Ginecología Hospital Universitario de Alava Vitoria-Gasteiz Entrada habitual: Vamos a ver si es

Más detalles

EMBARAZO MULTIPLE. Federico Duarte Sainina Martínez Clara Olmedo RESIDENTES DE PRIMER AÑO

EMBARAZO MULTIPLE. Federico Duarte Sainina Martínez Clara Olmedo RESIDENTES DE PRIMER AÑO Federico Duarte Sainina Martínez Clara Olmedo RESIDENTES DE PRIMER AÑO Definición:! Desarrollo de dos o mas fetos en la cavidad uterina en simultáneo. EMBARAZO GEMELAR: Clasificación:! Dicigóticos: 75%!

Más detalles

Dra. en C. Carla Santana Torres

Dra. en C. Carla Santana Torres "LA IMPORTANCIA DEL ANÁLISIS DE LOS MARCADORES BIOQUÍMICOS EN EL PRIMER TRIMESTRE DE GESTACIÓN PARA LA PREVENCIÓN DE PREECLAMPSIA Y MUERTES MATERNO-FETALES." Dra. en C. Carla Santana Torres OBJETIVO Dar

Más detalles

Curs de genètica aplicada a Medicina Fetal

Curs de genètica aplicada a Medicina Fetal Curs de genètica aplicada a Medicina Fetal MA Sánchez Durán Diciembre 2015 Introducción Detección de defectos congénitos Desarrollo Genética 2 7 7 Infecciones Monogénicos 55 25 Cromosómicos Poligénico

Más detalles