1. Los triacilglicéridos o grasas son utilizados en la alimentación humana.

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamaño: px
Comenzar la demostración a partir de la página:

Download "1. Los triacilglicéridos o grasas son utilizados en la alimentación humana."

Transcripción

1 OPCION A 1. Los triacilglicéridos o grasas son utilizados en la alimentación humana. a) Explique su composición química (0,5 puntos). b) Explique la diferencia, desde el punto de vista químico, entre los aceites (grasas líquidas a temperatura ambiente) y los sebos (grasa sólidas a temperatura ambiente) (0,5 puntos). c) Explique en qué consiste la saponificación (0,5 puntos). d) Mencione dos grupos de lípidos insaponificables (0,5 puntos). 2. Las mitocondrias son unos orgánulos que están presentes en las células eucariotas. a) Haga un esquema o dibujo de una mitocondria y señale sus componentes (1 punto). b) Indique la localización en las mitocondrias de los siguientes procesos metabólicos: cadena de transporte de electrones y ciclo de Krebs (0,5 puntos). c) Cómo se llaman los productos del ciclo de Krebs que al oxidarse ceden sus electrones a la cadena de transporte electrónico?, cuál es el aceptor final de los electrones? (0,5 puntos). 3. Respecto al ciclo celular. a) Defina el estado de interfase de dicho ciclo, indique en qué forma se encuentran el material genético de la célula en ese estado (0,5 puntos). b) Señale los distintos períodos en los que se divide la interfase (0,75 puntos). c) Explique lo que ocurre en cada uno de ellos (0,75 puntos). 4. La siguiente secuencia nucleotídica corresponde a un fragmento del inicio de un gen de una cepa bacteriana: 3 TACAATTCCCGGGCAACACAC 5 a) Escriba la secuencia de bases del ARN mensajero que se puede sintetizar e indique su polaridad (0,5 puntos). b) Cuál es el número máximo de aminoácidos que puede codificar este fragmento (0,5 puntos). c) Qué características del código genético ha utilizado para determinar el número de aminoácidos? (0,5 puntos). d) Si se detectara una variante de la cepa que produjera un polipéptido de cinco aminoácidos, cómo pudo producirse la variante? (0,5 puntos). 5. En la industria alimentaria existen procesos en los que se utilizan levaduras. a) Ponga un ejemplo de proceso industrial relacionado con la industria alimentaria en el que se utilicen levaduras e indique cómo se denomina el proceso metabólico que tiene lugar (0,5 puntos). b) Cuál es el balance global del proceso metabólico citado anteriormente? (0,5 puntos). c) Realice un esquema de la organización celular de las levaduras. (1 punto).

2 OPCION B 1. En relación con los glúcidos: a) Indique si los siguientes compuestos: sacarosa, almidón, glucógeno y lactosa son disacáridos o polisacáridos (1 punto). b) En relación con los compuestos indicados en el apartado anterior, indique en qué tipo de célula, animal o vegetal, se encuentran los homopolisacáridos y cuál es su función (1 punto). 2. La siguiente vía metabólica, cuya reacción global se indica a continuación, es esencial para el metabolismo de las células animales: Glucosa + 2 NAD ADP + 2 P i fi 2 Piruvato + 2 NADH + 2 H ATP + 2 H 2 O a) Indique el nombre de la vía y en qué compartimento celular se produce (0,5 puntos). b) Explique los posibles destinos metabólicos que puede tener el piruvato producido (1 punto). c) Escriba la reacción global de oxidación de la glucosa (0,5 puntos). 3. En relación con los procesos de mitosis y meiosis celulares: a) Haga un esquema comparativo entre la metafase mitótica y la primera metafase meiótica en un organismo 2n = 4 cromosomas (1 punto). b) Durante la mitosis, indique en qué momento se transforma la cromatina en cromosomas y cuándo se transforman los cromosomas en cromatina (0,5 puntos). c) En la meiosis: indique en qué fase o período se separan los cromosomas y en qué período o fase se separan las cromátidas (0,5 puntos). 4. EN relación la expresión de la información genética: a) Cite y defina los dos procesos que tiene lugar en la expresión de la información genética (1 punto). b) Dónde tienen lugar los procesos anteriores en células procariotas y eucariotas (1 punto). 5. En relación con la respuesta inmunitaria primaria y secundaria: a) Cuando se origina la respuesta inmune primaria y cuando la secundaria (0,5 puntos). b) Explique dos diferencias entre la respuesta inmune primaria y la secundaria e indique qué tipo de células son las responsables de las diferencias entre ambos tipos de respuestas (0,75 puntos). c) Qué método de inmunización artificial se basa en inducir el desarrollo de la respuesta inmune?. Explique el procedimiento de este método y su finalidad (0,75 puntos).

3 OPCION A 1. Solución: a) Los triglicéridos son lípidos saponificables que están compuestos por una molécula de glicerina que se encuentra esterificada con tres ácidos grasos. El enlace éster tiene lugar entre el grupo hidroxilo (-OH) de un alcohol, en este caso es la glicerina, y el grupo carboxilo (- COOH) de un ácido graso. También reciben el nombre de grasas neutras porque no tienen carga eléctrica. Los triglicéridos son moléculas apolares y prácticamente insolubles en agua debido a que los grupos hidroxilo (-OH) de la glicerina, que son polares, están unidos mediante enlaces éster a los grupos carboxilo (-COOH) de los ácidos grasos. Los triglicéridos suponen la reserva energética tanto en animales como en vegetales. Se acumulan en vacuolas en las células vegetales y en mamíferos en una células especiales denominadas adipocitos. Otra importante función, es actuar como aislantes térmicos y almacén de alimento. b) Los triglicéridos que son sólidos a temperatura ambiente, se les conoce generalmente como grasas o sebos y los ácidos grasos que los constituyen son saturados (no poseen dobles enlaces en su molécula) y de cadena larga, por tanto, de punto de fusión elevado. Por el contrario, los triglicéridos cuyos ácidos grasos son insaturados son líquidos y se les denomina aceites. Por hidrogenación los ácidos grasos insaturados pierden los dobles enlaces pasando el triglicérido al estado sólido. Esta propiedad es aprovechada en la industria para fabricar mantequillas a partir de aceites. c) La principal diferencia entre los lípidos saponificables y los insaponificables estriba en que los primeros contienen ácidos grasos en su estructura molecular, mientras que los lípidos insaponificables carecen de ellos. Los ácidos grasos tienen un comportamiento de ácidos moderadamente fuertes, que les permite realizar reacciones de esterificación y de saponificación. - La esterificación es la reacción química que se produce entre un ácido graso y un alcohol, con formación de un éster y una molécula de agua. Ácido graso + alcohol esterificación éster + agua

4 Mediante hidrólisis los ésteres se rompen liberando el ácido graso y el alcohol - La saponificación es una reacción típica de los ácidos grasos en la cual reaccionan con álcalis o bases obteniéndose una sal del ácido graso, denominada jabón. Ácido graso + base saponificación jabón + agua d) Los lípidos insaponificables no pueden realizar la reacción de saponificación ya que carecen de ácidos grasos en su estructura molecular, es decir, carecen de enlaces ésteres que producen jabones por hidrólisis alcalina. Los lípidos insaponificables se clasifican en esteroides, terpenos y prostaglandinas. Entre los esteroides destacan los esteroles, que incluyen numerosas moléculas de interés biológico, tales como el colesterol. 2. Solución: a) La mitocondria es un orgánulo citoplasmático presente de forma permanente en las células eucariotas, cuya función es fundamentalmente energética al intervenir en la respiración celular aerobia. Las mitocondrias presentan formas variables, observándose al microscopio electrónico como formaciones filamentosas o granulares. Sin embargo, suelen tener forma cilíndrica, a modo de bastón. El diámetro suele ser constante y oscila entre las 0,5 y 1 µm. Su estructura se observa en corte longitudinal. Son orgánulos limitados por una doble membrana: la membrana mitocondrial externa es lisa, mientras que la membrana mitocondrial interna forma unas invaginaciones o repliegues denominadas crestas mitocondriales. Entre ambas membranas existe un espacio intermembranoso. El espacio delimitado por la membrana interna es la matriz mitocondrial y contiene, entre otros componentes, ADN y ribosomas. Espacio intermembrana Matriz mitocondrial ADN Ribosomas Cresta mitocondrial Membrana mitocondrial externa Membrana mitocondrial interna

5 b) El ciclo de Krebs se desarrolla en la matriz mitocondrial donde se encuentran todas las enzimas necesarias para su funcionamiento. La cadena de transporte electrónico consta de una serie de enzimas oxidorreductasas que recogen los electrones de los coenzimas reducidos obtenidos en fases catabólicas anteriores y los van pasando de una a otra hasta un aceptor final de electrones, el oxígeno molecular, que al reducirse, origina agua. Esta cadena de transporte electrónico se encuentra ubicada en la membrana de las crestas mitocondriales. c) El ciclo de Krebs está constituido por una serie de reacciones que se desarrollan a expensas de una serie de ácidos orgánicos que forman el denominado ciclo. También se le llama ciclo del ácido cítrico o de los ácidos tricarboxílicos porque dicho ácido, que posee tres grupos carboxilo (-COOH) es uno de los compuestos que aparecen en él. Durante el ciclo de Krebs, el grupo acetilo del acetil-coa procedente del piruvato obtenido en la glucólisis o de la degradación metabólica de ácidos grasos, es degradado a CO 2 y a átomos de hidrógeno. Los protones obtenidos de la deshidrogenación son transferidos a las coenzimas NADH y FADH 2. La reoxidación de las coenzimas tiene lugar en la cadena respiratoria obteniéndose ATP mediante fosforilación oxidativa. Los electrones cedidos por las coenzimas a la cadena de transporte van pasando de una molécula transportadora a otra hasta el aceptor final de los electrones, que es el oxígeno molecular. 3. Solución: a) Una propiedad de las células que están en crecimiento, tanto procariotas como eucariotas, es la capacidad de duplicar su ADN genómico y pasar copias idénticas de esta información a las células hijas. Este fenómeno se denomina ciclo celular, comprende el período de tiempo desde que se forma una células hasta que se divide y está constituido por dos etapas o estados claramente diferentes: - El estado de división celular o mitosis y separación de las células hijas. - El estado de no división o interfase o periodo de crecimiento celular. En este estado la célula realiza sus funciones habituales y, si está destinada a la división celular, la duplicación o replicación del ADN. El material genético o ADN de una célula eucariota que se encuentra en interfase se asocia a unas proteínas denominadas histonas constituyendo una estructura denominada cromatina. b y c)la interfase comprende a su vez tres períodos: G 1, S y G 2 y dura aproximadamente el 90 % del total del ciclo celular. - Fase G 1 : es el período más variable en el tiempo del ciclo celular, pudiendo durar de 2 o 3 horas a muchos días, o incluso años. Es una fase de alta actividad metabólica, donde los genes se transcriben y traducen en proteínas. La observación de esta fase al microscopio electrónico se caracteriza por la presencia del diplosoma que está formado únicamente por los dos centriolos característicos. Hay determinadas células que detienen su ciclo en la fase G 0, experimentan una serie de transformaciones que las conducen a una diferenciación celular, de modo que la célula se

6 especializa y expresa sólo aquellos genes que le permiten desempeñar su actividad concreta en el tejido. Es el caso de células altamente especializadas, como las neuronas, cuya diferenciación celular no las permite volver a dividirse. - Fase S: su nombre viene de síntesis ya que durante esta fase ocurre la replicación del ADN y la síntesis de proteínas e histonas. Cada molécula de ADN se replica en dos moléculas idénticas de ADN; de modo que las histonas y las otras proteínas cromosómicas se unen rápidamente al nuevo ADN. Comienza la duplicación del diplosoma, al formar cada centriolo otro perpendicular a él. - Fase G 2 : Durante esta fase no hay síntesis de ADN, aunque si éste está dañado, se puede reparar. Se produce un continuo crecimiento celular y continúa también la síntesis de otras macromoléculas (ARN, proteínas, lípidos, microtúbulos del huso acromático,...). Los centriolos, ya duplicados, forman dos diplosomas que permanecen reunidos en el mismo centrosoma. Tras la fase G 2 la célula entra en la fase M (de mitosis) en la cual la célula se divide en dos células hijas. 4. Solución: a) La transcripción: es la primera fase de la síntesis proteica. El proceso consiste en la síntesis de un ARNm, tomando como molde una de las dos cadenas del ADN y está catalizado por las ARN-polimerasas. Estas enzimas se desplazan a lo largo de la cadena de ADN leyéndola en sentido 3-5, mientras que el sentido de síntesis del ARN es 5-3. Para poder averiguar la secuencia de las dos hebras de ADN del que proviene el ARN de la figura hay que tener en cuenta: 1. La ley de complementaridad de bases. 2. El sentido de síntesis de las ARN polimerasas. 3. La timina es exclusiva del ADN y el uracilo del ARN. Por lo tanto, la secuencia del ARNm transcrita a partir de la secuencia de ADN de la figura será la siguiente: ADN 3 TACAATTCCCGGGCAACACAC 5 ARNm 5 AUGUUAAGGGCCCGUUGUGUG 3 b y c) La clave genética establece la relación que hay entre la secuencia de nucleótidos de los genes y la secuencia de aminoácidos de las proteínas, es decir, la relación existente entre la estructura primaria de ambos tipos de biomoléculas. Para descifrar el código genético se utilizó como hipótesis de trabajo que tres bases (un codón) codificaban un aminoácido, ya que el número de secuencias posibles formadas por tres nucleótidos es 4 3 = 64, número más que suficiente para codificar los 20 aminoácidos proteicos. Si los codones se formasen con dos letras, el número de secuencias posibles sería 4 2 = 16 y, por tanto, no sería un número suficiente para codificar los 20 aminoácidos.

7 Además hay que tener en cuenta una característica general del código genético que consiste en que la lectura es sin comas o sin solapamiento. Partiendo de lo anteriormente expuesto, el número máximo de aminoácidos que puede codificar el fragmento del enunciado es 7. 5 AU G/UUA/AGG/GCC/CGU/UGU/GUG 3 d) Un gen es un segmento de ADN con la información necesaria para la síntesis de una cadena polipeptídica. La secuencia de nucleótidos de ese gen es específica para cada cadena polipeptídica. Cualquier cambio en la secuencia de nucleótidos de un gen conduce a alteraciones o cambios en la molécula que codifica. Las mutaciones moleculares, también denominadas puntuales, son las que afectan a la secuencia de nucleótidos. Las mutaciones puntuales pueden producirse por: a) Sustitución de nucleótidos o bases: es decir, por ejemplo, donde existía un nucleótido de adenina, se instala uno de timina. b) Pérdida de nucleótidos. c) Inserción de nuevos nucleótidos. Por ejemplo, en el caso de una mutación por sustitución de bases al sólo afectar a uno de los nucleótidos, es un único triplete el que se ve afectado. Como el código genético es degenerado, el triplete puede sustituirse por otro que codifique el mismo aminoácido, de modo que la mutación no afectaría al enzima y sería una mutación silenciosa o nula. Sin embargo, si se detectase una variante de la cepa que produjese un polipéptido de cinco aminoácidos se debería a que la mutación puntual daría lugar a un codón de terminación. 5. Solución: Las bacterias, que son organismos procariotas que están incluidos dentro del reino Monera, y las levaduras, dentro de los Hongos, juegan un papel importante en la industria alimentaria interviniendo en la fabricación de productos alimenticios, como por ejemplo, derivados lácteos (queso y yogur), artículos de panadería y muchas de las bebidas alcohólicas. a) En la producción de pan las levaduras utilizadas son Saccharomyces cerevisiae. En general, estos microorganismos utilizados en la industria alimentaria llevan a cabo un catabolismo anaeróbico denominado fermentación alcohólica, como ruta metabólica para la obtención de energía. Son los productos resultantes de este proceso los que utiliza la industria alimentaria en su provecho. b) La fermentación es un tipo de catabolismo parcial, que se caracteriza por ser un proceso de oxidación incompleta, típico de los organismos anaeróbicos. Se realiza, pues, sin la intervención del oxígeno. Durante la fermentación, la energía obtenida procede, igual que en la respiración aerobia, de las reacciones de oxido-reducción habidas durante el catabolismo de la glucosa (glucólisis), pero en la fermentación las coenzimas reducidas no ceden sus electrones a una cadena cuyo aceptor final es el oxígeno, sino que los ceden directamente a un compuesto orgánico que se reduce y es el producto característico de cada fermentación (láctica, alcohólica...).

8 La fermentación alcohólica producida por Saccharomyces cerevisiae es un paso esencial en la producción de pan. Se produce a partir de moléculas de glucosa (presentes en la masa), que sufren una glucólisis cuyo producto final es el ácido pirúvico. Este ácido pirúvico en condiciones anaeróbicas se descarboxila para transformarse en acetaldehído, el cual se reduce a alcohol etílico por acción del NADH 2 conviertiéndose sí en el aceptor final de los electrones del NADH obtenido en la glucólisis. ácido pirúvico acetaldehído + CO 2 acetaldehído + NADH 2 etanol + NAD + c) Las levaduras son hongos filamentosos unicelulares eucarióticos de forma ovoide. Se trata de organismos heterótrofos que carecen de cloroplastos. Saccharomyces cerevisiae presenta una pared celular rígida, estructuralmente semejante a las paredes celulares vegetales, pero muy diferente desde el punto de vista químico. Al tratarse de un organismo eucariota presenta las estructuras características:

2.-FISIOLOGÍA CELULAR

2.-FISIOLOGÍA CELULAR 2.-FISIOLOGÍA CELULAR METABOLISMO CELULAR Metabolismo. Conjunto de reacciones químicas que se dan en un organismo vivo. Se pueden clasificar en dos grandes grupos. Catabolismo: Reacciones degradativas

Más detalles

Los elementos químicos más abundantes en los seres vivos son: Agua y proteínas. Carbono, oxígeno, hidrógeno, nitrógeno, fósforo y azufre.

Los elementos químicos más abundantes en los seres vivos son: Agua y proteínas. Carbono, oxígeno, hidrógeno, nitrógeno, fósforo y azufre. Los elementos químicos más abundantes en los seres vivos son: Agua y proteínas. Carbono, oxígeno, hidrógeno, nitrógeno, fósforo y azufre. Glúcidos, lípidos, proteínas, ácidos nucleicos. Oxígeno, calcio,

Más detalles

Esta prueba presenta DOS OPCIONES DIFERENTES, DEBERÁ ELEGIR UNA DE ELLAS Cada opción consta de tres bloques de preguntas TODAS SON OBLIGATORIAS

Esta prueba presenta DOS OPCIONES DIFERENTES, DEBERÁ ELEGIR UNA DE ELLAS Cada opción consta de tres bloques de preguntas TODAS SON OBLIGATORIAS Pruebas de Acceso a Enseñanzas Universitarias Oficiales de Grado (Bachillerato L.O.E) Curso 2010-2011 Materia: BIOLOGÍA Esta prueba presenta DOS OPCIONES DIFERENTES, DEBERÁ ELEGIR UNA DE ELLAS Cada opción

Más detalles

Las moléculas de los seres vivos Control de la actividad celular Fuente de energía para las células:

Las moléculas de los seres vivos Control de la actividad celular Fuente de energía para las células: Las moléculas de los seres vivos Control de la actividad celular Fuente de energía para las células: 1. ATP 2. La respiración celular 3. La fermentación Proceso de fotosíntesis La fuente principal de energía

Más detalles

http://www.biologia54paternal.blogspot.com Unidad 7: Respiración Celular

http://www.biologia54paternal.blogspot.com Unidad 7: Respiración Celular 1 La energía lumínica es capturada por las plantas verdes y otros organismos fotosintéticos, que la transforman en energía química fijada en moléculas como la glucosa. Estas moléculas son luego degradadas

Más detalles

TEMA 5: Nutrición y metabolismo

TEMA 5: Nutrición y metabolismo TEMA 5: Nutrición y metabolismo 5.1 Concepto de nutrición. Nutrición autótrofa y heterótrofa. Los seres vivos son sistemas abiertos, esto quiere decir que hay un intercambio continuo de materia y energía.

Más detalles

Metabolismo metabolismo rutas metabólicas. dos fases anabolismo ATP NADPH catabolismo ATP NADH NADPH convergente interconectados

Metabolismo metabolismo rutas metabólicas. dos fases anabolismo ATP NADPH catabolismo ATP NADH NADPH convergente interconectados Metabolismo El metabolismo es el conjunto de procesos, intercambios y transformaciones que tienen lugar en el interior de la célula, catalizados por enzimas. Estos procesos se organizan en rutas metabólicas.

Más detalles

METABOLISMO CELULAR. Es el conjunto de reacciones químicas a través de las cuales el organismo intercambia materia y energía con el medio

METABOLISMO CELULAR. Es el conjunto de reacciones químicas a través de las cuales el organismo intercambia materia y energía con el medio METABOLISMO CELULAR Es el conjunto de reacciones químicas a través de las cuales el organismo intercambia materia y energía con el medio Reacciones Celulares Básicas. Los sistemas vivos convierten la energía

Más detalles

BIOENERGÉTICA CUESTIONARIO

BIOENERGÉTICA CUESTIONARIO BIOENERGÉTICA CUESTIONARIO 1) a) El esquema representa una mitocondria con diferentes detalles de su estructura. Identifique las estructuras numeradas del 1 al 8. b) Indique dos procesos de las células

Más detalles

LA NUTRICIÓN CELULAR

LA NUTRICIÓN CELULAR LA NUTRICIÓN CELULAR La composición química de los seres vivos Todos los seres vivos estamos formados por células y constituidos por el mismo tipo de sustancias químicas, las biomoléculas. Estas biomoléculas

Más detalles

Catabolismo de la glucosa Ocurre en cuatro etapas:

Catabolismo de la glucosa Ocurre en cuatro etapas: 1 Catabolismo de la glucosa Ocurre en cuatro etapas: 1.- Glucólisis 2.- Descarboxilación oxidativa 3.- Ciclo de Krebs 4.- Cadena respiratoria o fosforilación oxidativa 1.- GLUCÓLISIS Ocurre en el citoplasma.

Más detalles

Capítulo 5: BIOMOLÉCULAS

Capítulo 5: BIOMOLÉCULAS Capítulo 5: BIOMOLÉCULAS De qué están hechas las células? Al analizar los átomos y moléculas presentes en las células, se observa que todas ellas se asemejan: una gran proporción es agua; el resto es un

Más detalles

TEMARIO PARA EL EXAMEN DE BIOQUÍMICA

TEMARIO PARA EL EXAMEN DE BIOQUÍMICA TEMARIO PARA EL EXAMEN DE BIOQUÍMICA PARTE I. ESTRUCTURA BIOLÓGICA Y QUÍMICA DE LAS PROTEÍNAS 1. CARACTERÍSTICAS QUÍMICAS DE LA MATERIA VIVA 1. La mayoría de los organismos están compuestos solamente de

Más detalles

Biología I. Bioenergética. Examen resuelto del bloque 4: Luis Antonio Mendoza Sierra y Enrique Mendoza Sierra Editorial Trillas ISBN 978-607-17-0640-9

Biología I. Bioenergética. Examen resuelto del bloque 4: Luis Antonio Mendoza Sierra y Enrique Mendoza Sierra Editorial Trillas ISBN 978-607-17-0640-9 Biología I Luis Antonio Mendoza Sierra y Enrique Mendoza Sierra Editorial Trillas ISBN 978-607-17-0640-9 Examen resuelto del bloque 4: Bioenergética D.R. 2011, Luis Antonio Mendoza Sierra Este documento

Más detalles

PREGUNTAS TEST CORRESPONDIENTES A LOS TEMAS 1 AL 5

PREGUNTAS TEST CORRESPONDIENTES A LOS TEMAS 1 AL 5 PREGUNTAS TEST CORRESPONDIENTES A LOS TEMAS 1 AL 5 Las preguntas de test que le adjuntamos corresponden a exámenes de las últimas convocatorias. Una vez que finalicen el estudio de los cinco primeros capítulos,

Más detalles

PRUEBA DE ACCESO A LA UNIVERSIDAD CONVOCATORIA DE SEPTIEMBRE DE 2012. EJERCICIO DE: BIOLOGÍA TIEMPO DISPONIBLE: 1 hora 30 minutos

PRUEBA DE ACCESO A LA UNIVERSIDAD CONVOCATORIA DE SEPTIEMBRE DE 2012. EJERCICIO DE: BIOLOGÍA TIEMPO DISPONIBLE: 1 hora 30 minutos PRUEBA DE ACCESO A LA UNIVERSIDAD CONVOCATORIA DE SEPTIEMBRE DE 2012 EJERCICIO DE: BIOLOGÍA TIEMPO DISPONIBLE: 1 hora 30 minutos PUNTUACIÓN QUE SE OTORGARÁ A ESTE EJERCICIO: (véanse las distintas partes

Más detalles

Procariota y Eucariota

Procariota y Eucariota Célula Todas las células comparten dos características esenciales. La primera es una membrana externa, la membrana celular -o membrana plasmática- que separa el citoplasma de la célula de su ambiente externo.

Más detalles

Textos de refuerzo. 2. Formación de ADN y ARN. 1. Principios de bioquímica. Proteínas. 1 Unidad 3

Textos de refuerzo. 2. Formación de ADN y ARN. 1. Principios de bioquímica. Proteínas. 1 Unidad 3 1. Principios de bioquímica 2. Formación de ADN y ARN 1. Principios de bioquímica La bioquímica estudia los componentes químicos de los seres vivos: proteínas, carbohidratos, lípidos y ácidos nucleicos.

Más detalles

Esta prueba presenta DOS OPCIONES DIFERENTES, DEBERÁ ELEGIR UNA DE ELLAS Cada opción consta de tres bloques de preguntas TODAS SON OBLIGATORIAS

Esta prueba presenta DOS OPCIONES DIFERENTES, DEBERÁ ELEGIR UNA DE ELLAS Cada opción consta de tres bloques de preguntas TODAS SON OBLIGATORIAS Pruebas de Acceso a Enseñanzas Universitarias Oficiales de Grado (Bachillerato L.O.E) Curso 2010-2011 Materia: BIOLOGÍA Esta prueba presenta DOS OPCIONES DIFERENTES, DEBERÁ ELEGIR UNA DE ELLAS Cada opción

Más detalles

Tutoría 4: Unidad 2, Capítulos 2 y 3

Tutoría 4: Unidad 2, Capítulos 2 y 3 Tutoría 4: Unidad 2, Capítulos 2 y 3 Una de las alternativas que, desde, te ofrecemos para acompañarte en el estudio de esta materia, son las tutorías presenciales. En el campus encontrarás el Cronograma

Más detalles

Biología I. Biología I. Tema 6. Respiración celular. Explicar en qué consiste la respiración aeróbica y las etapas que la conforman.

Biología I. Biología I. Tema 6. Respiración celular. Explicar en qué consiste la respiración aeróbica y las etapas que la conforman. Biología I Tema 6. Respiración celular 1 Objetivo de aprendizaje del tema Al finalizar el tema serás capaz de: Explicar en qué consiste la respiración aeróbica y las etapas que la conforman. Explicar en

Más detalles

ARAGÓN (ZARAGOZA) / JUNIO 02. LOGSE / BIOLOGÍA / EXAMEN COMPLETO

ARAGÓN (ZARAGOZA) / JUNIO 02. LOGSE / BIOLOGÍA / EXAMEN COMPLETO TIEMPO DISPONIBLE: 1 H. 30 M. Se valorará el uso de vocabulario y la notación científica. Los errores ortográficos, el desorden, la falta de limpieza en la presentación y la mala redacción, podrán suponer

Más detalles

PREGUNTAS PAU. DIVISIÓN CELULAR Y CÉLULA VEGETAL

PREGUNTAS PAU. DIVISIÓN CELULAR Y CÉLULA VEGETAL PREGUNTAS PAU. DIVISIÓN CELULAR Y CÉLULA VEGETAL 1.-El esquema representa una serie de reacciones químicas (metabolismo) que tienen lugar en el interior de una célula. a.- Identifica los orgánulos I y

Más detalles

La división celular. .Interfase

La división celular. .Interfase .Interfase La división celular El conjunto de procesos propios de la interfase hacen posible el mantenimiento o el incremento de las estructuras celulares, lo que conlleva, en principio, un incremento

Más detalles

TEMA 16: EL CATABOLISMO.

TEMA 16: EL CATABOLISMO. TEMA 16: EL CATABOLISMO. 1 Entre los distintos tipos de biomoléculas orgánicas que forman parte de las células vivas hay que distinguir por un lado a las proteínas y los ácidos nucleicos, cuya misión fundamental

Más detalles

EL CATABOLISMO. donde tiene lugar, c) qué se genera y d) para qué sirven.

EL CATABOLISMO. donde tiene lugar, c) qué se genera y d) para qué sirven. Concepto de catabolismo y mecanismo general de obtención de energía (ATP, respiración, fermentación). Panorámica general del catabolismo (glúcidos, lípidos y aminoácidos). Glucólisis, ciclo de Krebs, β-oxidación

Más detalles

TEMA 10 EL METABOLISMO CELULAR. CATABOLISMO. 1. Características del metabolismo celular

TEMA 10 EL METABOLISMO CELULAR. CATABOLISMO. 1. Características del metabolismo celular TEMA 10 EL METABOLISMO CELULAR. CATABOLISMO 1. Características del metabolismo celular - El Metabolismo celular es el conjunto de reacciones químicas que se produce en el interior de las células para obtener

Más detalles

Cuestiones Selectividad sobre METABOLISMO

Cuestiones Selectividad sobre METABOLISMO Cuestiones Selectividad sobre METABOLISMO 1.- Con referencia al ciclo de Krebs o ciclo de los ácidos tricarboxílicos de una célula eucariótica: a) Indique el compartimento celular en el que transcurre

Más detalles

De manera general la teoría celular moderna se resume en tres postulados:

De manera general la teoría celular moderna se resume en tres postulados: De manera general la teoría celular moderna se resume en tres postulados: La célula es la unidad básica estructural de todos los seres vivos, todos los organismos están formados por células. La célula

Más detalles

Ambientación Universitaria BIOLOGÍA. Guía de Actividades 2014

Ambientación Universitaria BIOLOGÍA. Guía de Actividades 2014 1 Ambientación Universitaria BIOLOGÍA Guía de Actividades 2014 2 I.- INTRODUCCIÓN- CONCEPTO DE CIENCIA Y VIDA 1) Lea el siguiente texto. Mencione ejemplos de lo que considere investigación en ciencias

Más detalles

Comprender el proceso de glucólisis identificando los principales reactivos y productos.

Comprender el proceso de glucólisis identificando los principales reactivos y productos. OBJETIVOS Comprender el proceso de glucólisis identificando los principales reactivos y productos. Interpretar el Ciclo de Krebs y la cadena de transporte de electrones. Comparar la respiración aeróbica

Más detalles

Preguntas de selectividad en Andalucía. Ácidos nucleicos. Análisis e interpretación de imágenes, esquemas, figuras...

Preguntas de selectividad en Andalucía. Ácidos nucleicos. Análisis e interpretación de imágenes, esquemas, figuras... Año 2001 Describa las funciones más relevantes de los nucleótidos. Cite un ejemplo de nucleótido que participe en cada una de ellas [1,5]. Explique las funciones de los distintos tipos de RNA que participan

Más detalles

TEMA 13. EL METABOLISMO CELULAR 5. PROCESOS DE OXIDO-REDUCCIO E EL METABOLISMO

TEMA 13. EL METABOLISMO CELULAR 5. PROCESOS DE OXIDO-REDUCCIO E EL METABOLISMO TEMA 13. EL METABOLISMO CELULAR 1. METABOLISMO CELULAR: GE ERALIDADES. 2. RUTAS METABÓLICAS. 3. TIPOS DE PROCESOS METABÓLICOS. 4. TIPOS METABOLICOS DE SERES VIVOS. 5. PROCESOS DE OXIDO-REDUCCIO E EL METABOLISMO

Más detalles

UNIVERSIDADES PÚBLICAS DE LA COMUNIDAD DE MADRID

UNIVERSIDADES PÚBLICAS DE LA COMUNIDAD DE MADRID UNIVERSIDADES PÚBLICAS DE LA COMUNIDAD DE MADRID PRUEBA DE ACCESO A LAS ENSEÑANZAS UNIVERSITARIAS OFICIALES DE GRADO MODELO Curso 0-0 MATERIA: BIOLOGÍA INSTRUCCIONES GENERALES Y VALORACIÓN Estructura de

Más detalles

La Célula. Unidad Fundamental delavida

La Célula. Unidad Fundamental delavida La Célula Unidad Fundamental delavida La Célula. Unidad Fundamental de la vida El descubrimiento de la célula La teoría celular Estructura de la célula Tipos de células Tipos de células eucariotas Orgánulos

Más detalles

BIOQUÍMICA TEMA 3. METABOLISMO CELULAR

BIOQUÍMICA TEMA 3. METABOLISMO CELULAR BIOQUÍMICA TEMA 3. METABOLISMO CELULAR D. Ph. Daniel Díaz Plascencia. Contacto: dplascencia@uach.mx www.lebas.com.mx QUÉ ES EL METABOLISMO CELULAR? El metabolismo se podría definir como el conjunto de

Más detalles

PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR Convocatoria mayo de 2005 BIOLOGIA

PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR Convocatoria mayo de 2005 BIOLOGIA Convocatoria mayo de 2005 BIOLOGIA a) El ADN es la molécula portadora del mensaje genético: define cómo está compuesto el ADN y qué diferencias existen entre el ADN y el ARN b) Explica qué es un gen y

Más detalles

En las células aerobias distintas vías catabólicas convergen en el ciclo de Krebs

En las células aerobias distintas vías catabólicas convergen en el ciclo de Krebs CICLO DE KREBS Material elaborado por: J. Monza, S. Doldán y S. Signorelli. En las células aerobias distintas vías catabólicas convergen en el ciclo de Krebs El ciclo de Krebs (de los ácidos tricarboxílicos

Más detalles

Laboratorio. Objetivos I N T R O D U C C I Ó N. Al finalizar este laboratorio el estudiante podrá:

Laboratorio. Objetivos I N T R O D U C C I Ó N. Al finalizar este laboratorio el estudiante podrá: Laboratorio 8 Respiración celular Objetivos Al finalizar este laboratorio el estudiante podrá: 1. Entender qué es la respiración celular, su importancia y los pasos principales de la misma. 2. Diferenciar

Más detalles

Examen nº 3 Opción A

Examen nº 3 Opción A Examen nº 3 1. Indique qué es un enlace O-glucosídico [0,2] y qué grupos funcionales participan [0,1]. Cite dos polisacáridos que se forman por la polimerización de monosacáridos de configuración α [0,15]

Más detalles

TEST (cuatro respuestas incorrectas quitan una correcta) CORRECTAS 2-D

TEST (cuatro respuestas incorrectas quitan una correcta) CORRECTAS 2-D Pruebas de Acceso a Enseñanzas de Grado. Curso 2012-13 CRITERIOS DE CORRECCIÓN Y CALIFICACIÓN. Materia: Biología Tipo 3 Esta prueba está estructurada en DOS OPCIONES (A y B). DEBERÁ ELEGIR UNA DE ELLAS

Más detalles

Tema 4.- LA CÉLULA Biología y Geología 4º ESO: La célula

Tema 4.- LA CÉLULA Biología y Geología 4º ESO: La célula Tema 4.- LA CÉLULA 1 Teoría Celular. Robert Hooke en 1665 observó las primeras células. Al analizar corcho vió unas estructuras semejantes a una panal y les llamó cellulas (celdillas). 2 Teoría Celular.

Más detalles

FLUJO DE LA INFORMACIÓN GENÉTICA REPRODUCCIÓN CELULAR Biología General

FLUJO DE LA INFORMACIÓN GENÉTICA REPRODUCCIÓN CELULAR Biología General FLUJO DE LA INFORMACIÓN GENÉTICA REPRODUCCIÓN CELULAR Biología General 1- Diga si son falsas o verdaderas las siguientes afirmaciones con respecto al núcleo celular: I. La envoltura nuclear presenta dos

Más detalles

PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR OPCIÓN C BIOLOGÍA. Lee atentamente el texto y las preguntas antes de contestar.

PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR OPCIÓN C BIOLOGÍA. Lee atentamente el texto y las preguntas antes de contestar. PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR OPCIÓN C BIOLOGÍA DATOS DEL ASPIRANTE Apellidos: CALIFICACIÓN PRUEBA Nombre: D.N.I. o Pasaporte: Fecha de nacimiento: / / Instrucciones: Lee atentamente

Más detalles

TEMA 4 CMC BIOTECNOLOGÍA

TEMA 4 CMC BIOTECNOLOGÍA Conceptos Tema 4 TEMA 4 CMC BIOTECNOLOGÍA Células eucariotas: Células con núcleo. Núcleo: Un compartimento en el interior de la célula que alberga el material genético. Citoplasma: En una célula eucariota,

Más detalles

UNIVERSIDAD AUTÓNOMA DE MADRID PRUEBA DE ACCESO A LA UNIVERSIDAD PARA MAYORES DE 25 AÑOS Convocatoria 2014 INSTRUCCIONES GENERALES Y VALORACIÓN

UNIVERSIDAD AUTÓNOMA DE MADRID PRUEBA DE ACCESO A LA UNIVERSIDAD PARA MAYORES DE 25 AÑOS Convocatoria 2014 INSTRUCCIONES GENERALES Y VALORACIÓN INSTRUCCIONES GENERALES Y VALORACIÓN INSTRUCCIONES: Lea detenidamente el enunciado del examen, elija un repertorio y respóndalo íntegramente. DURACIÓN DEL EJERCICIO: Una hora y media CALIFICACIÓN: 2 puntos

Más detalles

NIVEL QUÍMICO DE ORGANIZACIÓN DEL CUERPO HUMANO

NIVEL QUÍMICO DE ORGANIZACIÓN DEL CUERPO HUMANO NIVEL QUÍMICO DE ORGANIZACIÓN DEL CUERPO HUMANO 10. Defina macromolécula utilizando los términos polímero y monómero. Cite ejemplos. 11. Qué elementos químicos poseen los glúcidos y por qué reciben el

Más detalles

PRUEBAS DE ACCESO PARA MAYORES DE 25 AÑOS

PRUEBAS DE ACCESO PARA MAYORES DE 25 AÑOS PRUEBAS DE ACCESO PARA MAYORES DE 25 AÑOS CONVOCATORIA DE 2014 EJERCICIO DE: BIOLOGÍA TIEMPO DISPONIBLE: 1 hora 30 minutos PUNTUACIÓN QUE SE OTORGARÁ A ESTE EJERCICIO: (véanse las distintas partes del

Más detalles

Ruta de las pentosas fosfato

Ruta de las pentosas fosfato Ruta de las pentosas fosfato La ruta predominante del catabolismo de la glucosa es la glucólisis para dar piruvato, seguida por la oxidación a CO 2 en el ciclo del ácido cítrico. Un proceso alternativo,

Más detalles

5. BIOLOGÍA. BACHILLERATO (LOGSE) Prueba de acceso a la Universidad. Ejercicio de BIOLOGIA. Segunda parte de la prueba

5. BIOLOGÍA. BACHILLERATO (LOGSE) Prueba de acceso a la Universidad. Ejercicio de BIOLOGIA. Segunda parte de la prueba 84 5. BIOLOGÍA BACHILLERATO (LOGSE) Prueba de acceso a la Universidad Ejercicio de BIOLOGIA Segunda parte de la prueba Modalidad de Ciencias de la Naturaleza y de la Salud Materia obligatoria en la via

Más detalles

PRUEBA DE ACCESO A LA UNIVERSIDAD

PRUEBA DE ACCESO A LA UNIVERSIDAD PRUEBA DE ACCESO A LA UNIVERSIDAD CONVOCATORIA DE SEPTIEMBRE DE 2015 EJERCICIO DE: BIOLOGÍA TIEMPO DISPONIBLE: 1 hora 30 minutos PUNTUACIÓN QUE SE OTORGARÁ A ESTE EJERCICIO: (véanse las distintas partes

Más detalles

Evolución de la vida en la tierra:la Célula

Evolución de la vida en la tierra:la Célula Evolución de la vida en la tierra:la Célula Nuestro planeta tierra no siempre ha sido igual, sin embargo todos los astros que forman el universo están compuestos por los mismos elementos y están controlados

Más detalles

PROGRAMAS MATERIAS. MAYORES 25 AÑOS Biología

PROGRAMAS MATERIAS. MAYORES 25 AÑOS Biología 1 PROGRAMAS MATERIAS. MAYORES 25 AÑOS Biología Para superar esta prueba, el alumno deberá demostrar tener conocimientos básicos de Biología a nivel de LOGSE. PRESENTACIÓN. La Biología es la ciencia que

Más detalles

La célula vegetal: aspectos estructurales y metabólicos diferenciados

La célula vegetal: aspectos estructurales y metabólicos diferenciados La célula vegetal: aspectos estructurales y metabólicos diferenciados Descripción de la célula vegetal La célula vegetal presenta algunas diferenciaciones morfológicas respecto a la célula animal: a) Tienen

Más detalles

CÓDIGO GENÉTICO Y SÍNTESIS DE PROTEÍNAS

CÓDIGO GENÉTICO Y SÍNTESIS DE PROTEÍNAS CÓDIGO GENÉTICO Y SÍNTESIS DE PROTEÍNAS Sumario Mitosis y meiosis Código genético y síntesis de proteínas: 1. Concepto de gen 2. Estructura del ADN 3. La replicación del ADN 4. La transcripción 5. La traducción

Más detalles

UNIVERSIDADES PÚBLICAS DE LA COMUNIDAD DE MADRID

UNIVERSIDADES PÚBLICAS DE LA COMUNIDAD DE MADRID UNIVERSIDADES PÚBLICAS DE LA COMUNIDAD DE MADRID PRUEBA DE ACCESO A LAS ENSEÑANZAS UNIVERSITARIAS DE GRADO Curso 00-0 MATERIA: BIOLOGÍA INSTRUCCIONES GENERALES Y VALORACIÓN Estructura de la prueba: la

Más detalles

Objetivos de Aprendizaje:

Objetivos de Aprendizaje: Objetivos de Aprendizaje: Resultados de Aprendizaje: METABOLISMO El metabolismo es el conjunto de reacciones y procesos físico-químicos que ocurren en una célula, necesarios para su supervivencia. Estos

Más detalles

Pruebas de Acceso a las Universidades de Castilla y León

Pruebas de Acceso a las Universidades de Castilla y León Pruebas de Acceso a las Universidades de Castilla y León BILGÍA Texto para los Alumnos Nº páginas: 3 El alumno deberá elegir entre una de las dos opciones (A o B) ofertadas en el anverso y reverso de esta

Más detalles

TEMA 15: METABOLISMO: ASPECTOS GENERALES.

TEMA 15: METABOLISMO: ASPECTOS GENERALES. 1 TEMA 15: METABOLISMO: ASPECTOS GENERALES. 1.-CONCEPTO DE METABOLISMO. Se denomina metabolismo (o también metabolismo intermediario) al conjunto de reacciones químicas enzimáticamente catalizadas que

Más detalles

Universidad Católica Agropecuaria del Trópico Seco Pbro. Francisco Luis Espinoza Pineda Fundación 1968-2011

Universidad Católica Agropecuaria del Trópico Seco Pbro. Francisco Luis Espinoza Pineda Fundación 1968-2011 Universidad Católica Agropecuaria del Trópico Seco Pbro. Francisco Luis Espinoza Pineda Fundación 1968-2011 Carrera: Medicina Veterinaria y Zootecnia Asignatura: Bioquímica Oxidaciones Biológicas Introducción

Más detalles

MORFOFISIOLOGIA III VIDEOCONFERENCIA 3 METABOLISMO Y SU REGULACION. METABOLISMO DE LOS TRIACILGLICERIDOS

MORFOFISIOLOGIA III VIDEOCONFERENCIA 3 METABOLISMO Y SU REGULACION. METABOLISMO DE LOS TRIACILGLICERIDOS MORFOFISIOLOGIA III VIDEOCONFERENCIA 3 METABOLISMO Y SU REGULACION. METABOLISMO DE LOS TRIACILGLICERIDOS LIPOGENESIS La lipogénesis es el proceso de síntesis de los triacilglicéridos; su estructura esta

Más detalles

PREGUNTAS DE SELECTIVIDAD POR TEMAS

PREGUNTAS DE SELECTIVIDAD POR TEMAS BIOMOLÉCULAS PREGUNTAS DE SELECTIVIDAD POR TEMAS A. Defina los siguientes términos: a. Polisacáridos. (1 punto) b. Lípidos saponificables. (1 punto) B. Dada la siguiente secuencia de ADN: 3' TACCTACACAGATCTTGC

Más detalles

TEMA 5: MODELOS DE ORGANIZACIÓN CELULAR: PROCARIÓTICA Y EUCARIÓTICA (VEGETAL Y ANIMAL)

TEMA 5: MODELOS DE ORGANIZACIÓN CELULAR: PROCARIÓTICA Y EUCARIÓTICA (VEGETAL Y ANIMAL) TEMA 5: MODELOS DE ORGANIZACIÓN CELULAR: PROCARIÓTICA Y EUCARIÓTICA (VEGETAL Y ) 1.- Describir y diferenciar los dos tipos de organización celular. Comparar las características de las células vegetales

Más detalles

Las células hijas son exactamente iguales a la célula madre

Las células hijas son exactamente iguales a la célula madre El ciclo celular Las células eucariotas, desde el momento en que se originan, pasan por una serie Célula madre de etapas y sucesos que permiten su crecimiento y, eventualmente, su reproducción o división

Más detalles

PRUEBA ESPECÍFICA PRUEBA 2010

PRUEBA ESPECÍFICA PRUEBA 2010 PRUEBA DE ACCESO A LA UNIVERSIDAD MAYORES PRUEBA ESPECÍFICA PRUEBA 2010 PRUEBA SOLUCIONARIO Aclaraciones previas En el examen hay dos partes: En la primera parte hay que desarrollar uno de los temas: A

Más detalles

SET DE IMAGENES DE CÉLULAS Imágenes tomadas desde: http://recursos.cnice.mec.es/biosfera/profesor/recursos.htm

SET DE IMAGENES DE CÉLULAS Imágenes tomadas desde: http://recursos.cnice.mec.es/biosfera/profesor/recursos.htm SET DE IMAGENES DE CÉLULAS Imágenes tomadas desde: http://recursos.cnice.mec.es/biosfera/profesor/recursos.htm CELULA ANIMAL CELULA VEGETAL CELULA PROCARIOTA CUADRO COMPARATIVO: TIPOS DE CELULAS Indica

Más detalles

UNIVERSIDADES PÚBLICAS DE LA COMUNIDAD DE MADRID MATERIA: BIOLOGÍA

UNIVERSIDADES PÚBLICAS DE LA COMUNIDAD DE MADRID MATERIA: BIOLOGÍA UNIVERSIDADES PÚBLICAS DE LA COMUNIDAD DE MADRID PRUEBA DE ACCESO A LAS ENSEÑANZAS UNIVERSITARIAS DE GRADO Curso 2012-2013 8 MATERIA: BIOLOGÍA INSTRUCCIONES GENERALES Y VALORACIÓN Estructura de la prueba:

Más detalles

III. Material genético. b. Composición y estructura del RNA.

III. Material genético. b. Composición y estructura del RNA. III. Material genético b. Composición y estructura del RNA. RNA (ácido ribonucléico) Polímero de nucleótidos La pentosa de los nucleótidos es la Ribosa: en la posición 2' del anillo del azúcar hay un grupo

Más detalles

Por Roberto Rustom Laura Meléndez y Matías San Martín Microbiología General Clase n 06 04/06/02 Odontología II año U. de Chile

Por Roberto Rustom Laura Meléndez y Matías San Martín Microbiología General Clase n 06 04/06/02 Odontología II año U. de Chile Introducción: La clase anterior vimos cómo funciona la célula bacteriana incluyendo también sus requerimientos básicos. Factores Nutricionales y Ambientales: Son sustancias que están en el medio externo

Más detalles

COMPOSICIÓN QUÍMICA DE LA CÉLULA.

COMPOSICIÓN QUÍMICA DE LA CÉLULA. COMPOSICIÓN QUÍMICA DE LA CÉLULA. El 99% del peso de una célula está dominado por 6 elementos químicos: carbono, hidrógeno, nitrógeno, oxígeno, fósforo y azufre. La química de los seres vivos, objeto de

Más detalles

UNIVERSIDADES PÚBLICAS DE LA COMUNIDAD DE MADRID

UNIVERSIDADES PÚBLICAS DE LA COMUNIDAD DE MADRID UNIVERSIDADES PÚBLICAS DE LA COMUNIDAD DE MADRID PRUEBA DE ACCESO A ESTUDIOS UNIVERSITARIOS (LOGSE) Curso 2005-2006 MATERIA: BIOLOGÍA SEPTIEMBRE INSTRUCCIONES GENERALES Y VALORACIÓN Estructura de la prueba:

Más detalles

UNIDAD 1: Introducción a la biología

UNIDAD 1: Introducción a la biología UNIVERSIDAD DEL TOLIMA FACULTAD DE CIENCIAS BÁSICAS PROGRAMA DE MATEMÁTICAS CON ÉNFASIS EN ESTADÍSTICA MICROCURRICULO ASIGNATURA: OPTATIVA EN BIOLIGÍA CONTENIDOS UNIDAD 1: Introducción a la biología Explicar

Más detalles

1. Cuáles son las diferencias en los componentes químicos del ADN y ARN?

1. Cuáles son las diferencias en los componentes químicos del ADN y ARN? ACTIVIDADES TEMA 4 - BIOTECNOLOGÍA 1. Cuáles son las diferencias en los componentes químicos del ADN y ARN? Las cadenas de ADN están formadas por fosfato y desoxirribosa y la del ARN por fosfato y ribosa.

Más detalles

REGIÓN DE MURCIA / SEPTIEMBRE 04. LOGSE / BIOLOGIA / OPCIÓN A / EXAMEN COMPLETO

REGIÓN DE MURCIA / SEPTIEMBRE 04. LOGSE / BIOLOGIA / OPCIÓN A / EXAMEN COMPLETO EXAMEN COMPLETO Instrucciones de la prueba: Responda sólo a una de las dos opciones (a o b) en cada una de las cinco cuestiones. Cada opción está valorada con dos puntos. Cuestión 1: a) Cofactores enzimáticos:

Más detalles

Actividades del Tema 2: niveles de organización: nivel celular

Actividades del Tema 2: niveles de organización: nivel celular ACTIVIDADES DEL TEMA Nº 2: NIVELES DE ORGANIZACIÓN. NIVEL CELULAR 1 Actividades del Tema 2: niveles de organización: nivel celular 1.- Completa el siguiente dibujo indicando sus partes: centriolos, mitocondrias,

Más detalles

cromátidas centrómero cromosoma

cromátidas centrómero cromosoma núcleo en interfase fibra de cromatina cromátidas centrómero cromosoma 2n = 46 cromátidas cromosomas homólogos Los genes están formados por genes alelos segmentos de ADN y se encuentran situados en los

Más detalles

La célula, unidad de estructura y función: La teoría celular

La célula, unidad de estructura y función: La teoría celular Unidad Didáctica II: Organización y estructura celular La célula, unidad de estructura y función: La teoría celular La célula es la unidad esencial que forma a todo ser vivo. Es además la estructura anatómica

Más detalles

IES Pando Departamento de Biología y Geología 1

IES Pando Departamento de Biología y Geología 1 IES Pando Departamento de Biología y Geología 1 2 Células en diversos estadios del ciclo celular en la raíz de ajo. 3 Diversos aspectos del núcleo durante el ciclo celular Ciclo celular 4 Repartición del

Más detalles

ESQUEMA GENERAL DEL METABOLISMO CELULAR

ESQUEMA GENERAL DEL METABOLISMO CELULAR 2.5.5. Metabolismo. 2.5.5.1. Concepto de metabolismo, catabolismo y anabolismo. 2.5.5.2. Aspectos generales del metabolismo: reacciones de oxidorreducción y ATP. 2.5.5.3. Estrategias de obtención de energía:

Más detalles

III INFORMACIÓN CELULAR

III INFORMACIÓN CELULAR III INFORMACIÓN CELULAR POR QUÉ ES NECESARIA LA INFORMACIÓN CELULAR? En toda célula, tanto procariota como eucariota, se dan complejos procesos metabólicos y fisiológicos con la finalidad de obtener materiales

Más detalles

Qué es un gen? EXPRESION GÉNICA 01/05/2013

Qué es un gen? EXPRESION GÉNICA 01/05/2013 Qué es un gen? Es una secuencia de nucleótidos en la molécula de ADN, equivalente a una unidad de transcripción. Contiene la información, a partir de la cual se sintetiza un polipéptido, una enzima, un

Más detalles

PARTE ESPECÍFICA MATERIA: BIOLOGÍA

PARTE ESPECÍFICA MATERIA: BIOLOGÍA CALIFICACIÓN: PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR DE FORMACIÓN PROFESIONAL JUNIO DE 2012 Resolución de 27 de abril de 2012 (DOCM de 30 de abril) Apellidos Nombre Centro de examen Instrucciones

Más detalles

TEMA 6. ÁCIDOS NUCLEICOS

TEMA 6. ÁCIDOS NUCLEICOS TEMA 6. ÁCIDOS NUCLEICOS 1. Definición. 2. Composición química de los ácidos nucleicos. Nucleotidos Nucleósido 3. Nucleótidos no nucleicos Adenosín trifosfato (ATP) Adenosín monofosfato cíclico (AMP-c)

Más detalles

Guía de Biología I Medio Departamento de Ciencias Profesora NATALIA URQUIETA M.

Guía de Biología I Medio Departamento de Ciencias Profesora NATALIA URQUIETA M. COLEGIO SAN CRISTOBAL Av. Diego Portales N 1.520. La Florida Guía de Biología I Medio Departamento de Ciencias Profesora NATALIA URQUIETA M. MOLÉCULAS ORGANICAS. Los componentes orgánicos de la materia

Más detalles

Células procariotas y eucariotas

Células procariotas y eucariotas Células procariotas y eucariotas La teoría celular, establece que todos los seres vivos están constituidos por células y que toda célula proviene de una preexistente. En efecto, desde los minúsculos microorganismos

Más detalles

Repaso: Química celular (biomoléculas)

Repaso: Química celular (biomoléculas) Repaso: Química celular (biomoléculas) Hay 4 tipos principales de biomoléculas: 1) glúcidos o hidratos de carbono, 2) lípidos o grasas, 3) proteínas y 4) ácidos nucleicos. Las biomoléculas más grandes,

Más detalles

UNIVERSIDAD NACIONAL AGRARIA LA MOLINA CENTRO DE ESTUDIOS PREUNIVERSITARIOS SEGUNDO SEMINARIO DE BIOLOGÍA

UNIVERSIDAD NACIONAL AGRARIA LA MOLINA CENTRO DE ESTUDIOS PREUNIVERSITARIOS SEGUNDO SEMINARIO DE BIOLOGÍA UNIVERSI NCIONL GRRI L MOLIN CENTRO E ESTUIOS PREUNIVERSITRIOS SEGUNO SEMINRIO E IOLOGÍ UNI 3. ESTRUCTUR Y FUNCIÓN CELULR 1.-Respecto a la membrana celular, marque verdadero (V) o falso (F) según corresponda.

Más detalles

4º E.S.O. Biología y Geología - Unidad 4.- La célula. Actividades de clase para realizar con ordenador: http://iessuel.org/ccnn/

4º E.S.O. Biología y Geología - Unidad 4.- La célula. Actividades de clase para realizar con ordenador: http://iessuel.org/ccnn/ 4º E.S.O. Biología y Geología - Unidad 4.- La célula Actividades de clase para realizar con ordenador: http://iessuel.org/ccnn/ Alumno/a... Fecha... 1.- Recuerdas estos conceptos de cursos anteriores?

Más detalles

ANDALUCIA / JUNIO 02. LOGSE / BIOLOGIA / OPCION A / EXAMEN COMPLETO

ANDALUCIA / JUNIO 02. LOGSE / BIOLOGIA / OPCION A / EXAMEN COMPLETO OPCION A 1. Defina qué son los esteroides [0,2]. Cite tres ejemplos de moléculas esteroideas [0,3]. Describa las funciones biológicas fundamentales de los esteroides [1]. 2. Describa la estructura [0,15],

Más detalles

XXIII CONGRESO DE INVESTIGACIÓN CUAM - ACMor

XXIII CONGRESO DE INVESTIGACIÓN CUAM - ACMor XXIII CONGRESO DE INVESTIGACIÓN CUAM - ACMor RAPIDEZ DE FERMENTACIÓN POR SACCHAROMYCES CEREVISIAE DE ALGUNOS TIPOS DE GLÚCIDOS Alumnos Cruz González Michell, Hurtado Arroyo Grecia Briseida Terán Landa

Más detalles

Prueba de acceso a la Universidad para mayores de 25 años

Prueba de acceso a la Universidad para mayores de 25 años Prueba de acceso a la Universidad para mayores de 25 años Asignatura: Biología MODELO DE EXAMEN 1.- Moléculas orgánicas: Los lípidos y sus funciones. 2.- Células procariotas y eucariotas. 3.- Estructura

Más detalles

GENES Y MANIPULACIÓN GENÉTICA

GENES Y MANIPULACIÓN GENÉTICA GENES Y MANIPULACIÓN GENÉTICA El ADN, material de los genes La información que controla la aparición de los caracteres hereditarios se localiza en el interior del núcleo celular y se transmite de célula

Más detalles

ADN ARN Proteínas. La información genética es portada por el ADN y se hereda con él.

ADN ARN Proteínas. La información genética es portada por el ADN y se hereda con él. Todos los organismos contienen información que les permite coordinar sus procesos. Esta información, a fin de poder ser transferida a la descendencia, esta asentada en una molécula capaz de replicarse,

Más detalles

BIOLOG A AGUA: ESTRUCTURA QU MICA, PROPIEDADES Y FUNCIONES. OSMOSIS SALES MINERALES

BIOLOG A AGUA: ESTRUCTURA QU MICA, PROPIEDADES Y FUNCIONES. OSMOSIS SALES MINERALES BIOLOG A Contenidos: LA BASE F SICO QU MICA DE LA VIDA BIOELEMENTOS BIOMOLÉCULAS INORG NICAS AGUA: ESTRUCTURA QU MICA, PROPIEDADES Y FUNCIONES. OSMOSIS SALES MINERALES BIOMOLÉCULAS ORG NICAS GL CIDOS:

Más detalles

Curso acceso mayores de 25 años

Curso acceso mayores de 25 años 1. 2. 3. 4. 5. 6. 7. 8. 9. Nutrición. Definición y tipos de metabolismo. Anabolismo Autótrofo. Fotosíntesis: concepto e importancia. Fases de la fototosíntesis. Localización en el cloroplasto. Factores

Más detalles

5) EL METABOLISMO CELULAR: GENERALIDADES. ENZIMAS

5) EL METABOLISMO CELULAR: GENERALIDADES. ENZIMAS 5) EL METABOLISMO CELULAR: GENERALIDADES. ENZIMAS EL METABOLISMO: CONCEPTO La nutrición de las células supone una serie de complejos procesos químicos catalizados por enzimas que tienen como finalidad

Más detalles

1.- En relación con las aportaciones de Mendel al estudio de la herencia:

1.- En relación con las aportaciones de Mendel al estudio de la herencia: UNIVERSIDADES PÚBLICAS DE LA COMUNIDAD DE MADRID PRUEBA DE ACCESO A LAS ENSEÑANZAS UNIVERSITARIAS DE GRADO Curso 2011-2012 MATERIA: BIOLOGÍA Instrucciones de la prueba: El examen se compone de dos opciones

Más detalles

ANDALUCIA / JUNIO 01. LOGSE / BIOLOGIA / OPCION A / EXAMEN COMPLETO

ANDALUCIA / JUNIO 01. LOGSE / BIOLOGIA / OPCION A / EXAMEN COMPLETO OPCION A 1. Describa la estructura de la molécula de agua [0,75] y explique el proceso de disolución de una sustancia soluble en agua, como por ejemplo, el cloruro sódico o sal común [0,75]. 2. Qué son

Más detalles

TALLER EVALUATIVO- CARBOHIDRATOS

TALLER EVALUATIVO- CARBOHIDRATOS TALLER EVALUATIVO- CARBOHIDRATOS ÁREA/ASIGNATURA: QUIMICA Grado : 11 DOCENTE: Yadira Eugenia Guarin Blanco FECHA: 04/10/2013 1. Realiza la siguiente lectura, copia las preguntas en el cuaderno y responde.

Más detalles