APLICAÇÃO DAS TÉCNICAS MOLECULARES NA MONITORIZAÇÃO DE CULTIVOS DE MICROALGAS. Patrícia Alexandra Clemente Janeiro de Assunção

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamaño: px
Comenzar la demostración a partir de la página:

Download "APLICAÇÃO DAS TÉCNICAS MOLECULARES NA MONITORIZAÇÃO DE CULTIVOS DE MICROALGAS. Patrícia Alexandra Clemente Janeiro de Assunção"

Transcripción

1 APLICAÇÃO DAS TÉCNICAS MOLECULARES NA MONITORIZAÇÃO DE CULTIVOS DE MICROALGAS. Patrícia Alexandra Clemente Janeiro de Assunção

2 Protocolo Básico Identificación (BM) Extracción de ADN Polymerase Chain Reaction (PCR) Secuenciación Análisis de secuencias Base de datos genéticos (Genebank) Comparación de secuencias (Blast) Análisis Filogenéticos Identificación +

3 Protocolo Básico Identificación (BM) 1. PCR especifica (presencia/ausencia) Extracción de ADN Polymerase Chain Reaction (PCR) Secuenciación Análisis de secuencias Base de datos genéticos (Genebank) Comparación de secuencias (Blast) Análisis Filogenéticos 2. Amplificación genes (secuenciación) Identificación

4 Protocolo Básico Identificación (BM) Extracción de ADN Secuenciación genes (18S, ITS, rbcl...) Polymerase Chain Reaction (PCR) Secuenciación Análisis de secuencias Base de datos genéticos (Genebank) Comparación de secuencias (Blast) Análisis Filogenéticos Identificación

5 Protocolo Básico Identificación (BM) Blast (Basic Local Alignment search Tool): Extracción de ADN Polymerase Chain Reaction (PCR) Secuenciación Análisis de secuencias Base de datos genéticos (Genebank) Comparación de secuencias (Blast) Análisis Filogenéticos Identificación

6 Cómo se cultivan las Microalgas? Laboratorio Escalado Raceways (250L, L, ) Centrifugado Atomizado Biomasa (seca, fresca)

7 Cómo aplicar la Biología Molecular? ANTES DURANTE DESPUÉS Laboratorio Cultivos (Escalado, raceways) Producto final (Biomasa fresca, seca)

8 En el laboratorio (antes de cultivar a gran escala) Detección de especies de interés en muestras de campo 3xs Muestras Cepas puras 3xs Semanas, Meses C- C+ PCR especifica Secuenciación Secuenciación Identificación de la especie aislada

9 En el laboratorio (antes de cultivar a gran escala) Identificación y/o confirmación de especies que se adquirieran Especies mal identificadas: Colecciones, artículos, base de datos Identificación sólo hasta sp. : Muchas especies del mismo género 1 especie produce la sustancia de interés (ej. 28 especies Dunaliella, 1 D. salina) Taxonomía tradicional: Caracteres fisiológicos y morfológicos.? Taxonomia tradicional

10 En los cultivos Identificación (Bacterias, Diatomeas, Dinoflagelados, Cianobacterias) PCR especificas (genero, especie ), Secuenciación (SSU, ITS, rbcl, ) Contaminantes en microalgas comerciales (raceways abiertos) Más frecuentes en verano Identificar especie: Prever toxicidad. Tomar medidas para evitar la contaminación. Especie a identificar Extracción ADN PCR Secuenciación Secuenciación Identificación

11 Identificación de toxinas en los cultivos de microalgas PCR (vs HPLC, ELISA, otros ensayos.) Identificar los genes que producen toxinas: Microcistinas (mcya, mcyb, mcyc, mcyd, mcye, mcyg) Cilindrospermopsina GTGATTGAATTTCTTGGTCG GGAAATTTCTATGTCTGACTCAG ATCCAGCAGTTGAGCAAGC GCCGATGTTTGGCTGTAAAT ATCACTTCAATCTAACGACT AGTTGCTGCTGTAAGAAA GCAACATCCCAAGAGCAAAG CCGACAACATCACAAAGGC GACGCTCAAATGATGAAAC GCAACCGATAAAAACTCCC CGCAAACCCGATTTACAG CCCCTACCATCTTCATCTTC ACTCTCAAGTTATCCTCCCTC AATCGCTAAAACGCCACC GGCATTCCTAGTTATATTGCCATACTA GCCCGTTTTTGTCCCTTTCGTGC CCTCGCACATAGCCATTTGC GAAGCTCTGGAATCCGGTAA GGCAAATTGTGATAGCCACGAGC GATGGAACATCGCTCACTGGTG ndaf mcya mcyb mcyc mcyd mcye mcyg rpoc1 polyketide synthase peptide synthase Gene a identificar Extracción ADN PCR PCR convencional PCR a tiempo real Furukawa K. J. of Bioscience and Bioengineering, (2006) 102 (2): 90-96; Ouahid Y. Environ Toxicol, (2005) 20: ; Fergursson KM, Saint CP. Environ Toxicol, (2003) 18(2):120-5.

12 Aspectos legales Estudios impacto ambiental (ej. Si la especie a cultivar existe en Canarias?) Lista de especies Marinas de Canarias (Algas, Hongos, Plantas y Animales). Gobierno de Canarias Estudios antes (microorganismos: Bacterias, Dinoflagelados y Cianobacterias) Reino Plantae: sólo División Magnoliophyta No está contemplado División Chlorophyta: Tetraselmis, Dunaliella Taxonomía puede haber cambiado. No detectar no significa que no exista. PCR especifica para detectar la especie del cultivo en el entorno cercano marino. PCR/secuenciación de las especies presentes en los cultivo de microalgas.

13 Producto Final: Trazabilidad (Chlorella) Productos comerciales (tabletas y capsulas) Muestras de biomasa comercial Secuenciación del 18S rdna Otras especies (Scenedesmus, Parachlorella, ) Diferentes especies de Chlorella (C. vulgaris, C. sorokiniana, ) Görs et al. (2010). Quality analysis of commercial Chlorella products used as dietary supplement in human nutrition. J Appl Phycol, 22:

14 Ingeniería genética Fuentes naturales agotadas (ej. Taxol) Bastante desarrollado en bacterias, hongos, levaduras Chlamydomonas reinhardtii: gama completa de herramientas moleculares para la manipulación genética Microalgas: biofactorías unicelulares Tipo de proteína Función Aplicación Anticuerpo Anticuerpo derivado del IgG1 Actividad contra la glicoproteína D del virus herpes simple Actividad contra el antígeno PA83 del ántrax Anticuerpos monoclonales Anticuerpos monoclonales Toxina B del cólera Factor necrosis tumoral Vacuna oral contra Staphylococcus aureus Tratamiento del cáncer Vacuna oral Terapéutico Gran capacidad para acumular biomasa (64.000L/4 semanas) (XXX-12h) Manipulación genética (6-8 semanas) Proteínas, biodiesel, pigmentos, Suero bovino amiloide asociado a las glándulas mamarias Descarboxilasa de ácido glutámico humana 65 Estimulación de la producción de mucina en el intestino para inmunizar a recién nacidos Diagnóstico temprano de la diabetes tipo I Terapéutico Terapéutico Organismo Costo de producción Tiempo de producción Capacidad de escalamiento Calidad del producto Riesgo de Contaminación Bacterias Bajo Corto Alto Bajo Endotoxinas Levaduras Medio Medio Alto Medio Bajo Células de insectos Alto Medio Medio Alto Alto Células de mamíferos Alto Largo Muy bajo Muy alto Virus-Priones Animales Alto Muy largo Bajo Muy alto Virus-Priones Células de plantas Bajo Corto Alto Alto Bajo Plantas Muy bajo Largo Muy alto Alto Bajo Microalgas Muy bajo Corto Muy alto Alto Bajo Factor de crecimiento endotelial vascular humano Proteína B1 del grupo de alta movilidad Tratamiento del enfisema pulmonar y de la disfunción eréctil; antidepresivo Curación de heridas mediante la activación de células endoteliales Terapéutico Terapéutico Rivera Solís et al La microalga verde Chlamydomonas reinhardtii: nueva alternativa para la producción de proteínas recombinantes de interés médico. Ciencia, (oct-nov):1-9

15 Ejemplos (Planta Piloto ITC) 1 2??

16 Ejemplos (Planta Piloto ITC) Secuenciación del 18S rdna, ITS BLAST (Basic Local Alignment Search Tool): Árbol filogenético Chlamydomonas oligothermica Nannochloropsis salina isolate D12 Nannochloropsis salina strain MBIC10063 Nannochloropsis gaditana Cepa problema Nannochloropsis limnetica strain SAG Nannochloropsis granulata strain MBIC10054 Nannochloropsis oceanica strain MBIC10090 Nannochloropsis maritima Nannochloropsis oceanica strain LAMB0001

17 Ejemplos (Planta Piloto ITC) Isochrysis galbana Nannochloropsis gaditana

18 GRACIAS

Aplicación de las técnicas moleculares para el manejo de cultivos de microalgas y gestión de áreas costeras

Aplicación de las técnicas moleculares para el manejo de cultivos de microalgas y gestión de áreas costeras Aplicación de las técnicas moleculares para el manejo de cultivos de microalgas y gestión de áreas costeras Por qué cultivar Microalgas? Actividad escasamente desarrollada pero con un potencial económico

Más detalles

Chlamydomonas reinhardtii:

Chlamydomonas reinhardtii: La microalga verde Chlamydomonas reinhardtii: nueva alternativa para la producción de proteínas recombinantes de interés médico Rodrigo Arturo Rivera Solís, Santy Peraza Echeverría y Virginia Aurora Herrera

Más detalles

Biotecnología. Historia y aplicaciones Su utilización en el INTA Alto Valle. investigación

Biotecnología. Historia y aplicaciones Su utilización en el INTA Alto Valle. investigación Alejandro Giayetto Técnico INTA agiayetto@correo.inta.gov.ar Mirta Rossini Técnico INTA mrossini@correo.inta.gov.ar Diana Vera Biotecnóloga labfitopatologia@correo.inta.gov.ar investigación 10 Biotecnología

Más detalles

LA BIOTECNOLOGÍA HACE TU VIDA MEJOR Y MÁS FÁCIL

LA BIOTECNOLOGÍA HACE TU VIDA MEJOR Y MÁS FÁCIL LA BIOTECNOLOGÍA HACE TU VIDA MEJOR Y MÁS FÁCIL BIOTECNOLOGÍA APLICADA A LA SALUD La Biotecnología está presente en la Medicina y en la Salud animal, ya que participa en el diagnóstico y en el tratamiento

Más detalles

Oferta tecnológica: Novedoso fotobiorreactor para el cultivo masivo de microalgas

Oferta tecnológica: Novedoso fotobiorreactor para el cultivo masivo de microalgas Oferta tecnológica: Novedoso fotobiorreactor para el cultivo masivo de microalgas Oferta tecnológica: Novedoso fotobiorreactor para el cultivo masivo de microalgas. RESUMEN El grupo de investigación Procesado

Más detalles

5-MARCO DE REFERENCIA

5-MARCO DE REFERENCIA 5-MARCO DE REFERENCIA Para hablar de pruebas diagnosticas es necesario el conocimiento de ciertos términos que a continuación se describen. Sensibilidad: Es la probabilidad de obtener una prueba positiva

Más detalles

Oferta tecnológica: Método para detectar inserciones de espaciadores en estructuras CRISPR

Oferta tecnológica: Método para detectar inserciones de espaciadores en estructuras CRISPR Oferta tecnológica: Método para detectar inserciones de espaciadores en estructuras CRISPR Oferta tecnológica: Método para detectar inserciones de espaciadores en estructuras CRISPR. RESUMEN Las repeticiones

Más detalles

Organización biológica: Acelular. Celular

Organización biológica: Acelular. Celular La teoría celular : Todo ser vivo está formado por una o más células. La célula es lo más pequeño que tiene vida propia: es la unidad anatómica y fisiológica del ser vivo. Intercambio de materia y energía.

Más detalles

BIOMASA MICROALGAL PARA LA OBTENCIÓN DE COMBUSTIBLE

BIOMASA MICROALGAL PARA LA OBTENCIÓN DE COMBUSTIBLE 3 er Congreso de Energías Renovables y Biocombustibles COBER III BIOMASA MICROALGAL PARA LA OBTENCIÓN DE COMBUSTIBLE M.Sc. Carla Aguilar Samanamud caguilar@imarpe.gob.pe BIOTECNOLOGÍA ACUÁTICA IMARPE Lima

Más detalles

MICRO 06. OTRAS TÉCNICAS DE DIAGNÓSTICO MICROBIOLÓGICO. ESPECTROMETRÍA DE MASAS CON TECNOLOGÍA MALDI-TOF PARA LA IDENTIFICACIÓN MICROBIANA

MICRO 06. OTRAS TÉCNICAS DE DIAGNÓSTICO MICROBIOLÓGICO. ESPECTROMETRÍA DE MASAS CON TECNOLOGÍA MALDI-TOF PARA LA IDENTIFICACIÓN MICROBIANA MICRO 06. OTRAS TÉCNICAS DE DIAGNÓSTICO MICROBIOLÓGICO. ESPECTROMETRÍA DE MASAS CON TECNOLOGÍA MALDI-TOF PARA LA IDENTIFICACIÓN MICROBIANA I. DEFINICIÓN II. III. FUNDAMENTO METODOLOGÍA 1 I. DEFINICIÓN

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

A principios de los años ochentas el desarrollo de nuevas tecnologías para la

A principios de los años ochentas el desarrollo de nuevas tecnologías para la Nuevos marcadores para la detección temprana y predicción de sobrevida en blancos terapéuticos. A principios de los años ochentas el desarrollo de nuevas tecnologías para la identificación del ADN del

Más detalles

METODOLOGÍA DE DETECCIÓN Y CUANTIFICACIÓN DE CIANOBACTERIAS Y CIANOTOXINAS. Antonio Quesada Universidad Autónoma de Madrid

METODOLOGÍA DE DETECCIÓN Y CUANTIFICACIÓN DE CIANOBACTERIAS Y CIANOTOXINAS. Antonio Quesada Universidad Autónoma de Madrid METODOLOGÍA DE DETECCIÓN Y CUANTIFICACIÓN DE CIANOBACTERIAS Y CIANOTOXINAS Antonio Quesada Universidad Autónoma de Madrid Índice Identificación y cuantificación de cianobacterias potencialmente tóxicas

Más detalles

Laboratorio de Biotecnología Energética ECUADOR

Laboratorio de Biotecnología Energética ECUADOR Laboratorio de Biotecnología Energética ECUADOR El Laboratorio de Biotecnología Energética, BIOTEC forma parte de la Corporación para la Investigación Energética, creado en mayo del 2013 conjuntamente

Más detalles

Fabricación de Terapias Genéticas: Cómo Asegurar la Seguridad y Calidad de los Productos

Fabricación de Terapias Genéticas: Cómo Asegurar la Seguridad y Calidad de los Productos Fabricación de Terapias Genéticas: Cómo Asegurar la Seguridad y Calidad de los Productos DIAPOSITIVA 1 Esta presentación discutirá la fabricación de productos de terapias genéticas para asegurar la seguridad

Más detalles

TAXONOMÍA BACTERIANA. Dra. Silvana D Agosto Área Bacteriología - Curso de Microbiología Año 2015

TAXONOMÍA BACTERIANA. Dra. Silvana D Agosto Área Bacteriología - Curso de Microbiología Año 2015 TAXONOMÍA BACTERIANA Dra. Silvana D Agosto Área Bacteriología - Curso de Microbiología Año 2015 Taxonomía: Taxos ( griego ), estructuración u orden - Nomos ( griego ), ley Es la ciencia que estudia la

Más detalles

Autor: David Rodríguez Estupiñán. Tutores: Héctor Mendoza Guzmán Eduardo Portillo Hahnafeld Adelina de la Jara Valido

Autor: David Rodríguez Estupiñán. Tutores: Héctor Mendoza Guzmán Eduardo Portillo Hahnafeld Adelina de la Jara Valido Autor: David Rodríguez Estupiñán Tutores: Héctor Mendoza Guzmán Eduardo Portillo Hahnafeld Adelina de la Jara Valido Cultivos abiertos (raceways) Cultivos cerrados (fotobiorreactores) Comparativa cultivos

Más detalles

FICHA DE INFORMACIÓN PÚBLICA NECESARIA

FICHA DE INFORMACIÓN PÚBLICA NECESARIA DESCRIPCIÓN DEL TÍTULO FICHA DE INFORMACIÓN PÚBLICA NECESARIA Denominación : MÁSTER EN METODOLOGÍA DE INVESTIGACIÓN EN BIOLOGÍA FUNDAMENTAL Y BIOMEDICINA. Centro responsable: FACULTAD DE CIENCIAS BIOLÓGICAS

Más detalles

Observaciones al microscopio

Observaciones al microscopio Observaciones al microscopio En esta práctica Ud. deberá poner en práctica los conocimientos adquiridos en la práctica anterior, por lo tanto para ingresar al laboratorio deberá manejar satisfactoriamente

Más detalles

1. Diseño, elaboración de manuales y desarrollo de prácticas de las asignaturas del primer año de la titulación.

1. Diseño, elaboración de manuales y desarrollo de prácticas de las asignaturas del primer año de la titulación. Anexo I. 1. Diseño, elaboración de manuales y desarrollo de prácticas de las asignaturas del primer año de la titulación. a) Asignatura BIOQUÍMICA Esta asignatura es la primera en la que el alumno entra

Más detalles

Nuevas tecnologías basadas en biomarcadores para oncología

Nuevas tecnologías basadas en biomarcadores para oncología Nuevas tecnologías basadas en biomarcadores para oncología INGENASA Barcelona 14-03-2013 mjrodriguez@ingenasa.com INMUNOLOGÍA Y GENÉTICA APLICADA PYME creada en 1981: Aplicaciones industriales de la biotecnología

Más detalles

SESIÓN 15. Dominio eukaria (eucariotes) y su importancia. OBJETIVO DE LA SESIÓN

SESIÓN 15. Dominio eukaria (eucariotes) y su importancia. OBJETIVO DE LA SESIÓN SESIÓN 15. Dominio eukaria (eucariotes) y su importancia. OBJETIVO DE LA SESIÓN Describir las principales características de bacterias, del dominio archaea y de organismos pluricelulares a través del análisis

Más detalles

Bacterias. Características del dominio Eubacteria (las bacterias)

Bacterias. Características del dominio Eubacteria (las bacterias) Bacterias Características del dominio Eubacteria (las bacterias) La característica principal que distingue la célula procariótica de la eucariótica es la ausencia de un núcleo rodeado de membrana (Fig.

Más detalles

INDICE DE MATERIAS I- LISTA DE FIGURAS, 8. II- LISTA DE CUADROS, 10. III- RESUMEN, 11. IV- SUMMARY, 12. 1- INTRODUCCIÓN, 13.

INDICE DE MATERIAS I- LISTA DE FIGURAS, 8. II- LISTA DE CUADROS, 10. III- RESUMEN, 11. IV- SUMMARY, 12. 1- INTRODUCCIÓN, 13. INDICE DE MATERIAS I- LISTA DE FIGURAS, 8. II- LISTA DE CUADROS, 10. III- RESUMEN, 11. IV- SUMMARY, 12. 1- INTRODUCCIÓN, 13. 1.1 Presentación de la especie Fragaria chiloensis, 14. 1.1.1 Clasificación

Más detalles

SERVICIO DE ANTICUERPOS POLICLONALES A PEDIDO

SERVICIO DE ANTICUERPOS POLICLONALES A PEDIDO SERVICIO DE ANTICUERPOS POLICLONALES A PEDIDO GrupoBios S.A. Avda.Zañartu 1482 Ñuñoa Santiago-Chile Teléfono: (56-2) 473 6100 Fax: (56-2) 239 4250 e-mail: ventas@grupobios.cl www.grupobios.cl 2011 CONTENIDO

Más detalles

Chlorophyta (algas verdes)

Chlorophyta (algas verdes) Chlorophyta (algas verdes) Ir appt Las algas verdes son en su mayoría microscópicas, aunque en raras ocasiones pueden alcanzar más de un metro de largo. En contrapartida son muy diversas en cuanto a su

Más detalles

APLICADAS A LA ECOLOGÍA MICROBIANA

APLICADAS A LA ECOLOGÍA MICROBIANA TÉCNICAS MOLECULARES APLICADAS A LA ECOLOGÍA MICROBIANA Áreas de estudio tradicionales en la Ecología Microbiana: - Estudio de la diversidad microbiana, incluye aislamiento, identificación y cuantificación

Más detalles

FARMACOPEA MERCOSUR: VACUNAS PARA USO HUMANO

FARMACOPEA MERCOSUR: VACUNAS PARA USO HUMANO MERCOSUR/XLII SGT Nº 11/P.RES. Nº 09/14 FARMACOPEA MERCOSUR: VACUNAS PARA USO HUMANO VISTO: El Tratado de Asunción, el Protocolo de Ouro Preto y las Resoluciones N 31/11 y 22/14 del Grupo Mercado Común.

Más detalles

BIOTECNOLOGÍA Y BIOSEGURIDAD EN MÉXICO

BIOTECNOLOGÍA Y BIOSEGURIDAD EN MÉXICO BIOTECNOLOGÍA Y BIOSEGURIDAD EN MÉXICO La Biotecnología La biotecnología se puede definir como el conjunto de técnicas que involucran la manipulación de organismos vivos o sus componentes sub-celulares,

Más detalles

La ingeniería genética

La ingeniería genética Objetivos Antes de empezar En esta quincena aprenderás a: Biotecnología moderna. tradicional Ingeniería genética y manipulación del genoma. Alimentos transgénicos. La clonación. El genoma humano Problemas

Más detalles

I. DATOS DE IDENTIFICACIÓN

I. DATOS DE IDENTIFICACIÓN UNIVERSIDAD AUTÓNOMA DE BAJA CALIFORNIA COORDINACION DE FORMACION BASICA COORDINACION DE FORMACION PROFESIONAL Y VINCULACIÓN PROGRAMA DE UNIDAD DE APRENDIZAJE 1. Unidad Académica: FACULTAD DE CIENCIAS

Más detalles

Tema 14. Mejora genética en acuicultura

Tema 14. Mejora genética en acuicultura Tema 14. Mejora genética en acuicultura Genética CC. Mar 2004-05 Objetivos Destacar los experimentos realizados en peces y otros organismos acuáticos Describir la transgénesis en organismos acuáticos Genética

Más detalles

AUXILIAR DE CLÍNICA VETERINARIA

AUXILIAR DE CLÍNICA VETERINARIA INTRODUCCIÓN Desde hace muchos años, animales de todo tipo, especialmente los de compañía, han convivido con el hombre. A lo largo de todo este tiempo, han sido muchos los hogares en los que se ha adquirido

Más detalles

ASIGNATURA: BIOLOGÍA MOLECULAR

ASIGNATURA: BIOLOGÍA MOLECULAR Página 1 de 5 CARACTERÍSTICAS GENERALES * Tipo: DESCRIPCIÓN Formación básica, Obligatoria, Optativa Trabajo de fin de grado, Prácticas externas Duración: Cuatrimestral Semestre / s: 3 Número de créditos

Más detalles

Anticuerpos Monoclonales contra el Cáncer de mama

Anticuerpos Monoclonales contra el Cáncer de mama Anticuerpos Monoclonales contra el Cáncer de mama Erick Ovando a la Biotecnología Departamento de Química Universidad Técnica Federico Santa María Valparaíso, 05 de Diciembre de 2006 1 Estadísticas de

Más detalles

La MEDICINA del SIGLO XXI

La MEDICINA del SIGLO XXI La MEDICINA del SIGLO XXI Ginés Morata Pérez Ex-Director del Centro de Biología Molecular del CSIC Carlos Martínez-A. Jefe del Departamento de Inmunología y Oncología del Centro Nacional de Biotecnología

Más detalles

Biocombustibles de algas: experiencias y próximos pasos

Biocombustibles de algas: experiencias y próximos pasos Biocombustibles de algas: experiencias y próximos pasos Carlos Díaz Enrique Espí Centro de Tecnología Repsol Santiago de Compostela, 10 de mayo de 2011 Índice Introducción Pros y contras de los biocombustibles

Más detalles

PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR Convocatoria mayo de 2005 BIOLOGIA

PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR Convocatoria mayo de 2005 BIOLOGIA Convocatoria mayo de 2005 BIOLOGIA a) El ADN es la molécula portadora del mensaje genético: define cómo está compuesto el ADN y qué diferencias existen entre el ADN y el ARN b) Explica qué es un gen y

Más detalles

Modalidad de Ciencias y Tecnología

Modalidad de Ciencias y Tecnología Biología Esta materia requiere conocimientos incluidos en Biología y geología. Los grandes y rápidos avances de la investigación biológica en las últimas décadas han llevado a considerar a la segunda mitad

Más detalles

MATERIALES DE REFERENCIA PARA PCR

MATERIALES DE REFERENCIA PARA PCR ACTIVIDADES DE LABORATORIOS DE REFERENCIA Madrid, 27 29 de junio de 2011 MATERIALES DE REFERENCIA PARA PCR Elena San Miguel Ibáñez. Dpto. de PCR LABORATORIO CENTRAL DE VETERINARIA (ALGETE) MATERIAL DE

Más detalles

BIOTECNOLOGÍA CONTRA EL CÁNCER

BIOTECNOLOGÍA CONTRA EL CÁNCER BIOTECNOLOGÍA CONTRA EL CÁNCER DEDICATORIA PREFACIO Página BIOTECNOLOGÍA CONTRA EL CÁNCER 3 Introducción 4 Genes cancerígenos y cambios fisiológicos requeridos para que se presente el cáncer Virus asociados

Más detalles

Evaluación de algas psicrófilas antárticas como posible fuente de energía renovable (Avance semestre uno)

Evaluación de algas psicrófilas antárticas como posible fuente de energía renovable (Avance semestre uno) DI 08 Tipo de Documento: DI Presentado por: Ecuador Tipo de Sesión: CACAT Punto de la Agenda 11.1 Evaluación de algas psicrófilas antárticas como posible fuente de energía renovable (Avance semestre uno)

Más detalles

empleando Cultivos Celulares MSc.MARIA TERESA IBARZ M. Jefe División n Control Nacional Productos Biológicos

empleando Cultivos Celulares MSc.MARIA TERESA IBARZ M. Jefe División n Control Nacional Productos Biológicos Ensayos de Potencia para Vacunas empleando Cultivos Celulares MSc.MARIA TERESA IBARZ M. Jefe División n Control Nacional Productos Biológicos Cultivos Celulares Se desarrolló a finales del siglo XIX como

Más detalles

5. BIOLOGÍA. BACHILLERATO (LOGSE) Prueba de acceso a la Universidad. Ejercicio de BIOLOGIA. Segunda parte de la prueba

5. BIOLOGÍA. BACHILLERATO (LOGSE) Prueba de acceso a la Universidad. Ejercicio de BIOLOGIA. Segunda parte de la prueba 84 5. BIOLOGÍA BACHILLERATO (LOGSE) Prueba de acceso a la Universidad Ejercicio de BIOLOGIA Segunda parte de la prueba Modalidad de Ciencias de la Naturaleza y de la Salud Materia obligatoria en la via

Más detalles

Introducción al Inmunodiagnóstico.

Introducción al Inmunodiagnóstico. UNIVRSIDAD D LOS ANDS FACULTAD D FARMACIA Y BIOANÁLISIS CATDRA D INMUNOLOGÍA Introducción al Inmunodiagnóstico. César Pérez-Maldonado,PhD. 2009. INMUNIDAD Mecanismos de Defensa (specíficos / Inespecíficos)

Más detalles

BIOQUIMICA Y GENETICA MOLECULAR APLICADA A LA VETERINARIA

BIOQUIMICA Y GENETICA MOLECULAR APLICADA A LA VETERINARIA BIOQUIMICA Y GENETICA MOLECULAR APLICADA A LA VETERINARIA PROFESORADO CURSO 1994-1995: Dr. J. Ariño (Unidad de Bioquímica) Dra. F. Bosch (Unidad de Bioquímica) Dr. A. Sánchez (Unidad de Genética y Mejora)

Más detalles

Ficha Docente: BIOTECNOLOGÍA FARMACÉUTICA I

Ficha Docente: BIOTECNOLOGÍA FARMACÉUTICA I BIOTECNOLOGÍA FARMACÉUTICA I CURSO 2015-16 FACULTAD DE FARMACIA UNIVERSIDAD COMPLUTENSE DE MADRID I.- IDENTIFICACIÓN NOMBRE DE LA ASIGNATURA: CARÁCTER: Optativa MATERIA: Complementaria 9.2: Itinerario

Más detalles

OBJETIVOS, CONTENIDOS Y CRITERIOS DE EVALUACIÓN DEPARTAMENTO DE CC NN. BIOLOGÍA 2º BACH OBJETIVOS GENERALES

OBJETIVOS, CONTENIDOS Y CRITERIOS DE EVALUACIÓN DEPARTAMENTO DE CC NN. BIOLOGÍA 2º BACH OBJETIVOS GENERALES OBJETIVOS, CONTENIDOS Y CRITERIOS DE EVALUACIÓN DEPARTAMENTO DE CC NN. BIOLOGÍA 2º BACH OBJETIVOS GENERALES La enseñanza de la Biología en el bachillerato tendrá como finalidad el desarrollo de las siguientes

Más detalles

Clostridium difficile Confirmación Instituto de Salud Pública de Chile. 6 de Junio de 2012

Clostridium difficile Confirmación Instituto de Salud Pública de Chile. 6 de Junio de 2012 Clostridium difficile Confirmación Instituto de Salud Pública de Chile 6 de Junio de 2012 1 Clostridium difficile Historia: 1935, Hall y O Toole : Bacillus difficilis Investigando flora comensal de deposiciones

Más detalles

Genómica aplicada al diagnóstico de patologías periodontales

Genómica aplicada al diagnóstico de patologías periodontales Genómica aplicada al diagnóstico de patologías periodontales Dra. Blanca Bermejo Barrera, Directora Desarrollo Área Molecular FACTORES AMBIENTALES: - Enfermedades sistémicas: Diabetes Enfermedad Cardiovascular

Más detalles

QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA. Julio A. Carrasco Vallejo Julio 2014

QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA. Julio A. Carrasco Vallejo Julio 2014 QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA Julio A. Carrasco Vallejo Julio 2014 Definiciones Biología Molecular: Estudio de los flujos de información genética en una célula Biotecnología: Uso de sistemas

Más detalles

NOCIONES DE EPIDEMIOLOGÍA Y DIAGNOSTICO DE HIV. Dra G Carballal Laboratorio de Virología Clínica CEMIC, 2009

NOCIONES DE EPIDEMIOLOGÍA Y DIAGNOSTICO DE HIV. Dra G Carballal Laboratorio de Virología Clínica CEMIC, 2009 NOCIONES DE EPIDEMIOLOGÍA Y DIAGNOSTICO DE HIV Dra G Carballal Laboratorio de Virología Clínica CEMIC, 2009 La Pandemia de SIDA Personas que viven con el HIV/SIDA Total 40 millones Adultos 38 Niños 2 Nuevas

Más detalles

PROGRAMA DE MAESTRÍA EN CIENCIAS CON CONCENTRACION EN BIOTECNOLOGÍA

PROGRAMA DE MAESTRÍA EN CIENCIAS CON CONCENTRACION EN BIOTECNOLOGÍA PROGRAMA DE MAESTRÍA EN CIENCIAS CON CONCENTRACION EN BIOTECNOLOGÍA DESCRIPCION DEL PROGRAMA Programa interdisciplinario que comprende las áreas de química, biología, biotecnología y administración de

Más detalles

GUÍA DOCENTE DE BIOTECNOLOGÍA

GUÍA DOCENTE DE BIOTECNOLOGÍA GUÍA DOCENTE DE BIOTECNOLOGÍA I. IDENTIFICACIÓN DE LA ASIGNATURA Nombre de la asignatura: Carácter: Titulación: Ciclo: Departamento: Profesor/responsable Biotecnología Optativa Licenciatura en Farmacia

Más detalles

Cultura Cientí fica 1 Bachillerato

Cultura Cientí fica 1 Bachillerato Cultura Cientí fica 1 Bachillerato 3. La revolución genética: biotecnología Actividades de consolidación 1. Cualquier molécula de ADN formada por la unión de segmentos de ADN de origen diferente es: a)

Más detalles

Universidad Católica Ávila

Universidad Católica Ávila Universidad Católica Ávila de Curso Académico 2014/2015 Planes de Estudio Máster Universitario en Biotecnología Agroalimentaria por la Universidad Católica Santa Teresa de Jesús de Ávila Facultad de Ciencias

Más detalles

Transgénicos naturales y transgénicos de laboratorio

Transgénicos naturales y transgénicos de laboratorio Transgénicos naturales y transgénicos de laboratorio Inés Ponce de León Dept. Biología Molecular Instituto de Investigaciones Biológicas Clemente Estable Organismos genéticamente modificados (OGMs) Un

Más detalles

Muestras citológicas para el estudio de mutaciones de EGFR y KRAS en cáncer de pulmón de célula no pequeña

Muestras citológicas para el estudio de mutaciones de EGFR y KRAS en cáncer de pulmón de célula no pequeña Muestras citológicas para el estudio de mutaciones de EGFR y KRAS en cáncer de pulmón de célula no pequeña Caroline Becker; Enric Carcereny Costa; Felipe Andreo García; Eva Castellá; Mariona Lletjós Sanuy;

Más detalles

PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN DE LAS COMPETENCIAS PROFESIONALES CUESTIONARIO DE AUTOEVALUACIÓN PARA LAS TRABAJADORAS Y TRABAJADORES

PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN DE LAS COMPETENCIAS PROFESIONALES CUESTIONARIO DE AUTOEVALUACIÓN PARA LAS TRABAJADORAS Y TRABAJADORES MINISTERIO DE EDUCACIÓN SECRETARÍA DE ESTADO DE EDUCACIÓN Y FORMACIÓN PROFESIONAL DIRECCIÓN GENERAL DE FORMACIÓN PROFESIONAL INSTITUTO NACIONAL DE LAS CUALIFICACIONES PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN

Más detalles

BioSeq 739 Servicio de ayuda al diagnóstico oncológico

BioSeq 739 Servicio de ayuda al diagnóstico oncológico BioSeq 739 Servicio de ayuda al diagnóstico oncológico Análisis Genómico Tumoral por Secuenciación Masiva PPBSA CP13 060312 Información sobre el servicio de BioSeq 739 La mayoría de tipos de cáncer se

Más detalles

Selección de pacientes

Selección de pacientes 2 Selección de pacientes MENSAJES CLAVE Aproximadamente entre el 20% y el 30% de las pacientes con cáncer de mama presentan tumores HER2 positivos. Hasta un 24% de los tumores con receptores de estrógenos

Más detalles

Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio

Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio El VIRUS PRUEBAS PRESUNTIVAS ELISA: es la prueba convencional para la detección

Más detalles

Julio M. Delgado Biotechnova S.A.S direccioncientifica@biotechnova.com

Julio M. Delgado Biotechnova S.A.S direccioncientifica@biotechnova.com MEDICAMENTOS BIOTECNOLOGICOS INTERFERON Y OTROS Julio M. Delgado Biotechnova S.A.S direccioncientifica@biotechnova.com Que se Consideran Fármacos Biotecnológicos? Que es un Biofármaco? Biológicos: Producto

Más detalles

Agentes Biológicos. Médico Carlos A. Contreras Quevedo Mestría en ciencias especialidad en salud ocupacional.

Agentes Biológicos. Médico Carlos A. Contreras Quevedo Mestría en ciencias especialidad en salud ocupacional. Agentes Biológicos Médico Carlos A. Contreras Quevedo Mestría en ciencias especialidad en salud ocupacional. Introducción. En el medio sanitario el riesgo biológico es el que más frecuentemente encontramos,

Más detalles

GLOSARIO. Ácido Desoxirribonucleico (ADN).- Molécula almacenadora de información hereditaria

GLOSARIO. Ácido Desoxirribonucleico (ADN).- Molécula almacenadora de información hereditaria GLOSARIO Ácido Desoxirribonucleico (ADN).- Molécula almacenadora de información hereditaria que se encuentra en el núcleo de la célula. Las bases del ADN son 4: Adenina, Timina, Citosina y Guanina representadas

Más detalles

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante BIOTECNOLOGÍA 1.- Ingeniería Genética, ADN recombinante Técnica del ADN recombinante: es la más usada en ingeniería genética, esta basada en el uso de las enzimas de restricción o endonucleasas de restricción

Más detalles

AGAMMAGLOBULINEMIA LIGADA AL CROMOSOMA X

AGAMMAGLOBULINEMIA LIGADA AL CROMOSOMA X AGAMMAGLOBULINEMIA LIGADA AL CROMOSOMA X Este folleto está pensado para el uso de pacientes y de sus familias y no reemplaza los consejos de un inmunólogo clínico. 1 Tambien disponible: INMUNODEFICIENCIA

Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

Conferencia "Biotecnología y nuevos alimentos"

Conferencia Biotecnología y nuevos alimentos Conferencia "Biotecnología y nuevos alimentos" Dra. Mary Lopretti Post PhD., Instituto Nacional Politécnico de Grenoble, Francia. Jefa, Departamento de Bioprocesos y Biotecnología, LATU. Auditorio ORT

Más detalles

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental.

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Gemma Saucedo. Laboratorio Aguas de Barcelona 22-23 de noviembre de 2006 Introducción PCR: Polymerase Chain Reaction

Más detalles

Calostro, el oro líquido por Antolin de la Torre (Articulo publicado en a revista Verdemente)

Calostro, el oro líquido por Antolin de la Torre (Articulo publicado en a revista Verdemente) Calostro, el oro líquido por Antolin de la Torre (Articulo publicado en a revista Verdemente) 1 Calostro, el oro líquido. por Antolín de la Torre Parte I Que la naturaleza es sabia, es una frase conocida

Más detalles

Qué es el hombre dentro de la naturaleza? Nada con respecto al infinito. Todo con respecto a la nada. Un intermedio entre la nada y el todo.

Qué es el hombre dentro de la naturaleza? Nada con respecto al infinito. Todo con respecto a la nada. Un intermedio entre la nada y el todo. 1 BIODIVERSIDAD Qué es el hombre dentro de la naturaleza? Nada con respecto al infinito. Todo con respecto a la nada. Un intermedio entre la nada y el todo. Blaise Pascal PREGUNTAS 1) Cómo se define el

Más detalles

QUÉ SON LAS MICROALGAS? INTERÉS Y USO

QUÉ SON LAS MICROALGAS? INTERÉS Y USO Número: 011 Fecha: Octubre 2015 QUÉ SON LAS MICROALGAS? INTERÉS Y USO 1. INTRODUCCIÓN Hace más de 10 años que la Estación Experimental Cajamar Las Palmerillas empezó afrontar el reto en la investigación

Más detalles

CERTIFICACIONES...5 AGRADECIMIENTOS...11 ÍNDICE DE CONTENIDO...15 LISTADOS...21 LISTADO DE TABLAS...23 LISTADO DE FIGURAS...23 ABREVIATURAS...27 RESUMEN...33 RESUMEN...35 SUMMARY...36 INTRODUCCIÓN...39

Más detalles

@ul@ Virtual del Agua en usal.es. Programa Laboratorio Virtual de Microbiología. Sistemas Acuáticos

@ul@ Virtual del Agua en usal.es. Programa Laboratorio Virtual de Microbiología. Sistemas Acuáticos @ul@ Virtual del Agua en usal.es Programa Laboratorio Virtual de Microbiología. Sistemas Acuáticos Centro de Investigación y Desarrollo Tecnológico del Agua (CIDTA) Universidad de Salamanca Laboratorio

Más detalles

PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN DE LAS COMPETENCIAS PROFESIONALES CUESTIONARIO DE AUTOEVALUACIÓN PARA LAS TRABAJADORAS Y TRABAJADORES

PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN DE LAS COMPETENCIAS PROFESIONALES CUESTIONARIO DE AUTOEVALUACIÓN PARA LAS TRABAJADORAS Y TRABAJADORES MINISTERIO DE EDUCACIÓN SECRETARÍA DE ESTADO DE EDUCACIÓN Y FORMACIÓN PROFESIONAL DIRECCIÓN GENERAL DE FORMACIÓN PROFESIONAL INSTITUTO NACIONAL DE LAS CUALIFICACIONES PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN

Más detalles

PRUEBA DE VIH. Universidad de Panamá USAID Proyecto Capacity Centroamérica

PRUEBA DE VIH. Universidad de Panamá USAID Proyecto Capacity Centroamérica PRUEBA DE VIH Universidad de Panamá USAID Proyecto Capacity Centroamérica Es la prueba de detección que produce los resultados rápidamente, en aproximadamente 20 minutos y utiliza sangre de una vena o

Más detalles

Detección de microorganismos patógenos en los alimentos. Prof. Dr. Luis M. Medina

Detección de microorganismos patógenos en los alimentos. Prof. Dr. Luis M. Medina Detección de microorganismos patógenos en los alimentos Prof. Dr. Luis M. Medina ANÁLISIS MICROBIOLÓGICOS EN ALIMENTOS Indicadores recuento total (BAM ) enterobacteriáceas totales coliformes totales E.

Más detalles

Producción de medicamentos en cultivos celulares

Producción de medicamentos en cultivos celulares Producción de medicamentos en cultivos celulares Dra. Guillermina Forno, MBA Gerente de Desarrollo, Zelltek S.A. 25 y 26 de Junio de 2015 Rosario, Argentina GENERACIÓN DE PRODUCTOS BIOFARMACÉUTICOS Definición

Más detalles

APLICACIÓN DE LA METODOLOGÍA MOLECULAR I

APLICACIÓN DE LA METODOLOGÍA MOLECULAR I APLICACIÓN DE LA METODOLOGÍA MOLECULAR I DIGANÓSTICO DE ENFERMEDADES INFECCIOSAS Amplificación de la Señal en DNA Ramificado Amplification) (Branched DNA Singal Es un sistema similar al ELISA, en el cual

Más detalles

Uso de los recursos genéticos del océano Jesús M. Arrieta Carlos M. Duarte Departamento de Investigación del Cambio Global Instituto Mediterráneo de Estudios Avanzados (IMEDEA) Biodiversidad marina Los

Más detalles

PROTOCOLOS DE OBTENCIÓN, CONSERVACIÓN Y ENVÍO DE MUESTRAS BIOLÓGICAS

PROTOCOLOS DE OBTENCIÓN, CONSERVACIÓN Y ENVÍO DE MUESTRAS BIOLÓGICAS PROTOCOLOS DE OBTENCIÓN, CONSERVACIÓN Y ENVÍO DE MUESTRAS BIOLÓGICAS ESTUDIO TRASLACIONAL PROSPECTIVO DE DETERMINACIÓN DE FACTORES PREDICTIVOS DE EFICACIA Y TOXICIDAD EN PACIENTES CON CÁNCER ÍNDICE 1 INTRODUCCIÓN....

Más detalles

Prospección, aislamiento y caracterización de bacterias celulolíticas de suelo de bosque nativo de Misiones, Argentina.

Prospección, aislamiento y caracterización de bacterias celulolíticas de suelo de bosque nativo de Misiones, Argentina. Premio CPIA Bioenergía 12 de Mayo de 2015 Prospección, aislamiento y caracterización de bacterias celulolíticas de suelo de bosque nativo de Misiones, Argentina. Tesista: Gonzalo Julián Sabarís Di Lorenzo

Más detalles

Solicitud para la concesión de permisos para Experimentación y/o Liberación al Medio de Microorganismos Genéticamente Modificados y/o sus productos

Solicitud para la concesión de permisos para Experimentación y/o Liberación al Medio de Microorganismos Genéticamente Modificados y/o sus productos Solicitud para la concesión de permisos para Experimentación y/o Liberación al Medio de Microorganismos Genéticamente Modificados y/o sus productos para aplicaciones en animales El Secretario de Agricultura,

Más detalles

Pontificia Universidad Católica del Ecuador

Pontificia Universidad Católica del Ecuador Av. 1 de Octubre 1076 y Roca Apartado postal 17-01-184 Fax: 59 99 16 56 Telf: 59 99 15 5 1. DATOS INFORMATIVOS: MATERIA O MÓDULO: CÓDIGO: 160 INMUNODIAGNOSTICO DE MICROORGANISMOS T-L CARRERA: Microbiología

Más detalles

UNIVERSIDAD DE LOS ANDES FACULTAD DE MEDICINA INSTITUTO DE INMUNOLOGIA CLINICA HERRAMIENTAS MODERNAS PARA EL DIAGNÓSTICO

UNIVERSIDAD DE LOS ANDES FACULTAD DE MEDICINA INSTITUTO DE INMUNOLOGIA CLINICA HERRAMIENTAS MODERNAS PARA EL DIAGNÓSTICO UNIVERSIDAD DE LOS ANDES FACULTAD DE MEDICINA INSTITUTO DE INMUNOLOGIA CLINICA HERRAMIENTAS MODERNAS PARA EL DIAGNÓSTICO Dra. Haydeé Urdaneta Romero. Junio 2007 ABORDAJES DIAGNÓSTICOS IDENTIFICACIÓN MORFOLÓGICA

Más detalles

M.Sc. Manuel Campos Rudín, Paula Solera, maritza Guerrero, Leonardo Garro Mena, Roberto Vega, Andrea Rivera

M.Sc. Manuel Campos Rudín, Paula Solera, maritza Guerrero, Leonardo Garro Mena, Roberto Vega, Andrea Rivera Ficha del proyecto Título del proyecto Período de ejecución Universidades participantes Nombre y apellidos (investigador principal) Nombre y apellidos(investiga dores asociados) Asistentes Resumen/Abstract

Más detalles

Facultad de Ciencias Bioquímicas y Farmacéuticas Área de Integración n Disciplinar y Estudio de la Problemática Profesional TPP I Unidad 2 Aspectos biológicos del VIH Algunos datos importantes 1959 Se

Más detalles

Name Date Class. [Comienzo de Sección 11-1] Por favor pasa a la página 226 para empezar la Sección 11-1, La Ingeniería Genética.

Name Date Class. [Comienzo de Sección 11-1] Por favor pasa a la página 226 para empezar la Sección 11-1, La Ingeniería Genética. [Introducción] Por favor abre tu libro en la página 225. Capítulo 11: La Tecnología de Genes Los científicos trabajan día a día en búsqueda de nuevas formas para el uso de la tecnología genética en beneficio

Más detalles

UNIVERSIDAD AUTONOMA DE TAMAULIPAS

UNIVERSIDAD AUTONOMA DE TAMAULIPAS R-RS-01-25-03 UNIVERSIDAD AUTONOMA DE TAMAULIPAS NOMBRE DE LA FACULTAD O UNIDAD ACADEMICA NOMBRE DE LA CARRERA LICENCIADO EN NUTRICION Y CIENCIA DE LOS ALIMENTOS NOMBRE DE LA ASIGNATURA LABORATORIO DE

Más detalles

EVALUACIÓN N DE EFICACIA. 15.1. Introducción

EVALUACIÓN N DE EFICACIA. 15.1. Introducción 15.1. Introducción PRODUCCIÓN N DE ENTOMOPATÓGENOS Y EVALUACIÓN N DE EFICACIA 15.2. Producción de entomopatógenos: 15.3.1. Virus 15.3.2. Bacterias 15.3.3. Hongos 15.3.4. Nematodos 15.3. Formulación y aplicación

Más detalles

CUALIFICACIÓN. ANÁLISIS BIOTECNOLÓGICO PROFESIONAL Familia Profesional Nivel 3. Versión 5 Situación RD 143/2011 Actualización

CUALIFICACIÓN. ANÁLISIS BIOTECNOLÓGICO PROFESIONAL Familia Profesional Nivel 3. Versión 5 Situación RD 143/2011 Actualización Página 1 de 34 CUALIFICACIÓN ANÁLISIS BIOTECNOLÓGICO PROFESIONAL Familia Profesional Química Nivel 3 Código QUI476_3 Versión 5 Situación RD 143/2011 Actualización Competencia general Organizar y aplicar

Más detalles

Dpto. de Ciencias Agrarias y del Medio Natural Área: Fisiología Vegetal MASTER EN BIOLOGÍA MOLECULAR, CELULAR Y GENÉTICA

Dpto. de Ciencias Agrarias y del Medio Natural Área: Fisiología Vegetal MASTER EN BIOLOGÍA MOLECULAR, CELULAR Y GENÉTICA Dpto. de Ciencias Agrarias y del Medio Natural Área: Fisiología Vegetal LICENCIATURA EN QUÍMICAS MASTER EN BIOLOGÍA MOLECULAR, CELULAR Y GENÉTICA PROGRAMA DE LAS ASIGNATURAS TÉCNICAS DE BIOLOGÍA MOLECULAR

Más detalles

Diagnóstico microbiológico de la infección por HIV

Diagnóstico microbiológico de la infección por HIV Diagnóstico microbiológico de la infección por HIV Juan Carlos Rodríguez Díaz S. Microbiología Hospital General Universitario de Alicante E-mail: rodriguez_juadia@gva.es http://microbiología-alicante.umh.es

Más detalles

Profesional con doctorado con más de quince años de experiencia en temas de física de rocas.

Profesional con doctorado con más de quince años de experiencia en temas de física de rocas. DOCTORADO A2 Profesional Químico o Ing. químico con mínimo 5 años de experiencia, después de obtener su título de pregrado, trabajando en proyectos de investigación. Mínimo con título de Doctorado. Preferiblemente

Más detalles

Entender el funcionamiento de los relojes permitiría lidiar con ciertas patologías en humanos. 28 ACTUALIDAD EN I+D RIA / Vol. 41 / N.

Entender el funcionamiento de los relojes permitiría lidiar con ciertas patologías en humanos. 28 ACTUALIDAD EN I+D RIA / Vol. 41 / N. 28 ACTUALIDAD EN I+D RIA / Vol. 41 / N.º 1 Entender el funcionamiento de los relojes permitiría lidiar con ciertas patologías en humanos Abril 2015, Argentina 29 Relojes biológicos en plantas Ajustar el

Más detalles

Brote de Enterovirus D68- EEUU 2014 Perspectiva laboratorio

Brote de Enterovirus D68- EEUU 2014 Perspectiva laboratorio Brote de Enterovirus D68- EEUU 2014 Perspectiva laboratorio Allan Nix Jefe de equipo Laboratorio de Picornavirus Rama de laboratorio de Polio y Picornavirus Webinar OPS / SARInet 6 de noviembre de 2014

Más detalles

Medicamentos biológicos y biosimilares

Medicamentos biológicos y biosimilares Medicamentos biológicos y biosimilares folleto biosimilares FILMAR.indd 1 24/10/12 10:09 En qué se diferencian los medicamentos biológicos de los medicamentos tradicionales? Introducción Gracias a la investigación

Más detalles

RIESGOS BIOLÓGICOS GENERALIDADES

RIESGOS BIOLÓGICOS GENERALIDADES GENERALIDADES Definición Algunas de las tareas que desempeñan ciertos colectivos de trabajadores, conllevan riesgos vinculados a la exposición a agentes biológicos como: Virus, bacterias y parásitos, susceptibles

Más detalles

Biología Molecular en el Diagnóstico de Enfermedades Infecciosas. Bq. Ivonne Vergara P. Laboratorio Biología Molecular Clínica Las Condes

Biología Molecular en el Diagnóstico de Enfermedades Infecciosas. Bq. Ivonne Vergara P. Laboratorio Biología Molecular Clínica Las Condes Biología Molecular en el Diagnóstico de Enfermedades Infecciosas Dirección Médica Bq. Ivonne Vergara P. Laboratorio Biología Molecular Clínica Las Condes Existen diversas técnicas de Biología Molecular

Más detalles