Cultura Cientí fica 1 Bachillerato

Tamaño: px
Comenzar la demostración a partir de la página:

Download "Cultura Cientí fica 1 Bachillerato"


1 Cultura Cientí fica 1 Bachillerato 3. La revolución genética: biotecnología Actividades de consolidación 1. Cualquier molécula de ADN formada por la unión de segmentos de ADN de origen diferente es: a) ADN basura. b) ADN recombinante. c) ADN complementario. 2. Existe alguna relación entre la secuencia de bases de una cadena de ADN, la secuencia de bases de una molécula de ARNm y la secuencia de aminoácidos de una proteína? 3. Para separar una mezcla de moléculas de ADN en bandas, cada una de ellas formada por miles de moléculas de ADN de la misma longitud lo que se hace es: a) Un ensayo de hibridación con una sonda de ADN. b) Una electroforesis, por ejemplo, en gel de agarosa. c) Una secuenciación del ADN. 4. La siguiente secuencia corresponde a una molécula de ADN de cadena doble de un determinado organismo: A T G A A T T C G A A G C T T G Grupo Editorial Bruño, S. L.

2 Consultando la tabla siguiente, contesta a las cuestiones: Enzima Puntos de restricción EcoRI HindIII PstI BglII a) Qué fragmentos de restricción se originarán tras la incubación de la molécula de ADN con la endonucleasa de restricción EcoRI? b) Y si se utiliza HindIII? 5. Analiza y comenta la situación que se plantea en el texto siguiente y que podría ser real en un futuro no muy lejano: Sr. y Sra. Gillespie, buenos días. Soy el Dr. Percibal Longman, encargado del Programa de Análisis Genético de la Seguridad Social. El resultado de los análisis a los que han sido sometidos revela que, si ustedes tienen un hijo, hay un 12,5 % de probabilidades de que sea portador del gen de predisposición a una enfermedad degenerativa del tejido muscular. Hoy en día el tratamiento de esta enfermedad se realiza con éxito, pero es muy costoso. Debo informarles que la Ley sobre Prevención de Discapacidades de Origen Genético aprobada el año pasado por el Parlamento Europeo les permite tener hijos, ya que no alcanzan el 33 % a partir del cual se establece la prohibición, pero deben saber que la Seguridad Social no se hará cargo de los gastos que genere la posible enfermedad de su hijo. Adopten ustedes la decisión que crean más conveniente. 6. En un laboratorio de biotecnología, un grupo de científicos está trabajando en el diseño de diferentes organismos genéticamente modificados de segunda generación cuando son informados de un grave incidente: los contenedores que acumulan los residuos radiactivos de baja y media actividad, almacenados en el cementerio nuclear de Carleg, están agrietados y se teme que exista emisión de radioisótopos, lo que puede afectar a las personas y al medio ambiente. Qué tipo de OGM podría desarrollar este grupo de biotecnólogos para solucionar el problema? 7. El proceso de síntesis de proteínas se denomina: a) Transcripción. b) Traducción. c) Replicación. 2 Grupo Editorial Bruño, S. L.

3 8. El sida y la «enfermedad de las vacas locas» nos han demostrado lo fácil que es para las enfermedades saltar de una especie a otra, con gravísimas consecuencias. Si trasplantar un corazón de cerdo transgénico a una persona, posiblemente, sería un éxito, por qué crees que aún no se ha realizado esta operación? 9. La biotecnología actual permite crear copias de animales gracias a una técnica que se conoce como: a) Duplicación. b) Transgénesis. c) Clonación. 10. Sabrías explicar qué es un animal knockout y para qué se diseñan? 11. El ADN es una macromolécula formada por la unión de otras moléculas más sencillas llamadas: a) Cromatina. b) Aminoácidos. c) Nucleótidos. 12. Para clonar un fragmento de ADN, este debe ser introducido en: a) Un vector de expresión. b) Una sonda de ADN. c) Un vector de clonación. 13. Las células procariotas carecen de núcleo. Dónde crees que se realizan los procesos de transcripción y traducción? 14. Una parte del genoma humano no tiene función conocida y representa el: a) 95 % del genoma. b) 33,5 % del genoma. c) 99,99 % del genoma. 15. Construye las dos cadenas de ADN del cual se obtuvo por un proceso de transcripción la siguiente secuencia de ARN: AUGCCUAGGCUCAAUACGGUGA 16. Las células madre adultas son células: a) Totipotentes. b) Pluripotentes. c) Multipotentes. 3 Grupo Editorial Bruño, S. L.

4 17. Las células madre embrionarias son células: a) Totipotentes. b) Pluripotentes. c) Multipotentes. 18. La reacción en cadena de la polimerasa (PCR) permite: a) Obtener millones de copias de un segmento específico de ADN mediante la repetición de múltiples ciclos de replicación del ADN in vitro. b) Obtener millones de copias de un segmento específico de ADN mediante un proceso denominado transformación. c) Obtener millones de copias de un segmento específico de ADN mediante bibliotecas o genotecas de ADN. 19. La insulina es una hormona que se produce en el páncreas y controla la concentración de azúcar en la sangre. Las personas diabéticas no la producen en cantidad suficiente, por lo que muchas de ellas deben inyectarse insulina para corregir el problema. En la actualidad la insulina humana es producida por ingeniería genética. Describe el proceso que se sigue para su obtención. 20. En la siguiente figura se muestra el número de genes de distintas especies así como el porcentaje de coincidencias entre el genoma de una persona en relación con otras personas y con otras especies animales (chimpancé, ratón, gusano de tierra y mosca del vinagre). Qué conclusiones puedes sacar de su estudio? 4 Grupo Editorial Bruño, S. L.

5 Soluciones 1. b). 2. En la secuencia de bases del ADN se encuentra la información genética necesaria para sintetizar una proteína. Sin embargo, esa información no puede utilizarse directamente, sino que se emplea para sintetizar una molécula de ARN m en un proceso que recibe le nombre de transcripción. De esta manera el ARN m lleva en su secuencia de bases la información hasta los ribosomas, que son los orgánulos encargados de descifrar el ARN m, y en ellos se lleva a cabo la síntesis de la proteína, proceso denominado traducción. 3. b). 4. a) Fragmentos de restricción originados tras la incubación de la molécula de ADN con la endonucleasa de restricción EcoRI: Secuencia de reconocimiento : A T G A A T T C G A A G C T T G Fragmentos de restricción : A T G T A C T T A A 5 Grupo Editorial Bruño, S. L. A A T T C G A A G C T T G G C T T C G A A C b) Fragmentos de restricción originados tras la incubación de la molécula de ADN con la endonucleasa de restricción HindIII: Secuencia de reconocimiento: A T G A A T T C G A A G C T T G Fragmentos de restricción: A T G A A T T C G A A G C T T G Respuesta abierta. Los alumnos deberían valorar la problemática ética que plantea la utilización de la biotecnología, así como la importancia de la misma en el campo de la prevención de enfermedades de origen genético. 6. De la misma forma que se utilizan determinados microorganismos en los procesos de biorremediación, se podrían diseñar bacterias genéticamente modificadas para limpiar las zonas donde se acumulan los residuos nucleares, eliminando el peligro, que de otra manera, dura miles de años.

6 7. b). 8. No se ha realizado ningún xenotransplante por temor a transferir virus y enfermedades porcinas al ser humano. 9. c). 10. Los animales knockout son aquellos en los que se sustituye un gen funcional por otro mutante no funcional con el fin de examinar los efectos que este tipo de experimento tiene sobre el animal y poder conocer la función que desempeña el gen. Los ratones son los organismos más utilizados en ingeniería genética. Son modelos ideales para estudiar determinadas enfermedades en las personas porque la mayoría de sus genes actúan de una forma muy parecida al de los genes humanos. Su manipulación puede ayudar a conocer, por ejemplo, el funcionamiento de los genes que provocan el cáncer y así comprender la evolución de esta enfermedad. 11. c). 12. c). 13. En las células procariotas los procesos de transcripción y de traducción tienen lugar a la vez y en el citoplasma de la célula. Antes incluso de que haya finalizado la formación del ARNm, los ribosomas ya pueden proceder a su lectura. 14. a). 15. La doble cadena de ADN será: 16. c). 17. b). 18. a). TACGGATCCGAG TT ATGCCACT ATGCCTAGGCTC AATACGGTGA 19. Se aísla el gen de la insulina humana y se inserta en un vector de expresión, en este caso un plásmido bacteriano, con la ayuda de enzimas de restricción. Después se inserta el plásmido que transporta el gen humano en las bacterias que se transforman en bacterias transgénicas. Por último, las bacterias transgénicas se cultivan en un tanque de fermentación, del que se extrae la insulina. 20. El Proyecto Genoma Humano ha demostrado que la diferencia entre dos personas es tan solo del 0,01 %. Esto significa que compartimos con cualquier persona desconocida el 99,99 % del mismo ADN. Si comparamos con otras especies, las coincidencias con un chimpancé son casi del 96 %, con un ratón tenemos en común el 80 % de nuestros genes, con el gusano de tierra Caenorhabditis elegans la coincidencia es del 40 % y con la mosca del vinagre un 60 %. El número de nuestros genes es similar al número de genes existente en el chimpancé y en el ratón y no es muy superior al número presente en invertebrados como el citado gusano de tierra o la mosca del vinagre. 6 Grupo Editorial Bruño, S. L.

1. Cuáles son las diferencias en los componentes químicos del ADN y ARN?

1. Cuáles son las diferencias en los componentes químicos del ADN y ARN? ACTIVIDADES TEMA 4 - BIOTECNOLOGÍA 1. Cuáles son las diferencias en los componentes químicos del ADN y ARN? Las cadenas de ADN están formadas por fosfato y desoxirribosa y la del ARN por fosfato y ribosa.

Más detalles


TEMA 4 CMC BIOTECNOLOGÍA Conceptos Tema 4 TEMA 4 CMC BIOTECNOLOGÍA Células eucariotas: Células con núcleo. Núcleo: Un compartimento en el interior de la célula que alberga el material genético. Citoplasma: En una célula eucariota,

Más detalles


REVOLUCIÓN GENÉTICA Y BIOTECNOLOGÍA Tema 4 REVOLUCIÓN GENÉTICA Y BIOTECNOLOGÍA 1. ADN y ARN pág 92-93 -Composición química y conceptos: ADN, ARN, nucleótidos, bases nitrogenadas, ácido fosfórico. -Estructura: doble hélice, cadenas complementarias.

Más detalles


GENES Y MANIPULACIÓN GENÉTICA GENES Y MANIPULACIÓN GENÉTICA El ADN, material de los genes La información que controla la aparición de los caracteres hereditarios se localiza en el interior del núcleo celular y se transmite de célula

Más detalles

7.012 Serie de ejercicios 5

7.012 Serie de ejercicios 5 Nombre Grupo 7.012 Serie de ejercicios 5 Pregunta 1 Al estudiar los problemas de esterilidad, usted intenta aislar un hipotético gen de conejo que explique la prolífica reproducción de estos animales.

Más detalles


EL ADN y la INGENIERÍA GENÉTICA IES LAS VIÑAS MANILVA. MÁLAGA. CMC. Susana Serradilla EL ADN y la INGENIERÍA GENÉTICA EL GENOMA HUMANO GENOMA: Conjunto de genes de un ser vivo. GENOMA HUMANO: Conjunto de genes de la especie humana PROYECTO

Más detalles

Jesús G.C. Colegio Claret Segovia

Jesús G.C. Colegio Claret Segovia 1 UNIDAD 8 Documento elaborado por del de LA R E VO LU CI Ó N G EN É TI CA 1.- El ADN La célula es la unidad morfológica, funcional y genética de todos los seres vivos Todos los seres vivos están formados

Más detalles

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas ELEMENTOS BÁSICOS DE LA INVESTIGACIÓN EN GENES Análisis

Más detalles

Técnicas de Biología Molecular

Técnicas de Biología Molecular Técnicas de Biología Molecular DNA I. Enzimas de restricción Análisis Las enzimas de restricción fueron aisladas de bacterias; su función natural es proteger contra DNA extraño II. Separación electroforética

Más detalles

Enzimas de restricción

Enzimas de restricción BIOTECNOLOGIA Enzimas de restricción Endonucleasas que reconocen dianas específicas en el ADN Protegen a cada cepa de bacterias de otro ADN que no pertenece al sistema El ADN propio está protegido porque

Más detalles


LA BIOTECNOLOGÍA HACE TU VIDA MEJOR Y MÁS FÁCIL LA BIOTECNOLOGÍA HACE TU VIDA MEJOR Y MÁS FÁCIL BIOTECNOLOGÍA APLICADA A LA SALUD La Biotecnología está presente en la Medicina y en la Salud animal, ya que participa en el diagnóstico y en el tratamiento

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

CUESTIONES TEMA 4: La revolución genética y la biotecnología.

CUESTIONES TEMA 4: La revolución genética y la biotecnología. CUESTIONES TEMA 4: La revolución genética y la biotecnología. 1. El ADN no puede salir del núcleo: Cómo logra llevar a los ribosomas que están en el citoplasma la información que porta? 2. El individuo

Más detalles

Soluciones de la serie de ejercicios 4 (Curso 7.012)

Soluciones de la serie de ejercicios 4 (Curso 7.012) Pregunta 1 Soluciones de la serie de ejercicios 4 (Curso 7.012) Usted está estudiando la síntesis del aminoácido triptófano en las bacterias. Las enzimas TrpA, TrpB, TrpC, TrpD, TrpE and AroH son necesarias

Más detalles

Tipos de células madre

Tipos de células madre Biología Bachillerato IES Fuentesnuevas 1 CÉLULAS MADRE O TRONCALES (STEM CELLS) Las células madre son células que tienen capacidad de renovarse continuamente por sucesivas divisiones por mitosis y de

Más detalles

Name Date Class. [Comienzo de Sección 11-1] Por favor pasa a la página 226 para empezar la Sección 11-1, La Ingeniería Genética.

Name Date Class. [Comienzo de Sección 11-1] Por favor pasa a la página 226 para empezar la Sección 11-1, La Ingeniería Genética. [Introducción] Por favor abre tu libro en la página 225. Capítulo 11: La Tecnología de Genes Los científicos trabajan día a día en búsqueda de nuevas formas para el uso de la tecnología genética en beneficio

Más detalles

Microbiología General 2006-2007. Tema 5: Transmisión de la información genética

Microbiología General 2006-2007. Tema 5: Transmisión de la información genética Microbiología General 2006-2007 Tema 5: Transmisión de la información genética Transmisión de la información genética Reparto del material genético en procariontes y eucariontes. Transferencia horizontal

Más detalles

Tema 11. Herramientas de la genética molecular

Tema 11. Herramientas de la genética molecular Tema 11. Herramientas de la genética molecular Genética CC. Mar 2004-05 Objetivos Técnicas de clonación Construcción de genotecas e identificación de secuencias Mapas de restricción Amplificación (PCR)

Más detalles


QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA. Julio A. Carrasco Vallejo Julio 2014 QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA Julio A. Carrasco Vallejo Julio 2014 Definiciones Biología Molecular: Estudio de los flujos de información genética en una célula Biotecnología: Uso de sistemas

Más detalles

Genómica y transcriptómica para la generación de datos en Evolución

Genómica y transcriptómica para la generación de datos en Evolución recuadro Genómica y transcriptómica para la generación de datos en Evolución Gabriela Bedó Genómica. Sus objetivos Compilar todas las secuencias de un organismo Establecer la localización de los genes

Más detalles

La ingeniería genética

La ingeniería genética Objetivos Antes de empezar En esta quincena aprenderás a: Biotecnología moderna. tradicional Ingeniería genética y manipulación del genoma. Alimentos transgénicos. La clonación. El genoma humano Problemas

Más detalles

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada La PCR La Reacción en Cadena de la Polimerasa es la herramienta más utilizada PCR- Ventajas y Usos Amplificación ilimitada de secuencias de interés. Rápida, Sencilla y Eficaz. Técnica altamente sensible

Más detalles


BIOTECNOLOGÍA Y GENÉTICA MOLECULAR BIOTECNOLOGÍA Y GENÉTICA MOLECULAR Conceptos de biotecnología y genética molecular. Importancia y beneficios de la biotecnología. Genética y Tecnología del DNA recombinante: estrategias de clonación. Enzimas

Más detalles

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante BIOTECNOLOGÍA 1.- Ingeniería Genética, ADN recombinante Técnica del ADN recombinante: es la más usada en ingeniería genética, esta basada en el uso de las enzimas de restricción o endonucleasas de restricción

Más detalles


CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 DEFINICIÓN PCR: Constituye la técnica más importante para amplificar ácidos nucleicos in vitro. Ambas hebras del DNA de interés son replicadas

Más detalles

Reacción en cadena de la polimerasa (PCR)

Reacción en cadena de la polimerasa (PCR) Dr. Alejandro Leal Reacción en cadena de la polimerasa (PCR) La reacción en cadena de la polimerasa (PCR, por sus siglas en inglés de "polymerase chain reaction") es un método de amplificación in vitro

Más detalles


TEMA 4: LA REVOLUCIÓN GENÉTICA TEMA 4: LA REVOLUCIÓN GENÉTICA 1. Introducción Los seres vivos son capaces de hacer copias de sí mismos, de tal modo que los hijos heredan los caracteres de sus padres. Para lograrlo a) Deben almacenar

Más detalles


Proyecto GENOMA HUMANO CÉLULAS MADRE Proyecto GENOMA HUMANO PROYECTO GENOMA HUMANO PROYECTO GENOMA HUMANO TIPOS DE ADN EN EL GENOMA HUMANO Intrones, promotores y regiones reguladoras (40 %) DNA intergénico con funciones desconocidas(68,3

Más detalles


LA INGENIERÍA GENÉTICA LA INGENIERÍA GENÉTICA Todo organismo, aún el más simple, contiene una enorme cantidad de información. Esa información se repite en cada una de sus células organizada en unidades llamadas genes, los cuales

Más detalles

ADN ARN Proteínas. La información genética es portada por el ADN y se hereda con él.

ADN ARN Proteínas. La información genética es portada por el ADN y se hereda con él. Todos los organismos contienen información que les permite coordinar sus procesos. Esta información, a fin de poder ser transferida a la descendencia, esta asentada en una molécula capaz de replicarse,

Más detalles

Autor: Andrés M. Gatica Arias,

Autor: Andrés M. Gatica Arias, Autor: Andrés M. Gatica Arias, Introducción Es de rigurosa justicia emancipar la enseñanza de todo extraño poder, y convertirla en una función social, sin otra ley que la libre indagación y

Más detalles

IES Pando Departamento de Biología y Geología 1

IES Pando Departamento de Biología y Geología 1 IES Pando Departamento de Biología y Geología 1 2 Células en diversos estadios del ciclo celular en la raíz de ajo. 3 Diversos aspectos del núcleo durante el ciclo celular Ciclo celular 4 Repartición del

Más detalles

Curso: Ingeniería genética Agropecuaria Unidad 1: Conceptos y perspectiva histórica de la tecnología del ADN recombinante.

Curso: Ingeniería genética Agropecuaria Unidad 1: Conceptos y perspectiva histórica de la tecnología del ADN recombinante. Temáticas que se revisarán: Universidad Nacional Abierta y a Distancia Especialización en Mejoramiento Genético Ingeniería genética Agropecuaria Luz Mery Bernal Parra Curso: Ingeniería genética Agropecuaria

Más detalles

Slide 1 / 50. Biotecnología

Slide 1 / 50. Biotecnología Slide 1 / 50 Biotecnología Slide 2 / 50 Biotecnología definida La manipulación (mediante la ingeniería genética) de los organismos vivos o sus componentes para producir productos útiles, generalmente comerciales

Más detalles

Clonación molecular. Clonar significa hacer copias idénticas

Clonación molecular. Clonar significa hacer copias idénticas INGENIERÍA GENÉTICA Clonación molecular Clonar significa hacer copias idénticas Este término originalmente fue aplicado al procedimiento de aislar una célula y permitirle reproducirse creando una población

Más detalles

UD 3. La Revolución Genética

UD 3. La Revolución Genética UD 3. La Revolución Genética 1. INTRODUCCIÓN: El ADN, la genética. 2. La ingeniería genética 3. Para qué sirve la ingeniería genética? Aplicaciones 4. Transgénicos 5.El Proyecto Genoma Humano (PGH) 6.

Más detalles

Técnicas descritas en el curso 7.28

Técnicas descritas en el curso 7.28 Técnicas descritas en el curso 7.28 Técnica: Clase 1 Experimento de incorporación de dntps Ensayo de extensión del cebador Ensayo de unión en filtro Electroforesis en gel Análisis de ADN Helicasa Polaridad

Más detalles

Practica la genética Ficha didáctica del profesorado Bachillerato

Practica la genética Ficha didáctica del profesorado Bachillerato Ficha didáctica del profesorado Bachillerato Extracción de ADN Cuál es la función de cada uno de los ingredientes utilizados para realizar la disolución tampón para la visualización

Más detalles

cromátidas centrómero cromosoma

cromátidas centrómero cromosoma núcleo en interfase fibra de cromatina cromátidas centrómero cromosoma 2n = 46 cromátidas cromosomas homólogos Los genes están formados por genes alelos segmentos de ADN y se encuentran situados en los

Más detalles


CIENCIA Y VIDA COTIDIANA CIENCIA Y VIDA COTIDIANA La clonación, el ADN y cosas de la genética Santiago Torres Martínez Departamento Genética y Microbiología Universidad de Murcia Murcia 25 febrero y 3 marzo, 2008 . Genética. Gen.

Más detalles

En función de la relación existente entre el donante y el receptor se diferencian varios tipos de trasplantes:

En función de la relación existente entre el donante y el receptor se diferencian varios tipos de trasplantes: TEMA 4: AVANCES BIOMÉDICOS 1.- TRASPLANTES DE ÓRGANOS Trasplante o injerto en medicina es un tratamiento médico complejo que consiste en trasladar órganos, tejidos o células de una persona a otra. El órgano

Más detalles

Práctico: Genética bacteriana 2007.

Práctico: Genética bacteriana 2007. Práctico: Genética bacteriana 2007. Actividad integrada Departamento de Genética Departamento de Bacteriología y Virología. OBJETIVOS Objetivos generales El estudiante al terminar la actividad práctica

Más detalles

GLOSARIO. Ácido Desoxirribonucleico (ADN).- Molécula almacenadora de información hereditaria

GLOSARIO. Ácido Desoxirribonucleico (ADN).- Molécula almacenadora de información hereditaria GLOSARIO Ácido Desoxirribonucleico (ADN).- Molécula almacenadora de información hereditaria que se encuentra en el núcleo de la célula. Las bases del ADN son 4: Adenina, Timina, Citosina y Guanina representadas

Más detalles


CIENCIA Y VIDA COTIDIANA CIENCIA Y VIDA COTIDIANA Dieta genética para prevenir enfermedades? La clonación, el ADN y otras cosas Genética para andar por casa. Santiago Torres Martínez Catedrático de Genética Departamento de Genética

Más detalles


CÓDIGO GENÉTICO Y SÍNTESIS DE PROTEÍNAS CÓDIGO GENÉTICO Y SÍNTESIS DE PROTEÍNAS Sumario Mitosis y meiosis Código genético y síntesis de proteínas: 1. Concepto de gen 2. Estructura del ADN 3. La replicación del ADN 4. La transcripción 5. La traducción

Más detalles

La división celular. .Interfase

La división celular. .Interfase .Interfase La división celular El conjunto de procesos propios de la interfase hacen posible el mantenimiento o el incremento de las estructuras celulares, lo que conlleva, en principio, un incremento

Más detalles

Soluciones de la serie de ejercicios 3 (Curso 7.012)

Soluciones de la serie de ejercicios 3 (Curso 7.012) Soluciones de la serie de ejercicios 3 (Curso 7.012) Stardate Diario personal del Médico militar del USS Hackerprise Al regresar de una misión en Europa, su compañero de tripulación, Noslen,

Más detalles

Oferta tecnológica: Método para detectar inserciones de espaciadores en estructuras CRISPR

Oferta tecnológica: Método para detectar inserciones de espaciadores en estructuras CRISPR Oferta tecnológica: Método para detectar inserciones de espaciadores en estructuras CRISPR Oferta tecnológica: Método para detectar inserciones de espaciadores en estructuras CRISPR. RESUMEN Las repeticiones

Más detalles

Módulo III (Optativo) Ampliación de Biología-Geología Bloque 2. Unidad 6. Genes y manipulación genética.

Módulo III (Optativo) Ampliación de Biología-Geología Bloque 2. Unidad 6. Genes y manipulación genética. Módulo III (Optativo) Ampliación de Biología-Geología Bloque 2. Unidad 6. Genes y manipulación genética. En Unidades anteriores has estudiado que las características de un ser vivo se deben a sus genes

Más detalles

Revolución genética (tema 4) Raquel Pascual, Paula Pardo y Jaime Parras

Revolución genética (tema 4) Raquel Pascual, Paula Pardo y Jaime Parras Revolución genética (tema 4) Raquel Pascual, Paula Pardo y Jaime Parras Diferencia entre los seres vivos 1. Pedruscos y bichos, Qué los diferencia? Dos tipos de objeto seres vivos (pueden hacer copias

Más detalles



Más detalles

Biología I. Biología I. Tema 9. Biotecnología

Biología I. Biología I. Tema 9. Biotecnología Biología I Tema 9. Biotecnología Objetivo de aprendizaje del tema Al finalizar el tema serás capaz de: Exponer los antecedentes, aplicaciones e importancia de la Biotecnología. Definir el término de Biotecnología

Más detalles

Biología Profundización

Biología Profundización UNIDAD 1: GENÉTICA SUB-UNIDAD 2: TRANSCRIPCIÓN Y TRADUCCIÓN Biología Profundización En esta sesión tú podrás: - Conocer el proceso transcripcional y post-transcripcional. - Reconocer los sucesivos procesos

Más detalles

Capítulo 7.3. Resumen para no expertos

Capítulo 7.3. Resumen para no expertos Resumen para no expertos Comunicación bacteriana y síntesis de antibióticos La comunicación es un factor esencial para todos los seres vivos. Las bacterias, en concreto, se comunican utilizando pequeños

Más detalles

Ingeniería Genética II

Ingeniería Genética II Ingeniería Genética II Expresión de proteínas recombinantes Vectores de expresión Características adicionales: - Promotor regulable - Terminador de la transcripción - Sitio de reconocimiento por el ribosoma

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles


I.S.P.I. N 9009 San Juan Bautista de La Salle INTRODUCCIÓN A LA BIOTECNOLOGÍA Y TECNOLOGÍAS ESPECÍFICAS I.S.P.I. N 9009 San Juan Bautista de La Salle INTRODUCCIÓN A LA BIOTECNOLOGÍA Y TECNOLOGÍAS ESPECÍFICAS Asignatura: Frecuencia: Docente a cargo: Destinatarios: Anual 5 horas por semana Lic. César R. Olsina

Más detalles


La MEDICINA del SIGLO XXI La MEDICINA del SIGLO XXI Ginés Morata Pérez Ex-Director del Centro de Biología Molecular del CSIC Carlos Martínez-A. Jefe del Departamento de Inmunología y Oncología del Centro Nacional de Biotecnología

Más detalles

Investigación en genes. Tecnología del ADN recombinante

Investigación en genes. Tecnología del ADN recombinante Investigación en genes Tecnología del ADN recombinante Tecnología del ADN recombinante 1º parte: Conocimientos básicos que posibilitaron su desarrollo 2º parte: Instrumentos básicos 3º parte Ejemplos Conocimientos

Más detalles

- Clonar un gen (molde ADN o ARN)

- Clonar un gen (molde ADN o ARN) APLICACIONES PCR Aplicaciones de la PCR - Clonar un gen (molde ADN o ARN) - Secuencia conocida - Genes homólogos en especies próximas (primers degenerados) - Información de secuencia proteica (primers

Más detalles

5. BIOLOGÍA. BACHILLERATO (LOGSE) Prueba de acceso a la Universidad. Ejercicio de BIOLOGIA. Segunda parte de la prueba

5. BIOLOGÍA. BACHILLERATO (LOGSE) Prueba de acceso a la Universidad. Ejercicio de BIOLOGIA. Segunda parte de la prueba 84 5. BIOLOGÍA BACHILLERATO (LOGSE) Prueba de acceso a la Universidad Ejercicio de BIOLOGIA Segunda parte de la prueba Modalidad de Ciencias de la Naturaleza y de la Salud Materia obligatoria en la via

Más detalles

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri OBJETIVO Desarrollar un banco de datos a partir de plantas de origen indudable y del uso

Más detalles

PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR OPCIÓN C BIOLOGÍA. Lee atentamente el texto y las preguntas antes de contestar.

PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR OPCIÓN C BIOLOGÍA. Lee atentamente el texto y las preguntas antes de contestar. PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR OPCIÓN C BIOLOGÍA DATOS DEL ASPIRANTE Apellidos: CALIFICACIÓN PRUEBA Nombre: D.N.I. o Pasaporte: Fecha de nacimiento: / / Instrucciones: Lee atentamente

Más detalles


CIENCIA Y VIDA COTIDIANA CIENCIA Y VIDA COTIDIANA Genética para andar por casa... y 3 Murcia, 17 de diciembre de 2012. Genética. Gen. ADN. Información genética. Cromosomas. Genética forense. Ingeniería genética. Clonación/Transgénicos.

Más detalles


17.- INGENIERÍA GENÉTICA 17.- INGENIERÍA GENÉTICA SECUENCIACIÓN DEL ADN Se puede hacer de todo el ADN o de genes sueltos. Sabiendo la secuencia de un gen se puede comparar con el gen de un individuo y saber si está mutado. 1.

Más detalles

Biotecnología. Historia y aplicaciones Su utilización en el INTA Alto Valle. investigación

Biotecnología. Historia y aplicaciones Su utilización en el INTA Alto Valle. investigación Alejandro Giayetto Técnico INTA Mirta Rossini Técnico INTA Diana Vera Biotecnóloga investigación 10 Biotecnología

Más detalles


DATOS DE LA ASIGNATURA DATOS DE LA ASIGNATURA Denominación: Ingeniería Genética Aplicada Código: 58127 Clase: Optativa Curso: 2º Carácter: Cuatrimestral Cuatrimestre: 2º Créditos LRU: 6 Teóricos: 4.5 Prácticos: 1.5 Créditos

Más detalles

Bioluminiscencia: de la Naturaleza a labiotecnología

Bioluminiscencia: de la Naturaleza a labiotecnología Bioluminiscencia: de la Naturaleza a labiotecnología Científicos crean gatos con piel fluorescente. El ciencia y ecología. 13-12-2007 Son los científicos unos excéntricos? Cómo brilla la naturaleza?

Más detalles


file:///c:/documents%20and%20settings/administrador/mis%20docu... [ Principal ] [ contenido ] [ introducción ] [ ciclo celular ] [ divisiones celulares ] [ ciclos de vida ] [ mendel ] [ otras relaciones alélicas ] [ ligados ] [ sexo y herencia ] [ interacción ] [ estructura

Más detalles



Más detalles

TEMA 5 TEMA 6. 7. La célula tiene que saber la ruta a emplear en cada momento, cómo regula estos procesos de manera primaria?.

TEMA 5 TEMA 6. 7. La célula tiene que saber la ruta a emplear en cada momento, cómo regula estos procesos de manera primaria?. TEMA 1 1. El agua es uno de los principales elementos de los seres vivos, por qué es tan importante?. 2. Las proteínas son polímeros de aminoácidos, cuáles son las características básicas de los aminoácidos

Más detalles

Qué es un gen? EXPRESION GÉNICA 01/05/2013

Qué es un gen? EXPRESION GÉNICA 01/05/2013 Qué es un gen? Es una secuencia de nucleótidos en la molécula de ADN, equivalente a una unidad de transcripción. Contiene la información, a partir de la cual se sintetiza un polipéptido, una enzima, un

Más detalles

Ácidos nucleicos: ADN y ARN

Ácidos nucleicos: ADN y ARN Unidad I Genética Ácidos nucleicos: ADN y ARN Definición Los ácidos nucleicos son compuestos orgánicos constituidos por unidades llamadas nucleótidos. Su función principal es transmitir las características

Más detalles

Técnicas de ADN recombinante: la manipulación genética

Técnicas de ADN recombinante: la manipulación genética Técnicas de ADN recombinante: la manipulación genética A partir de los años 70 se desarrollaron las herramientas de la biología molecular o la ingeniería genética o lo que se ha llamado técnicas del ADN

Más detalles

Mapeo genómico: Determinación de la localización de elementos en un genoma, con respecto de marcadores identificados

Mapeo genómico: Determinación de la localización de elementos en un genoma, con respecto de marcadores identificados Mapeo genómico: Determinación de la localización de elementos en un genoma, con respecto de marcadores identificados Tipos de mapas: MAPAS FISICOS (de restricción, citogenéticos, de híbridos de radiación...)

Más detalles



Más detalles

FISIOLOGÍA GENERAL Jesús Merino Pérez y María José Noriega Borge

FISIOLOGÍA GENERAL Jesús Merino Pérez y María José Noriega Borge REPLICACIÓN DEL ADN INTRODUCCIÓN La unidad básica de información en los seres vivos es el gen, definido en células eucariotas como un segmento de ADN que lleva la información necesaria para la síntesis

Más detalles

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now.

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now. Unidad Curricular: Virología y Micología Veterinaria 1 TRABAJO PRÁCTICO No. 3 AMPLIFICACIÓN DE GENES VIRALES Reacción en Cadena de la Polimerasa, conocida como PCR (por sus siglas en inglés: Polimerase

Más detalles


GUÍA DOCENTE DE BIOTECNOLOGÍA GUÍA DOCENTE DE BIOTECNOLOGÍA I. IDENTIFICACIÓN DE LA ASIGNATURA Nombre de la asignatura: Carácter: Titulación: Ciclo: Departamento: Profesor/responsable Biotecnología Optativa Licenciatura en Farmacia

Más detalles

Dpto. de Ciencias Agrarias y del Medio Natural Área: Fisiología Vegetal MASTER EN BIOLOGÍA MOLECULAR, CELULAR Y GENÉTICA


Más detalles

III. Material genético. b. Composición y estructura del RNA.

III. Material genético. b. Composición y estructura del RNA. III. Material genético b. Composición y estructura del RNA. RNA (ácido ribonucléico) Polímero de nucleótidos La pentosa de los nucleótidos es la Ribosa: en la posición 2' del anillo del azúcar hay un grupo

Más detalles

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica TÉCNICAS GENÓMICAS Utilidad/Objetivos: 1) Detección de microorganismos directamente en muestras clínicas identificando un fragmento específico del genoma del microorganismo concreto 2) Cuantificación del

Más detalles


AVANCES EN TRANSGÉNESIS ANIMAL AVANCES EN TRANSGÉNESIS ANIMAL Dr. Pablo Bosch Laboratorio de Reprogramación Celular e Ingeniería Genética Departamento de Biología Molecular FCEFQyN, UNRC 1 de 33 Estructura de la presentación Definición

Más detalles

Tecnología de DNA recombinante I

Tecnología de DNA recombinante I Tecnología de DNA recombinante I Base: capacidad de manipular moléculas de DNA en un tubo de ensayo Enzimas: Purificadas, con actividades conocidas y controladas DNA polimerasas Síntesis de DNA Nucleasas

Más detalles


LA NUEVA BIOTECNOLOGÍA LA NUEVA BIOTECNOLOGÍA Ingeniería genética: técnicas que permiten manipular la información genética de un ser vivo. TECNOLOGÍA TRADICIONAL DEL ADN RECOMBINANTE CLONACIÓN DE GENES: Obtención de muchas copias

Más detalles

clonación humana Monografías de Comunicación Científica Museos Científicos Coruñeses Una informació n elaborada por

clonación humana Monografías de Comunicación Científica Museos Científicos Coruñeses Una informació n elaborada por Una informació n elaborada por Museos Científicos Coruñeses Monografías de Comunicación Científica 04 Edición realizada con el patrocinio de clonación humana El 13 de febrero de 2004 todos los medios de

Más detalles

ÁCIDOS NUCLEICOS. Por: Wilfredo Santiago

ÁCIDOS NUCLEICOS. Por: Wilfredo Santiago ÁCIDOS NUCLEICOS Por: Wilfredo Santiago Ácidos Nucleicos Formados por subunidades llamadas nucleótidos; pueden ser un solo nucleótido o una cadena larga de nucleótidos. Ácidos Nucleicos Nucleótidos individuales:

Más detalles

2.- Mejora genética de animales y plantas. 2.1. Procedimientos clásicos. 2.2. Ingeniería genética.

2.- Mejora genética de animales y plantas. 2.1. Procedimientos clásicos. 2.2. Ingeniería genética. GENÉTICA APLICADA. 1.- Enfermedades hereditarias: concepto. 2.- Mejora genética de animales y plantas. 2.1. Procedimientos clásicos. 2.2. Ingeniería genética. 3.- Repercusiones sociales de la genética.

Más detalles


BIOTECNOLOGÍA Y BIOSEGURIDAD EN MÉXICO BIOTECNOLOGÍA Y BIOSEGURIDAD EN MÉXICO La Biotecnología La biotecnología se puede definir como el conjunto de técnicas que involucran la manipulación de organismos vivos o sus componentes sub-celulares,

Más detalles

El primer bovino bitransgénico del mundo

El primer bovino bitransgénico del mundo 112 ACTUALIDAD EN I+D RIA / Vol. 37 / N.À 2 Por Expresión Bicistrónica El primer bovino bitransgénico del mundo Por primera vez en la historia, científicos logran insertar dos genes humanos en un sólo

Más detalles



Más detalles

Genética molecular. 1. Qué son los genes? 2. En qué consiste. 3. Pueden los genes CUESTIONES. Dónde se encuentran?

Genética molecular. 1. Qué son los genes? 2. En qué consiste. 3. Pueden los genes CUESTIONES. Dónde se encuentran? 0S4BL_12_07 25/1/12 16:46 Página 150 ESIONES enética molecular 1. Qué son los genes? Dónde se encuentran? 2. En qué consiste la realización del mensaje genético? 3. Pueden los genes cambiarse o eliminarse,

Más detalles

Modalidad de Ciencias y Tecnología

Modalidad de Ciencias y Tecnología Biología Esta materia requiere conocimientos incluidos en Biología y geología. Los grandes y rápidos avances de la investigación biológica en las últimas décadas han llevado a considerar a la segunda mitad

Más detalles

Preguntas de selectividad en Andalucía. Ácidos nucleicos. Análisis e interpretación de imágenes, esquemas, figuras...

Preguntas de selectividad en Andalucía. Ácidos nucleicos. Análisis e interpretación de imágenes, esquemas, figuras... Año 2001 Describa las funciones más relevantes de los nucleótidos. Cite un ejemplo de nucleótido que participe en cada una de ellas [1,5]. Explique las funciones de los distintos tipos de RNA que participan

Más detalles


FLUJO DE LA INFORMACIÓN GENÉTICA REPRODUCCIÓN CELULAR Biología General FLUJO DE LA INFORMACIÓN GENÉTICA REPRODUCCIÓN CELULAR Biología General 1- Diga si son falsas o verdaderas las siguientes afirmaciones con respecto al núcleo celular: I. La envoltura nuclear presenta dos

Más detalles

Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario

Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario Cuándo debemos sospechar que un cáncer puede ser hereditario? El cáncer es una enfermedad muy frecuente, es fácil que en una

Más detalles

Got es de color negro y es idéntico que su padre que se llamaba Vasito. El segundo toro clonado del proyecto llamado Glass nació muerto.

Got es de color negro y es idéntico que su padre que se llamaba Vasito. El segundo toro clonado del proyecto llamado Glass nació muerto. Noticia: Got, el primer toro bravo clonado Nace en Palencia Científicos españoles han clonado con éxito a un semental de la ganadería de toros de lidia de Alfonso Guardiola. Ya está aquí el primer animal

Más detalles


INGENIERÍA GENÉTICA 5 GAATTC 3 3 CTTAAG 5 INGENIERÍA GENÉTICA 1. Fundamentos básicos de la ingeniería genética 2. Desnaturalización e hibridación del ADN 3. Reacción en cadena de la polimerasa (PCR) 4. Nuevas disciplinas surgidas de la ingeniería

Más detalles


PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR Convocatoria mayo de 2005 BIOLOGIA Convocatoria mayo de 2005 BIOLOGIA a) El ADN es la molécula portadora del mensaje genético: define cómo está compuesto el ADN y qué diferencias existen entre el ADN y el ARN b) Explica qué es un gen y

Más detalles

Claus per a comprendre la genètica

Claus per a comprendre la genètica Curs: 2011-2012 Diploma Sènior de la UOM. Primer curs. Obligatòria. Claus per a comprendre la genètica Tema 8: Clonació i cel.lules mare Dr. José Aurelio Castro Ocón Universitat de les Illes Balears La

Más detalles