Cultura Cientí fica 1 Bachillerato

Tamaño: px
Comenzar la demostración a partir de la página:

Download "Cultura Cientí fica 1 Bachillerato"

Transcripción

1 Cultura Cientí fica 1 Bachillerato 3. La revolución genética: biotecnología Actividades de consolidación 1. Cualquier molécula de ADN formada por la unión de segmentos de ADN de origen diferente es: a) ADN basura. b) ADN recombinante. c) ADN complementario. 2. Existe alguna relación entre la secuencia de bases de una cadena de ADN, la secuencia de bases de una molécula de ARNm y la secuencia de aminoácidos de una proteína? 3. Para separar una mezcla de moléculas de ADN en bandas, cada una de ellas formada por miles de moléculas de ADN de la misma longitud lo que se hace es: a) Un ensayo de hibridación con una sonda de ADN. b) Una electroforesis, por ejemplo, en gel de agarosa. c) Una secuenciación del ADN. 4. La siguiente secuencia corresponde a una molécula de ADN de cadena doble de un determinado organismo: A T G A A T T C G A A G C T T G Grupo Editorial Bruño, S. L.

2 Consultando la tabla siguiente, contesta a las cuestiones: Enzima Puntos de restricción EcoRI HindIII PstI BglII a) Qué fragmentos de restricción se originarán tras la incubación de la molécula de ADN con la endonucleasa de restricción EcoRI? b) Y si se utiliza HindIII? 5. Analiza y comenta la situación que se plantea en el texto siguiente y que podría ser real en un futuro no muy lejano: Sr. y Sra. Gillespie, buenos días. Soy el Dr. Percibal Longman, encargado del Programa de Análisis Genético de la Seguridad Social. El resultado de los análisis a los que han sido sometidos revela que, si ustedes tienen un hijo, hay un 12,5 % de probabilidades de que sea portador del gen de predisposición a una enfermedad degenerativa del tejido muscular. Hoy en día el tratamiento de esta enfermedad se realiza con éxito, pero es muy costoso. Debo informarles que la Ley sobre Prevención de Discapacidades de Origen Genético aprobada el año pasado por el Parlamento Europeo les permite tener hijos, ya que no alcanzan el 33 % a partir del cual se establece la prohibición, pero deben saber que la Seguridad Social no se hará cargo de los gastos que genere la posible enfermedad de su hijo. Adopten ustedes la decisión que crean más conveniente. 6. En un laboratorio de biotecnología, un grupo de científicos está trabajando en el diseño de diferentes organismos genéticamente modificados de segunda generación cuando son informados de un grave incidente: los contenedores que acumulan los residuos radiactivos de baja y media actividad, almacenados en el cementerio nuclear de Carleg, están agrietados y se teme que exista emisión de radioisótopos, lo que puede afectar a las personas y al medio ambiente. Qué tipo de OGM podría desarrollar este grupo de biotecnólogos para solucionar el problema? 7. El proceso de síntesis de proteínas se denomina: a) Transcripción. b) Traducción. c) Replicación. 2 Grupo Editorial Bruño, S. L.

3 8. El sida y la «enfermedad de las vacas locas» nos han demostrado lo fácil que es para las enfermedades saltar de una especie a otra, con gravísimas consecuencias. Si trasplantar un corazón de cerdo transgénico a una persona, posiblemente, sería un éxito, por qué crees que aún no se ha realizado esta operación? 9. La biotecnología actual permite crear copias de animales gracias a una técnica que se conoce como: a) Duplicación. b) Transgénesis. c) Clonación. 10. Sabrías explicar qué es un animal knockout y para qué se diseñan? 11. El ADN es una macromolécula formada por la unión de otras moléculas más sencillas llamadas: a) Cromatina. b) Aminoácidos. c) Nucleótidos. 12. Para clonar un fragmento de ADN, este debe ser introducido en: a) Un vector de expresión. b) Una sonda de ADN. c) Un vector de clonación. 13. Las células procariotas carecen de núcleo. Dónde crees que se realizan los procesos de transcripción y traducción? 14. Una parte del genoma humano no tiene función conocida y representa el: a) 95 % del genoma. b) 33,5 % del genoma. c) 99,99 % del genoma. 15. Construye las dos cadenas de ADN del cual se obtuvo por un proceso de transcripción la siguiente secuencia de ARN: AUGCCUAGGCUCAAUACGGUGA 16. Las células madre adultas son células: a) Totipotentes. b) Pluripotentes. c) Multipotentes. 3 Grupo Editorial Bruño, S. L.

4 17. Las células madre embrionarias son células: a) Totipotentes. b) Pluripotentes. c) Multipotentes. 18. La reacción en cadena de la polimerasa (PCR) permite: a) Obtener millones de copias de un segmento específico de ADN mediante la repetición de múltiples ciclos de replicación del ADN in vitro. b) Obtener millones de copias de un segmento específico de ADN mediante un proceso denominado transformación. c) Obtener millones de copias de un segmento específico de ADN mediante bibliotecas o genotecas de ADN. 19. La insulina es una hormona que se produce en el páncreas y controla la concentración de azúcar en la sangre. Las personas diabéticas no la producen en cantidad suficiente, por lo que muchas de ellas deben inyectarse insulina para corregir el problema. En la actualidad la insulina humana es producida por ingeniería genética. Describe el proceso que se sigue para su obtención. 20. En la siguiente figura se muestra el número de genes de distintas especies así como el porcentaje de coincidencias entre el genoma de una persona en relación con otras personas y con otras especies animales (chimpancé, ratón, gusano de tierra y mosca del vinagre). Qué conclusiones puedes sacar de su estudio? 4 Grupo Editorial Bruño, S. L.

5 Soluciones 1. b). 2. En la secuencia de bases del ADN se encuentra la información genética necesaria para sintetizar una proteína. Sin embargo, esa información no puede utilizarse directamente, sino que se emplea para sintetizar una molécula de ARN m en un proceso que recibe le nombre de transcripción. De esta manera el ARN m lleva en su secuencia de bases la información hasta los ribosomas, que son los orgánulos encargados de descifrar el ARN m, y en ellos se lleva a cabo la síntesis de la proteína, proceso denominado traducción. 3. b). 4. a) Fragmentos de restricción originados tras la incubación de la molécula de ADN con la endonucleasa de restricción EcoRI: Secuencia de reconocimiento : A T G A A T T C G A A G C T T G Fragmentos de restricción : A T G T A C T T A A 5 Grupo Editorial Bruño, S. L. A A T T C G A A G C T T G G C T T C G A A C b) Fragmentos de restricción originados tras la incubación de la molécula de ADN con la endonucleasa de restricción HindIII: Secuencia de reconocimiento: A T G A A T T C G A A G C T T G Fragmentos de restricción: A T G A A T T C G A A G C T T G Respuesta abierta. Los alumnos deberían valorar la problemática ética que plantea la utilización de la biotecnología, así como la importancia de la misma en el campo de la prevención de enfermedades de origen genético. 6. De la misma forma que se utilizan determinados microorganismos en los procesos de biorremediación, se podrían diseñar bacterias genéticamente modificadas para limpiar las zonas donde se acumulan los residuos nucleares, eliminando el peligro, que de otra manera, dura miles de años.

6 7. b). 8. No se ha realizado ningún xenotransplante por temor a transferir virus y enfermedades porcinas al ser humano. 9. c). 10. Los animales knockout son aquellos en los que se sustituye un gen funcional por otro mutante no funcional con el fin de examinar los efectos que este tipo de experimento tiene sobre el animal y poder conocer la función que desempeña el gen. Los ratones son los organismos más utilizados en ingeniería genética. Son modelos ideales para estudiar determinadas enfermedades en las personas porque la mayoría de sus genes actúan de una forma muy parecida al de los genes humanos. Su manipulación puede ayudar a conocer, por ejemplo, el funcionamiento de los genes que provocan el cáncer y así comprender la evolución de esta enfermedad. 11. c). 12. c). 13. En las células procariotas los procesos de transcripción y de traducción tienen lugar a la vez y en el citoplasma de la célula. Antes incluso de que haya finalizado la formación del ARNm, los ribosomas ya pueden proceder a su lectura. 14. a). 15. La doble cadena de ADN será: 16. c). 17. b). 18. a). TACGGATCCGAG TT ATGCCACT ATGCCTAGGCTC AATACGGTGA 19. Se aísla el gen de la insulina humana y se inserta en un vector de expresión, en este caso un plásmido bacteriano, con la ayuda de enzimas de restricción. Después se inserta el plásmido que transporta el gen humano en las bacterias que se transforman en bacterias transgénicas. Por último, las bacterias transgénicas se cultivan en un tanque de fermentación, del que se extrae la insulina. 20. El Proyecto Genoma Humano ha demostrado que la diferencia entre dos personas es tan solo del 0,01 %. Esto significa que compartimos con cualquier persona desconocida el 99,99 % del mismo ADN. Si comparamos con otras especies, las coincidencias con un chimpancé son casi del 96 %, con un ratón tenemos en común el 80 % de nuestros genes, con el gusano de tierra Caenorhabditis elegans la coincidencia es del 40 % y con la mosca del vinagre un 60 %. El número de nuestros genes es similar al número de genes existente en el chimpancé y en el ratón y no es muy superior al número presente en invertebrados como el citado gusano de tierra o la mosca del vinagre. 6 Grupo Editorial Bruño, S. L.

1. Cuáles son las diferencias en los componentes químicos del ADN y ARN?

1. Cuáles son las diferencias en los componentes químicos del ADN y ARN? ACTIVIDADES TEMA 4 - BIOTECNOLOGÍA 1. Cuáles son las diferencias en los componentes químicos del ADN y ARN? Las cadenas de ADN están formadas por fosfato y desoxirribosa y la del ARN por fosfato y ribosa.

Más detalles

7.012 Serie de ejercicios 5

7.012 Serie de ejercicios 5 Nombre Grupo 7.012 Serie de ejercicios 5 Pregunta 1 Al estudiar los problemas de esterilidad, usted intenta aislar un hipotético gen de conejo que explique la prolífica reproducción de estos animales.

Más detalles

Tipos de células madre

Tipos de células madre Biología Bachillerato IES Fuentesnuevas 1 CÉLULAS MADRE O TRONCALES (STEM CELLS) Las células madre son células que tienen capacidad de renovarse continuamente por sucesivas divisiones por mitosis y de

Más detalles

CUESTIONES TEMA 4: La revolución genética y la biotecnología.

CUESTIONES TEMA 4: La revolución genética y la biotecnología. CUESTIONES TEMA 4: La revolución genética y la biotecnología. 1. El ADN no puede salir del núcleo: Cómo logra llevar a los ribosomas que están en el citoplasma la información que porta? 2. El individuo

Más detalles

Soluciones de la serie de ejercicios 4 (Curso 7.012)

Soluciones de la serie de ejercicios 4 (Curso 7.012) Pregunta 1 Soluciones de la serie de ejercicios 4 (Curso 7.012) Usted está estudiando la síntesis del aminoácido triptófano en las bacterias. Las enzimas TrpA, TrpB, TrpC, TrpD, TrpE and AroH son necesarias

Más detalles

TEMA 4 CMC BIOTECNOLOGÍA

TEMA 4 CMC BIOTECNOLOGÍA Conceptos Tema 4 TEMA 4 CMC BIOTECNOLOGÍA Células eucariotas: Células con núcleo. Núcleo: Un compartimento en el interior de la célula que alberga el material genético. Citoplasma: En una célula eucariota,

Más detalles

Practica la genética Ficha didáctica del profesorado Bachillerato

Practica la genética Ficha didáctica del profesorado Bachillerato Ficha didáctica del profesorado Bachillerato www.eurekamuseoa.es Extracción de ADN Cuál es la función de cada uno de los ingredientes utilizados para realizar la disolución tampón para la visualización

Más detalles

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante BIOTECNOLOGÍA 1.- Ingeniería Genética, ADN recombinante Técnica del ADN recombinante: es la más usada en ingeniería genética, esta basada en el uso de las enzimas de restricción o endonucleasas de restricción

Más detalles

Revolución genética (tema 4) Raquel Pascual, Paula Pardo y Jaime Parras

Revolución genética (tema 4) Raquel Pascual, Paula Pardo y Jaime Parras Revolución genética (tema 4) Raquel Pascual, Paula Pardo y Jaime Parras Diferencia entre los seres vivos 1. Pedruscos y bichos, Qué los diferencia? Dos tipos de objeto seres vivos (pueden hacer copias

Más detalles

IES Pando Departamento de Biología y Geología 1

IES Pando Departamento de Biología y Geología 1 IES Pando Departamento de Biología y Geología 1 2 Células en diversos estadios del ciclo celular en la raíz de ajo. 3 Diversos aspectos del núcleo durante el ciclo celular Ciclo celular 4 Repartición del

Más detalles

Curso: Ingeniería genética Agropecuaria Unidad 1: Conceptos y perspectiva histórica de la tecnología del ADN recombinante.

Curso: Ingeniería genética Agropecuaria Unidad 1: Conceptos y perspectiva histórica de la tecnología del ADN recombinante. Temáticas que se revisarán: Universidad Nacional Abierta y a Distancia Especialización en Mejoramiento Genético Ingeniería genética Agropecuaria Luz Mery Bernal Parra Curso: Ingeniería genética Agropecuaria

Más detalles

CÓDIGO GENÉTICO Y SÍNTESIS DE PROTEÍNAS

CÓDIGO GENÉTICO Y SÍNTESIS DE PROTEÍNAS CÓDIGO GENÉTICO Y SÍNTESIS DE PROTEÍNAS Sumario Mitosis y meiosis Código genético y síntesis de proteínas: 1. Concepto de gen 2. Estructura del ADN 3. La replicación del ADN 4. La transcripción 5. La traducción

Más detalles

Enzimas de restricción

Enzimas de restricción BIOTECNOLOGIA Enzimas de restricción Endonucleasas que reconocen dianas específicas en el ADN Protegen a cada cepa de bacterias de otro ADN que no pertenece al sistema El ADN propio está protegido porque

Más detalles

Biotecnología. Historia y aplicaciones Su utilización en el INTA Alto Valle. investigación

Biotecnología. Historia y aplicaciones Su utilización en el INTA Alto Valle. investigación Alejandro Giayetto Técnico INTA agiayetto@correo.inta.gov.ar Mirta Rossini Técnico INTA mrossini@correo.inta.gov.ar Diana Vera Biotecnóloga labfitopatologia@correo.inta.gov.ar investigación 10 Biotecnología

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles

Genómica y transcriptómica para la generación de datos en Evolución

Genómica y transcriptómica para la generación de datos en Evolución recuadro Genómica y transcriptómica para la generación de datos en Evolución Gabriela Bedó Genómica. Sus objetivos Compilar todas las secuencias de un organismo Establecer la localización de los genes

Más detalles

GENES Y MANIPULACIÓN GENÉTICA

GENES Y MANIPULACIÓN GENÉTICA GENES Y MANIPULACIÓN GENÉTICA El ADN, material de los genes La información que controla la aparición de los caracteres hereditarios se localiza en el interior del núcleo celular y se transmite de célula

Más detalles

Técnicas de ADN recombinante: la manipulación genética

Técnicas de ADN recombinante: la manipulación genética Técnicas de ADN recombinante: la manipulación genética A partir de los años 70 se desarrollaron las herramientas de la biología molecular o la ingeniería genética o lo que se ha llamado técnicas del ADN

Más detalles

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada La PCR La Reacción en Cadena de la Polimerasa es la herramienta más utilizada PCR- Ventajas y Usos Amplificación ilimitada de secuencias de interés. Rápida, Sencilla y Eficaz. Técnica altamente sensible

Más detalles

Got es de color negro y es idéntico que su padre que se llamaba Vasito. El segundo toro clonado del proyecto llamado Glass nació muerto.

Got es de color negro y es idéntico que su padre que se llamaba Vasito. El segundo toro clonado del proyecto llamado Glass nació muerto. Noticia: Got, el primer toro bravo clonado Nace en Palencia Científicos españoles han clonado con éxito a un semental de la ganadería de toros de lidia de Alfonso Guardiola. Ya está aquí el primer animal

Más detalles

Anomalías Cromosómicas

Anomalías Cromosómicas 12 Unique Grupo de apoyo para enfermedades cromosómicas raras del Reino Unido Teléfono: + 44 (0) 1883 330766 Email: info@rarechromo.org www.rarechromo.org Anomalías Cromosómicas Orphanet Información gratuita

Más detalles

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas ELEMENTOS BÁSICOS DE LA INVESTIGACIÓN EN GENES Análisis

Más detalles

Técnicas de Biología Molecular

Técnicas de Biología Molecular Técnicas de Biología Molecular DNA I. Enzimas de restricción Análisis Las enzimas de restricción fueron aisladas de bacterias; su función natural es proteger contra DNA extraño II. Separación electroforética

Más detalles

Proyecto GENOMA HUMANO

Proyecto GENOMA HUMANO CÉLULAS MADRE Proyecto GENOMA HUMANO PROYECTO GENOMA HUMANO PROYECTO GENOMA HUMANO TIPOS DE ADN EN EL GENOMA HUMANO Intrones, promotores y regiones reguladoras (40 %) DNA intergénico con funciones desconocidas(68,3

Más detalles

Anomalías Cromosómicas

Anomalías Cromosómicas 12 Teléfono: + 44 (0) 1883 330766 Email: info@rarechromo.org www.rarechromo.org Anomalías Cromosómicas Orphanet Información gratuita sobre enfermedades raras, ensayos clínicos, medicamentos y enlaces a

Más detalles

Qué es un gen? EXPRESION GÉNICA 01/05/2013

Qué es un gen? EXPRESION GÉNICA 01/05/2013 Qué es un gen? Es una secuencia de nucleótidos en la molécula de ADN, equivalente a una unidad de transcripción. Contiene la información, a partir de la cual se sintetiza un polipéptido, una enzima, un

Más detalles

Microbiología General 2006-2007. Tema 5: Transmisión de la información genética

Microbiología General 2006-2007. Tema 5: Transmisión de la información genética Microbiología General 2006-2007 Tema 5: Transmisión de la información genética Transmisión de la información genética Reparto del material genético en procariontes y eucariontes. Transferencia horizontal

Más detalles

Bioluminiscencia: de la Naturaleza a labiotecnología

Bioluminiscencia: de la Naturaleza a labiotecnología Bioluminiscencia: de la Naturaleza a labiotecnología Científicos crean gatos con piel fluorescente. El mundo.es ciencia y ecología. 13-12-2007 Son los científicos unos excéntricos? Cómo brilla la naturaleza?

Más detalles

INGENIERÍA GENÉTICA 5 GAATTC 3 3 CTTAAG 5

INGENIERÍA GENÉTICA 5 GAATTC 3 3 CTTAAG 5 INGENIERÍA GENÉTICA 1. Fundamentos básicos de la ingeniería genética 2. Desnaturalización e hibridación del ADN 3. Reacción en cadena de la polimerasa (PCR) 4. Nuevas disciplinas surgidas de la ingeniería

Más detalles

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now.

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now. Unidad Curricular: Virología y Micología Veterinaria 1 TRABAJO PRÁCTICO No. 3 AMPLIFICACIÓN DE GENES VIRALES Reacción en Cadena de la Polimerasa, conocida como PCR (por sus siglas en inglés: Polimerase

Más detalles

ADN ARN Proteínas. La información genética es portada por el ADN y se hereda con él.

ADN ARN Proteínas. La información genética es portada por el ADN y se hereda con él. Todos los organismos contienen información que les permite coordinar sus procesos. Esta información, a fin de poder ser transferida a la descendencia, esta asentada en una molécula capaz de replicarse,

Más detalles

Jesús G.C. Colegio Claret Segovia

Jesús G.C. Colegio Claret Segovia 1 UNIDAD 8 Documento elaborado por del de LA R E VO LU CI Ó N G EN É TI CA 1.- El ADN La célula es la unidad morfológica, funcional y genética de todos los seres vivos Todos los seres vivos están formados

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

UD 3. La Revolución Genética

UD 3. La Revolución Genética UD 3. La Revolución Genética 1. INTRODUCCIÓN: El ADN, la genética. 2. La ingeniería genética 3. Para qué sirve la ingeniería genética? Aplicaciones 4. Transgénicos 5.El Proyecto Genoma Humano (PGH) 6.

Más detalles

Reacción en cadena de la polimerasa (PCR)

Reacción en cadena de la polimerasa (PCR) Dr. Alejandro Leal Reacción en cadena de la polimerasa (PCR) La reacción en cadena de la polimerasa (PCR, por sus siglas en inglés de "polymerase chain reaction") es un método de amplificación in vitro

Más detalles

REVOLUCIÓN GENÉTICA Y BIOTECNOLOGÍA

REVOLUCIÓN GENÉTICA Y BIOTECNOLOGÍA Tema 4 REVOLUCIÓN GENÉTICA Y BIOTECNOLOGÍA 1. ADN y ARN pág 92-93 -Composición química y conceptos: ADN, ARN, nucleótidos, bases nitrogenadas, ácido fosfórico. -Estructura: doble hélice, cadenas complementarias.

Más detalles

LA BIOTECNOLOGÍA HACE TU VIDA MEJOR Y MÁS FÁCIL

LA BIOTECNOLOGÍA HACE TU VIDA MEJOR Y MÁS FÁCIL LA BIOTECNOLOGÍA HACE TU VIDA MEJOR Y MÁS FÁCIL BIOTECNOLOGÍA APLICADA A LA SALUD La Biotecnología está presente en la Medicina y en la Salud animal, ya que participa en el diagnóstico y en el tratamiento

Más detalles

PROBLEMAS MAS FRECUENTES DURANTE LA SECUENCIACIÓN NO SE PRODUCE REACCION O ESTA DECAE POCO DESPUÉS DE COMENZAR

PROBLEMAS MAS FRECUENTES DURANTE LA SECUENCIACIÓN NO SE PRODUCE REACCION O ESTA DECAE POCO DESPUÉS DE COMENZAR PROBLEMAS MAS FRECUENTES DURANTE LA SECUENCIACIÓN NO SE PRODUCE REACCION O ESTA DECAE POCO DESPUÉS DE COMENZAR Las causas pueden ser las siguientes: No hay ADN o se encuentra en muy baja concentración.

Más detalles

LOS RETOS DE LA BIOMEDICINA: ENTRE LA CIENCIA Y LA ÉTICA

LOS RETOS DE LA BIOMEDICINA: ENTRE LA CIENCIA Y LA ÉTICA AULA DE MAYORES Y DE LA EXPERIENCIA F.Córdoba, R.Torronteras, A.Canalejo Departamento de Biología Ambiental y Salud Pública LOS RETOS DE LA BIOMEDICINA: ENTRE LA CIENCIA Y LA ÉTICA Tema 1.3. Los sistemas

Más detalles

La Filogenia en nuestro ADN. Las huellas filogenéticas en nuestro ADN

La Filogenia en nuestro ADN. Las huellas filogenéticas en nuestro ADN 78 Hurvitz M. Filogenia en nuestro ADN La Filogenia en nuestro ADN Las huellas filogenéticas en nuestro ADN Hipótesis o Perspectiva Teórica Marcos Hurvitz Área de Biología Molecular Instituto de Coloproctología

Más detalles

Entender el funcionamiento de los relojes permitiría lidiar con ciertas patologías en humanos. 28 ACTUALIDAD EN I+D RIA / Vol. 41 / N.

Entender el funcionamiento de los relojes permitiría lidiar con ciertas patologías en humanos. 28 ACTUALIDAD EN I+D RIA / Vol. 41 / N. 28 ACTUALIDAD EN I+D RIA / Vol. 41 / N.º 1 Entender el funcionamiento de los relojes permitiría lidiar con ciertas patologías en humanos Abril 2015, Argentina 29 Relojes biológicos en plantas Ajustar el

Más detalles

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri OBJETIVO Desarrollar un banco de datos a partir de plantas de origen indudable y del uso

Más detalles

La división celular. .Interfase

La división celular. .Interfase .Interfase La división celular El conjunto de procesos propios de la interfase hacen posible el mantenimiento o el incremento de las estructuras celulares, lo que conlleva, en principio, un incremento

Más detalles

Capítulo 13 REPLICACIÓN DEL ADN

Capítulo 13 REPLICACIÓN DEL ADN REPLICACIÓN DEL ADN La reproducción necesita la correcta y precisa transmisión de la información genética de padres a hijos, por lo que resulta imprescindible la previa replicación o duplicación del ADN

Más detalles

Preguntas de selectividad en Andalucía. Ácidos nucleicos. Análisis e interpretación de imágenes, esquemas, figuras...

Preguntas de selectividad en Andalucía. Ácidos nucleicos. Análisis e interpretación de imágenes, esquemas, figuras... Año 2001 Describa las funciones más relevantes de los nucleótidos. Cite un ejemplo de nucleótido que participe en cada una de ellas [1,5]. Explique las funciones de los distintos tipos de RNA que participan

Más detalles

Medicamentos biológicos y biosimilares

Medicamentos biológicos y biosimilares Medicamentos biológicos y biosimilares folleto biosimilares FILMAR.indd 1 24/10/12 10:09 En qué se diferencian los medicamentos biológicos de los medicamentos tradicionales? Introducción Gracias a la investigación

Más detalles

EL ADN y la INGENIERÍA GENÉTICA

EL ADN y la INGENIERÍA GENÉTICA IES LAS VIÑAS MANILVA. MÁLAGA. CMC. Susana Serradilla EL ADN y la INGENIERÍA GENÉTICA EL GENOMA HUMANO GENOMA: Conjunto de genes de un ser vivo. GENOMA HUMANO: Conjunto de genes de la especie humana PROYECTO

Más detalles

GLOSARIO. Ácido Desoxirribonucleico (ADN).- Molécula almacenadora de información hereditaria

GLOSARIO. Ácido Desoxirribonucleico (ADN).- Molécula almacenadora de información hereditaria GLOSARIO Ácido Desoxirribonucleico (ADN).- Molécula almacenadora de información hereditaria que se encuentra en el núcleo de la célula. Las bases del ADN son 4: Adenina, Timina, Citosina y Guanina representadas

Más detalles

LA NUTRICIÓN CELULAR

LA NUTRICIÓN CELULAR LA NUTRICIÓN CELULAR La composición química de los seres vivos Todos los seres vivos estamos formados por células y constituidos por el mismo tipo de sustancias químicas, las biomoléculas. Estas biomoléculas

Más detalles

Preguntas que se hacen con frecuencia sobre los estudios clínicos

Preguntas que se hacen con frecuencia sobre los estudios clínicos Preguntas que se hacen con frecuencia sobre los estudios clínicos Son seguros? Todos los ensayos clínicos deben ser aprobados por el gobierno federal y deben cumplir con una reglamentación estricta que

Más detalles

- Clonar un gen (molde ADN o ARN)

- Clonar un gen (molde ADN o ARN) APLICACIONES PCR Aplicaciones de la PCR - Clonar un gen (molde ADN o ARN) - Secuencia conocida - Genes homólogos en especies próximas (primers degenerados) - Información de secuencia proteica (primers

Más detalles

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica TÉCNICAS GENÓMICAS Utilidad/Objetivos: 1) Detección de microorganismos directamente en muestras clínicas identificando un fragmento específico del genoma del microorganismo concreto 2) Cuantificación del

Más detalles

Evolución de la vida en la tierra:la Célula

Evolución de la vida en la tierra:la Célula Evolución de la vida en la tierra:la Célula Nuestro planeta tierra no siempre ha sido igual, sin embargo todos los astros que forman el universo están compuestos por los mismos elementos y están controlados

Más detalles

La MEDICINA del SIGLO XXI

La MEDICINA del SIGLO XXI La MEDICINA del SIGLO XXI Ginés Morata Pérez Ex-Director del Centro de Biología Molecular del CSIC Carlos Martínez-A. Jefe del Departamento de Inmunología y Oncología del Centro Nacional de Biotecnología

Más detalles

TABLA DE DECISION. Consideremos la siguiente tabla, expresada en forma genérica, como ejemplo y establezcamos la manera en que debe leerse.

TABLA DE DECISION. Consideremos la siguiente tabla, expresada en forma genérica, como ejemplo y establezcamos la manera en que debe leerse. TABLA DE DECISION La tabla de decisión es una herramienta que sintetiza procesos en los cuales se dan un conjunto de condiciones y un conjunto de acciones a tomar según el valor que toman las condiciones.

Más detalles

ÁCIDOS NUCLEICOS. Por: Wilfredo Santiago

ÁCIDOS NUCLEICOS. Por: Wilfredo Santiago ÁCIDOS NUCLEICOS Por: Wilfredo Santiago Ácidos Nucleicos Formados por subunidades llamadas nucleótidos; pueden ser un solo nucleótido o una cadena larga de nucleótidos. Ácidos Nucleicos Nucleótidos individuales:

Más detalles

COMPARACIÓN DE ÁREAS DE FIGURAS POR ESTUDIANTES DE PRIMERO DE MAGISTERIO

COMPARACIÓN DE ÁREAS DE FIGURAS POR ESTUDIANTES DE PRIMERO DE MAGISTERIO COMPARACIÓN DE ÁREAS DE FIGURAS POR ESTUDIANTES DE PRIMERO DE MAGISTERIO Sonia Aguilera Piqueras y Pablo Flores Martínez Departamento de Didáctica de la Matemática Universidad de Granada 1. Introducción

Más detalles

Genoma y Ensamblado Seminario de Modelos y Métodos cuantitativos (Bioinformática)

Genoma y Ensamblado Seminario de Modelos y Métodos cuantitativos (Bioinformática) Genoma y Ensamblado Seminario de Modelos y Métodos cuantitativos (Bioinformática) Rodrigo Fernández Cristián Maureira Gabriel Zamora Universidad Técnica Federico Santa María 18 de noviembre de 2010 Genoma

Más detalles

LA INGENIERÍA GENÉTICA

LA INGENIERÍA GENÉTICA LA INGENIERÍA GENÉTICA Todo organismo, aún el más simple, contiene una enorme cantidad de información. Esa información se repite en cada una de sus células organizada en unidades llamadas genes, los cuales

Más detalles

Modulo 2 NIVEL CELULAR DE ORGANIZACIÓN DEL CUERPO HUMANO

Modulo 2 NIVEL CELULAR DE ORGANIZACIÓN DEL CUERPO HUMANO Modulo 2 NIVEL CELULAR DE ORGANIZACIÓN DEL CUERPO HUMANO NIVEL CELULAR DE ORGANIZACIÓN DEL CUERPO HUMANO Los seres vivos están integrados por moléculas (inanimadas) los organismos vivos poseen atributos

Más detalles

Centro de Capacitación en Informática

Centro de Capacitación en Informática Fórmulas y Funciones Las fórmulas constituyen el núcleo de cualquier hoja de cálculo, y por tanto de Excel. Mediante fórmulas, se llevan a cabo todos los cálculos que se necesitan en una hoja de cálculo.

Más detalles

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico.

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. AQUAGESTION ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. Noviembre 2011 ACTUALIDAD Este año Sernapesca confirma

Más detalles

Veamos rápidamente el ciclo celular

Veamos rápidamente el ciclo celular Replicación del adn Veamos rápidamente el ciclo celular Fase G1: Fase de crecimiento celular. Fase G2: la célula ya duplicó su material genético, y se prepara para la mitosis. Fase M: fase de división

Más detalles

Biología Profundización

Biología Profundización UNIDAD 1: GENÉTICA SUB-UNIDAD 2: TRANSCRIPCIÓN Y TRADUCCIÓN Biología Profundización En esta sesión tú podrás: - Conocer el proceso transcripcional y post-transcripcional. - Reconocer los sucesivos procesos

Más detalles

Mapeo genómico: Determinación de la localización de elementos en un genoma, con respecto de marcadores identificados

Mapeo genómico: Determinación de la localización de elementos en un genoma, con respecto de marcadores identificados Mapeo genómico: Determinación de la localización de elementos en un genoma, con respecto de marcadores identificados Tipos de mapas: MAPAS FISICOS (de restricción, citogenéticos, de híbridos de radiación...)

Más detalles

Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario

Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario Cuándo debemos sospechar que un cáncer puede ser hereditario? El cáncer es una enfermedad muy frecuente, es fácil que en una

Más detalles

La ingeniería genética

La ingeniería genética Objetivos Antes de empezar En esta quincena aprenderás a: Biotecnología moderna. tradicional Ingeniería genética y manipulación del genoma. Alimentos transgénicos. La clonación. El genoma humano Problemas

Más detalles

Ingeniería Genética II

Ingeniería Genética II Ingeniería Genética II Expresión de proteínas recombinantes Vectores de expresión Características adicionales: - Promotor regulable - Terminador de la transcripción - Sitio de reconocimiento por el ribosoma

Más detalles

PROGRAMA DE DETECCIÓN PRENATAL DE ANOMALÍAS CROMOSÓMICAS

PROGRAMA DE DETECCIÓN PRENATAL DE ANOMALÍAS CROMOSÓMICAS GUÍA PARA LAS EMBARAZADAS PROGRAMA DE DETECCIÓN PRENATAL DE ANOMALÍAS CROMOSÓMICAS La decisión de realizar las pruebas incluidas en este Programa es una decisión voluntaria y personal, que debe tomar tras

Más detalles

Población con discapacidad en Jalisco en 2010

Población con discapacidad en Jalisco en 2010 Nota Técnica: 11/11 Guadalajara, Jalisco, 03 de junio de 2011 Población con discapacidad en Jalisco en 2010 Resumen El Censo de Población y Vivienda 2010 captó las personas que de manera permanente tienen

Más detalles

Ensayos Clínicos en Oncología

Ensayos Clínicos en Oncología Ensayos Clínicos en Oncología Qué son y para qué sirven? www.seom.org ESP 05/04 ON4 Con la colaboración de: Una parte muy importante de la Investigación en Oncología Médica se realiza a través de Ensayos

Más detalles

Naturaleza y educación

Naturaleza y educación Novedades en la investigación de la EH. En lenguaje sencillo. Escrito por científicos. Para toda la comunidad EH. El ejercicio aumenta el reciclaje celular El ejercicio aumenta el reciclaje celular en

Más detalles

Metodología de la Investigación. Dr. Cristian Rusu cristian.rusu@ucv.cl

Metodología de la Investigación. Dr. Cristian Rusu cristian.rusu@ucv.cl Metodología de la Investigación Dr. Cristian Rusu cristian.rusu@ucv.cl 6. Diseños de investigación 6.1. Diseños experimentales 6.1.1. Diseños preexperimentales 6.1.2. Diseños experimentales verdaderos

Más detalles

LO QUE DEBE SABER ACERCA DEL TRATAMIENTO CON CELULAS MADRE. 1. Hay diferentes tipos de células madre, cada una, con su propósito establecido.

LO QUE DEBE SABER ACERCA DEL TRATAMIENTO CON CELULAS MADRE. 1. Hay diferentes tipos de células madre, cada una, con su propósito establecido. LO QUE DEBE SABER ACERCA DEL TRATAMIENTO CON CELULAS MADRE 1. Hay diferentes tipos de células madre, cada una, con su propósito establecido. Hay muchos tipos de células madre que provienen de diferentes

Más detalles

UNIDAD 15: EL SISTEMA IMNUNITARIO

UNIDAD 15: EL SISTEMA IMNUNITARIO UNIDAD 15: EL SISTEMA IMNUNITARIO Lee atentamente. 1. EL ORGANISMO RECONOCE A LOS ELEMENTOS EXTRAÑOS Las células de una persona introducidas en otra son reconocidas por el organismo como algo extraño no

Más detalles

Ética y Valores II. Tema 3: La tecnología en la medicina e ingeniería genética. Unidad I

Ética y Valores II. Tema 3: La tecnología en la medicina e ingeniería genética. Unidad I Tema 3: La tecnología en la medicina e ingeniería genética Ética y Valores II Unidad I Importancia y relación de la ética, la ciencia y la tecnología en la práctica médica y la bioética LA TECNOLOGÍA EN

Más detalles

Calculadora de Tamaño muestral GRANMO

Calculadora de Tamaño muestral GRANMO Calculadora de Tamaño muestral GRANMO Versión 7.12 Abril 2012 http://www.imim.es/ofertadeserveis/software-public/granmo/ Entre las distintas ofertas que existen para el cálculo del tamaño muestral, ofrecemos

Más detalles

Autor: Andrés M. Gatica Arias, Dr.sc.agr

Autor: Andrés M. Gatica Arias, Dr.sc.agr Autor: Andrés M. Gatica Arias, Dr.sc.agr Introducción Es de rigurosa justicia emancipar la enseñanza de todo extraño poder, y convertirla en una función social, sin otra ley que la libre indagación y

Más detalles

CIENCIA Y VIDA COTIDIANA

CIENCIA Y VIDA COTIDIANA CIENCIA Y VIDA COTIDIANA Genética para andar por casa... y 3 Murcia, 17 de diciembre de 2012. Genética. Gen. ADN. Información genética. Cromosomas. Genética forense. Ingeniería genética. Clonación/Transgénicos.

Más detalles

Protéjase contra el cáncer cervical. Reciba la. Prueba del VPH. para su tranquilidad. Para más información, visite www.thehpvtest.

Protéjase contra el cáncer cervical. Reciba la. Prueba del VPH. para su tranquilidad. Para más información, visite www.thehpvtest. Protéjase contra el cáncer cervical Reciba la Prueba del VPH para su tranquilidad Para más información, visite www.thehpvtest.com Protéjase contra el cáncer cervical El cáncer es una enfermedad terrible.

Más detalles

La diabetes infantil. Ciencias para el mundo contemporáneo. Trabajo sobre un tema de la salud.

La diabetes infantil. Ciencias para el mundo contemporáneo. Trabajo sobre un tema de la salud. La diabetes infantil. Ciencias para el mundo contemporáneo. Trabajo sobre un tema de la salud. Qué es la diabetes? Es una enfermedad en la que se produce una mala utilización de los azúcares (hidratos

Más detalles

APRENDIENDO CON NEFRON SUPERHEROE

APRENDIENDO CON NEFRON SUPERHEROE APRENDIENDO CON NEFRON SUPERHEROE DIABETES - UN FACTOR DE RIESGO PARA LA ENFERMEDAD RENAL La Diabetes mellitus, generalmente conocida como diabetes, es una enfermedad en la que su cuerpo no produce suficiente

Más detalles

cromátidas centrómero cromosoma

cromátidas centrómero cromosoma núcleo en interfase fibra de cromatina cromátidas centrómero cromosoma 2n = 46 cromátidas cromosomas homólogos Los genes están formados por genes alelos segmentos de ADN y se encuentran situados en los

Más detalles

Guía para comparar presupuestos de Traducción

Guía para comparar presupuestos de Traducción Guía para comparar presupuestos de Traducción 1 Introducción Estimado cliente: Probablemente, cuando tiene que realizar una traducción solicita presupuestos a varios proveedores. Y posiblemente, al recibirlos

Más detalles

MITOS SOBRE LA DIABETES

MITOS SOBRE LA DIABETES MITOS SOBRE LA DIABETES Los mitos, que a menudo pasan de una generación a otra como historia oral, representan un vínculo entre las generaciones pasada y presente. Como tales, a menudo contienen elementos

Más detalles

CASO PRÁCTICO DISTRIBUCIÓN DE COSTES

CASO PRÁCTICO DISTRIBUCIÓN DE COSTES CASO PRÁCTICO DISTRIBUCIÓN DE COSTES Nuestra empresa tiene centros de distribución en tres ciudades europeas: Zaragoza, Milán y Burdeos. Hemos solicitado a los responsables de cada uno de los centros que

Más detalles

CIENCIA Y VIDA COTIDIANA

CIENCIA Y VIDA COTIDIANA CIENCIA Y VIDA COTIDIANA La clonación, el ADN y cosas de la genética Santiago Torres Martínez Departamento Genética y Microbiología Universidad de Murcia Murcia 25 febrero y 3 marzo, 2008 . Genética. Gen.

Más detalles

MINISTERIO DE SANIDAD SERVICIOS SOCIALES E IGUALDAD. Qué es la sangre del cordón umbilical y para qué sirve?

MINISTERIO DE SANIDAD SERVICIOS SOCIALES E IGUALDAD. Qué es la sangre del cordón umbilical y para qué sirve? RESPUESTAS A LAS PREGUNTAS MÁS COMUNES SOBRE SANGRE DE CORDÓN UMBILICAL, PLANTEADAS TRAS LA APROBACIÓN DEL REAL DECRETO 1301/2006 SOBRE CALIDAD Y SEGURIDAD DE CÉLULAS Y TEJIDOS. Qué es la sangre del cordón

Más detalles

Microsoft Excel. El Documento Excel. Interfase de Programa. Celdas

Microsoft Excel. El Documento Excel. Interfase de Programa. Celdas Microsoft Excel Microsoft Excel (en adelante Excel) es una aplicación tipo Hoja de Cálculo destinada al diseño y generación de documentos a partir de datos numéricos. Podría entenderse como una calculadora

Más detalles

La translocación robertsoniana 1/29 en la raza Morucha.

La translocación robertsoniana 1/29 en la raza Morucha. La translocación robertsoniana 1/29 en la raza Morucha. Introducción. En la fecundación de los animales, concretamente en la meiosis, con muy poca frecuencia se producen errores que dan lugar a alteraciones

Más detalles

DETERMINACIÓN DEL FACTOR Rh por PCR

DETERMINACIÓN DEL FACTOR Rh por PCR Ref.PCRRh DETERMINACIÓN DEL FACTOR Rh por PCR 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

UNIDAD 7 LA DIGNIDAD DE LA VIDA

UNIDAD 7 LA DIGNIDAD DE LA VIDA UNIDAD 7 LA DIGNIDAD DE LA VIDA A) EL EMBRIÓN: fecundación Espermatozoides llegando al ovocito Concepción La carrera por la vida... "Desde el momento mismo de la fecundación, desde el instante en que a

Más detalles

Técnicas descritas en el curso 7.28

Técnicas descritas en el curso 7.28 Técnicas descritas en el curso 7.28 Técnica: Clase 1 Experimento de incorporación de dntps Ensayo de extensión del cebador Ensayo de unión en filtro Electroforesis en gel Análisis de ADN Helicasa Polaridad

Más detalles

LA ESTRATEGIA NACIONAL DE BOSQUES Y CAMBIO CLIMÁTICO

LA ESTRATEGIA NACIONAL DE BOSQUES Y CAMBIO CLIMÁTICO LA ESTRATEGIA NACIONAL DE BOSQUES Y CAMBIO CLIMÁTICO LA ESTRATEGIA NACIONAL DE BOSQUES Y CAMBIO CLIMÁTICO En palabras simples, el Cambio Climático es la modificación del clima que actualmente ocurre en

Más detalles

.- En qué tipo de enfermos está indicado el trasplante de células de sangre de cordón umbilical?

.- En qué tipo de enfermos está indicado el trasplante de células de sangre de cordón umbilical? RESPUESTAS A LAS PREGUNTAS MÁS COMUNES SOBRE SANGRE DE CORDÓN UMBILICAL PLANTEADAS TRAS LA APROBACIÓN DEL REAL DECRETO 1301/2006 SOBRE CALIDAD Y SEGURIDAD DE CÉLULAS Y TEJIDOS Qué es la sangre del cordón

Más detalles

Ciclo de vida y Metodologías para el desarrollo de SW Definición de la metodología

Ciclo de vida y Metodologías para el desarrollo de SW Definición de la metodología Ciclo de vida y Metodologías para el desarrollo de SW Definición de la metodología La metodología para el desarrollo de software es un modo sistemático de realizar, gestionar y administrar un proyecto

Más detalles

LA REVOLUCIÓN GENÉTICA: DESVELANDO LOS SECRETOS DE LA VIDA

LA REVOLUCIÓN GENÉTICA: DESVELANDO LOS SECRETOS DE LA VIDA LA REVOLUCIÓN GENÉTICA: DESVELANDO LOS SECRETOS DE LA VIDA YA DEBERÍAS SABER Todos los seres vivos tenemos células. Nuestras células son eucariotas (núcleo verdadero) Todas tienen: membrana, citoplasma

Más detalles

www.martinendocrino.com 1/5

www.martinendocrino.com 1/5 Los problema por los que algunas parejas no pueden conseguir un embarazo son de origen muy diverso y por eso también son diferentes las soluciones que se buscan: Estimulación ovárica: Se trata de modificar

Más detalles

(Estudios in vivo y estudios in vitro)

(Estudios in vivo y estudios in vitro) (Estudios in vivo y estudios in vitro) IN VIVO: es la experimentación con un todo, que viven organismos en comparación. Ensayos con animales y ensayos clínicos son dos formas de investigación in vivo.

Más detalles

III. Material genético. b. Composición y estructura del RNA.

III. Material genético. b. Composición y estructura del RNA. III. Material genético b. Composición y estructura del RNA. RNA (ácido ribonucléico) Polímero de nucleótidos La pentosa de los nucleótidos es la Ribosa: en la posición 2' del anillo del azúcar hay un grupo

Más detalles