Rol del Laboratorio en el Diagnóstico. CMV en pacientes transplantados. Bioquímica Mariela Merkt

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamaño: px
Comenzar la demostración a partir de la página:

Download "Rol del Laboratorio en el Diagnóstico. CMV en pacientes transplantados. Bioquímica Mariela Merkt"

Transcripción

1 Rol del Laboratorio en el Diagnóstico y Prevención n de la Infección n por CMV en pacientes transplantados Bioquímica Mariela Merkt

2 CMV: Características Familia β Herpesviridae DNA doble cadena Virus envuelto Es el virus herpes más grande (240 kb)

3 Infección por CMV Es común, entre el % de la población mundial adulta es seropositiva Muchos individuos son infectados en la infancia, y en la mayoría de la población no causa enfermedad con significado clínico CMR, 13,83-121,200

4 CMV INFECCION PRIMARIA ESTADO LATENTE oreceptores de transplantes o pacientes HIV positivos oindividuos con sistema inmune inmaduro omujer embarazada: infección congenita REACTIVACION Enfermedad clínica Severa JCM,40, ,2002

5 Small RNA and Large Virus NEJM;357,

6 Infecciones post transplante

7 El impacto del CMV en los transplantados es considerado como la más importante causa de morbi-mortalidad JCM,40, ,2002

8 Enfermedad por CMV Primoinfección: transferencia a través del órgano transplantado Reactivación: Infección latente Super infección: cepa distinta a la cepa latente

9 Efectos del CMV DIRECTOS INDIRECTOS 1.Directos: Sindrome mononucleosis like Leucopenia o trombocitopenia Infección del injerto Neumonitis Infección de TGI Encefalitis NEJM;338,24;1998

10 Efectos del CMV 2.Indirectos: Acción inmunomoduladora: Aumenta el riesgo de infecciones oportunistas (bacterianas, fúngicas) Aumenta el riesgo de injuria del órgano transplantado (agudo y crónico) Relacionado a ateroesclerosis del corazón transplantado NEJM;338,24;1998

11 Factores de riesgo para desarrollar enfermedad por CMV Estatus del donante y del receptor del transplante Del grado de inmunosupresión (reactivación) La presencia de CMV en sangre (viremia) asociado con alto riesgo de recurrencia o enfermedad futura La carga viral de CMV IHMF;2002

12 Presentación clínica depende del tipo de transplante TOS (excepto corazón y pulmón) ocurren severas infecciones del tracto GI con leucopenia y trombocitopenia; la neumonía es rara. TMO y receptores de corazón y pulmón la neumonía es la secuela más frecuente y la más fatal. La retinitis es rara en los transplantados IHMF;2002

13 Manifestaciones Clínicas

14 Tratamiento Manejo antiviral de CMV Prevención Tratamiento Profilaxis universal Dirigida a todos los transplantados Profilaxis selectiva Dirigida a pacientes de alto riesgo Temprano (preemptive) Según resultado del test empleado Tratamiento tardío Se aplica una vez iniciado los síntomas

15 PROFILAXIS V: No se requieren test de laboratorio para iniciar la terapia D. Riesgo de exposición a drogas en individuos de bajo riesgo Desarrollo de resistencia PRE- EMPTIVE THERAPY V: Exposición de pocos individuos a las drogas, al igual que el tiempo de exposición D. Requiere test de elevada sensibilidad IHMF;2002

16 Por qué medir la viremia? Diagnóstico de enfermedad Tratamiento Monitoreo de la replicación viral Pre-emptive therapy Monitoreo de la terapia antiviral Duración del tratamiento Evaluar resistencia IHMF;2002

17 Frecuencia de monitoreo para guiar pre-emptive therapy Semanalmente monitorear viremia usando durante los primero 3 meses luego del transplante o durante más tiempo dependiendo de la intensidad de la inmunosupresión.

18 Riesgo de infección según serología D-/R- D-/R+ D+/R+ D+R- Mayor riesgo IHMF;2002

19 Ensayos para la detección de CMV 1.NO MOLECULARES: Cultivo convencional, shell vial, antigenemia pp65 2. MOLECULARES: A.Cualitativos: PCR casera, PCR Amplicor, Nuclisens pp67 (NASBA) B. Cuantitativos: Cobas Amplicor Monitor, Híbrido de captura, Quantiplex bdna, PCR en tiempo real IHMF;2002

20 NO MOLECULARES

21 IHMF;2002

22 Detección del Ag temprano pp65 por Inmunofluorescencia pp65 Resultados: Se informa nº de células positivas/ leucocitos

23 Comparando métodos Pp65 V: Es más sensible que los métodos de cultivo viral D: no es útil en periodos de neutropenia (se necesita un gran número de leucocitos) Requiere del rápido procesamiento de las muestras, y su resultado puede ser subjetivo, dependiendo de la experiencia del observador. Cultivo viral insume mucho tiempo, menor reproducibilidad, menor sensibilidad IHMF;2002

24 Recomendaciones para el inicio de pre-emptive therapy según pp65 TOS: TMO: Más de 10 células positivas/ células observadas Mayor o igual a 1-2 células positivas/ células observadas El cultivo viral y el shell vial no son adecuados para guiar pre-emptive therapy IHMF;2002

25 MOLECULARES

26 Ensayos moleculares comerciales para la detección de la infección por CMV IHMF;2002

27 2. METODOS MOLECULARES Nuclisens pp67 test Tipo de muestra: plasma El target de ácido nucleico es RNA y no DNA (indica infección activa) Límite de detección: aprox 700 moléculas de RNA Desventaja: No es cuantitativo IHMF;2002

28 2. METODOS MOLECULARES Híbrido de captura CMV DNA assay Sensibilidad de %, comparado con el shell vial 74-97% y Amplicor CMV Monitor assay % New Microbiol 1996;19:

29 2. METODOS MOLECULARES Branched-DNA (bdna) Ventaja Alta reproducibilidad Desventaja Necesita de un alto número de PMN IHMF;2002

30 2. METODOS MOLECULARES Cobas Amplicor CMV Monitor (ROCHE) Cuantitativa Puede ser utilizada con plasma o Leucocitos El test utiliza el Cobas amplicor Buena especificidad Estrecho rango dinámico y alta demanda de tiempo para su realización. Rango: copias/ml plasma o por Leucocitos IHMF;2002

31 Cobas Amplicor CMV Monitor (ROCHE) Cuantitativo Usando plasma: copias/ml en TOS TMO cercano al límite de detección para guiar pre-emptive therapy IHMF;2002

32 2. MOLECULARES Detección cualitativa de ADN por PCR Tipo de muestra: Leucocitos Ventajas Permite detectar a muy bajo nivel de viremia (alta sensibilidad) Permite monitorear la eficacia del tratamiento antiviral Sensibilidad cercana al 100 % Desventajas No permite diferenciar infección latente de enfermedad activa. IHMF;2002

33 2. METODOS MOLECULARES PCR en Tiempo Real Combina la química de la PCR con sondas fluorescentes para detectar el producto amplificado en la misma reacción, permitiendo además medir durante la amplificación la cantidad de ADN sintetizada a cada momento, mostrando y registrando la cinética de la reacción de la amplificación. Enferm Infecc Microbio Clin 2004;22 (5):

34 Hay diferentes fluoróforos para la detección SYBER Green: Fluoróforo no específico Detecta todos DNA de doble cadena producidos durante la reacción de amplificación (producto específico, inespecífico o dímeros de primer)

35 Para discriminar si las muestras son positivas o negativas se realiza una curva de desnaturalización ( melting curve ) al final de la reacción La reacción se calienta desde 50 hasta 95 ºC monitoreando continuamente la fluorescencia Cada amplicon tiene un Tm característico, lo cual depende del: tamaño, contenido de CG y la secuencia. Enferm Infecc Microbio Clin 2004;22 (5):

36 PCR Cualitativa Lo realizamos en: Sangre entera Biopsias Control interno LightCycler: Roche Se informa: Detectable o no detectable. Sitio de amplificación Gen que codifica para la glicoproteina B del CMV

37 PCR Cuantitativa LightCycler Roche Tipo de muestra: Plasma Se utlizan standares de cuantificación caseros Control interno Rango lineal: copias Se informa: copias/ml de plasma

38 Sitio de amplificación Gen que codifica para la glicoproteina B del CMV 2000 copias/ml

39 2. METODOS MOLECULARES PCR en Tiempo Real Ventajas Altamente sensible y específica Mejor relación costo-beneficio para determinar C.V Permite predecir enfermedad monitorear la terapia antiviral Rápida 1 hora Menor riesgo de contaminación cruzada

40 Aplicación de la Cinética de la carga viral en la identificación del paciente de riesgo Carga viral en la primera muestra positiva (carga viral inicial) Velocidad de aumento de la carga viral FACTOR DE RIESGO

41 Cinética de cargas virales (CMV) copias/ml Días copias/ml Días copias/m l Días

42 Tipos de muestra Cuantificación en distintos compartimentos celulares: sangre entera, plasma, Leucocitos, MN, PMN Carga viral en sangre entera 0.67 log más elevada que en plasma Carga viral en PMN y MN similar en pacientes con enfermedad activa Uso de Leucocitos: carga viral baja, progresión rápida de la enfermedad (TMO). Uso de plasma: progresión lenta de la enfermedad (HIV), neutropenia. CMR, 1998,11:

43 Qué muestra es la mas conveniente? Evaluar cada caso en particular Tipo de paciente Metodología disponible Todas las muestras 1. Proveen información pronóstico 2. Pueden usarse para el inicio preemptive therapy 3. Pueden medir respuesta a la terapia

44 Tratamiento Ganciclovir IV: Tratamiento de 2-4 semanas en TOS Idem en TMO; con pneumonitis se agrega gammaglobulina endovenosa. No hay estudios randomizados; está basado en estudios comparativos en un pequeño grupo de pacientes. Valaciclovir Foscarnet (resistencia al ganciclovir) Cidofovir: en individuos con HIV/SIDA NEJM;335, , 1996

45 CONCLUSIONES Se necesitarían estudios comparativos para evaluar y poder estandarizar los ensayos moleculares para los distintos transplantes Se necesitarían estudios que validen la carga de CMV para iniciar las estrategias del tratamiento temprano en función a los resultados de la carga viral

46 CONCLUSIONES La baja sensibilidad del cultivo convencional y del shell vial limitan su uso en el manejo de la infección por CMV en este tipo de pacientes Es necesaria la utilización de métodos cuantitativos para establecer el riesgo de enfermedad y para monitoreo del tratamiento o detectar resistencia.

47 A pesar de que hay muchos puntos en el manejo del paciente transplantado que aún no han sido dilucidados, y que falta mucho por aprender, las herramientas diagnósticas con las cuales contamos en el Laboratorio son de mucha utilidad para poder ayudar a este tipo de pacientes a prolongar su vida

48 Muchas Gracias

PCR EN TIEMPO REAL, UNA HERRAMIENTA EN EL PACIENTE TRASPLANTADO

PCR EN TIEMPO REAL, UNA HERRAMIENTA EN EL PACIENTE TRASPLANTADO PCR EN TIEMPO REAL, UNA HERRAMIENTA EN EL PACIENTE TRASPLANTADO Dra. Carolina Rodríguez Laboratorio Dr. Stamboulian División Biología Molecular Introducción En la actualidad, el paciente trasplantado,

Más detalles

APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR. Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina

APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR. Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina BiologÍa Molecular: es una disciplina que se enfoca principalmente en el estudio

Más detalles

NOCIONES DE EPIDEMIOLOGÍA Y DIAGNOSTICO DE HIV. Dra G Carballal Laboratorio de Virología Clínica CEMIC, 2009

NOCIONES DE EPIDEMIOLOGÍA Y DIAGNOSTICO DE HIV. Dra G Carballal Laboratorio de Virología Clínica CEMIC, 2009 NOCIONES DE EPIDEMIOLOGÍA Y DIAGNOSTICO DE HIV Dra G Carballal Laboratorio de Virología Clínica CEMIC, 2009 La Pandemia de SIDA Personas que viven con el HIV/SIDA Total 40 millones Adultos 38 Niños 2 Nuevas

Más detalles

Experiencias en Q-PCR para la aplicación y diagnóstico en Medicina Humana

Experiencias en Q-PCR para la aplicación y diagnóstico en Medicina Humana Experiencias en Q-PCR para la aplicación y diagnóstico en Medicina Humana MSc. Gonzalo Manrique Laboratorio de Biología Molecular Asociación Española Junio de 2009 INDICE INTRODUCCION (conceptos básicos,

Más detalles

PORQUE BUSCAMOS LA HEPATITIS C?

PORQUE BUSCAMOS LA HEPATITIS C? PORQUE BUSCAMOS LA HEPATITIS C? ESTE INDIVIDUO TIENE HCV? ESTA PERSONA (POTENCIAL DONANTE DE SANGRE) PUEDE ESTAR EXPUESTO A HCV? QUE EFECTOS TIENE LA INFECCION POR HCV EN EL HIGADO? CUAL ES LA PROBABILIDAD

Más detalles

DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino

DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino DIAGNOSTICO VIROLOGICO MOLECULAR Dr. Gerardo Andino DIAGNÓSTICO MOLECULAR La tecnología empleada para la detección de genomas virales mediante la amplificación de secuencias específicas (PCR y reacciones

Más detalles

DIAGNÓSTICO MOLECULAR CMV Y EBV

DIAGNÓSTICO MOLECULAR CMV Y EBV DIAGNÓSTICO MOLECULAR CMV Y EBV DIAGNÓSTICO MOLECULAR REACCIÓN EN CADENA DE LA POLIMERASA (PCR) ALTA SENSIBILIDAD Y ESPECIFICIDAD DIAGNÓSTICO MOLECULAR REACCIÓN EN CADENA DE LA POLIMERASA (PCR) PCR PUNTO

Más detalles

Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio

Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio El VIRUS PRUEBAS PRESUNTIVAS ELISA: es la prueba convencional para la detección

Más detalles

Juan Pablo Caeiro Infectologia

Juan Pablo Caeiro Infectologia Juan Pablo Caeiro Infectologia CLASIFICACION DE HERPES VIRUS Alfaherpesvirus Herpes virus simple 1 (HSV-1 o HHV-1) Herpes virus simple 2 (HSV-2 o HHV-2) Varicela-Zoster virus (VZV o HHV-3) Betaherpesvirus

Más detalles

5-MARCO DE REFERENCIA

5-MARCO DE REFERENCIA 5-MARCO DE REFERENCIA Para hablar de pruebas diagnosticas es necesario el conocimiento de ciertos términos que a continuación se describen. Sensibilidad: Es la probabilidad de obtener una prueba positiva

Más detalles

Algoritmos diagnósticos para VIH

Algoritmos diagnósticos para VIH Algoritmos diagnósticos para VIH ALGORITMOS DIAGNÓSTICOS PARA VIH Los avances tecnológicos de los distintos ensayos para el tamizaje y diagnóstico de la infección por VIH, conjuntamente con la necesidad

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

Diagnóstico microbiológico de la infección por HIV

Diagnóstico microbiológico de la infección por HIV Diagnóstico microbiológico de la infección por HIV Juan Carlos Rodríguez Díaz S. Microbiología Hospital General Universitario de Alicante E-mail: rodriguez_juadia@gva.es http://microbiología-alicante.umh.es

Más detalles

Un centro de biotecnología al servicio de la salud

Un centro de biotecnología al servicio de la salud Tecnologías para la Vida S. de R.L. de C.V. En búsqueda del bienestar humano Un centro de biotecnología al servicio de la salud Mexicali, Baja California, México Septiembre de 2012 Tecnologías para la

Más detalles

Biología Molecular en el Diagnóstico de Enfermedades Infecciosas. Bq. Ivonne Vergara P. Laboratorio Biología Molecular Clínica Las Condes

Biología Molecular en el Diagnóstico de Enfermedades Infecciosas. Bq. Ivonne Vergara P. Laboratorio Biología Molecular Clínica Las Condes Biología Molecular en el Diagnóstico de Enfermedades Infecciosas Dirección Médica Bq. Ivonne Vergara P. Laboratorio Biología Molecular Clínica Las Condes Existen diversas técnicas de Biología Molecular

Más detalles

Diagnóstico Serológico de Sífilis Técnicas treponémicas

Diagnóstico Serológico de Sífilis Técnicas treponémicas Diagnóstico Serológico de Sífilis Técnicas treponémicas T.M. Rodrigo Colina Morales Laboratorio de Infecciones de Transmisión Sexual Sección Bacteriología Mayo 2014 FTA-ABS (Fluorescent Treponemal Antibody

Más detalles

TEMA 40: HERPESVIRUS: CITOMEGALOVIRUS Y VIRUS EPSTEIN-BARR

TEMA 40: HERPESVIRUS: CITOMEGALOVIRUS Y VIRUS EPSTEIN-BARR TEMA 40: HERPESVIRUS: CITOMEGALOVIRUS Y VIRUS EPSTEIN-BARR CASO CLINICO Estudiante universitario que acude a urgencias debido a un cuadro de fiebre, cefalea, faringitis y dificultades para deglutir, con

Más detalles

DIAGNÓSTICO DEL CITOMEGALOVIRUS EN LOS PACIENTES TRASPLANTADOS Y ENSAYOS DE SENSIBILIDAD ANTIVIRAL

DIAGNÓSTICO DEL CITOMEGALOVIRUS EN LOS PACIENTES TRASPLANTADOS Y ENSAYOS DE SENSIBILIDAD ANTIVIRAL DIAGNÓSTICO DEL CITOMEGALOVIRUS EN LOS PACIENTES TRASPLANTADOS Y ENSAYOS DE SENSIBILIDAD ANTIVIRAL Santiago Melón García y María de Oña Navarro Sección de Virología, Servicio de Microbiología I, Hospital

Más detalles

DIAGNÓSTICO DE LABORATORIO DE DENGUE EN PANAMÁ

DIAGNÓSTICO DE LABORATORIO DE DENGUE EN PANAMÁ DIAGNÓSTICO DE LABORATORIO DE DENGUE EN PANAMÁ TM Brechla Moreno A. Instituto Conmemorativo Gorgas de Estudios de la Salud, Panamá Departamento de Virología y Biotecnología 2013 TÉCNICAS PARA LA DETECCIÓN

Más detalles

INTERPRETACION DE LOS RESULTADOS DE LA HEPATITIS VIRALES EN ADULTOS

INTERPRETACION DE LOS RESULTADOS DE LA HEPATITIS VIRALES EN ADULTOS INTERPRETACION DE LOS RESULTADOS DE LA HEPATITIS VIRALES EN ADULTOS S. Microbiología Hospital General Universitario de Elche Abril 2009 HEPATITIS A INTRODUCCION La principal característica diferencial

Más detalles

Pruebas rápidas r. Estrategias preventivas. Propuesta de nuevas estrategias preventivas

Pruebas rápidas r. Estrategias preventivas. Propuesta de nuevas estrategias preventivas XV ENCUENTRO ESTATAL PARA ONG s Madrid, 1-3 de Octubre 2009 Diagnóstico tardío o. Pruebas rápidas r Dra Carmen Rodríguez Centro Sanitario Sandoval Madrid Estrategias preventivas La prevención de nuevas

Más detalles

Hepatitis viral tipo C (HCV) RT-PCR

Hepatitis viral tipo C (HCV) RT-PCR Hepatitis viral tipo C (HCV) RT-PCR Celía, Alejandro Fabián Taborda, Florencia Ines Características Generales del HCV Agente etiológico de las HNANB transmitidas por transfusiones Flia: Flaviviridae Género:

Más detalles

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles

Nuevos ensayos moleculares de la tecnología SUMA para el diagnóstico de las hepatitis B y C

Nuevos ensayos moleculares de la tecnología SUMA para el diagnóstico de las hepatitis B y C Nuevos ensayos moleculares de la tecnología SUMA para el diagnóstico de las hepatitis B y C MSc. Anny Armas Cayarga Laboratorio de Biología Molecular Centro de Inmunoensayo Octubre 16, 2015 Qué es el diagnóstico

Más detalles

Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional

Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional BIOQ. LILIANA DI TULLIO BUDASSI FAC. CS.BIOQUÍMICAS Y FARMACÉUTICAS UNIVERSIDAD NACIONAL DE ROSARIO lilianadt2003@yahoo.com.ar

Más detalles

PRUEBA DE VIH. Universidad de Panamá USAID Proyecto Capacity Centroamérica

PRUEBA DE VIH. Universidad de Panamá USAID Proyecto Capacity Centroamérica PRUEBA DE VIH Universidad de Panamá USAID Proyecto Capacity Centroamérica Es la prueba de detección que produce los resultados rápidamente, en aproximadamente 20 minutos y utiliza sangre de una vena o

Más detalles

Diagnóstico e Historia Natural de la Hepatitis B

Diagnóstico e Historia Natural de la Hepatitis B Diagnóstico e Historia Natural de la Hepatitis B Infección por el Virus de la Hepatitis B Un Gran Problema de Salud Pública Distribución universal 300 millones de portadores crónicos 1/3 de la población

Más detalles

ARTÍCULO ORIGINAL REPRODUCIBILITY OF A QUANTIFICATION ASSAY, NUCLISENS HIV - 1 QT, IN HIV POSITIVE PLASMA SAMPLES

ARTÍCULO ORIGINAL REPRODUCIBILITY OF A QUANTIFICATION ASSAY, NUCLISENS HIV - 1 QT, IN HIV POSITIVE PLASMA SAMPLES Rev Chil Infect (2002); 19 (1): 25-31 ARTÍCULO ORIGINAL Estudio de reproducibilidad del examen de cuantificación de VIH-1 por la técnica Nuclisens HIV-1 QT en muestras de plasma de pacientes infectados

Más detalles

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR)

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) Centro de de Microscopía Electrónica Facultad de de Ciencias Médicas Universidad Nacional de de Córdoba

Más detalles

Centro Nacional de Alerta y Respuesta Rápida. Dirección de Epidemiología CORONAVIRUS

Centro Nacional de Alerta y Respuesta Rápida. Dirección de Epidemiología CORONAVIRUS CORONAVIRUS Introducción Los coronavirus constituyen una gran familia de virus que en el ser humano pueden causar diversas enfermedades que van desde el resfriado común hasta el SRAS (síndrome respiratorio

Más detalles

HEPATITIS C, EPIDEMIA SILENTE

HEPATITIS C, EPIDEMIA SILENTE PILDORAS EPIDEMIOLOGICAS Hepatitis C en el Mundo Se estima una prevalencia de 200 millones de portadores a nivel mundial con una mortalidad anual de 350 mil personas como consecuencia del efecto crónico

Más detalles

Enfermedad por CMV: cuándo tratamos?

Enfermedad por CMV: cuándo tratamos? Enfermedad por CMV: como diagnosticamos y cuándo tratamos? Dr. José Marcó del Pont Infectología Pediátrica Hospital Italiano Buenos Aires 7º Congreso Argentino de Infectología Pediátrica. Córdoba 2014

Más detalles

CONVENIO 036 de 2012

CONVENIO 036 de 2012 CONVENIO 036 de 2012 Guía de Práctica Clínica basada en la evidencia científica para la atención integral del VIH/Sida en niñas y niños. Guía de práctica clínica basada en la evidencia científica para

Más detalles

INFECCION POR HHV6 EN TRANSPLANTADOS RENALES: UNA CONTROVERSIA EN EL DIAGNOSTICO. Julieta Giménez Carolina Carrizo

INFECCION POR HHV6 EN TRANSPLANTADOS RENALES: UNA CONTROVERSIA EN EL DIAGNOSTICO. Julieta Giménez Carolina Carrizo INFECCION POR HHV6 EN TRANSPLANTADOS RENALES: UNA CONTROVERSIA EN EL DIAGNOSTICO Julieta Giménez Carolina Carrizo Infection with Herpesvirus 6 after Kidney-Pancreas Transplant Hombre, 29 añosa Enfermedad

Más detalles

A principios de los años ochentas el desarrollo de nuevas tecnologías para la

A principios de los años ochentas el desarrollo de nuevas tecnologías para la Nuevos marcadores para la detección temprana y predicción de sobrevida en blancos terapéuticos. A principios de los años ochentas el desarrollo de nuevas tecnologías para la identificación del ADN del

Más detalles

Nuevo algoritmo diagnóstico de la Infección por VIH

Nuevo algoritmo diagnóstico de la Infección por VIH Nuevo algoritmo diagnóstico de la Infección por VIH Dra. Manuelita Zavala Pineda Médico Adscrito Servicio Infectología Hospital General de México Dr. Eduardo Liceaga Marcadores inmunológicos y virológicos

Más detalles

Hepatitis HEPATITIS A

Hepatitis HEPATITIS A Hepatitis Es una enfermedad inflamatoria que afecta al hígado. La inflamación, se puede presentar en forma aguda o ser un proceso crónico, dependiendo de la etiología que le dio origen. Sus causas pueden

Más detalles

6 INFECCIÓN POR EL VIRUS DE LA INMUNODEFICIENCIA HUMANA (VIH) Y SIDA. TRATAMIENTO Y PREVENCIÓN DE LAS INFECCIONES OPORTUNISTAS ASOCIADAS

6 INFECCIÓN POR EL VIRUS DE LA INMUNODEFICIENCIA HUMANA (VIH) Y SIDA. TRATAMIENTO Y PREVENCIÓN DE LAS INFECCIONES OPORTUNISTAS ASOCIADAS 6 INFECCIÓN POR EL VIRUS DE LA INMUNODEFICIENCIA HUMANA (VIH) Y SIDA. TRATAMIENTO Y PREVENCIÓN DE LAS INFECCIONES OPORTUNISTAS ASOCIADAS Introducción.................... 663 Clasificación de la infección

Más detalles

Unidad de Enfermedades Infecciosas. Servicio de Medicina Interna. Complejo Hospitalario Universitario de Santiago de Compostela

Unidad de Enfermedades Infecciosas. Servicio de Medicina Interna. Complejo Hospitalario Universitario de Santiago de Compostela PACIENTE CON SINDROME MENINGEO Y EXANTEMA Caso presentado por: E. Losada, A. Antela, A. Prieto. Unidad de Enfermedades Infecciosas. Servicio de Medicina Interna. Complejo Hospitalario Universitario de

Más detalles

Facultad de Ciencias Bioquímicas y Farmacéuticas Área de Integración n Disciplinar y Estudio de la Problemática Profesional TPP I Unidad 2 Aspectos biológicos del VIH Algunos datos importantes 1959 Se

Más detalles

IMPORTANCIA DEL LABORATORIO EN EL DIAGNÓSTICO Y SEGUIMIENTO DE LA INFECCIÓN VIH. María Delgado Yagüe Resindente de M. Interna H.U.F.

IMPORTANCIA DEL LABORATORIO EN EL DIAGNÓSTICO Y SEGUIMIENTO DE LA INFECCIÓN VIH. María Delgado Yagüe Resindente de M. Interna H.U.F. IMPORTANCIA DEL LABORATORIO EN EL DIAGNÓSTICO Y SEGUIMIENTO DE LA INFECCIÓN VIH María Delgado Yagüe Resindente de M. Interna H.U.F.A DIAGNÓSTICO IMPORTANCIA DEL LABORATORIO EN EL DIAGÓSTICO DE LA INFECCIÓN

Más detalles

PCR A TIEMPO REAL. María Maiques R4-Bioquímica Clínica 25-Abril-07

PCR A TIEMPO REAL. María Maiques R4-Bioquímica Clínica 25-Abril-07 PCR A TIEMPO REAL María Maiques R4-Bioquímica Clínica 25-Abril-07 VEAMOS Herramientas para detectar mutaciones Moléculas fluorescentes y tecnología FRET PCR a tiempo real: equipos y métodos de detección

Más detalles

PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH

PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH Blga. Gisely Hijar Guerra Coordinación del Laboratorio de Biotecnología y Biología Molecular. Responsable de los Procesos de la Prueba

Más detalles

GUIAS DE ATENCION EN VIH SIDA. Madeleyne Jaramillo Zapata Enfermera, Universidad de Antioquia Mg. En Administración en salud, Universidad CES

GUIAS DE ATENCION EN VIH SIDA. Madeleyne Jaramillo Zapata Enfermera, Universidad de Antioquia Mg. En Administración en salud, Universidad CES GUIAS DE ATENCION EN VIH SIDA Madeleyne Jaramillo Zapata Enfermera, Universidad de Antioquia Mg. En Administración en salud, Universidad CES VIH en cifras En 2011, el Programa de las Naciones Unidas sobre

Más detalles

Herpes zoster Patogénesis

Herpes zoster Patogénesis Herpes Zoster Herpes zoster Patogénesis Lesiones de varicela Lesiones de zoster Ganglio anexo a la raíz dorsal (virus latente) Neuronas sensitivas Epidemiología Incidencia 2 (1,5-3) casos cada 1.000 personas/año

Más detalles

DIAGNÓSTICO DE LAS ITS. INFECCIONES VIRALES

DIAGNÓSTICO DE LAS ITS. INFECCIONES VIRALES DIAGNÓSTICO DE LAS ITS. INFECCIONES VIRALES Virus Herpes Simple Prof. Adj. Pablo López. Departamento de Laboratorio de Patología Clínica. Inmunología y Biología Molecular. Hospital de Clínicas. Herpes

Más detalles

ANTIVIRALES. Od.Viviana Karaben Cátedra de Farmacología FOUNNE.

ANTIVIRALES. Od.Viviana Karaben Cátedra de Farmacología FOUNNE. ANTIVIRALES Od.Viviana Karaben Cátedra de Farmacología FOUNNE. 2008 Los virus son parásitos intracelulares obligados, su replicación depende básicamente de procesos de síntesis de la célula huésped. Los

Más detalles

Problemas en el Diagnostico de la Infección VIH. Diplomado de Atención Integral del VIH-SIDA. 2007

Problemas en el Diagnostico de la Infección VIH. Diplomado de Atención Integral del VIH-SIDA. 2007 Problemas en el Diagnostico de la Infección VIH Diplomado de Atención Integral del VIH-SIDA. 2007 Algunas Generalidades Sub - tipos del VIH y pruebas de laboratorio Analogía del VIH 1 y 2 es de: 40-60%

Más detalles

El Laboratorio en el diagnóstico de las tuberculosis y Micobacterias atípicas: Herramientas diagnósticas disponibles en Chile

El Laboratorio en el diagnóstico de las tuberculosis y Micobacterias atípicas: Herramientas diagnósticas disponibles en Chile El Laboratorio en el diagnóstico de las tuberculosis y Micobacterias atípicas: Herramientas diagnósticas disponibles en Chile Dra. Patricia González A. Médico Microbiólogo Laboratorio Clínica Alemana Facultad

Más detalles

RESUMEN EJECUTIVO EN ESPAÑOL

RESUMEN EJECUTIVO EN ESPAÑOL RESUMEN EJECUTIVO EN ESPAÑOL Guía de Práctica Clínica para la prevención, diagnóstico, evaluación y tratamiento de la Hepatitis C en enfermedad renal crónica Page 1 of 8 GUIA 1: DETECCIÓN Y EVALUACIÓN

Más detalles

Selección de pacientes

Selección de pacientes 2 Selección de pacientes MENSAJES CLAVE Aproximadamente entre el 20% y el 30% de las pacientes con cáncer de mama presentan tumores HER2 positivos. Hasta un 24% de los tumores con receptores de estrógenos

Más detalles

Bioq. María Elina Acevedo Biología Molecular Fundación Hemocentro Buenos Aires

Bioq. María Elina Acevedo Biología Molecular Fundación Hemocentro Buenos Aires Bioq. María Elina Acevedo Biología Molecular Fundación Hemocentro Buenos Aires OBJETIVO DETECTAR Y DESCARTAR PRECOZMENTE UNIDADES DE SANGRE DE DONANTES CON VIREMIA PARA HIV, HBV Y HCV, CON PRUEBAS SEROLÓGICAS

Más detalles

METODOS MOLECULARES DE INNOVACION EN BANCO DE SANGRE

METODOS MOLECULARES DE INNOVACION EN BANCO DE SANGRE VI CONGRESO DEL GRUPO COOPERATIVO IBERO- AMERICANO DE MEDICINA TRANSFUSIONAL G-CIAMT 06-11 de junio 2009 METODOS MOLECULARES DE INNOVACION EN BANCO DE SANGRE Dr. César Sánchez Zúñiga Laboratorio de Biomedicina

Más detalles

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico.

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. AQUAGESTION ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. Noviembre 2011 ACTUALIDAD Este año Sernapesca confirma

Más detalles

HEPATITIS VÍRICAS: EVOLUCIÓN HISTÓRICA

HEPATITIS VÍRICAS: EVOLUCIÓN HISTÓRICA HEPATITIS VÍRICAS: EVOLUCIÓN HISTÓRICA DRA. María Elena Sixto Julio de 2010 HEPATITIS VIRICAS HEPATITIS A HEPATITIS B HEPATITIS C HEPATITIS E HEPATITIS D CLASIFICACIÓN SEGÚN MECANISMO DE TRANSMISIÓN Transmisión

Más detalles

ROCIO DE LOS LLANOS MORENO SELVA R3 OBSTETRICIA Y GINECOLOGIA

ROCIO DE LOS LLANOS MORENO SELVA R3 OBSTETRICIA Y GINECOLOGIA ROCIO DE LOS LLANOS MORENO SELVA R3 OBSTETRICIA Y GINECOLOGIA 2º cáncer + frecuente a nivel mundial: Europa: 4ºposición y 7ª causa de muerte Mujer 18-45ª 2º cáncer y 2ª causa de muerte España: 7º cancer

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

TÉCNICAS Y AVANCES DIAGNÓSTICOS EN LAS INFECCIONES RESPIRATORIAS DE ORIGEN VIRAL. Carla López Causapé Servicio de Microbiología HUSE

TÉCNICAS Y AVANCES DIAGNÓSTICOS EN LAS INFECCIONES RESPIRATORIAS DE ORIGEN VIRAL. Carla López Causapé Servicio de Microbiología HUSE TÉCNICAS Y AVANCES DIAGNÓSTICOS EN LAS INFECCIONES RESPIRATORIAS DE ORIGEN VIRAL Carla López Causapé Servicio de Microbiología HUSE IMPORTANCIA DE LAS INFECCIONES RESPIRATORIAS DE ORIGEN VIRAL Las Infecciones

Más detalles

Pruebas serológicas para dengue

Pruebas serológicas para dengue Pruebas serológicas para dengue El 40% de la población mundial corre riesgo de infección por dengue Durante más de 25 años, Focus Diagnostics ha sido un líder en el desarrollo de ensayos inmunológicos

Más detalles

SERVICIOS LABORATORIO HISTOCOMPATIBILIDAD

SERVICIOS LABORATORIO HISTOCOMPATIBILIDAD SERVICIOS LABORATORIO HISTOCOMPATIBILIDAD El laboratorio de histocompatibilidad está capacitado para desarrollar los estudios necesarios para trasplantes de órganos de acuerdo a los requerimientos internacionalmente

Más detalles

Actualización en nuevas técnicas de diagnóstico genético molecular disponibles en Chile

Actualización en nuevas técnicas de diagnóstico genético molecular disponibles en Chile Actualización en nuevas técnicas de diagnóstico genético molecular disponibles en Chile Dra. Teresa Aravena Clínica INDISA Hospital Clínico de la Universidad de Chile Hospital Dr. Sótero del Río Exámenes

Más detalles

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental.

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Gemma Saucedo. Laboratorio Aguas de Barcelona 22-23 de noviembre de 2006 Introducción PCR: Polymerase Chain Reaction

Más detalles

8 Congreso Argentino de Salud Integral del Adolescente. Dr. Eduardo Rubinstein. Hospital Francisco J. Muñiz Adolescencia

8 Congreso Argentino de Salud Integral del Adolescente. Dr. Eduardo Rubinstein. Hospital Francisco J. Muñiz Adolescencia 8 Congreso Argentino de Salud Integral del Adolescente Dr. Eduardo Rubinstein Hospital Francisco J. Muñiz Adolescencia VIH EN ADOLESCENTES: QUE HAY DE NUEVO? En diagnóstico de infección por VIH En seguimiento

Más detalles

Nadia Isabel Hornquist Hurtarte Química Bióloga Clínica de Enfermedades Infecciosas Hospital Roosevelt

Nadia Isabel Hornquist Hurtarte Química Bióloga Clínica de Enfermedades Infecciosas Hospital Roosevelt Nadia Isabel Hornquist Hurtarte Química Bióloga Clínica de Enfermedades Infecciosas Hospital Roosevelt Fase aguda: Entre el 40% a 90% sintomáticos (similar mononucleosis) Fase crónica: asintomaticos El

Más detalles

VI JORNADA DE FORMACIÓN INTERHOSPITALARIA DEL LABORATORIO CLÍNICO

VI JORNADA DE FORMACIÓN INTERHOSPITALARIA DEL LABORATORIO CLÍNICO VI JORNADA DE FORMACIÓN INTERHOSPITALARIA DEL LABORATORIO CLÍNICO 8. DIABETES AUTOINMUNE ADELA RAMOS HERNÁNDEZ R III. BIOQUÍMICA CLÍNICA DEFINICION Enfermedad metabólica crónica y compleja, caracterizada

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles

Herramientas de laboratorio aplicadas al diagnóstico y el monitoreo del tratamiento de la infección por VIH (Virus

Herramientas de laboratorio aplicadas al diagnóstico y el monitoreo del tratamiento de la infección por VIH (Virus Herramientas de laboratorio aplicadas al diagnóstico y el monitoreo del tratamiento de la infección por VIH (Virus Inmunodeficiencia Humana) Fabián Fay CIBIC. Rosario. Argentina Test de laboratorio para

Más detalles

Citomegalovirus en el transplante renal

Citomegalovirus en el transplante renal Citomegalovirus en el transplante renal Cytomegalovirus in the kidney transplant Autores: Francisco Llamas Fuentes, Juan Pérez Martínez, Eduardo Gallego Valcarce S. Nefrología. C.H.U. Albacete Contacto:

Más detalles

LA BIOTECNOLOGÍA HACE TU VIDA MEJOR Y MÁS FÁCIL

LA BIOTECNOLOGÍA HACE TU VIDA MEJOR Y MÁS FÁCIL LA BIOTECNOLOGÍA HACE TU VIDA MEJOR Y MÁS FÁCIL BIOTECNOLOGÍA APLICADA A LA SALUD La Biotecnología está presente en la Medicina y en la Salud animal, ya que participa en el diagnóstico y en el tratamiento

Más detalles

Situación de la asociación TB-VIH/SIDA

Situación de la asociación TB-VIH/SIDA Situación de la asociación TB-VIH/SIDA Dr. Alberto Vargas González Centro de Investigaciones Regionales DR. Hideyo Noguchi /UADY Laboratorio de Microbiología Huésped Infección Patógeno Enfermedad RESPUESTA

Más detalles

Estrategia utilizada

Estrategia utilizada Estrategia utilizada 1) Extracción HIV RNA V3 7114 7218 2) One Step RT-PCR (x triplicado) 3) 2 nd PCR (A1 A2 A3) A1 A2 A3 4) Secuencuiación A1 A2 A3 TGTACAAGACCCAACAACAATACAAGAAAAAGTATACATGTAGGACG AGGGAGATCAATTTATGCAACAGAAAAAATAATAGGAGATACAAAAC

Más detalles

Técnicas moleculares.

Técnicas moleculares. Técnicas moleculares. DMTV Carolina Acevedo Curso de Microbiología 2015 SÍNTESIS IN VITRO DE UNA GRAN CANTIDAD DE COPIAS DE UN SEGMENTO DE ADN EXISTENTE EN UNA MUESTRA. O sea. Amplificamos en forma exponencial

Más detalles

Bioq. María Elina Acevedo Biología Molecular Fundación Hemocentro Buenos Aires Tamizaje de infecciones transmisibles por transfusión en Argentina (Ley 22.990 - Ley Nacional de Sangre ) HVB: Enzimoinmunoensayos

Más detalles

ACTUALIZACIÓN EN DENGUE Y CHIKUNGUNYA

ACTUALIZACIÓN EN DENGUE Y CHIKUNGUNYA ACTUALIZACIÓN EN DENGUE Y CHIKUNGUNYA Diagnóstico de las infecciones por DENV y CHIKV María Gabriela Barbás Bioq. Esp.en Virología Jefa del Servicio Bioquímico Laboratorio Central de la Provincia de Córdoba

Más detalles

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa?

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa? 2º BIOQUÍMICA CUESTIONES 1. Por qué la PCR convencional no es cuantitativa? En la PCR convencional, la cuantificación del ADN de la muestra es complicada debido a que la eficacia de amplificación va disminuyendo

Más detalles

CAPÍTULO VIII EL SÍNDROME HIPER IgM LIGADO AL X

CAPÍTULO VIII EL SÍNDROME HIPER IgM LIGADO AL X CAPÍTULO VIII EL SÍNDROME HIPER IgM LIGADO AL X Los pacientes con el Síndrome Hiper IgM ligado al x tienen deficiencia de una proteína, Ligando CD40, que se encuentra en la superficie de los linfocitos

Más detalles

CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015

CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 DEFINICIÓN PCR: Constituye la técnica más importante para amplificar ácidos nucleicos in vitro. Ambas hebras del DNA de interés son replicadas

Más detalles

ZONA GRIS: IMPORTANCIA DE LA FASE PREANALITICA EN BIOLOGÍA MOLECULAR.

ZONA GRIS: IMPORTANCIA DE LA FASE PREANALITICA EN BIOLOGÍA MOLECULAR. ZONA GRIS: IMPORTANCIA DE LA FASE PREANALITICA EN BIOLOGÍA MOLECULAR. Autores: Dª. Sonia Vidal Rico. D. Fernando Grossón García. D. Carlos Pascual Ferrer. Dª. Elena Vidal Rico. Dª. Concepción Tuset Ruiz.

Más detalles

INTRODUCIÓN. Los datos de la distribución geográfica quedarían distribuidos según el siguiente esquema

INTRODUCIÓN. Los datos de la distribución geográfica quedarían distribuidos según el siguiente esquema INTRODUCIÓN Hagamos un repaso de los datos recogidos en la bibliografía. Infección por VHC: Infección crónica por VHC afecta al 3% de la población mundial Incidencia de infección aguda: 1/100.000 habitantes

Más detalles

Varicela 1. Agente inmunizante 2. Conservación

Varicela 1. Agente inmunizante 2. Conservación Varicela 1. Agente inmunizante Es una vacuna viral atenuada, desarrollada en Japón en 1974; se utiliza el virus varicela-zoster cepa OKA atenuada (aceptada por OMS) obtenida en cultivos de células diploides

Más detalles

TUBERCULOSIS DEFINICION:

TUBERCULOSIS DEFINICION: DEFINICION: Enfermedad Infecto- contagiosa provocada por el bacilo de Koch (mycobacterium tuberculosis). Afecta primariamente los pulmones. MICOBACTERIUM TUBERCULOSO ( BAAR) Microorganismo estrictamente

Más detalles

PRUEBA RAPIDA EN EMBARAZADAS (n=62,214 2009-Junio 2010) NO REACTIVO n=218 REACTIVO INDETERMINADO. Tabla 9: Resultados Prueba rápida

PRUEBA RAPIDA EN EMBARAZADAS (n=62,214 2009-Junio 2010) NO REACTIVO n=218 REACTIVO INDETERMINADO. Tabla 9: Resultados Prueba rápida 11-RESULTADOS 11.1-Interpretación y análisis de resultados Un total de de 62,214 mujeres embarazadas se realizaron la prueba rápida de VIH durante años 2009 hasta junio 2010 (Tabla 9). De ellas, 61,808

Más detalles

imegen Alfa-1-AT Manual de Usuario Referencia: IMG-211

imegen Alfa-1-AT Manual de Usuario Referencia: IMG-211 Manual de Usuario imegen Alfa-1-AT Genotipado de las mutaciones Glu342Lys (PI-Z) y Glu264Val (PI-S) del gen SERPINA1 mediante PCR a tiempo real Referencia: Fabricado en España Garantías y responsabilidades

Más detalles

Pontificia Universidad Católica del Ecuador

Pontificia Universidad Católica del Ecuador Av. 1 de Octubre 1076 y Roca Apartado postal 17-01-184 Fax: 59 99 16 56 Telf: 59 99 15 5 1. DATOS INFORMATIVOS: MATERIA O MÓDULO: CÓDIGO: 160 INMUNODIAGNOSTICO DE MICROORGANISMOS T-L CARRERA: Microbiología

Más detalles

Mononucleosis infecciosa

Mononucleosis infecciosa Mononucleosis infecciosa Clasificación Orden Herpesvirales Familia Herpesviridae Alfaherpesvirinae Simplexvirus Human herpes 1 y 2 (HSV-1 y HSV-2) Varicellovirus Human herpes 3 (VZV) Betaherpesvirinae

Más detalles

Herramientas para el diagnóstico, seguimiento y tratamiento en Hepatitis B. Fabián Fay CIBIC Rosario Argentina ffay@cibic.com.ar

Herramientas para el diagnóstico, seguimiento y tratamiento en Hepatitis B. Fabián Fay CIBIC Rosario Argentina ffay@cibic.com.ar Herramientas para el diagnóstico, seguimiento y tratamiento en Hepatitis B Fabián Fay CIBIC Rosario Argentina ffay@cibic.com.ar HBV - Marcadores Serológicos HBsAg: Antígeno de Superficie Anti-HBc (total):

Más detalles

Perinatal Transmisión al bebé, durante el embarazo, parto o lactancia.

Perinatal Transmisión al bebé, durante el embarazo, parto o lactancia. Dr. Horacio Salomón Investigador Principal del CONICET Director del INBIRS (Ex-CNRSIDA) UBA-CONICET Contacto sexual Relaciones sexuales sin protección por contacto directo con fluidos corporales como secreciones

Más detalles

Papiloma Virus Humano (PVH) El cáncer de cuello uterino sí se puede evitar.

Papiloma Virus Humano (PVH) El cáncer de cuello uterino sí se puede evitar. Papiloma Virus Humano (PVH) El cáncer de cuello uterino sí se puede evitar. Qué es la infección por PVH El Papiloma Virus Humano (PVH) es la enfermedad de transmisión sexual más común en la mayoría de

Más detalles

PRÁCTICAS DE MICROBIOLOGIA CLINICA

PRÁCTICAS DE MICROBIOLOGIA CLINICA PRÁCTICAS DE MICROBIOLOGIA CLINICA Juan Carlos Rodríguez Hospital General Universitario de Alicante E-mail: rodriguez_juadia@gva.es http://microbiologia-alicante.umh.es CASO CLINICO: Rubéola Evolución

Más detalles

Licda. Yarisel Rodríguez Mgtra. Dalis Mojica ICGES/LCRSP

Licda. Yarisel Rodríguez Mgtra. Dalis Mojica ICGES/LCRSP Licda. Yarisel Rodríguez Mgtra. Dalis Mojica ICGES/LCRSP RED NACIONAL DE DENGUE PROGRAMA DE EVALUACIÓN EXTERNA DE LA CALIDAD SUPERVISIONES PRUEBAS DE PROFICIENCIA CONTROL DE CALIDAD INDIRECTO No hay laboratorios

Más detalles

versus PCR en Tiempo Real PCR convencional no es cuantitativo

versus PCR en Tiempo Real PCR convencional no es cuantitativo PCR convencional o PCR de punto final versus PCR en Tiempo Real PCR convencional no es cuantitativo S Lobos C - U de Chile 1 PCR clásico La cantidad de producto no está relacionada con la cantidad de DNA

Más detalles

5. La infección hospitalaria: herramientas para su control

5. La infección hospitalaria: herramientas para su control 5. La infección hospitalaria: herramientas para su control Por definición se considera infección nosocomial o de adquisición hospitalaria a la que no está presente ni se está incubando en el momento del

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. info@atgen.com.uy www.atgen.com.uy

Más detalles

Manifestaciones clínicas. Cuadro mononucleósido asociado a la primoinfección. Clasificación de la infección VIH.

Manifestaciones clínicas. Cuadro mononucleósido asociado a la primoinfección. Clasificación de la infección VIH. Manifestaciones clínicas. Cuadro mononucleósido asociado a la primoinfección. Clasificación de la infección VIH. Jose Maria Kindelán. Hospital Universitario Reina Sofía. Córdoba I. Historia natral de la

Más detalles

FeLV Ag / FIV Ab Test Kit

FeLV Ag / FIV Ab Test Kit SensPERT FeLV Ag / FIV Ab Test Kit CONCEPTO SENSPERT La línea de diagnóstico SensPERT de Rapid Test proporciona una solución rápida, específica y fiable para los médicos veterinarios en su práctica clínica

Más detalles

TaqMan GMO Maize Quantification Kit. Part No: 4481972

TaqMan GMO Maize Quantification Kit. Part No: 4481972 TaqMan GMO Maize Quantification Kit Part No: 4481972 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan

Más detalles

VII Jornadas Catalanas de Salud Internacional

VII Jornadas Catalanas de Salud Internacional NOVEDADES DIAGNÓSTICAS EN HELMINTIASIS Esperanza Rodríguez Servicio de Parasitología Centro Nacional de Microbiología Instituto de Salud Carlos III Enfermedad Personas en riesgo Personas Infectadas Muertes

Más detalles

Análisis de la Respuesta Inmunitaria a las vacunas

Análisis de la Respuesta Inmunitaria a las vacunas Análisis de la Respuesta Inmunitaria a las vacunas José Ignacio Santos Profesor de Medicina Experimental Jefe de la Subdivisión de Investigación Clínica Facultad de Medicina Universidad Nacional Autónoma

Más detalles

INTERFERON. Efectos Inmunomoduladores Induce expresión de MHC clase I Activa macrófagos Células asesinas naturales Linfocitos T citotóxicos

INTERFERON. Efectos Inmunomoduladores Induce expresión de MHC clase I Activa macrófagos Células asesinas naturales Linfocitos T citotóxicos INTERFERON Efectos antivirales directos Reclutamiento de células inmunes Efectos Inmunomoduladores Induce expresión de MHC clase I Activa macrófagos Células asesinas naturales Linfocitos T citotóxicos

Más detalles

Anexo X Técnicas disponibles en el Centro Nacional de Microbiología (CNM) para el Diagnóstico del SRAS

Anexo X Técnicas disponibles en el Centro Nacional de Microbiología (CNM) para el Diagnóstico del SRAS nexo X Técnicas disponibles en el Centro Nacional de Microbiología (CNM) para el Diagnóstico del SRS Técnicas disponibles en el Centro Nacional de Microbiología (CNM) para el Diagnóstico del SRS 1.- islamiento

Más detalles