Save this PDF as:

Tamaño: px
Comenzar la demostración a partir de la página:



1 Espacio para el men saje. Para causar un mayor impacto, escriba dos o tres frases. PROTEON TRIGO PROTEON WHEAT Título Test Inmunoenzimático para la Detección y Cuantificación de Proteína de Trigo Immunoenzymatic Test for Detection and Quantitation of wheat Protein S.L. María de Luna 11, Nave Zaragoza (SPAIN) Phone/Fax: G-COM-PR.04 S.L. JUN 05 Rev 0

2 ESPAÑOL PRINCIPIO DEL ENSAYO El kit PROTEON Trigo es un ensayo inmunoenzimático tipo ELISA competitivo indirecto basado en la detección específica de proteína de trigo en productos lácteos. El ensayo se basa en la competición entre la proteína de trigo presente en las muestras o patrones y la proteína inmovilizada en la superficie de la placa microtiter, por su unión a un anticuerpo específico. La unión de este primer anticuerpo con la proteína inmovilizada se podrá cuantificar colorimétricamente usando una enzima conjugada a un segundo anticuerpo. La cantidad de proteína de la muestra o patrón será inversamente proporcional a la intensidad de color del producto final. La determinación cuantitativa de proteína de las muestras se realizará por interpolación en una curva de calibrado en la que se representarán los porcentajes de proteína de trigo de las soluciones patrón frente a sus absorbancias a 450 nm. El límite de detección del test es de 0,26% (p/p) de proteína de trigo en proteína total. CONTENIDO DEL KIT 1 placa microtiter divisible de 96 pocillos (12 tiras de 8 pocillos) tapizada con el antígeno. 6 viales con soluciones patrón de proteína de trigo x 10 (al 0%, 1%, 2%, 4%, 8%). 1 vial con el Primer Anticuerpo x vial con Anticuerpo Conjugado x vial con solución de Substrato/cromógeno (TMB) Listo para usar. 1 vial con Solución Stop (Acido sulfúrico). 1 vial con Solución Tampón x 10. Certificado de Producto. MATERIAL ADICIONAL NECESARIO Micropipetas de µl y de µl. Agitador tipo noria para tubos de 25 ml. Balanza analítica. Espectrofotómetro para placas ELISA con filtro de 450 nm. 2

3 ESPAÑOL PRECAUCIONES DE USO Solo para diagnóstico in vitro La Solución Stop contiene ácido sulfúrico y es corrosiva. Manejar los reactivos con extrema precaución, evitar el contacto con la piel, ojos y membranas mucosas. Hacer uso de unas buenas prácticas en el laboratorio, así como de ropa y material adecuado. La hoja de seguridad del kit está disponible a través de su proveedor habitual o de Z.E.U- INMUNOTEC,SL. MANEJO Y ALMACENAMIENTO DEL KIT 1. Todos los componentes del kit deben ser conservados entre 4 y 12ºC y en oscuridad. (Nunca en congelador). El kit tiene una caducidad de 1 año, cuando se conserva en estas condiciones. 2. No se asegura la calidad de los componentes del kit después de su fecha de caducidad. 3. La Solución de Conjugado puede ser preparada para su uso inmediato o puede almacenarse en refrigeración (4-12ºC). 4. La solución de Substrato/cromógeno es sensible a la luz por lo que se debe evitar la exposición directa a ésta. La aparición de coloración en la solución de Substrato/cromógeno es indicativo del deterioro del mismo y éste debe ser desechado. Es aconsejable trasvasar la cantidad que se vaya a utilizar en el ensayo a otro tubo. 5. No cambiar ningún procedimiento del ensayo, en particular los tiempos y la temperatura de incubación. Una vez iniciado el ensayo realizar todos los pasos sin interrupción, no se deben dejar secar completamente los pocillos. 6. Evitar que incida la luz directamente sobre la placa durante la incubación. 7. Evitar que se formen burbujas de aire en los pocillos, ya que podrían interferir en la lectura fotométrica. 8. La reproducibilidad de los resultados de los ensayos ELISA depende en gran medida de un lavado eficiente y uniforme de los pocillos. Es importante incidir en este paso y repetirlo cuantas veces sea necesario. 9. La temperatura óptima de análisis debe situarse entre 20-24ºC. Temperaturas por encima o por debajo pueden originar curvas de calibrado que no conserven la linealidad o curvas con absorbancias más bajas de lo normal respectivamente. 3 S.L.

4 ESPAÑOL PREPARACIÓN DE LAS MUESTRAS Y SOLUCIONES Preparación de los patrones de trigo: Diluir los patrones 1/10 con la Solución Tampón. Ejemplo: Diluir 0,1 ml de la Solución Patrón con 0,9 ml de Solución Tampón. Mezclar bien. Preparación del Primer Anticuerpo: Diluir el Primer Anticuerpo 1/20 con la solución tampón. Ejemplo: Diluir 0,05 ml de Anticuerpo con 0,95 ml de Solución Tampón. Mezclar bien. Preparación de las muestras: Pesar 100 mg de la muestra (leche en polvo) y disolverla en 9,9 ml de Solución Tampón. Mezclar hasta que las partículas estén bien dispersas y homogeneizar en un rotatubos tipo noria durante 30 minutos. Este tests también se puede usar con muestras de queso y yogurt. Consultar con la extracción de la muestra. Preparación del Anticuerpo Conjugado: Preparar solo el volumen de solución necesario para el ensayo. Para ello, mezclar 1 volumen del Anticuerpo Conjugado con 99 volúmenes del Tampón. Por ejemplo: Para analizar 8 muestras, es necesario 1,6 ml (0,2 ml/pocillo) de Solución de Anticuerpo Conjugado diluida. 2 ml de esta solución se preparan mezclando 0,020 ml del tubo del Anticuerpo Conjugado con 1,980 ml de Solución Tampón. 4

5 ESPAÑOL PROCEDIMIENTO DEL ENSAYO: Es imprescindible antes de realizar el ensayo, leer con atención los consejos sobre manejo y almacenamiento del kit. 1. Para una mayor fiabilidad de los resultados es aconsejable realizar los ensayos con los patrones y las muestras por duplicado. 2. Acondicionar a temperatura ambiente todos los componentes y reactivos necesarios para la realización del ensayo. Sacar la placa microtiter de la bolsa y cortar las tiras que vayan a ser utilizadas. Guardar el resto en la bolsa con el desecante. 3. Aplicar 100 µl de muestra o patrón diluidos y 100 µl del Primer Anticuerpo diluido en cada pocillo de la placa y agitar suavemente. Cubrir la placa e incubar a temperatura ambiente durante 30 minutos. 4. Lavar la placa 4 veces con Solución Tampón usando un frasco lavador o una micropipeta multicanal (añadiendo aproximadamente 0,3 ml/pocillo). Eliminar después el líquido volcando la placa sobre un recipiente. Para asegurarse de que se ha retirado completamente el líquido tras el último lavado, golpear la placa con los pocillos mirando hacia abajo sobre un papel absorbente. 5. Añadir 200 µl del Anticuerpo Conjugado diluido en cada pocillo. Cubrir la placa e incubar a temperatura ambiente durante 30 minutos. 6. Repetir la secuencia de lavados como en el paso Aplicar a cada pocillo 100 µl de Solución de Substrato/cromógeno. Cubrir la placa e incubar a temperatura ambiente (20-24ºC) durante 30 minutos, tiempo en el que se desarrollará el color azul. No lavar la placa en este paso. 8. Añadir a cada pocillo 50 µl de Solución Stop para parar la reacción. Mezclar bien, dando unos golpes suaves en el borde lateral del marco hasta que aparezca la coloración amarilla en todos los pocillos. 9. Leer la absorbancia de cada pocillo a una longitud de onda de 450 nm con un espectrofotómetro para placas microtiter. Si es necesario tomar como referencia un blanco, usar el aire. Muestra Buffer Extrac. 100 µl Anticuerpo 100 µl Conjugado 200 µl TMB 100 µl Sol. Stop 50 µl lavado lavado 30 min 30 min 30 min 30 min Lectura 450 nm EXTRACCIÓN ETAPA INMUNOLÓGICA ETAPA REVELADO 5 S.L.

6 ESPAÑOL REPRESENTACIÓN Y CÁLCULO DE LOS RESULTADOS. 1. Dividir el valor medio de absorbancia de cada patrón o muestra por el valor medio de absorbancia del patrón al 0 % (patrón Bo de máxima señal) y multiplicar por 100, para obtener el cociente B/B 0 como se indica a continuación: Media de la absorbancia del patrón o muestra X 100 = B (%) Media de la absorbancia del Patrón 0% B 0 2. Representar el valor de % B/Bo de cada patrón frente a la concentración de proteína en escala semilogarítmica, como en el ejemplo que se expone a continuación: B/B0 (%) y = -21,105 Ln(x) + 77,92 R 2 = 0, % Proteína de trigo 3. Interpolar el valor %B/Bo, calculado para cada muestra, en la curva de calibrado para obtener así el correspondiente valor de concentración. (No hay que olvidar que en muestras diluidas hay que multiplicar estas concentraciones por el correspondiente factor de dilución) BIBLIOGRAFÍA: M.A. Manso, T.M.Cattaneo, S. Barzaghi, M.D. Pérez, L. Sánchez, M. Calvo, C. Olieran G.Brett & R. López-Fandiño. Determination of Wheat Protein in Milk and Milk Products Using Idirect Competive ELISA 2002, Bulletin IDF371, Lourdes Sánchez, María D.Pérez, Pilar Puyol, Gary Brett, Miguel Calvo. Determination of Vegetal Proteins in Milk Powder by Enzyme linked Immunosorbent Assay: Interlaboratory Study Journal of AOAC International, vol 85, 6,

7 ENGLISH TEST PRINCIPLE PROTEON wheat is a competitive ELISA test for detection and quantitation of wheat protein in dairy products. The test is based on the competition of wheat proteins, extrated from the sample, and those immobilised on the plate to bind a specific anti-wheat antibody. The antigen (wheat protein) will react with the antibody to form an antigen-antibody complex. A second antibody marked with peroxidase will bind specifically the first antibody and colour will be developed when adding the peroxidase substrate. A standard curve is obtained to determine the amount of wheat protein contained in the sample. Samples containing high concentration of wheat protein will produce less colour intensity and viceversa. The limit of detection for the test is 0.26% (w/w) wheat protein / total protein. KIT COMPONENTS 96-well microtiter (12 strips of 8 wells) coated with the antigen 6 vials wheat protein standards x10 (0%, 1%, 2%, 4%, 8%) 1 vial First Antibody x 20 1 vial Conjugate antibody x vial Substrate/chromogen (TMB) Ready to use 1 vial Stop Solution (Sulphuric Acid 1M) 1 vial Buffer x 10 Product Certificate ADDITIONAL MATERIAL NOT PROVIDED Micropipettes ( µl and µl) ELISA reader (450 nm filter) End-over-end rotation homogenizer (for 25 ml tubes) Analytical balance WARNINGS AND PRECAUTIONS FOR THE USERS For in vitro diagnostic use only. Some reagents can be dangerous. The stop solution contains sulphuric acid and is corrosive. Good laboratory practices and protective clothing should be used. Handle the reagents with extreme caution, avoid contact with skin, eyes and mucous membranes. Safety data sheet is available on request from your local distributor or Z.E.U.-INMUNOTEC. 7 S.L.

8 ENGLISH HANDLING AND STORAGE RECOMMENDATIONS 1. The kit must be stored at 4-12ºC (never frozen) and protected from light. This kit has a shelf life of one year, when stored at the recommended conditions 2. Prepare the solutions according to the next section (Preparation of Samples and Solutions) immediately before use. 3. Strip wells must be stored hermetically sealed in the provided bag when not in used. 4. The diluted conjugate solution is stable for several days. 5. The Substrate Solution is sensitive to light and must be stored protected from any direct light exposure. This solution is transparent and must be discharged if becomes coloured. Avoid the reagent contamination by using a clean container. 6. The assay must be followed as indicated in a later section, specifically the incubation times. Once the assay has started, all the steps must be followed without any delays and avoiding the plate desiccation. 7. The plate must be protected from light while the assay is performed. 8. Avoid air bubbles in the wells any time during the assay. They may interfere with OD readings. 9. The performance of the kit can not be guaranteed after the expiry date. 10. Very important: The reproducibility of ELISA results depends on the efficiency and uniformity of washing of wells. The number of washes can be increased to improve the results. 11. The test should be carried out at 20-24ºC. Higher or lower temperatures could produce non-linear calibration curves or low absorbance readings respectively. 8

9 ENGLISH PREPARATION OF SAMPLES AND SOLUTIONS Preparation of wheat protein standards: Dilute the standards 1/10 with the provided Buffer. For example: mix 0.1 ml of standard and 0.9 ml of buffer solution. Preparation of the first antibody solution: Dilute the First Antibody 1/20 with the provided Buffer. For example: mix 0.05 ml of the First Antibody and 0.95 ml of Buffer Solution. Preparation of the samples: Weight 100 mg of the sample (powdered milk) and add 9.9 ml of Buffer Solution. Mix until all particles are dispersed. Place the solution in an end-over-end rotation for 30 min at room temperature. Yogurt and cheese samples can also be tested with this kit. Please, contact for information on samples extraction. Preparation of the Conjugate Antibody solution: Prepare only the volume to be used in the assay. Mix 1 volume of the Conjugate Antibody with 99 volumes of buffer solution. For example: for analysis of 8 samples; mix ml of the Conjugate Antibody solution and ml of Buffer Solution. 9 S.L.

10 ENGLISH TEST PROCEDURE Read the handling and storage recommendations prior running the assay 1. Standards and samples should be run in duplicate for a good reliability of results. 2. Take the kit out of the fridge until all the reagents have reached the room temperature (approximately 30 min). 3. Add 100 µl of diluted sample (or standard) and 100 µl of the diluted solution of the First Antibody into each well. Cover the plate with a lid and incubate for 30 minutes at room temperature (20-24ºC). 4. Wash the wells 4 times with the squeeze bottle or the multichannel pipette (add approximately 0.3 ml of Buffer Solution per well). Pour the liquid out from the wells and remove the remaining droplets by tapping the microplate upside down vigorously against absorbent paper. 5. Add 200 µl of the diluted solution of the Conjugate Antibody into each well, cover the plate with the lid and incubate for 30 minutes at 20-24ºC. 6. Wash the wells/plate 4 times following the washing procedure described above (Step number 4). 7. Add 100 µl of Substrate/Chromogen solution into each well. Place a lid on the plate and incubate for 30 minute at 20-24ºC. A blue colour will appear during this step. Do not wash the plate in this step. 8. Add 50 µl of Stop Solution into each well and mix very gently until the solution turns to yellow. 9. Read the results at 450nm using a microplate reader. Use an empty well as blank if necessary. Buffer Sample Extrac. Antibody 100 µl Conjugate 200 µl TMB 100 µl Stop sol. 50 µl wash wash 30 min 30 min 30 min 30 min Reading 450 nm EXTRACTION IMMUNOLOGICAL STEP DEVELOPING STEP 10

11 ENGLISH CALCULATION OF RESULTS 1. Divide the mean of each standard (or sample) absorbance (B) by the mean of absorbance obtained for the 0% standard (B 0, maximum binding), and multiply by 100 following the equation below: Mean of Standard (or Sample) Absorbance X 100 = B % Mean of Maximum Binding Absorbance B 0 2. Plot B/B 0 obtained for the standards in the y axis and the % of wheat protein in a logarithmic x axis. Calculate the % of wheat protein contained in the sample by interpolating the B/B 0 value obtained for the samples into the standard curve. When samples have been diluted the final result must be multiplied by the dilution factor B/B0(%) y = -21,105Ln(x) + 77,92 R 2 = 0, % Wheat Protein 10 REFERENCES: M.A. Manso, T.M.Cattaneo, S. Barzaghi, M.D. Pérez, L. Sánchez, M. Calvo, C. Olieran G.Brett & R. López-Fandiño. Determination of Wheat Protein in Milk and Milk Products Using Idirect Competive ELISA 2002, Bulletin IDF371, Lourdes Sánchez, María D.Pérez, Pilar Puyol, Gary Brett, Miguel Calvo. Determination of Vegetal Proteins in Milk Powder by Enzyme linked Immunosorbent Assay: Interlaboratory Study Journal of AOAC International, vol 85, 6, S.L.


CALOKIT-VACA Test inmunoenzimático para la detección de calostro en leche de vaca

CALOKIT-VACA Test inmunoenzimático para la detección de calostro en leche de vaca Test inmunoenzimático para la detección de calostro en leche de vaca Immunoenzymatic test for colostrum detection in cow s milk S.L. María de Luna 11, Nave 19 50018 Zaragoza (SPAIN) Telephone/Fax: 34 976

Más detalles

Mercodia Ultrasensitive C-peptide ELISA

Mercodia Ultrasensitive C-peptide ELISA Mercodia Ultrasensitive C-peptide ELISA Instrucciones para el uso 10-1141-01 REACTIVOS PARA 96 DETERMINACIONES Para uso diagnóstico in vitro ATENCIÓN! Protocolo de actualización Fabricado por Mercodia

Más detalles


DETERMINACIÓN DE GLUTEN EN ALIMENTOS PARA CELÍACOS INDICE DETERMINACIÓN DE GLUTEN EN ALIMENTOS PARA CELÍACOS INDICE 1 Objetivo 2 2 Alcance 2 3 Desarrollo 2 4 Anexo 8 1.0. Objetivo Determinación de gluten en alimentos para celíacos. 2.0. Alcance Este método analítico

Más detalles

RapidFinder STEC Detection Workflow

RapidFinder STEC Detection Workflow QUICK REFERENCE RapidFinder STEC Detection Workflow Aislamiento automático de ADN y detección de la PCR en tiempo real de E. coli O157:H7 y cepas "Big 6" de STEC no O157 Número de catálogo 4480466, 4428176,

Más detalles

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a Introducción Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a los investigadores verificar la expresión de una proteína, determinar la cantidad relativa

Más detalles

MANUAL EASYCHAIR. A) Ingresar su nombre de usuario y password, si ya tiene una cuenta registrada Ó

MANUAL EASYCHAIR. A) Ingresar su nombre de usuario y password, si ya tiene una cuenta registrada Ó MANUAL EASYCHAIR La URL para enviar su propuesta a la convocatoria es: Donde aparece la siguiente pantalla: Se encuentran dos opciones: A) Ingresar

Más detalles

ZE/OA48C ZE/OA96C. Test for detection of Okadaic Acid-toxins group. Test para la detección de las toxinas del grupo del Ácido Okadaico

ZE/OA48C ZE/OA96C. Test for detection of Okadaic Acid-toxins group. Test para la detección de las toxinas del grupo del Ácido Okadaico OKATEST ZE/OA48C ZE/OA96C Test for detection of Okadaic Acid-toxins group Test para la detección de las toxinas del grupo del Ácido Okadaico ZEU-INMUNOTEC, S.L. Pol. Plaza. C/ Bari, 25 dpdo. 50197 Zaragoza

Más detalles

Mercodia Proinsulin ELISA

Mercodia Proinsulin ELISA Mercodia Proinsulin ELISA Instrucciones para el uso 10-1118-01 REACTIVOS PARA 96 DETERMINACIONES Para uso diagnóstico in vitro Fabricado por Mercodia AB, Sylveniusgatan 8A, SE-754 50 Uppsala, Suecia EXPLICACIÓN

Más detalles

TaqMan GMO Maize Quantification Kit. Part No: 4481972

TaqMan GMO Maize Quantification Kit. Part No: 4481972 TaqMan GMO Maize Quantification Kit Part No: 4481972 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan

Más detalles

ELISA PeliClass human IgG subclass kit REF M1551

ELISA PeliClass human IgG subclass kit REF M1551 Sanquin Reagents Plesmanlaan 5 0 CX Amsterdam The Netherlands Phone: +.0.5.599 Fax: +.0.5.570 Email: Website: M55/ November 007 ELISA PeliClass human IgG subclass

Más detalles

Preparación de la Piel para la Cirugía

Preparación de la Piel para la Cirugía Skin Prep for Surgery Patient identification label Preparación de la Piel para la Cirugía Esta preparación de la piel antes de la cirugía puede ayudar a reducir el riesgo de infección. Lea estos 12 pasos

Más detalles

NycoCard CRP Single Test

NycoCard CRP Single Test NycoCard CRP Single Test ES DESCRIPCION DEL PRODUCTO Aplicaciones NycoCard CRP Single Test es un test de diagnóstico in vitro para medir de una forma rápida la proteína C reactiva (CRP) en la sangre humana.

Más detalles

SIMILAC ADVANCE Mixing Instructions for Concentrating 20 calorie per ounce formula. To make 22, 24, 27, and 30 kcal/oz. formula

SIMILAC ADVANCE Mixing Instructions for Concentrating 20 calorie per ounce formula. To make 22, 24, 27, and 30 kcal/oz. formula SIMILAC ADVANCE Mixing Instructions for Concentrating 20 calorie per ounce formula To make 22, 24, 27, and 30 kcal/oz. formula Preparing 22 Calorie Per Ounce Formula From Powder (Using Similac Advance

Más detalles

Componentes 1. MCPL MICROPLACA: 12 x 8 pocillos recubiertos con antígenos recombinantes de HCV (E. coli). Pocillos separables individualmente.

Componentes 1. MCPL MICROPLACA: 12 x 8 pocillos recubiertos con antígenos recombinantes de HCV (E. coli). Pocillos separables individualmente. bioelisa HCV 4.0 3000-1115 LEER CAMBIOS SOMBREADOS 96 tests 3000-1116 480 tests Test de ELISA para la detección de anticuerpos contra el virus de la hepatitis C (HCV) en suero o plasma humano para ser

Más detalles

New! Solvent-free The new MiniSystem is here... New cap design for easier sample collection!! New! New! 1. Ready to Use 2. One Step 3. Disposable 4. Closed Process 5. Save space and reagents 6. Fast Protocol

Más detalles

1. Sign in to the website, / Iniciar sesión en el sitio,

1. Sign in to the website, / Iniciar sesión en el sitio, Steps to Download Standards & Guidelines from the ASIS International Website / Pasos para Descargar los Standards & Guidelines de la Página Web de ASIS International 1. Sign in to the website,

Más detalles

Quantitative Fecal Calprotectin ELISA

Quantitative Fecal Calprotectin ELISA Quantitative Fecal Calprotectin ELISA KAPEPKT849 DIAsource ImmunoAssays S.A. - Rue du Bosquet, 2 - B-1348 Louvain-la-Neuve - Belgium : 121120/2 Quantitative Fecal Calprotectin ELISA Enzyme Linked ImmunoSorbent

Más detalles

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Para la purificación de ADN genómico de todos los kits de colección Oragene y ORAcollect. Visite nuestro sitio

Más detalles

Creating your Single Sign-On Account for the PowerSchool Parent Portal

Creating your Single Sign-On Account for the PowerSchool Parent Portal Creating your Single Sign-On Account for the PowerSchool Parent Portal Welcome to the Parent Single Sign-On. What does that mean? Parent Single Sign-On offers a number of benefits, including access to

Más detalles

Reutilización de aguas residuales urbanas depuradas

Reutilización de aguas residuales urbanas depuradas Reutilización de aguas residuales urbanas depuradas Grupo TC 10. Centro de Investigaciones de la Energía Solar UNIVERSIDAD DE ALMERÍA Reutilización de aguas residuales urbanas tratadas con fotofenton en

Más detalles

Cómo comprar en la tienda en línea de UDP y cómo inscribirse a los módulos UDP

Cómo comprar en la tienda en línea de UDP y cómo inscribirse a los módulos UDP Cómo comprar en la tienda en línea de UDP y cómo inscribirse a los módulos UDP Sistema de registro y pago Este sistema está dividido en dos etapas diferentes*. Por favor, haga clic en la liga de la etapa

Más detalles

PROCEDIMIENTO PARA DETERMINACIÓN DE SODIO, POTASIO y CALCIO EN ALIMENTOS. Método Espectrofotometría de Absorción Atómica de llama. Método AOAC 985.

PROCEDIMIENTO PARA DETERMINACIÓN DE SODIO, POTASIO y CALCIO EN ALIMENTOS. Método Espectrofotometría de Absorción Atómica de llama. Método AOAC 985. Página 1 de 8 1. OBJETIVO Determinar la concentración de sodio, potasio y calcio en muestras de alimentos con bajo contenido de grasa. 2. CAMPO DE APLICACIÓN Y ALCANCE El método es aplicable a alimentos

Más detalles

Mercodia Iso-Insulin ELISA

Mercodia Iso-Insulin ELISA Mercodia Iso-Insulin ELISA Instrucciones para el uso 10-1128-01 REACTIVOS PARA 96 DETERMINACIONES Para uso diagnóstico in vitro Fabricado por Mercodia AB, Sylveniusgatan 8A, SE-754 50 Uppsala, Suecia EXPLICACIÓN

Más detalles

Level 2 Spanish, 2010

Level 2 Spanish, 2010 9 0 4 2 6 L P 2 Level 2 Spanish, 2010 90426 Listen to and understand spoken language in Spanish in less familiar contexts Credits: Six 2.00 pm Friday 26 November 2010 LISTENING PASSAGE BOOKLET This booklet

Más detalles


CUANTIFICACIÓN DE ADENOSIN DESAMINASA (ADA) CUANTIFICACIÓN DE ADENOSIN DESAMINASA (ADA) PROTOCOLO ADA FUNDAMENTO DEL METODO: La adenosindesaminasa (ADA) es una enzima del catabolismo de las purinas que cataliza la conversión de la adenosina en inosina

Más detalles

Disfruten su verano! Hola estudiantes,

Disfruten su verano! Hola estudiantes, Hola estudiantes, We hope that your experience during Spanish 1 was enjoyable and that you are looking forward to improving your ability to communicate in Spanish. As we all know, it is very difficult

Más detalles

2008 Series Hemodialysis Machine Operator s Manuals Addendum for Concentrate Connection

2008 Series Hemodialysis Machine Operator s Manuals Addendum for Concentrate Connection 2008 Series Hemodialysis Machine Operator s Manuals Addendum for Concentrate Connection Caution: Federal (US) law restricts this device to sale only by or on the order of a physician. This is an addendum

Más detalles


REAL TOTAL RNA FROM BACTERIA AND YEAST KIT REAL TOTAL RNA FROM BACTERIA AND YEAST KIT Ref. 1. INTRODUCCIÓN 1. INTRODUCTION Este kit permite la obtención de ARN total a partir de diferentes cultivos de bacterias y levaduras, sin la utilización de

Más detalles



Más detalles

Los ensayos que se van a desarrollar son los siguientes:

Los ensayos que se van a desarrollar son los siguientes: I Resumen El objetivo principal del proyecto es desarrollar un software que permita analizar unos datos correspondientes a una serie de ensayos militares. Con este objetivo en mente, se ha decidido desarrollar

Más detalles

1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de Quant- it PicoGreen dsaadnssay Kit (Invitrogen ).

1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de Quant- it PicoGreen dsaadnssay Kit (Invitrogen ). 1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de QuantiT PicoGreen dsaadnssay Kit (Invitrogen ). 2. Finalidad. El presente documento describe el Procedimiento Normalizado de

Más detalles

Sistemas de impresión y tamaños mínimos Printing Systems and minimum sizes

Sistemas de impresión y tamaños mínimos Printing Systems and minimum sizes Sistemas de impresión y tamaños mínimos Printing Systems and minimum sizes Para la reproducción del Logotipo, deberán seguirse los lineamientos que se presentan a continuación y que servirán como guía

Más detalles


FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

General Certificate of Education Advanced Level Examination June 2013

General Certificate of Education Advanced Level Examination June 2013 General Certificate of Education Advanced Level Examination June 2013 Spanish Unit 4 Speaking Test Candidate s Material To be conducted by the teacher examiner between 7 March and 15 May 2013 (SPA4T) To

Más detalles

Read all instructions BEFORE assembly and USE of product. KEEP INSTRUCTIONS FOR FUTURE USE.

Read all instructions BEFORE assembly and USE of product. KEEP INSTRUCTIONS FOR FUTURE USE. Read all instructions BEFORE assembly and USE of product. KEEP INSTRUCTIONS FOR FUTURE USE. Lea todas las instrucciones ANTES de armar y USAR este producto. GUARDE LAS INSTRUCCIONES PARA USO FUTURO. 2013

Más detalles

Quantikine IVD ELISA. Inmunoensayo Epo Humano Manual de Instrucciones suplementario. Referencia DEP00

Quantikine IVD ELISA. Inmunoensayo Epo Humano Manual de Instrucciones suplementario. Referencia DEP00 Quantikine IVD ELISA Inmunoensayo Epo Humano Manual de Instrucciones suplementario Referencia DEP00 Este manual de instrucciones incluye el protocolo del ensayo y debe leerse en su totalidad antes de comenzar

Más detalles

Murex anti-hbc (total)

Murex anti-hbc (total) es 8G21-01/-02 GE65/66 Primera edición 10/2009 Murex anti-hbc (total) Enzimoinmunoanálisis para la detección de anticuerpos frente al antígeno core del virus de la hepatitis B (anti-hbc) en suero o plasma

Más detalles

RIDASCREEN. Leishmania Ab. Art. n.: K7121

RIDASCREEN. Leishmania Ab. Art. n.: K7121 RIDASCREEN Leishmania Ab Art. n.: K7121 R-Biopharm AG, An der neuen Bergstraße 17, D-64297 Darmstadt, Alemania Telf.: +49 (0) 6151 8102-0 / Fax: +49 (0) 6151 8102-20 1. Área de aplicación Para el diagnóstico

Más detalles

Grow healthy. Stay healthy. Grow healthy. Stay healthy. PREGNANCY JOURNEY BOOK DIARIO DEL EMBARAZO

Grow healthy. Stay healthy. Grow healthy. Stay healthy. PREGNANCY JOURNEY BOOK DIARIO DEL EMBARAZO PREGNANCY JOURNEY BOOK 2012 Start Smart for Your Baby. All rights reserved. TM 2012 Start Smart for Your Baby. All rights reserved. TM DIARIO DEL EMBARAZO

Más detalles

Matemáticas Muestra Cuadernillo de Examen

Matemáticas Muestra Cuadernillo de Examen Matemáticas Muestra Cuadernillo de Examen Papel-Lápiz Formato Estudiante Español Versión, Grados 3-5 Mathematics Sample Test Booklet Paper-Pencil Format Student Spanish Version, Grades 3 5 Este cuadernillo

Más detalles

General Certificate of Education Advanced Subsidiary Examination June 2014

General Certificate of Education Advanced Subsidiary Examination June 2014 General Certificate of Education Advanced Subsidiary Examination June 2014 Spanish SPA2T/SPA2V Unit 2 Speaking Test Examiner s Material To be conducted by the teacher examiner between 7 March and 15 May

Más detalles

Notas del instructor / Instructor s notes:

Notas del instructor / Instructor s notes: Vestidores Lockers Los vestidores o casilleros son proporcionados por la empresa para que pueda cambiarse, guardar su ropa y sus pertenencias mientras trabaja. Esta prohibido almacenar alimentos, bebidas

Más detalles


PET-RPLA KIT para DETECCIÓN de TOXINAS. Código: TD0930 PET-RPLA KIT para DETECCIÓN de TOXINAS Código: TD0930 Kit para detección de enterotoxina tipo A de Clostridium perfringens en muestras fecales o en filtrados de cultivos por aglutinación pasiva de látex

Más detalles


REAL TOTAL RNA SPIN BLOOD KIT REAL TOTAL RNA SPIN BLOOD KIT Ref. 50 Preps. 1. INTRODUCCIÓN 1. INTRODUCTION Sistema de producción certificado bajo norma ISO Este kit permite la obtención de ARN total libre de ADN directamente de sangre

Más detalles

Control de Calidad en la Técnica de ELISA. Lic. Valentina Bastidas D.

Control de Calidad en la Técnica de ELISA. Lic. Valentina Bastidas D. Control de Calidad en la Técnica de ELISA Lic. Valentina Bastidas D. TÉCNICA DE ELISA DEFINICIÓN E L I S A Ensayo Inmunoabsorbente Ligado a Enzimas Enzime-Linked ImmunoSorbent Assay TIPOS DE ELISA: ELISA

Más detalles

TESTOSTERONE-ELISA KAPD1559. DIAsource ImmunoAssays S.A. - Rue du Bosquet, 2 - B-1348 Louvain-la-Neuve - Belgium

TESTOSTERONE-ELISA KAPD1559. DIAsource ImmunoAssays S.A. - Rue du Bosquet, 2 - B-1348 Louvain-la-Neuve - Belgium TESTOSTERONE-ELISA KAPD1559 DIAsource ImmunoAssays S.A. - Rue du Bosquet, 2 - B-1348 Louvain-la-Neuve - Belgium : 140127/1 TESTOSTERONE ELISA KAPD1559 IN VITRO DIAGNOSTIC USE en DIAsource ImmunoAssays

Más detalles

An explanation by Sr. Jordan

An explanation by Sr. Jordan & An explanation by Sr. Jdan direct object pronouns We usually use Direct Object Pronouns to substitute f it them in a sentence when the it them follows the verb. Because of gender, him and her could also

Más detalles

TIPS: Understanding Overspray

TIPS: Understanding Overspray TIPS: Understanding Overspray In any pneumatic spray application, overspray is an area of concern that should be addressed early on. Fortunately if it does occur, it s easily remedied through the use of

Más detalles

4. DIL SAMP DILUYENTE DE LAS MUESTRAS: Tampón fosfato con proteínas estabilizadoras y conservantes. Listo para usar.

4. DIL SAMP DILUYENTE DE LAS MUESTRAS: Tampón fosfato con proteínas estabilizadoras y conservantes. Listo para usar. bioelisa HIV-1+2 (rec) 3000-1143 LEER CAMBIOS SOMBREADOS 96 tests 3000-1144 480 tests Test de ELISA para la detección de anticuerpos contra HIV-1 y HIV-2 en suero o plasma humano. Sumario Como es conocido

Más detalles

Lump Sum Final Check Contribution to Deferred Compensation

Lump Sum Final Check Contribution to Deferred Compensation Memo To: ERF Members The Employees Retirement Fund has been asked by Deferred Compensation to provide everyone that has signed up to retire with the attached information. Please read the information from

Más detalles

It doesn t take long for spills to become stains...permanently. For precision spill-removal on high-finish concrete floors when every second counts.

It doesn t take long for spills to become stains...permanently. For precision spill-removal on high-finish concrete floors when every second counts. It doesn t take long for spills to become stains...permanently. For concrete floors For precision spill-removal on high-finish concrete floors when every second counts. 6 Steps for spill clean-up Preparation

Más detalles


5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN 5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN Materiales - Eppendorf de 1,5 ml estériles - Eppendorf de pared fina para PCR - Puntas de pipeta estériles desechables - Guantes

Más detalles


TECHNICAL SERVICE REPORT TECGLASS Ensayos de adhesión Número del proyecto: Solicitante: Martina Schwippl Lista de Distribución cliente: Diego Peñas Lista de distribución Sika: Ulli Mueller Florian Doebbel Viviana Nardini Coste:

Más detalles


PROCEDIMIENTO PARA DETERMINAR RIBOFLAVINA EN ALIMENTOS. Método Fluorométrico-HPLC PRT-711.02-046 Página 1 de 8 1. OBJETIVO Determinar la concentración de riboflavina por cromatografía liquida de alta resolución en alimentos. 2. CAMPO DE APLICACIÓN Y ALCANCE El método es aplicable a

Más detalles



Más detalles

Level 1 Spanish, 2010

Level 1 Spanish, 2010 9 0 1 2 5 L P 1 Level 1 Spanish, 2010 90125 Listen to and understand simple spoken Spanish in familiar contexts Credits: Six 9.30 am Tuesday 30 November 2010 LISTENING PASSAGE BOOKLET This booklet contains:

Más detalles



Más detalles

Puede pagar facturas y gastos periódicos como el alquiler, el gas, la electricidad, el agua y el teléfono y también otros gastos del hogar.

Puede pagar facturas y gastos periódicos como el alquiler, el gas, la electricidad, el agua y el teléfono y también otros gastos del hogar. SPANISH Centrepay Qué es Centrepay? Centrepay es la manera sencilla de pagar sus facturas y gastos. Centrepay es un servicio de pago de facturas voluntario y gratuito para clientes de Centrelink. Utilice

Más detalles

Handling Chemotherapy Safely

Handling Chemotherapy Safely Handling Chemotherapy Safely Chemotherapy medicines, also called chemo, may be present in stool, urine, saliva, blood, mucus, vomit or drainage. Small amounts are also in vaginal and semen body fluids.

Más detalles

Tabla de Contenido 1. Descripción... 3

Tabla de Contenido 1. Descripción... 3 Tabla de Contenido 1. Descripción... 3 1.1 Principio... 3 1.2 Condiciones de Trabajo... 3 1.3 Especificaciones Técnicas... 4 2. Instalación... 5 2.1 Desempaque y revisión de Contenido... 5 2.2 Instalación...

Más detalles


TALLER 1 FORMAS DE REPRESENTACIÓN TALLER 1 FORMAS DE REPRESENTACIÓN Ejemplos 1.- Representar 421 10 en base 2 Resultado: 110100101b 2.- Representar 11010111 2 en base 10 Resultado: 215 3.- Representar 1101,1012 en base 10 Resultado: 13,625

Más detalles

Passaic County Technical Institute 45 Reinhardt Road Wayne, New Jersey 07470

Passaic County Technical Institute 45 Reinhardt Road Wayne, New Jersey 07470 Note: Instructions in Spanish immediately follow instructions in English (Instrucciones en español inmediatamente siguen las instrucciónes en Inglés) Passaic County Technical Institute 45 Reinhardt Road

Más detalles

Adobe Acrobat Reader X: Manual to Verify the Digital Certification of a Document

Adobe Acrobat Reader X: Manual to Verify the Digital Certification of a Document dobe crobat Reader X: Manual de verificación de Certificación Digital de un documento dobe crobat Reader X: Manual to Verify the Digital Certification of a Document Desarrollado por:

Más detalles

ICP FOREST / FUTMON 3rd Meeting of the Heads of the Laboratories

ICP FOREST / FUTMON 3rd Meeting of the Heads of the Laboratories mg/l Water Ring Test 2011 Range Na K Mg Ca 0 20 0 10 0 10 0-20 Spain Lab Range 1-20 1-40 1-20 1-40 INIA Lab Only measured ICP Forest samples During more than 15 years Knowledge of the ranges Water samples

Más detalles

Guide to Health Insurance Part II: How to access your benefits and services.

Guide to Health Insurance Part II: How to access your benefits and services. Guide to Health Insurance Part II: How to access your benefits and services. 1. I applied for health insurance, now what? Medi-Cal Applicants If you applied for Medi-Cal it will take up to 45 days to find

Más detalles

Enzyme immunoassay for the quantitative determination of AFP in human serum or plasma

Enzyme immunoassay for the quantitative determination of AFP in human serum or plasma AFP Enzyme immunoassay for the quantitative determination of AFP in human serum or plasma Inmunoensayo enzimático para la determinación cuantitativa de AFP en suero o plasma humano Only for in-vitro diagnostic

Más detalles

Scholarship 2014 Spanish

Scholarship 2014 Spanish 93007 930070 S SUPERVISOR S USE ONLY Scholarship 2014 Spanish 9.30 am Tuesday 25 November 2014 Time allowed: Three hours Total marks: 24 Check that the National Student Number (NSN) on your admission slip

Más detalles

Los bloques DLL (Figura A.1) externos permiten al usuario escribir su propio código y

Los bloques DLL (Figura A.1) externos permiten al usuario escribir su propio código y Apéndice A Bloques DLL Los bloques DLL (Figura A.1) externos permiten al usuario escribir su propio código y programarlo en lenguaje C, compilarlo dentro de un archivo DLL usando el Microsoft C/C++ o el

Más detalles

Some examples. I wash my clothes, I wash the dishes, I wash the car, I wash the windows. I wash my hands, I wash my hair, I wash my face.

Some examples. I wash my clothes, I wash the dishes, I wash the car, I wash the windows. I wash my hands, I wash my hair, I wash my face. Reflexive verbs In this presentation, we are going to look at a special group of verbs called reflexives. Let s start out by thinking of the English verb wash. List several things that you can wash. Some

Más detalles

Pumping, Storing and Transporting Breast Milk for Infants in the NICU

Pumping, Storing and Transporting Breast Milk for Infants in the NICU Pumping, Storing and Transporting Breast Milk for Infants in the NICU Procedure: 1. Wash your hands. 2. Gently massage your breasts. 3. Position the breast shield(s) on your breast(s) and turn on your

Más detalles



Más detalles

KMR SCA-05 Mounting Instructions Instrucción de Montaje Instruções de Montagem 0899.4897

KMR SCA-05 Mounting Instructions Instrucción de Montaje Instruções de Montagem 0899.4897 0899.4897 KMR SCA-05 Mounting Instructions Instrucción de Montaje Instruções de Montagem 0899.4897 KMR SCA-05 Mounting Instructions Instrucción de Montaje Instruções de Montagem The KMR SCA-05 kit is a

Más detalles



Más detalles



Más detalles



Más detalles


INSTALLATION INSTRUCTIONS Brix Ratio Check Instructions for ColdFusion and Flavor Overload Units INSTALLATION INSTRUCTIONS Brix Ratio Check Instructions For Coldfusion, Flavorfusion and Flavor Overload Units Kit P/N 629096865 SAFETY

Más detalles

iclef-2002 at Universities of Alicante and Jaen University of Alicante (Spain)

iclef-2002 at Universities of Alicante and Jaen University of Alicante (Spain) iclef-2002 at Universities of Alicante and Jaen University of Alicante (Spain) ! Introduction! Passage Retrieval Systems! IR-n system! IR-n system at iclef-2002! Conclusions and Future works ! Introduction!

Más detalles


ROCK N STEREO SOUND DESK Read and save these instructions ROCK N STEREO SOUND DESK RTA-M1102-BK INSTRUCTIONS TABLE OF CONTENTS PACKAGE INCLUDES Package Includes... 2 Specifications... 2 Product Parts List... 3 1 2 3 Product Details...

Más detalles

Enzyme immunoassay for the quantitative determination of Cortisol in human serum or plasma

Enzyme immunoassay for the quantitative determination of Cortisol in human serum or plasma Cortisol Enzyme immunoassay for the quantitative determination of Cortisol in human serum or plasma Inmunoensayo enzimático para la determinación cuantitativa de Cortisol en suero o plasma humano Only

Más detalles

ACCESS for ELLs, a Test of English Proficiency. El ACCESS de los estudiantes ELL, una prueba de conocimientos de inglés

ACCESS for ELLs, a Test of English Proficiency. El ACCESS de los estudiantes ELL, una prueba de conocimientos de inglés ACCESS for ELLs, a Test of English Proficiency El ACCESS de los estudiantes ELL, una prueba de conocimientos de inglés The ACCESS for ELLs Test This test: ê shows how well your child is learning English;

Más detalles

medac Asparaginase-Aktivitäts-Test MAAT Castellano 550-VPS/010512

medac Asparaginase-Aktivitäts-Test MAAT Castellano 550-VPS/010512 medac Asparaginase-Aktivitäts-Test MAAT Castellano 550-VPS/010512 FABRICANTE medac Gesellschaft für klinische Spezialpräparate mbh Fehlandtstraße 3 D-20354 Hamburg DISTRIBUIDOR medac Gesellschaft für klinische

Más detalles

Efecto de las nubes magnéticas sobre la propagación de los rayos cósmicos

Efecto de las nubes magnéticas sobre la propagación de los rayos cósmicos Efecto de las nubes magnéticas sobre la propagación de los rayos cósmicos J.J. Blanco, M.A. Hidalgo, J. Rodríguez-Pacheco, J. Medina y D. Arrazola Space Research Group, Universidad de Alcalá (Spain) Helios

Más detalles

TABLET or CAPSULE Medication Dosage Form:

TABLET or CAPSULE Medication Dosage Form: A Community Service Project of Southwest Georgia Public Health District 8/2 Pharmacy Program 1710 S. Slappey Blvd. P.O. Box Albany, GA 31706-3048 ENGLISH to SPANISH PRESCRIPTION CONVERSION CHART Section

Más detalles

Enzyme immunoassay for the quantitative determination of IgE in human serum or plasma

Enzyme immunoassay for the quantitative determination of IgE in human serum or plasma IgE Enzyme immunoassay for the quantitative determination of IgE in human serum or plasma Inmunoensayo enzimático para la determinación cuantitativa de IgE en suero o plasma humano Only for in-vitro diagnostic

Más detalles

Our microorganisms that initiate fermentation ensure a homogeneous final product, less time to initiate the process and a fewer unwanted alterations.

Our microorganisms that initiate fermentation ensure a homogeneous final product, less time to initiate the process and a fewer unwanted alterations. Nuestros microorganismos iniciadores de la fermentación, garantizan una homogeneidad en el acabado, un menor plazo de inicio del proceso y una reducción de las alteraciones indeseadas. Our microorganisms

Más detalles

ID. Number: 40-01 Su Seguridad y Salud al Soldar o Cortar / Your Safety and Health When Welding or Cutting

ID. Number: 40-01 Su Seguridad y Salud al Soldar o Cortar / Your Safety and Health When Welding or Cutting CATEGORIA 40 SOLDADURA/WELDING ID. Number: 40-01 Su Seguridad y Salud al Soldar o Cortar / Your Safety and Health When Welding or Cutting Produced: Publication date: Literacy level: Appropriate for: OHSP

Más detalles

A W. Product Label Identification. Etiqueta de identificación del producto. Andersen

A W. Product Label Identification. Etiqueta de identificación del producto. Andersen Product Label Identification Etiqueta de identificación for Andersen Windows and Patio Doors para puertas para patio y ventanas de Andersen Use this document to locate product identification () of your

Más detalles

General Certificate of Education Advanced Subsidiary Examination January 2013

General Certificate of Education Advanced Subsidiary Examination January 2013 General Certificate of Education Advanced Subsidiary Examination January 2013 Spanish SPA2T Unit 2 Speaking Test Examiner s Material To be conducted by the teacher examiner between 2 January and 20 January

Más detalles

Speak Up! In Spanish. Young s Language Consulting. Young's Language Consulting. Lesson 1 Meeting and Greeting People.

Speak Up! In Spanish. Young s Language Consulting. Young's Language Consulting. Lesson 1 Meeting and Greeting People. Buenos días Good morning Buenos días Good afternoon Buenas tardes Good evening Buenas tardes Good night Buenas noches Sir Señor Ma am/mrs. Señora Miss Señorita Buenas tardes Culture Note: When greeting

Más detalles

Influencia de la temperatura en el teñido de fibras proteínicas (queratina) con hojas de nogal


Más detalles

Bow Window without Head and Seat Boards Ventana panorámica en curva sin cabeceras ni bases

Bow Window without Head and Seat Boards Ventana panorámica en curva sin cabeceras ni bases Bow Window Rough Opening Sizes Tamaños de abertura no acabada de la ventana panorámica en curva for ndersen Casement CR, CN, C, CW, CX & CXW Windows para ventanas batientes ndersen CR, CN, C, CW, CX y

Más detalles

FOLLMANN. Excelente sistema de tintas en base agua Excellent water-based colour systems

FOLLMANN. Excelente sistema de tintas en base agua Excellent water-based colour systems FOLLMANN. Excelente sistema de tintas en base agua Excellent water-based colour systems Información del producto Tintas para la impresión de envases flexibles Product Information Packaging Printing Inks

Más detalles

Qué viva la Gráfica de Cien!

Qué viva la Gráfica de Cien! Qué viva la Gráfica de Cien! La gráfica de cien consiste en números del 1 al 100 ordenados en cuadrilones de diez números en hileras. El resultado es que los estudiantes que utilizan estás gráficas pueden

Más detalles

Dispositivos Lab-on-a-chip y ópticos para mediciones distribuidas con aplicaciones en biomedicina.

Dispositivos Lab-on-a-chip y ópticos para mediciones distribuidas con aplicaciones en biomedicina. UNIVERSIDAD NACIONAL DE INGENIERÍA FACULTAD DE CIENCIAS Sección de Posgrado y Segunda Especialización Profesional Dispositivos Lab-on-a-chip y ópticos para mediciones distribuidas con aplicaciones en biomedicina.

Más detalles

Nueva confirmación de pedido de compra con cambios: proveedor ES

Nueva confirmación de pedido de compra con cambios: proveedor ES Ayuda de trabajo Nueva confirmación de pedido de compra con cambios: proveedor ES Step 1. This Supplier portal activity lists the steps necessary for confirming a new purchase order with changes on price,

Más detalles


DUAL IMMERSION PROGRAM INFORMATION PRESCHOOL PRESENTATION SEPTEMBER 10, 2014 6:30 P.M. DUAL IMMERSION PROGRAM INFORMATION PRESCHOOL PRESENTATION SEPTEMBER 10, 2014 6:30 P.M. Presented by Dr. Norma R. Delgado, Director of Curriculum & Instruction 1 The United States Government has identified

Más detalles

Control Estadístico de Parámetros de Calidad de la Yerba Mate Elaborada

Control Estadístico de Parámetros de Calidad de la Yerba Mate Elaborada Control Estadístico de Parámetros de Calidad de la Yerba Mate Elaborada WONIATCZUK, Mariela I.; ZIELKE, Liliana E; KOTIK, Adrián y SCHMALKO, Miguel E. Centro de Investigación y Desarrollo Tecnológico (CIDeT)

Más detalles

Universidad Tecnológica de Panamá Centro de Investigaciones Hidráulicas e Hidrotécnicas Laboratorio de Sistemas Ambientales

Universidad Tecnológica de Panamá Centro de Investigaciones Hidráulicas e Hidrotécnicas Laboratorio de Sistemas Ambientales Página: 1 de 5 1. Introducción: La prueba de Demanda Química de Oxígeno (DQO) se basa en la oxidación química de la materia orgánica e inorgánica, presente en las muestras de agua, con dicromato de potasio

Más detalles


CONSENT FOR HIV BLOOD TEST i have been informed that a sample of my blood will be obtained and tested to determine the presence of antibodies to human immunodeficiency Virus (hiv), the virus that causes Acquired immune Deficiency

Más detalles

Departamento de Bioquímica y Biología Molecular,

Departamento de Bioquímica y Biología Molecular, 18. Inmunoanálisis Aurora Galván Cejudo 1, Isaac Túnez Fiñana 2 Departamento de Bioquímica y Biología Molecular, 1 Campus Universitario de Rabanales, Edificio Severo Ochoa, 14071-Córdoba, 2 Facultad de

Más detalles