3/22/2010. Iván Ferrer Rodríguez, PhD Catedrático. En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR.

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamaño: px
Comenzar la demostración a partir de la página:

Download "3/22/2010. Iván Ferrer Rodríguez, PhD Catedrático. En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR."

Transcripción

1 Iván Ferrer Rodríguez, PhD Catedrático En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR. Síntesis "in vitro" de secuencias específicas de ADN son amplificadas. Se basa en la replicación del ADN en los organismos eucariotas realizada por la polimerasa de ADN. Síntesis de una cadena complementaria de ADN 5 3 usando un molde de cadena sencilla, pero a partir de una región de doble cadena. 2 Para crear la región doble cadena se usan los denominados iniciadores (primers). Son una pareja de oligonucleótidos sintetizados de manera que sean complementarios a cada uno de los extremos 3 del fragmento de DNA que se desea amplificar. Partiendo de este principio, la reacción en Cadena de la Polimerasa se basa en la repetición de un ciclo formado por tres etapas: Desnaturalización del ADN doble cadena Hibridación de los iniciadores a cada una de las hebras Extensión por actuación de la polimerasa de ADN 3 1

2 Integridad del ADN Extracción No debe haber agentes quelantes (EDTA) que secuestren Mg No debe haber factores sanguíneos, fenol ni detergentes Cantidad Mínimo: ng Máximo: ng 4 Programas computarizados: DNAsis, Primer3 El contenido en G + C debe ser aproximadamente del 50% La relación máxima de purinas/pirimidinas será 60%/40% Deben evitarse zonas con secuencias largas de una sola base No seleccionar extremo 3 con estructura secundaria Últimas bases G o C 5 Se debe evitar la complementariedad entre los iniciadores para que NO se formen dímeros Tamaño de pb Temperatura de hibridación similar en ambos, generalmente entre los C. En la práctica, la temperatura de hibridación debe ser aproximadamente 2º menor que la temperatura calculada 6 2

3 Existen diferentes tipos de polimerasa de ADN que llevan a cabo la replicación del ADN Termolábiles: óptima 37-42ºC C, se desnaturalizan con calor Termoestables: óptima de 74 ºC, resiste a 96ºC durante ciclos 7 Inicialmente se usó Klenow Posee actividad 3 5 exonucleasa, proporciona capacidad de cambiar el nucleótido que ha sido erróneamente incorporado Aumenta la fidelidad de la replicación del ADN original Es una enzima termolábil Actualmente se utiliza es la Taq polimerasa Enzima termoestable aislada de Termus aquaticus (Taq) Soporta altas temperaturas 8 No usar un alto número de ciclos, ya que la tasa de error es proporcional al número de estos Normalmente el número de ciclos utilizado es de (hasta 35) La concentración de los deoxinucleótidos (dntps) debe ser igual para los 4 y debe ser la más baja posible que nos permita conseguir la cantidad de ADN necesaria Disminuir en lo posible el tiempo de cada etapa Concentración de Mg ++ entre 0.50 y 2.5 mm Exceso hace que disminuya la especificidad de la PCR 9 3

4 Deoxinucleótidos trifosfato (dntps) - datp, dgtp, dctp, dttp Concentraciones iguales, entre los pmol Se aconseja (Bradley, 1991) que la concentración de Mg ++ sea de mm veces superior a de dntps mm tris-hcl (ph=8.4 a Tª ambiente), 50 mm KCl, 0.1% w/v gelatina y 1.5 mm MgCl2 Algunos autores recomiendan el uso de adyuvantes, aumentan la especificidad y fidelidad de la reacción Dimetilsulfóxido (DMSO) al 10% contribuye a la disminución de la estructura secundaria del ADN (Anderson, 1990) Detergentes como el tween 20, laureth 12 (0.1%) o Tritón x10, que ayudan a estabilizar la enzima 11 Es de gran importancia la concentración de dos cationes que son añadidos en forma de sales Cloruro potásico (KCl) influye en la desnaturalización del ADN Cloruro de magnesio (MgCl2) aumenta la temperatura de hibridación del ADN, fundamental para la optimización de la reacción 12 4

5 Tres etapas que constituyen un ciclo, que repite durante un número determinado de veces Se modifican para optimizar la reacción Las primeras reacciones se realizaban manualmente, cambiando los tubos de un baño María a otro a diferente temperatura El proceso resultaba demasiado tedioso y era difícil alcanzar las temperaturas y los tiempos correctos, por lo que se desarrolló el termociclador que lo hacía de manera automática 13 Desnaturalización Es muy importante que el ADN molde se desnaturalice completamente Se recomiendan temperaturas de 94ºC durante30-60 segundos. Equipos eficientes requieren menos tiempo. En la práctica se suele añadir un período de desnaturalización antes de comenzar los ciclos para asegurarnos que se produce a lo largo de toda la muestra de ADN Esta etapa suele ser de 5 a 94ºC. 14 Hibridación de los iniciadores La temperatura y el tiempo van a depender de 3 factores relacionados con los oligonucleótidos: Composición de bases Tamaño Concentración En la práctica, puede oscilar entre 45ºC y 65ºC, durante un tiempo comprendido entre segundos Un aumento de temperatura favorece la especificidad ya que disminuye las uniones incorrectas de los iniciadores con la hebra molde 15 5

6 Extensión En la mayoría de las reacciones, la etapa de extensión se realiza a 72ºC Teóricamente esta temperatura puede variar entre 70-72ºC72 C. El tiempo de extensión depende del tamaño de la amplificación Se puede estimar un tiempo de un minuto para sintetizar 1,000 bases En la práctica es normal que al final de todos los ciclos se realice una última elongación de 5 a 72ºC. 16 Este número depende de la cantidad de ADN que existe en la muestra una vez que el resto de factores han sido optimizados Es importante no realizar un número alto de ciclos ya que puede dar lugar a la amplificación de productos no deseados originados por hibridaciones no específicas Después de un número determinado de ciclos la amplificación deja producirse de manera exponencial y llega a una fase estacionaria Normalmente el número de ciclos utilizado es de (hasta 35) 17 La Reacción en Cadena de la Polimerasa es una técnica muy sensible, por lo que es de gran importancia evitar contaminaciones Existen una serie de normas que ayudan a evitar las contaminaciones Lugar físico exclusivo para realizar la PCR Uso de instrumental exclusivo para la PCR Utilización de reactivos y tubos estériles Uso de guantes Controles blanco 18 6

7

P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA"

P.C.R. Técnica de amplificación enzimática de secuencias específicas de DNA P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA" Paso 1: Desnaturalización del DNA Paso 2: Hibridación de los "Primers" Paso 3: Extensión Paso 1: Desnaturalización del DNA

Más detalles

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now.

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now. Unidad Curricular: Virología y Micología Veterinaria 1 TRABAJO PRÁCTICO No. 3 AMPLIFICACIÓN DE GENES VIRALES Reacción en Cadena de la Polimerasa, conocida como PCR (por sus siglas en inglés: Polimerase

Más detalles

Reacción en cadena de la polymerasa (PCR)

Reacción en cadena de la polymerasa (PCR) Reacción en cadena de la polymerasa (PCR) 1 PCR Que es? Es una técnica in vitro diseñada para amplificar una región específica de DNA. Es extremadamente sensible, con la capacidad de amplificar millones

Más detalles

PCR. Técnica inventada por Kary Mullis :1987. Premio Nobel 1993. Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN

PCR. Técnica inventada por Kary Mullis :1987. Premio Nobel 1993. Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN PCR PCR Técnica inventada por Kary Mullis :1987 Premio Nobel 1993 Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN Aprovecha los requerimientos de la replicación Templete ADN Nucleótidos

Más detalles

Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez

Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez 1 Objetivos Entender la técnica: Reacción de Polimerasa en Cadena (PCR por sus siglas en inglés)

Más detalles

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS Prácticas docentes en la COD: 10-71 APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS FUNDAMENTO TEÓRICO La PCR es una técnica que permite llevar a cabo la síntesis in vitro de fragmentos de ADN. Está basada

Más detalles

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR Módulo 1 Amplificación de un fragmento de ADN genómico por PCR En este primer módulo se amplificará por PCR, mediante el uso de oligonucleótidos específicos, un fragmento de ADN genómico de Aspergillus

Más detalles

Reacción en cadena de la Polimerasa (PCR)

Reacción en cadena de la Polimerasa (PCR) Explicación de TP Nº 2 Reacción en cadena de la Polimerasa (PCR) Química Biológica Patológica Dra. Mariana L. Ferramola Dra. Gabriela Lacoste 2015 Definición de PCR Es la amplificación enzimática de un

Más detalles

FACULTAD REGIONAL ROSARIO

FACULTAD REGIONAL ROSARIO FACULTAD REGIONAL ROSARIO CATEDRA BIOTECNOLOGIA ROFESOR: Ing. Eduardo Santambrosio JTP: Ing. Marta Ortega AUX 1ª : Ing. Pablo Garibaldi PCR (Polymerase chain reaction) Reacción en cadena de la polimerasa

Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica TÉCNICAS GENÓMICAS Utilidad/Objetivos: 1) Detección de microorganismos directamente en muestras clínicas identificando un fragmento específico del genoma del microorganismo concreto 2) Cuantificación del

Más detalles

PROBLEMAS MAS FRECUENTES DURANTE LA SECUENCIACIÓN NO SE PRODUCE REACCION O ESTA DECAE POCO DESPUÉS DE COMENZAR

PROBLEMAS MAS FRECUENTES DURANTE LA SECUENCIACIÓN NO SE PRODUCE REACCION O ESTA DECAE POCO DESPUÉS DE COMENZAR PROBLEMAS MAS FRECUENTES DURANTE LA SECUENCIACIÓN NO SE PRODUCE REACCION O ESTA DECAE POCO DESPUÉS DE COMENZAR Las causas pueden ser las siguientes: No hay ADN o se encuentra en muy baja concentración.

Más detalles

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa?

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa? 2º BIOQUÍMICA CUESTIONES 1. Por qué la PCR convencional no es cuantitativa? En la PCR convencional, la cuantificación del ADN de la muestra es complicada debido a que la eficacia de amplificación va disminuyendo

Más detalles

Reacción en cadena de la polimerasa (PCR)

Reacción en cadena de la polimerasa (PCR) Dr. Alejandro Leal Reacción en cadena de la polimerasa (PCR) La reacción en cadena de la polimerasa (PCR, por sus siglas en inglés de "polymerase chain reaction") es un método de amplificación in vitro

Más detalles

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles

DETERMINACIÓN DEL FACTOR Rh por PCR

DETERMINACIÓN DEL FACTOR Rh por PCR Ref.PCRRh DETERMINACIÓN DEL FACTOR Rh por PCR 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR)

MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) OBJETIVOS - Definir PCR, conocer los reactivos que

Más detalles

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml)

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml) PCR SIMULADA Ref.PCR Simulada (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

Fundamento de la Reacción en Cadena de la Polimerasa (PCR)

Fundamento de la Reacción en Cadena de la Polimerasa (PCR) Fundamento de la Reacción en Cadena de la Polimerasa (PCR) Eva Mas, Julio Poza, Jesús Ciriza, Pilar Zaragoza, Rosario Osta y Clementina Rodellar. Laboratorio de Genética, Bioquímica y Grupos Sanguíneos.

Más detalles

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante BIOTECNOLOGÍA 1.- Ingeniería Genética, ADN recombinante Técnica del ADN recombinante: es la más usada en ingeniería genética, esta basada en el uso de las enzimas de restricción o endonucleasas de restricción

Más detalles

Tecnologías basadas en la PCR

Tecnologías basadas en la PCR Tecnologías de marcadores moleculares para estudios de diversidad genética de plantas: Módulo de aprendizaje Tecnologías basadas en el ADN Tecnologías basadas en la PCR Fundamentos de la PCR Derechos de

Más detalles

Materiales para la secuenciación de ADN

Materiales para la secuenciación de ADN Introduccion La Secuenciación Sanger es un método de secuenciación de ADN en el que el ADN diana se desnaturaliza y se hibrida con un cebador de oligonucleótidos, que se extiende entonces gracias a la

Más detalles

CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA. Grado en Medicina

CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA. Grado en Medicina DEPARTAMENTO DE BIOQUÍMICA Y BIOLOGÍA MOLECULAR III FACULTAD DE MEDICINA UNIVERSIDAD COMPLUTENSE DE MADRID CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA Grado en Medicina CURSO ACADÉMICO 2014/2015 INDICE

Más detalles

Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón

Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón Reacción en Cadena de la INTRODUCCION: Polimerasa (RCP) Década de los 70: Grandes

Más detalles

GUÍA PARA LA SECUENCIACIÓN AUTOMÁTICA DE DNA

GUÍA PARA LA SECUENCIACIÓN AUTOMÁTICA DE DNA Página 1 de 16 GUÍA PARA LA SECUENCIACIÓN AUTOMÁTICA DE DNA SERVICIO DE SECUENCIACIÓN-S.C.S.I.E. UNIVERSITAT DE VALÈNCIA Página 2 de 16 CONTENIDOS: 1.- Secuenciación automática de DNA 2.- Tipos de molde

Más detalles

PROBLEMAS MÁS FRECUENTES Y POSIBLES SOLUCIONES

PROBLEMAS MÁS FRECUENTES Y POSIBLES SOLUCIONES PROBLEMAS MÁS FRECUENTES Y POSIBLES SOLUCIONES NO SE PRODUCE REACCIÓN O ÉSTA DECAE POCO DESPUÉS DE COMENZAR No hay ADN o hay menos del necesario No hay cebador o la concentración es inferior a la necesaria.

Más detalles

Química Biológica Patológica Técnicas de Biología Molecular aplicadas a Bioquímica Clínica Tema 2 Dra. Silvia Varas qbpatologica.unsl@gmail.com Tema 2 PCR Historia Bases Optimización de una reacción de

Más detalles

Tipos de Muestras. Técnicas de Biología Molecular. Extracción de ácidos nucleicos. Extracción de DNA genómico. Muestra de sangre en papel filtro

Tipos de Muestras. Técnicas de Biología Molecular. Extracción de ácidos nucleicos. Extracción de DNA genómico. Muestra de sangre en papel filtro Técnicas de Biología Molecular Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO 2004 Tipos de Muestras Extracción de ácidos nucleicos o DNA o RNA Sangre total (EDTA) Saliva Líquido Amniótico Bulbo

Más detalles

Técnicas moleculares.

Técnicas moleculares. Técnicas moleculares. DMTV Carolina Acevedo Curso de Microbiología 2015 SÍNTESIS IN VITRO DE UNA GRAN CANTIDAD DE COPIAS DE UN SEGMENTO DE ADN EXISTENTE EN UNA MUESTRA. O sea. Amplificamos en forma exponencial

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

Técnicas de Biología Molecular. Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO

Técnicas de Biología Molecular. Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO Técnicas de Biología Molecular Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO 2004 Extracción de ácidos nucleicos o o DNA RNA Tipos de Muestras Sangre total (EDTA) Saliva Líquido Amniótico Bulbo

Más detalles

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática.

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Departamento de Bioquímica Médica y Biología Molecular Práctica 3 Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Curso 1 Medicina (Abril) 2012 BIOQUÍMICA

Más detalles

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada La PCR La Reacción en Cadena de la Polimerasa es la herramienta más utilizada PCR- Ventajas y Usos Amplificación ilimitada de secuencias de interés. Rápida, Sencilla y Eficaz. Técnica altamente sensible

Más detalles

N 1 Reacción n en Cadena de la Polimerasa

N 1 Reacción n en Cadena de la Polimerasa Trabajo Práctico N 1 Reacción n en Cadena de la Polimerasa Definición n e importancia. Usos y aplicaciones. Optimización. Tipos de PCR. Electroforesis. Fundamentos. Asociado al Programa Teórico: Tema 2.

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles

Polymerase Chain Reaction (PCR)

Polymerase Chain Reaction (PCR) Polymerase Chain Reaction (PCR) Un poco de historia La técnica de PCR fue inventada por Kary B. Mullis en 1983. La primer publicación sobre PCR apareció en 1985, aunque el principio básico de replicar

Más detalles

PCR. Qué es la PCR? T a de fusión de oligonucleótidos (t m )

PCR. Qué es la PCR? T a de fusión de oligonucleótidos (t m ) % a de fusión de oligonucleótidos (t m ) Qué es la PCR? La reacción en cadena de la polimerasa (PCR: polymerase chain reaction) es una técnica de amplificación de secuencias de DNA in vitro t m = 2 (A

Más detalles

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082 Página 1 de 5 1. OBJETIVO Detectar la presencia de Campylobacter jejuni en hamburguesa de pollo mediante técnica de PCR. 2. CAMPO DE APLICACIÓN Y ALCANCE Aplicar este procedimiento a muestras de hamburguesa

Más detalles

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN 5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN Materiales - Eppendorf de 1,5 ml estériles - Eppendorf de pared fina para PCR - Puntas de pipeta estériles desechables - Guantes

Más detalles

PROCEDIMIENTO PARA LA UTILIZACIÓN DEL POLIMORFISMO DEL GEN COMT (CATECOL-OXI-METILTRANSFERASA) EN EL DIAGNÓSTICO DEL SÍNDROME DE FIBROMIALGIA

PROCEDIMIENTO PARA LA UTILIZACIÓN DEL POLIMORFISMO DEL GEN COMT (CATECOL-OXI-METILTRANSFERASA) EN EL DIAGNÓSTICO DEL SÍNDROME DE FIBROMIALGIA 2 PROCEDIMIENTO PARA LA UTILIZACIÓN DEL POLIMORFISMO DEL GEN COMT (CATECOL-OXI-METILTRANSFERASA) EN EL DIAGNÓSTICO DEL SÍNDROME DE FIBROMIALGIA D E S C R I P C I Ó N OBJETO DE LA INVENCIÓN La presente

Más detalles

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR)

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) Centro de de Microscopía Electrónica Facultad de de Ciencias Médicas Universidad Nacional de de Córdoba

Más detalles

Investigación en genes. Tecnología del ADN recombinante

Investigación en genes. Tecnología del ADN recombinante Investigación en genes Tecnología del ADN recombinante Tecnología del ADN recombinante 1º parte: Conocimientos básicos que posibilitaron su desarrollo 2º parte: Instrumentos básicos 3º parte Ejemplos Conocimientos

Más detalles

Introducción al diseño de primers

Introducción al diseño de primers Introducción al diseño de primers INTRODUCCIÓN Esta guía es una breve aproximación al diseño de primers, utilizando programas bioinformáticos y pretende dar una orientación a aquellas personas que están

Más detalles

Criterios para diseñar primers. Iván Ferrer Rodríguez, Ph.D. Catedrático

Criterios para diseñar primers. Iván Ferrer Rodríguez, Ph.D. Catedrático Criterios para diseñar primers Iván Ferrer Rodríguez, Ph.D. Catedrático 1 Qué es un primer? Es una cadena corta de nucleótidos, un oligonucleótido. Sirve como punto de partida para la replicación del DNA.

Más detalles

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

Reacción en cadena de la Polimerasa (PCR)

Reacción en cadena de la Polimerasa (PCR) Explicación de TP Nº 3 Reacción en cadena de la Polimerasa (PCR) Química Biológica Patológica Bioq. Mariana L. Ferramola 2013 Definición de PCR Es la amplificación enzimática de un fragmento de interés

Más detalles

FUNDAMENTOS DE LA TÉCNICA PCR

FUNDAMENTOS DE LA TÉCNICA PCR FUNDAMENTOS DE LA TÉCNICA PCR 1 2 PCR Qué es? REACCIÓN EN CADENA DE LA POLIMERASA Técnica que nos permite amplificar selectivamente un segmento específico de DNA, hasta obtener una cantidad suficiente

Más detalles

Técnica de PCR. Beatriz Bellosillo. Servei de Patologia, Hospital del Mar, Barcelona, Spain

Técnica de PCR. Beatriz Bellosillo. Servei de Patologia, Hospital del Mar, Barcelona, Spain Técnica de PCR Beatriz Bellosillo Servei de Patologia, Hospital del Mar, Barcelona, Spain Biología Molecular Estudio de los procesos que se desarrollan en los seres vivos desde un punto de vista molecular

Más detalles

Reacción en cadena de la Polimerasa (PCR)

Reacción en cadena de la Polimerasa (PCR) Explicación de TP Nº 2 Reacción en cadena de la Polimerasa (PCR) Química Biológica Patológica Bioq. Mariana L. Ferramola 2014 Definición de PCR Es la amplificación enzimática de un fragmento de interés

Más detalles

Análisis de la Presencia de Organismos Genéticamente Modificados en Muestras de Alimentos

Análisis de la Presencia de Organismos Genéticamente Modificados en Muestras de Alimentos Análisis de la Presencia de Organismos Genéticamente Modificados en Muestras de Alimentos Sesión nº 6 Reacción en Cadena de la Polimerasa (PCR) M. Somma, M. Querci WORLD HEALTH ORGANIZATION REGIONAL OFFICE

Más detalles

CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL

CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL LIBRO DE MEMORIAS 2 CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL Santiago de Cali, 23 al 28 de agosto de 2010 3 Libro de memorias

Más detalles

Técnicas de ADN recombinante: la manipulación genética

Técnicas de ADN recombinante: la manipulación genética Técnicas de ADN recombinante: la manipulación genética A partir de los años 70 se desarrollaron las herramientas de la biología molecular o la ingeniería genética o lo que se ha llamado técnicas del ADN

Más detalles

TEMA 7. TÉCNICAS EN BIOLOGÍA MOLECULAR: DETECCIÓN E IDENTIFICACIÓN DE MICROORGANISMOS

TEMA 7. TÉCNICAS EN BIOLOGÍA MOLECULAR: DETECCIÓN E IDENTIFICACIÓN DE MICROORGANISMOS TEMA 7. TÉCNICAS EN BIOLOGÍA MOLECULAR: DETECCIÓN E IDENTIFICACIÓN DE MICROORGANISMOS I. TÉCNICAS EN BIOLOGÍA MOLECULAR: ESQUEMA DE TÉCNICAS UTILIZADAS 1. TECNICAS DE HIBRIDACIÓN CON SONDAS DE ACIDOS NUCLEICOS.

Más detalles

Práctico: Genética bacteriana 2007.

Práctico: Genética bacteriana 2007. Práctico: Genética bacteriana 2007. Actividad integrada Departamento de Genética Departamento de Bacteriología y Virología. OBJETIVOS Objetivos generales El estudiante al terminar la actividad práctica

Más detalles

Genética molecular (I)

Genética molecular (I) Genética molecular (I) EXPERIMENTO DE GRIFFITH (1928) Vídeo En las bacterias virulentas S muertas había algo capaz de transformar a las bacterias R, inocuas, en bacterias virulentas S. Ese algo, llamado

Más detalles

CAPÍTULO VI. Expresión de genes relacionados con apoptosis

CAPÍTULO VI. Expresión de genes relacionados con apoptosis CAPÍTULO VI Expresión de genes relacionados con apoptosis 1.- Introducción 2.- Protocolos para análisis genéticos 3.- Resultados en MCF-7 4.- Discusión 1.- Introducción Como se ha descrito anteriormente,

Más detalles

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri OBJETIVO Desarrollar un banco de datos a partir de plantas de origen indudable y del uso

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. info@atgen.com.uy www.atgen.com.uy

Más detalles

Índice. 4. Protocolo de envío de muestras 9 5. Problemas más frecuentes durante la secuenciación 10 6. Algunos datos y formulas de utilidad 17

Índice. 4. Protocolo de envío de muestras 9 5. Problemas más frecuentes durante la secuenciación 10 6. Algunos datos y formulas de utilidad 17 Índice Introducción 1 1. Modalidades de secuenciación 2 a. Secuenciación de una sola cadena 2 b. Secuenciación analítica 3 c. Secuenciación diagnóstica 3 2. Oligonucleótidos disponibles 5 3. Protocolo

Más detalles

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G.

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G. C825T Sistema para la detección de la mutación C825T en el gene de la proteína G. Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. Info@atgen.com.uy www.atgen.com.uy

Más detalles

Protocolos de secuenciación de ADN

Protocolos de secuenciación de ADN 1 Protocolos de secuenciación de ADN Introducción El método de secuenciación utilizado aquí es el desarrollado por Sanger en 1975. Este consiste en la incorporación de didesixinucleótidos marcados fluorescentemente

Más detalles

PRÁCTICAS DE MICROBIOLOGIA CLINICA

PRÁCTICAS DE MICROBIOLOGIA CLINICA PRÁCTICAS DE MICROBIOLOGIA CLINICA Juan Carlos Rodríguez Hospital General Universitario de Alicante E-mail: rodriguez_juadia@gva.es http://microbiologia-alicante.umh.es CASO CLINICO: Rubéola Evolución

Más detalles

Bases Moleculares. Efrén Santos

Bases Moleculares. Efrén Santos Bases Moleculares Efrén Santos ADN, ARN, proteínas ADN, contiene la información genética ARN, muy similar al ADN. (1) Copia temporal del ADN (2) Parte funcional y estructural del aparato traductor Proteinas,

Más detalles

REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Microbiología de los Alimentos Ingeniería en alimentos

REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Microbiología de los Alimentos Ingeniería en alimentos REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Microbiología de los Alimentos Ingeniería en alimentos 2015 Desarrollada por Kary Mullis en 1986 Técnica in vitro que permite amplificar enzimáticamente una región

Más detalles

versus PCR en Tiempo Real PCR convencional no es cuantitativo

versus PCR en Tiempo Real PCR convencional no es cuantitativo PCR convencional o PCR de punto final versus PCR en Tiempo Real PCR convencional no es cuantitativo S Lobos C - U de Chile 1 PCR clásico La cantidad de producto no está relacionada con la cantidad de DNA

Más detalles

La Biotecnología como Tema de Integración Curricular y su Relevancia en el Desarrollo de las Destrezas del Pensamiento

La Biotecnología como Tema de Integración Curricular y su Relevancia en el Desarrollo de las Destrezas del Pensamiento La Biotecnología como Tema de Integración Curricular y su Relevancia en el Desarrollo de las Destrezas del Pensamiento Gerardo Arroyo Cruzado, Ph.D. Departamento de Ciencias Biológicas, Facultad de Ciencias

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

Caracteristicas del ADN. Se rompen con las siguientes condiciones -Temperaturas >90 - ph >10.5

Caracteristicas del ADN. Se rompen con las siguientes condiciones -Temperaturas >90 - ph >10.5 PCR Caracteristicas del ADN Se rompen con las siguientes condiciones -Temperaturas >90 C - ph >10.5 Baja astringencia tiene uniones parciales o imperfectas. Renaturalización Dependiendo de: -Contenido

Más detalles

Miguel Dita (1) Einar Martínez de la Parte (2) Monica Blanco (3)

Miguel Dita (1) Einar Martínez de la Parte (2) Monica Blanco (3) Generalidades de la PCR: MÉTODO DE DIAGNÓSTICO MOLECULAR DE Foc RT4 Miguel Dita (1) Einar Martínez de la Parte (2) Monica Blanco (3) 1) Bioversity International, Costa Rica 2) INISAV Cuba. 3) Universidad

Más detalles

Tipos de Muestras. Técnicas de Biología Molecular. Extracción de ácidos nucleicos. Extracción de DNA genómico. Muestra de sangre en papel filtro

Tipos de Muestras. Técnicas de Biología Molecular. Extracción de ácidos nucleicos. Extracción de DNA genómico. Muestra de sangre en papel filtro Técnicas de Biología Molecular Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO 2004 Tipos de Muestras Extracción de ácidos nucleicos o DNA o RNA Sangre total (EDTA) Saliva Líquido Amniótico Bulbo

Más detalles

SECUENCIACIÓN SANGER DE ADN: GUÍA DE SOLUCIONES TÉCNICAS

SECUENCIACIÓN SANGER DE ADN: GUÍA DE SOLUCIONES TÉCNICAS SECUENCIACIÓN SANGER DE ADN: GUÍA DE SOLUCIONES TÉCNICAS Secugen recomienda que para la visualización de las secuencias se usen programas que permitan ver el dato crudo, ya que a partir de ese dato se

Más detalles

REACCIÓN EN CADENA DE LA POLIMERASA (PCR)

REACCIÓN EN CADENA DE LA POLIMERASA (PCR) REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Microbiología General Microbiología M de los Alimentos Licenciatura en Bioquímica i Ingeniería en alimentos c Microbiología r 2015 Licenciatura en Biotecnología

Más detalles

Extracción y purificación de los ácidos nucleicos

Extracción y purificación de los ácidos nucleicos Extracción y purificación de los ácidos nucleicos Todos los tipos de macromoléculas biológicas tienen una característica en común que va a permitir el desarrollo de un método de separación especifico para

Más detalles

CONCLUSIONES. Conclusiones CONCLUSIONES METODOLÓGICAS. Diseño experimental

CONCLUSIONES. Conclusiones CONCLUSIONES METODOLÓGICAS. Diseño experimental Conclusiones Conclusiones CONCLUSIONES CONCLUSIONES METODOLÓGICAS Diseño experimental 1. Los protocolos experimentales de extracción, amplificación y secuenciación de DNA antiguo deben adecuarse a la

Más detalles

Practica la genética Ficha didáctica del profesorado Bachillerato

Practica la genética Ficha didáctica del profesorado Bachillerato Ficha didáctica del profesorado Bachillerato www.eurekamuseoa.es Extracción de ADN Cuál es la función de cada uno de los ingredientes utilizados para realizar la disolución tampón para la visualización

Más detalles

BLOQUE I. CUÁL ES LA COMPOSICIÓN DE LOS SERES VIVOS? LAS MOLÉCULAS DE LA VIDA

BLOQUE I. CUÁL ES LA COMPOSICIÓN DE LOS SERES VIVOS? LAS MOLÉCULAS DE LA VIDA I.E.S. Flavio Irnitano El Saucejo (Sevilla) Curso 2.015 2.016 Departamento de Biología y Geología NIVEL: 2º Bachillerato MATERIA: BIOLOGÍA 6.1. Concepto y estructura. BLOQUE I. CUÁL ES LA COMPOSICIÓN DE

Más detalles

El valor energético de los alimentos

El valor energético de los alimentos El valor energético de los alimentos http://www2.uned.es/pea-nutricion-y-dietetica- I/guia/guia_nutricion/el_valor_energetico.htm?ca=n0 El valor energético o valor calórico de un alimento es proporcional

Más detalles

5. MATERIALES Y MÉTODOS

5. MATERIALES Y MÉTODOS 5. MATERIALES Y MÉTODOS 5.1 Equipos Los siguientes termocicladores se emplearon para la amplificación por PCR: - Perkin Elmer, GeneAmp PCR System 2400. - Perkin Elmer, GeneAmp PCR System 9600. - Applied

Más detalles

GUÍA N 1: MATERIAL GENETICO Y REPLICACIÓN DE ADN

GUÍA N 1: MATERIAL GENETICO Y REPLICACIÓN DE ADN SUBSECTOR PROFESOR NIVEL AÑO UNIDAD SEMESTRE Biología Iris Gaete IVº medio Hum 2016 Información Génica y Proteínas I GUÍA N 1 MATERIAL GENETICO Y REPLICACIÓN DE ADN Nombre Curso I. ESTRUCTURA DEL MATERIAL

Más detalles

DESINFECCION DEL AGUA CON CLORO Y CLORAMINAS

DESINFECCION DEL AGUA CON CLORO Y CLORAMINAS DESINFECCION DEL AGUA CON CLORO Y CLORAMINAS INDICE: 1- INTRODUCCION: a. POR QUÉ CLORO Y POR QUÉ CLORAMINAS? b. ELECCION DEL DESINFECTANTE RESIDUAL. 2- CLORAMINAS: a. QUÉ SON? b. QUE TIPO HAY? c. BAJO

Más detalles

Guía de PCR en tiempo real

Guía de PCR en tiempo real Guía de PCR en tiempo real Michelle C. Chirinos-Arias michelle.christine16@gmail.com Índice Introducción. 2 Algunos conceptos. 2 PCR (reacción en cadena de la polimerasa)... 2 PCR en tiempo real (qpcr)..

Más detalles

Secuenciar una molécula de ADN consiste en determinar en qué orden se disponen los cuatro nucleótidos (A, T, C y G) que componen la molécula.

Secuenciar una molécula de ADN consiste en determinar en qué orden se disponen los cuatro nucleótidos (A, T, C y G) que componen la molécula. SECUENCIACIÓN DEL ADN Secuenciar una molécula de ADN consiste en determinar en qué orden se disponen los cuatro nucleótidos (A, T, C y G) que componen la molécula. El primer método diseñado para secuenciar

Más detalles

La división celular. .Interfase

La división celular. .Interfase .Interfase La división celular El conjunto de procesos propios de la interfase hacen posible el mantenimiento o el incremento de las estructuras celulares, lo que conlleva, en principio, un incremento

Más detalles

40. Identificación de clones y fragmentos de ADNc mediante la reacción en cadena de la polimerasa (PCR)

40. Identificación de clones y fragmentos de ADNc mediante la reacción en cadena de la polimerasa (PCR) 40. Identificación de clones y fragmentos de ADNc mediante la reacción en cadena de la polimerasa (PCR) José Luis Caballero Repullo, Enriqueta Moyano Cañete, Juan Muñoz Blanco Departamento de Bioquímica

Más detalles

I. ESTEQUIOMETRÍA. Estas relaciones pueden ser:

I. ESTEQUIOMETRÍA. Estas relaciones pueden ser: I. ESTEQUIOMETRÍA Objetivo: Reconocerá la trascendencia de la determinación de las cantidades de reactivos y productos involucrados en una reacción química valorando la importancia que tiene este tipo

Más detalles

8º CONGRESO IBEROAMERICANO DE INGENIERIA MECANICA Cusco, 23 al 25 de Octubre de 2007

8º CONGRESO IBEROAMERICANO DE INGENIERIA MECANICA Cusco, 23 al 25 de Octubre de 2007 8º CONGRESO IBEROAMERICANO DE INGENIERIA MECANICA Cusco, 23 al 25 de Octubre de 2007 SIMULACIÓN Y ANÁLISIS TÉRMICO DE UN PROTOTIPO DE PORTA MUESTRAS PARA UN TERMOCICLADOR PARA USO EN INGENIERÍA Y BIOLOGÍA

Más detalles

COMPENDIOS INFORMATIVOS TEMA : ELABORACIÓN DE QUESO. La elaboración de quesos constituye una de las principales forma de conservación de la leche.

COMPENDIOS INFORMATIVOS TEMA : ELABORACIÓN DE QUESO. La elaboración de quesos constituye una de las principales forma de conservación de la leche. TEMA : ELABORACIÓN DE QUESO La elaboración de quesos constituye una de las principales forma de conservación de la leche. En Venezuela aproximadamente el 60% de la producción total de leche se destina

Más detalles

Amplificación de ácidos nucleicos in vitro.

Amplificación de ácidos nucleicos in vitro. Amplificación de ácidos nucleicos in vitro. El principal objetivo de las técnicas de amplificación de ácidos nucleicos in vitro, es mejorar la sensibilidad de los test basados en ácidos nucleicos y simplificarlos

Más detalles

CONTROL DE LA ACTIVIDAD CELULAR

CONTROL DE LA ACTIVIDAD CELULAR CONTROL DE LA ACTIVIDAD CELULAR Sumario Las Moléculas de los Seres Vivos Control de la actividad celular 1. Las reacciones celulares básicas 2. El control de las reacciones celulares 3. Los modelos de

Más detalles

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas ELEMENTOS BÁSICOS DE LA INVESTIGACIÓN EN GENES Análisis

Más detalles

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras METODOLOGIA DEL PCR Lic. Jorge Mato Luis Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras Desnaturalización del DNA 5 A G G T T A G T G G A C C C T T G A T 3 3 T C C A

Más detalles

OLIMPÍADA ARGENTINA DE BIOLOGÍA APEB ÁREA DE ACTUALIZACIÓN Y PERFECCIONAMIENTO EN LA ENSEÑANZA DE LA BIOLOGÍA CONTINUIDAD Y CAMBIO DE LAS ESPECIES I:

OLIMPÍADA ARGENTINA DE BIOLOGÍA APEB ÁREA DE ACTUALIZACIÓN Y PERFECCIONAMIENTO EN LA ENSEÑANZA DE LA BIOLOGÍA CONTINUIDAD Y CAMBIO DE LAS ESPECIES I: MINISTERIO DE EDUCACIÓN, CIENCIA Y TECNOLOGIA UNIVERSIDAD NACIONAL DE RIO CUARTO FACULTAD DE CIENCIAS EXACTAS, FÍSICO - QUÍMICAS Y NATURALES DEPARTAMENTO DE CIENCIAS NATURALES OLIMPÍADA ARGENTINA DE BIOLOGÍA

Más detalles

PCR Reacción n en cadena de la polimerasa Martes 16 de mayo

PCR Reacción n en cadena de la polimerasa Martes 16 de mayo IV CURSO AVANZADO WHO GSS 2006 Buenos Aires 15-24 de mayo de 2006 PCR Reacción n en cadena de la polimerasa Martes 16 de mayo Bioq. Elizabeth Miliwebsky Servicio Fisiopatogenia, Departamento Bacteriología

Más detalles

6. PROTEINAS RESPONSABLES DE LA REPLICACION DEL DNA. Verónica González Núñez Universidad de Salamanca

6. PROTEINAS RESPONSABLES DE LA REPLICACION DEL DNA. Verónica González Núñez Universidad de Salamanca 6. PROTEINAS RESPONSABLES DE LA REPLICACION DEL DNA Verónica González Núñez Universidad de Salamanca ESQUEMA. Proteínas responsables de la replicación del DNA 1. Proteínas implicadas en la replicación

Más detalles

Amplificación de Nucleó.dos Reacción en Cadena de la Polimerasa

Amplificación de Nucleó.dos Reacción en Cadena de la Polimerasa Amplificación de Nucleó.dos Reacción en Cadena de la Polimerasa Historia de la PCR Reacción en Cadena de la Polimerasa 1983: Kary Mullis tuvo la idea de PCR mientras trabajaba para Cetus Corpora.on in

Más detalles

CONTAMINACIÓN ACUÁTICA. USOS DEL AGUA: - DOMÉSTICO: Turbidez, sólidos disueltos, coliformes y compuestos tóxicos (metales y pesticidas)

CONTAMINACIÓN ACUÁTICA. USOS DEL AGUA: - DOMÉSTICO: Turbidez, sólidos disueltos, coliformes y compuestos tóxicos (metales y pesticidas) CONTAMINACIÓN ACUÁTICA Calidad de agua Se refiere al uso o actividad a que se destina el agua: potable, uso industrial, recreación, riego, etc. USOS DEL AGUA: - DOMÉSTICO: Turbidez, sólidos disueltos,

Más detalles

LA REACCION EN CADENA DE LA POLIMERASA

LA REACCION EN CADENA DE LA POLIMERASA LA REACCION EN CADENA DE LA POLIMERASA ADN super enrollado Secuencia Blanco Hebra de ADN ADN doble cadena Cromosoma Dra. Cristina Gutiérrez García Lab.. Virología a Molecular INHRR ESTRUCTURA DEL ADN.

Más detalles

GESTIÓN DEL AGUA. Capítulo 1 GESTIÓN DEL AGUA EN LA INDUSTRIA TÉCNICAS AMBIENTALES 1

GESTIÓN DEL AGUA. Capítulo 1 GESTIÓN DEL AGUA EN LA INDUSTRIA TÉCNICAS AMBIENTALES 1 Capítulo 1 GESTIÓN DEL AGUA EN LA INDUSTRIA TÉCNICAS AMBIENTALES 1 1 EL AGUA EN LA INDÚSTRIA 1.1 SITUACIÓN El agua es un recurso fundamental para la actividad industrial, su utilización ha variado a lo

Más detalles

ESCUELA SUPERIOR POLITÉCNICA DEL LITORAL. Facultad de Ingeniería en Mecánica y Ciencias de la Producción

ESCUELA SUPERIOR POLITÉCNICA DEL LITORAL. Facultad de Ingeniería en Mecánica y Ciencias de la Producción ESCUELA SUPERIOR POLITÉCNICA DEL LITORAL Facultad de Ingeniería en Mecánica y Ciencias de la Producción Detección de Salmonella spp. Mediante PCR en Muestras de Embutidos, Cereales y Superficies Inertes

Más detalles