El estudio de dianas terapéuticas en tumores sólidos. Rebeca Martínez

Tamaño: px
Comenzar la demostración a partir de la página:

Download "El estudio de dianas terapéuticas en tumores sólidos. Rebeca Martínez"

Transcripción

1 El estudio de dianas terapéuticas en tumores sólidos Rebeca Martínez

2 Índice 2 Introducción Biomarcadores en cáncer de pulmón Conclusiones

3 Índice 3 Introducción Biomarcadores en cáncer de pulmón Conclusiones

4 Cohorts: Clinical Trials Tumour Registries Tumour board Sampling Radiology Endoscopy 4 Surgery Patient Oncologist Targeted therapies Results Predictive biomarkers QA/QC Diagnosis IHC I+D+i In situ hibridization PCR Publication s Consensus Teaching Laboratorio de Dianas Terapéuticas

5 Introducción 5 Evolución del tratamiento del cáncer de pulmón: desarrollo de las terapias dirigidas, identificación de dianas terapéuticas y marcadores predictivos. Primera línea Mantenimiento Segunda línea Tercera línea Paclitaxel Gemcitabine 1998 Docetaxel 2003 Docetaxel 2000 Gefitinib 2004 Pemetrexed 2004 Erlotinib 2005 Bevacizumab 2007 Pemetrexed 2008 Mediana supervienci a global (meses) Cisplatin 1978 ~2 4 Best supportive care Carboplatin 1989 ~6 Single-agent platinum Vinorelbine 1997 ~ Doublets 12+ Gefitinib 2009 Pemetrexed 2009 Erlotinib 2010 Bevacizumab + PC Histology-direct therapy European Medicines Agency.

6 Introducción Como resultado de los avances de la investigación molecular en cáncer, ha sido posible identificar alteraciones en múltiples genes que codifican proteínas implicadas en las vías de transducción de señales que controlan procesos claves para la célula: proliferación y supervivencia celular. 6 SECUENCIACIÓN GENOMA ANÁLISIS EXPRESIÓN GÉNICA CGH ARRAYS CGH Ejemplo representativo de alteraciones genéticas en cáncer: carcinoma no microcítico de pulmón (figura adaptada de Ding et al., Nature 2008; 455: )

7 Introducción Evolución del tratamiento del cáncer de pulmón: identificación de subgrupos moleculares con relevancia terapéutica KRAS Evolución del tratamiento en NSCLC Desconocido 2004 Diagnóstico histológico reproducible No SCC SCC KRAS Desconocido 2010 EGFR Análisis de las alteraciones genéticas con valor predictivo EGFR Mut EGFR WT SCC 2008 Desconocido MET BRAF ERBB2 PDGFR KRAS EGFR ALK PIK3CA EGFR Mut ALK + KRAS Mut MET+ Otros Mut SCC Priorizar el uso de terapias dirigidas Hoy Adaptado de Pao et al., Lancet Oncol 2011; 12: y Sharma et al., Nat Rev Cancer 2010; 10:

8 Índice 8 Introducción Biomarcadores en cáncer de pulmón Conclusiones

9 Small thoracic samples Diagnosis Tumor board input Biomarkers 9 H&E IHC Step A1 Step A2 Step A3 Step A4 Section 1 3 µm S H&E Section 2 3 µm S S P40- Section 3 3 µm TTF1+ Section 4 5 µm Section 5 3 µm Section 6 5 µm Section 7 3 µm Sections µm Section 19 3 µm S S S S S EGFR mutation ALK translocation KRAS mutation ROS1 translocation DNA extraction H&E NSCLC- NOS NSCLC-NOS favours AC HER2 mutación S BRAF mutación H&E HER2 (3,6%) (~15%) [41,42] (10,5%) [42] (21%) [42] (1,7%) [43] BRAF (2%) AC Step B1 Step B2 Step B3 Section 1 3 µm Section 2 5 µm Section 3 3 µm Section 4 5 µm Section 5 3 µm Sections µm Section 17 3 µm Conde et al. Clin Transl Oncol, in press

10 Biomarcadores en cáncer de pulmón 10

11 Biomarcadores en cáncer de pulmón 11 FASE PRE-ANALÍTICA DE LA MUESTRA EGFR Fase analítica. Fase post-analítica. ALK Fase analítica. Fase post-analítica

12 Biomarcadores en cáncer de pulmón 12 FASE PRE-ANALÍTICA DE LA MUESTRA EGFR Fase analítica. Fase postanalítica. ALK Fase analítica. Fase postanalítica

13 Introducción: Qué muestras? 13 Tipos de muestras: A. Biopsia (bronquial, transbronquial o pleural) B. Biopsia con aguja gruesa (tru-cut) C. Pieza quirúrgica D. Citología A B C D

14 FASE PRE-ANALÍTICA 14 Fase de procesamiento de la muestra Manejo de la muestra Evaluación, gestión y rentabilidad de la muestra Macrodisección Sección Extracción del ADN Digestión del tejido Medición de la cantidad y calidad del ADN

15 FASE PRE-ANALÍTICA 15 Fase de procesamiento de la muestra Manejo de la muestra Evaluación, gestión y rentabilidad de la muestra Macrodisección Sección Extracción del ADN Digestión del tejido Medición de la cantidad y calidad del ADN

16 Fase de procesamiento 16 Estudio macroscópico

17 Fase de procesamiento 17 Fijación e inclusión Volumen de fijador adecuado (relación mínimo fijador: tejido de 10:1) Tiempo óptimo de fijación: 6-12 h biopsias pequeñas 8-18 h resecciones quirúrgicas. No se recomienda >36 horas.

18 FASE PRE-ANALÍTICA 18 Fase de procesamiento de la muestra Manejo de la muestra Evaluación, gestión y rentabilidad de la muestra Macrodisección Sección Extracción del ADN Digestión del tejido Medición de la cantidad y calidad del ADN

19 Manejo de la muestra Evaluación, gestión y rentabiliad de la muestra 19 S % % celularidad tumoral

20 Manejo de la muestra Evaluación, gestión y rentabilidad de la muestra 20 Comparison of direct sequencing and a commercial real-time pcr kit for detection of mutations in egfr gene Angulo B, Conde E, Martínez R, Suárez-Gauthier A, García-García E, Rubio-Viqueira B, López-Ríos F

21 Manejo de la muestra Macrodisección 21 Indicación: Siempre que el porcentaje de celularidad tumoral esté por debajo del límite de sensibilidad de la técnica a utilizar Eliminar: necrosis, inflamación, moco

22 Manejo de la muestra Macrodisección 22 A B Bloque NO tumoral Bloque TUMORAL C D

23 Manejo de la muestra Sección 23

24 Manejo de la muestra Sección 24 A) Realizar 2-5 cortes a 5-10 μm en un microtomo, utilizándose cuchillas desechables para cada caso con el fin de evitar contaminaciones cruzadas. B) Cada corte es recogido con ayuda de una aguja estéril e introducido en un tubo eppendorf estéril previamente rotulado. A B C

25 FASE PRE-ANALÍTICA 25 Fase de procesamiento de la muestra Manejo de la muestra Evaluación, gestión y rentabilidad de la muestra Macrodisección Sección Extracción del ADN Digestión del tejido Medición de la cantidad y calidad del ADN

26 Extracción del ADN 26 1) DESPARAFINACIÓN Lavados con xilol Lavados con etanol absoluto Eliminación de parafina 2) DIGESTIÓN/LISIS Incubación con proteinasa K Rotura de matriz extracelular y lisis de membrana plasmática y orgánulos subcelulares 4) 3) EXTRACCIÓN Separación del ADN del resto de moléculas biológicas ALMACENAMIENTO 4ºC (1 semana) -20ºC (meses) -80ºC (años) Disolventes orgánicos (fenol-cloroformo): separación en base a la distinta polaridad de las moléculas biológicas Kit comerciales: columnas con membrana de sílice con afinidad para unión específica del ADN. Ej:QIAamp DNA FFPE Tissue, QIAGEN. Posibilidad de automatización. TM TM QIAcube: robot para la automatización del protocolo de extracción con el kit QIAamp DNA FFPE tissue.

27 Extracción del ADN Cuantificación y valoración de la calidad del ADN extraído 27 ADN de tejido en parafina ADN de sangre o tejido congelado ADN degradado ADN íntegro

28 Biomarcadores en cáncer de pulmón 28 FASE PRE-ANALÍTICA DE LA MUESTRA EGFR Fase analítica. Fase post-analítica. ALK Fase analítica. Fase post-analítica

29 FASE ANALÍTICA 29 Introducción Aproximaciones metodológicas al estudio de mutaciones en el gen EGFR: Secuenciación Técnicas de enriquecimiento del alelo mutado Otras / Técnicas de screening PCR cuantitativa en tiempo real IHQ

30 INTRODUCCIÓN Introducción 30 Clin Cancer Res 2007; 13:

31 Aproximaciones metodológicas al estudio de mutaciones en el gen EGFR Secuenciación directa (método de Sanger) 31 EGFR wild-type: exón 19 EGFR mutado: deleción exón 19 E746-A750del VENTAJAS Gold-standard Coste Accesibilidad Posibilidad de identificar todas las posibles mutaciones. DESVENTAJAS Sensibilidad (25-50%) Múltiples etapas Contaminaciones (post-pcr) Experiencia interpretación de los electroferogramas

32 EGFR MUTATION DETECTED EGFR MUTATION NOT-DETECTED Aproximaciones metodológicas al estudio de mutaciones en el gen EGFR Secuenciación directa: % tumor EGFR E746-A750del 32 % mutant DNA relative to wildtype DNA <5% 10% 20% 25% 30% N.D. Direct Sequencing (n=10*) 0/10 1/10 (10%) 5/10 (50%) 5/10 (50%) 7/10 (70%) 3/10 (30%) ORIGINAL SAMPLE (100%) SENSITIVITY STUDY: 10% SENSITIVITY STUDY: 20% SENSITIVITY STUDY: 30%

33 Aproximaciones metodológicas al estudio de mutaciones en el gen EGFR PCR cuantitativa en tiempo real 33 TheraScreen EGFR29 Mutation Test kit (DxS) IDENTIFICACIÓN DE LA MUTACIÓN DETECCIÓN DE LA MUTACIÓN EGFR wt ensayo control primer ARMS Taq FLUORÓFORO MOLÉCULA ADN MOLDE PRIMER SECUENCIA MUTADA EGFR mutado ensayo control primer ARMS Taq MOLÉCULA ADN MOLDE X Scorpions A ensayo mutación B

34 Aproximaciones metodológicas al estudio de mutaciones en el gen EGFR PCR cuantitativa en tiempo real 34 TheraScreen EGFR29 Mutation Test kit (DxS) VENTAJAS Mayor sensibilidad Kit comercial (estandarización) Fácil manejo e interpretación DESVENTAJAS Coste No detecta todas las mutaciones y, salvo las mutaciones puntuales, no discrimina entre las distintas deleciones o inserciones

35 Aproximaciones metodológicas al estudio de mutaciones en el gen EGFR COBAS EGFR TEST 35 Study Objectives

36 Aproximaciones metodológicas al estudio de mutaciones en el gen EGFR COBAS EGFR TEST 36

37 Aproximaciones metodológicas al estudio de mutaciones en el gen EGFR Cobas Mutation Test 37 Direct sequencing Extracted DNA Plate setup 45min PCR run 2h:30min Post-PCR, including: electrophoresis and purification 2h:30 Sanger run, including: Plate setup 1h PCR run 3h:30min Purification 30min Sequencing 2h:30min Data analysis 1h cobas EGFR Mutation Test MUY poco (5 µm) Plate setup 30min PCR run 1h:30min Data analysis 1min Rápido (48h) Automatizado

38 Biomarcadores en cáncer de pulmón 38 FASE PRE-ANALÍTICA DE LA MUESTRA EGFR Fase analítica. Fase post-analítica. ALK Fase analítica. Fase post-analítica

39 FASE POST-ANALÍTICA 39 Introducción Interpretación de resultados PCR y secuenciación directa PCR cuantitativa en tiempo real Emisión del informe

40 Introducción 40 Consideraciones generales: Buenas prácticas de laboratorio Parámetros de control analítico de la técnica Interpretación de los resultados Emisión del informe

41 FASE POST-ANALÍTICA 41 Introducción Interpretación de resultados PCR y secuenciación directa PCR cuantitativa en tiempo real Emisión del informe

42 Interpretación de resultados PCR y SECUENCIACIÓN DIRECTA Parámetros de control analítico 42 Validar la especificidad (verificar que se amplifica la región de interés) 1.- Especificidad de los primers secuencia %G+C pb EGFR18F TGACCCTTGTCTCTGTGTTC EGFR18R AGAGGCCTGTGCCAGGGAC EGFR19F CAGTTAACGTCTTCCTTCTC EGFR19R CACACAGCAAAGCAGAAACTC EGFR20F ACTGACGTGCCTCTCCCTC EGFR20R CCCGTATCTCCCTTCCCTG EGFR21F TCACAGCAGGGTCTTCTCTG EGFR21R CTGACCTAAAGCCACCTCC Conde et al. Clin Cancer Res 2006; 12:

43 Interpretación de resultados PCR y SECUENCIACIÓN DIRECTA Parámetros de control analítico 43 Validar la sensibilidad (diluciones de ADN mutado en ADN wild-type, procedentes ambos de muestras de uso habitual en el laboratorio). COMPARISON OF DIRECT SEQUENCING AND A COMMERCIAL REAL-TIME PCR KIT FOR DETECTION OF MUTATIONS IN EGFR GENE Angulo B, Conde E, Martínez R, Suárez-Gauthier A, García-García E, Rubio-Viqueira B, López-Ríos F

44 Interpretación de resultados 44 PCR y SECUENCIACIÓN DIRECTA Parámetros de control analítico Secuenciar productos de PCR en dirección forward y reverse Revisión de electroferogramas mediante softwares específicos de alineamiento de secuencias y visual para evitar enmascaramientos por presencia de alelos wildtypes

45 Interpretación de resultados PCR y SECUENCIACIÓN DIRECTA 45 Revisión VISUAL de las secuencias

46 Interpretación de resultados PCR y SECUENCIACIÓN DIRECTA Interpretación 46 EGFR wild-type: exón 19 EGFR mutante: deleción en exón 19 (E746-A750) E746-A750del

47 Interpretación de resultados EGFR wild-type: exón 20 EGFR mutante: T790M 47 C>T ACG ATG EGFR wild-type: exón 21 EGFR mutante: L858R CTG CGG T>G

48 Interpretación de resultados 48 EGFR mutante: inserción exón 20 (V769_D770insASV)

49 FASE POST-ANALÍTICA 49 Introducción Interpretación de resultados PCR y secuenciación directa PCR cuantitativa en tiempo real Emisión del informe

50 Interpretación de resultados 50 PCR CUANTITATIVA EN TIEMPO REAL TheraScreen EGFR29 Mutation Test Kit (DxS) 8 ensayos: CONTROL, DELECIONES, T790M*, L858R, L861Q, G719X, S768I, INSERCIONES. CONTROL T790M DELECIONES EXÓN 19 L858R L861Q G719X S768I INSERCIONES EXÓN 20

51 Interpretación de resultados PCR CUANTITATIVA EN TIEMPO REAL TheraScreen EGFR29 Mutation Test Kit (DxS) 51 Valor Ct (umbral de ciclo, cycle thereshold): ciclo de PCR a partir del cual la señal de amplificación es estadísticamente significativa por encima del ruido de fondo Ct = Ct Ensayo mutación Ct Ensayo control EGFR E746-A750del Ct ENSAYO CONTROL DELECIÓN Ct = Ct Ensayo mutación Ct Ensayo control

52 Interpretación de resultados PCR CUANTITATIVA EN TIEMPO REAL Cobas EGFR Mutation Test 52

53 Interpretación de resultados PCR CUANTITATIVA EN TIEMPO REAL Cobas EGFR Mutation Test 53

54 Emisión del informe 54 Nº especimen Filiación del paciente Filiación del médico solicitante Tipo de especimen Bloque parafina / citología Biopsia / pieza quirúrgica Localización: 1º vs 2º Macrodisección: sí/no % celularidad tumoral Técnica empleada Exones analizados Presencia o ausencia de mutación Tipo específico de mutación Sensibilidad analítica de la técnica % mutaciones EGFR Fecha de entrada / Fecha de salida

55 Biomarcadores en cáncer de pulmón 55 FASE PRE-ANALÍTICA DE LA MUESTRA EGFR Fase analítica. Fase post-analítica. ALK Fase analítica. Fase post-analítica

56 Hibridación in situ fluorescente (FISH): Concepto Fase Analítica 56 Técnica que permite la localización de una secuencia de ADN de un gen/cromosoma en una preparación celular Precisa el anillamiento de una cadena simple de ADN marcada con fluorescencia a las secuencias diana complementarias El resultado de la hibridación se visualiza directamente en el núcleo

57 Protocolo en muestras parafinadas Fase Analítica 57 Selección del área neoplásica Carcinoma infiltrante Evitar áreas de necrosis Evitar áreas con inflamación Marcar el área seleccionada Cortes 3-4 µm del tejido en cristales silanizados Mantener en estufa a 55ºC 24h Desparafinado Pretratamiento Digestión: permite que la sonda acceda al ADN diana

58 Inventariable y fungible Fase Analítica 58 Microscopio de fluorescencia: Lámpara 100 W Objetivos:10x y 100x (inmersión) Aceite de inmersión Filtros individuales para cada fluorocromo: Dapi FITC Texas Red vs Orange Doble: FITC/Texas Red vs Orange Triple: Dapi/FITC/Texas Red vs Orange

59 FISH de la translocación ALK Vysis LSI ALK dual color, break-apart probe Fase Analítica 59 ALK Break Apart Probes identifica todas las translocaciones, independientemente del gen de fusión (EML4, TGF and KIF5B) 3 5 SpectrumOrange Probe Telomeric of break site (contiene el dominio tirosina kinasa) SpectrumGreen Probe Centromeric of break site

60 FISH de la translocación ALK Nueva Vysis LSI ALK dual color, break-apart probe Fase Analítica 60 Optimizada para pulmón Misma sonda Nueva fórmula Protocolo mejorado

61 Ventajas del FISH Fase Analítica 61 Evaluación directa del gen a estudiar Estudio de un amplio número de genes Aplicación sobre tejido en parafina, extensiones citológicas y fluidos Implementación en laboratorios de anatomía patológica Procedimiento estandarizado y validado: importante el empleo de kits Guías de interpretación validadas Rapidez en la emisión de los resultados Elevada especificidad y sensibilidad

62 Inconvenientes del FISH Fase Analítica 62 Coste del inventariable y fungible Tiempo de evaluación Pérdida de la fluorescencia Buena ejecución de la técnica Número adecuado de casos Entrenamiento del patólogo

63 FISH sobre citología 63 Protocolo más corto No desparafinado Pretratamiento No baño No digestión Resto del protocolo igual que parafina

64 Biomarcadores en cáncer de pulmón 64 FASE PRE-ANALÍTICA DE LA MUESTRA EGFR Fase analítica. Fase post-analítica. ALK Fase analítica. Fase post-analítica

65 ÍNDICE ÍNDICE 65 Interpretación de resultados Patrones de interpretación: Clásico Atípico Heterogeneidad intratumoral Retos del FISH ALK Otros patrones de significado incierto Emisión de informes

66 FISH: Interpretación de resultados Vysis LSI ALK dual color, break-apart probe Fase post-analítica 66 Sondas de rotura (Break Apart o Split Signal) Punto de ruptura Cromosoma A Cromosoma A Cromosoma?

67 FISH: Interpretación de resultados Vysis LSI ALK dual color, break-apart probe Fase post-analítica 67 NEGATIVO POSITIVO NO CONCLUYENTE Si de 5 a 25 núcleos (10-50%) son positivos Si <5 núcleos de 50 (<5/50 ó <10%) son negativos Si >25 núcleos de 50 (>25/50 ó >50%) son positivos Segundo observador: análisis de 50 núcleos más. Suma de las 2 lecturas de FISH (100 núcleos): - Si el promedio de núcleos positivos es <15% (<15/100), se considera negativo - Si el promedio de núcleos positivos es >15% (>15/100), se considera positivo

68 FISH: Interpretación de resultados FISH ALK NEGATIVOS: No translocación Fase post-analítica 68

69 FISH: Interpretación de resultados Fase post-analítica FISH ALK POSITIVO: Patrón clásico (señales split ) 69 3 ALK 5 2p23-21 EML4 ~ 12 Mb 3 ALK EML4 Translocación (inversión) (70%) 5 Gen de Fusion Negativ o Positivo (señales split)

70 FISH: Interpretación de resultados Fase post-analítica FISH ALK POSITIVO: Patrón clásico (señales split ) 70 Distancia entre las señales split Negativo Separación entre las señales de menos de dos el diámetro de las mismas Positivo Separación entre las señales de más de dos el diámetro de las mismas

71 FISH: Interpretación de resultados Fase post-analítica FISH ALK POSITIVO: Patrón clásico (señales split ) 71

72 FISH: Interpretación de resultados FISH ALK POSITIVO: Patrón atípico Fase post-analítica 72 Señales rojas (3') únicas [pérdida/deleción señal verde (5')] 3 ALK 5 ~ 12 Mb EML4 3 ALK EML4 Deleción (30%) Gen de Fusion

73 FISH: Interpretación de resultados FISH ALK POSITIVO: Patrón atípico Fase post-analítica 73 Señales rojas (3') únicas [pérdida/deleción señal verde (5')] Positivo Señales rojas (3 ) únicas / pérdida de señal verde (5 ) Negativo Señales verdes (5 ) únicas / pérdida de señal roja (3 )

74 FISH: Interpretación de resultados FISH ALK POSITIVO: Patrón atípico Fase post-analítica 74 Señales rojas (3') únicas [pérdida/deleción señal verde (5')]

75 FISH: Interpretación de resultados Heterogeneidad intratumoral Fase post-analítica 75 Heterogeneidad FISH ALK difusa, no focal IHQ ALK difusa, no focal Camidge et al., Clin Cancer Res 2010;16: Yoshida A et al, Am J Surg Pathol 2011;35:1226

76 FISH: Interpretación de resultados Retos del FISH ALK Fase post-analítica 76 Falsos positivos: Truncamiento nuclear Hibridación inespecífica Falsos negativos: Señales débiles Filtros de fluorescencia (p.e. filtro verde quemado ) Errores de interpretación: Valoración de células benignas Interpretación incorrecta de señales de rotura/fusión

77 FISH: Interpretación de resultados Otros patrones de interpretación Fase post-analítica 77

78 Emisión de informes Fase post-analítica 78 Nº espécimen Filiación del paciente Filiación del médico solicitante Tipo de muestra: o biopsia o pieza quirúrgica o citología Procedencia anatómica Fijador Sonda Nº de núcleos evaluados Idoneidad de la muestra: adecuada / inadecuada Observaciones: o % de células tumorales con señales verde (5 ) y roja (3 ) separadas (patrón split ) o % de células tumorales con señales rojas (3') únicas o Otros hallazgos Interpretación: translocado / no translocado Fecha de entrada / Fecha de salida

79 Secuenciación no-óptica 79

80 Secuenciación no-óptica 80 El Panel genético seleccionado contiene los 46 genes y 739 mutaciones más relevantes por su relación con la mayor parte de los cánceres y terapias conocidas

81 Índice 81 Introducción Biomarcadores en cáncer de pulmón Conclusiones

82 CONCLUSIONES ÍNDICE 82 Material disponible límitado Los técnicos nos tenemos que involucrar en todo el proceso. Métodos no estandarizados Necesidad de entrenamiento Control de cálidad interno y externo.

83 83 Hospital Universitario Madrid Sanchinarro C/ Oña 10, Madrid, España Muchas gracias

EGFR en cáncer de pulmón. Dr José Javier Gómez Román Dpto Anatomía Patológica Hospital Universitario Marqués de Valdecilla Santander

EGFR en cáncer de pulmón. Dr José Javier Gómez Román Dpto Anatomía Patológica Hospital Universitario Marqués de Valdecilla Santander EGFR en cáncer de pulmón Dr José Javier Gómez Román Dpto Anatomía Patológica Hospital Universitario Marqués de Valdecilla Santander Desde Septiembre a Mayo 8 reuniones sobre EGFR Hay un kit diagnóstico

Más detalles

Aproximación práctica al estudio del KRAS y otros biomarcadores. Javier Hernández Losa. 23-Mayo-2013

Aproximación práctica al estudio del KRAS y otros biomarcadores. Javier Hernández Losa. 23-Mayo-2013 Aproximación práctica al estudio del KRAS y otros biomarcadores Javier Hernández Losa. 23-Mayo-2013 Fase Pre-analítica: Selección del material Evaluación, gestión y rentabiliad de la muestra S09-23447

Más detalles

Muestras citológicas para el estudio de mutaciones de EGFR y KRAS en cáncer de pulmón de célula no pequeña

Muestras citológicas para el estudio de mutaciones de EGFR y KRAS en cáncer de pulmón de célula no pequeña Muestras citológicas para el estudio de mutaciones de EGFR y KRAS en cáncer de pulmón de célula no pequeña Caroline Becker; Enric Carcereny Costa; Felipe Andreo García; Eva Castellá; Mariona Lletjós Sanuy;

Más detalles

Biomarcadores. Oncología. CCR. k-ras, Biomarcador decisivo, imprescindible y disponible.

Biomarcadores. Oncología. CCR. k-ras, Biomarcador decisivo, imprescindible y disponible. 30 Biomarcadores. Oncología. CCR. k-ras, Biomarcador decisivo, imprescindible y disponible. 10 min. De esta forma el biomarcador K-ras Step 3: ARMS: Selectively amplifies target es un marcador decisivo

Más detalles

Perfil mutacional de los carcinomas pulmonares no microcíticos diagnosticados en el Hospital Carlos Haya de Málaga

Perfil mutacional de los carcinomas pulmonares no microcíticos diagnosticados en el Hospital Carlos Haya de Málaga Perfil mutacional de los carcinomas pulmonares no microcíticos diagnosticados en el Hospital Carlos Haya de Málaga D. Bautista, E. Prieto, M. Martínez, R. Fernández, A.I. de Hita, C. Gastelu Mutaciones

Más detalles

Selección de pacientes

Selección de pacientes 2 Selección de pacientes MENSAJES CLAVE Aproximadamente entre el 20% y el 30% de las pacientes con cáncer de mama presentan tumores HER2 positivos. Hasta un 24% de los tumores con receptores de estrógenos

Más detalles

Marta Hergueta Redondo Dic. -2005

Marta Hergueta Redondo Dic. -2005 Perfil de expresión genética en el carcinoma no microcítico de pulmón: utilidad de las biopsias endoscópicas, correlación con la histología y predicción pronóstica en pacientes operables. FIS 04/2641 Marta

Más detalles

Experiencias en Q-PCR para la aplicación y diagnóstico en Medicina Humana

Experiencias en Q-PCR para la aplicación y diagnóstico en Medicina Humana Experiencias en Q-PCR para la aplicación y diagnóstico en Medicina Humana MSc. Gonzalo Manrique Laboratorio de Biología Molecular Asociación Española Junio de 2009 INDICE INTRODUCCION (conceptos básicos,

Más detalles

Historia. Hibridación in situ Fluorescente

Historia. Hibridación in situ Fluorescente Fluorescent in situ Hybridization Historia Hibridación in situ Desarrollada por Pardue & Gall (1969) -Muy pocas secuencias de DNA disponibles -Radioisótopos Alto entrenamiento Seguridad Tiempo Hibridación

Más detalles

Cáncer de pulmón Biologia molecular

Cáncer de pulmón Biologia molecular Cáncer de pulmón Biologia molecular Ana Margarita Baldión Elorza Departamento de Patología y Laboratorio Clínico Hospital Universitario Fundación Santa Fe de Bogotá Cambio en el paradigma del estudio de

Más detalles

DETERMINACIÓN DEL HER 2

DETERMINACIÓN DEL HER 2 DETERMINACIÓN DEL HER 2 Valor predictivo Trastuzumab Resistencia tratamientos convencionales < respuesta a terapia adyuvante con tamoxifeno > respuesta a antraciclinas y taxanos Clasificaciones moleculares

Más detalles

Otras mutaciones tratables:

Otras mutaciones tratables: Otras mutaciones tratables: Qué buscar y cuándo buscarlas. Ihab Abdulkader Nallib Servicio de Anatomía Patológica Hospital Clínico Universitario Santiago de Compostela Directrices de determinaciones moleculares

Más detalles

Técnicas de hibridación Concepto, modalidades y tipos de sondas Aplicaciones principales. Federico Rojo Fundación Jiménez Díaz

Técnicas de hibridación Concepto, modalidades y tipos de sondas Aplicaciones principales. Federico Rojo Fundación Jiménez Díaz Técnicas de hibridación Concepto, modalidades y tipos de sondas Aplicaciones principales Federico Rojo Fundación Jiménez Díaz Guión de la presentación Alteraciones estructurales del DNA y cáncer Hibridación

Más detalles

Dra Cristina Fernandez F. INSTITUTO NACIONAL DEL TORAX

Dra Cristina Fernandez F. INSTITUTO NACIONAL DEL TORAX Dra Cristina Fernandez F. INSTITUTO NACIONAL DEL TORAX Perfil Genético del Cáncer Pulmonar LA TASADE MUTACION DE EGFR EN NORTE AMERICA 10 A 15% LA TASA DE MUTAC Kras en Norteamerica? 15 a 30% En Asia 39

Más detalles

personalizado del cáncer de pulmón y la importancia de las determinaciones moleculares para oncovida

personalizado del cáncer de pulmón y la importancia de las determinaciones moleculares para oncovida Tratamiento personalizado del cáncer de pulmón y la importancia de las determinaciones moleculares para optimizar el tratamiento 22 oncovida C o l e c c i ó n 1 Qué es el cáncer de pulmón y cuales son

Más detalles

CERTIFICACIONES...5 AGRADECIMIENTOS...11 ÍNDICE DE CONTENIDO...15 LISTADOS...21 LISTADO DE TABLAS...23 LISTADO DE FIGURAS...23 ABREVIATURAS...27 RESUMEN...33 RESUMEN...35 SUMMARY...36 INTRODUCCIÓN...39

Más detalles

(ICAPI) tiene como objetivo fundamental el ofrecer un

(ICAPI) tiene como objetivo fundamental el ofrecer un El Instituto Canario de Anatomía Patológica Integral (ICAPI) tiene como objetivo fundamental el ofrecer un diagnóstico de calidad en Anatomía Patológica, integrando las distintas disciplinas que en esta

Más detalles

REVISTA ESPAÑ OLA DE. Patología. www.elsevier.es/patologia

REVISTA ESPAÑ OLA DE. Patología. www.elsevier.es/patologia Rev Esp Patol. 2012;45(1):14-28 Patología REVISTA ESPAÑ OLA DE www.elsevier.es/patologia REVISIÓN Recomendaciones para la determinación de biomarcadores en el carcinoma de pulmón no microcítico avanzado.

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles

PCR A TIEMPO REAL. María Maiques R4-Bioquímica Clínica 25-Abril-07

PCR A TIEMPO REAL. María Maiques R4-Bioquímica Clínica 25-Abril-07 PCR A TIEMPO REAL María Maiques R4-Bioquímica Clínica 25-Abril-07 VEAMOS Herramientas para detectar mutaciones Moléculas fluorescentes y tecnología FRET PCR a tiempo real: equipos y métodos de detección

Más detalles

LAS TRANSLOCACIONES DE RAF PARTICIPAN EN EL CANCER

LAS TRANSLOCACIONES DE RAF PARTICIPAN EN EL CANCER Genética Molecular 10/11 Ana Serrano Puebla LAS TRANSLOCACIONES DE RAF PARTICIPAN EN EL CANCER En este trabajo se dispusieron a investigar sobre el desarrollo y mantenimiento de células cancerígenas en

Más detalles

Técnica de CGH-array. María Rodríguez-Rivera

Técnica de CGH-array. María Rodríguez-Rivera Técnica de CGH-array María Rodríguez-Rivera Laboratori de Citogenètica Molecular. Servei de Patologia. Hospital del Mar. Programa de Càncer-IMIM. Barcelona Índice Introducción a los microarrays Arrays

Más detalles

Importancia del Perfil Genético en la Medicina Personalizada

Importancia del Perfil Genético en la Medicina Personalizada Importancia del Perfil Genético en la Medicina Personalizada Fernando López-Ríos Laboratorio de Dianas Terapéuticas Centro Integral Oncológico Clara Campal Hospital Universitario Sanchinarro Madrid www.laboratoriodedianasterapeuticas.com

Más detalles

IDENTIFICACIÓN DE NUEVAS DIANAS TERAPÉUTICAS EN TUMORES GERMINALES REFRACTARIOS

IDENTIFICACIÓN DE NUEVAS DIANAS TERAPÉUTICAS EN TUMORES GERMINALES REFRACTARIOS IDENTIFICACIÓN DE NUEVAS DIANAS TERAPÉUTICAS EN TUMORES GERMINALES REFRACTARIOS Investigadores principales: Dr. Francesc Viñals Canals Facultat de Medicina CSUB Dr. Fco. Javier García del Muro Solans Institut

Más detalles

Valor predictivo de la Timilidato Sintetasa (TS) determinada por qpcr en pacientes con cáncer avanzado tratados con Pemetrexed

Valor predictivo de la Timilidato Sintetasa (TS) determinada por qpcr en pacientes con cáncer avanzado tratados con Pemetrexed Valor predictivo de la Timilidato Sintetasa (TS) determinada por qpcr en pacientes con cáncer avanzado tratados con Pemetrexed C. Chamizo, S. Zazo, N. Pérez-González, CL Aúz, Lina Daud, J. Madoz, M. Domine,,

Más detalles

patológico en cáncer de mama

patológico en cáncer de mama Actualizaciones en diagnóstico patológico en cáncer de mama Dra. Leonor Moyano Sch Dra. Laura Carreño T Dra. Valeria Cornejo Dr. Arturo Espinoza N Dr. Pablo Matamala Dra. Verónica Sanhueza L Temario 1.

Más detalles

HER2 en Cancer Gastrico

HER2 en Cancer Gastrico HER2 en Cancer Gastrico Dr. Alejandro Corvalan Laboratorio de Patologia Molecular y Epidemiologia Centro de Investigaciones Medicas Departamento de Hematoloiga &Oncologia P.Universidad Catolica de Chile

Más detalles

RECOMENDACIONES PARA HER 2 IHQ EN CANCER DE MAMA. Dra. Valeria Cornejo C. Hospital Clínico San Borja Arriarán

RECOMENDACIONES PARA HER 2 IHQ EN CANCER DE MAMA. Dra. Valeria Cornejo C. Hospital Clínico San Borja Arriarán RECOMENDACIONES PARA HER 2 IHQ EN CANCER DE MAMA Dra. Valeria Cornejo C. Hospital Clínico San Borja Arriarán Introducción Realización de grandes estudios que evalúan efectividad de las nuevas drogas target

Más detalles

Patología molecular y dianas terapéuticas Santiago Montes-Moreno 1 y Fernando López-Ríos 2

Patología molecular y dianas terapéuticas Santiago Montes-Moreno 1 y Fernando López-Ríos 2 Patología molecular y dianas terapéuticas Santiago Montes-Moreno 1 y Fernando López-Ríos 2 1 Servicio de Anatomía Patológica, Hospital Universitario Marqués de Valdecilla, Santander; 2 Laboratorio de Dianas

Más detalles

BioSeq 739 Servicio de ayuda al diagnóstico oncológico

BioSeq 739 Servicio de ayuda al diagnóstico oncológico BioSeq 739 Servicio de ayuda al diagnóstico oncológico Análisis Genómico Tumoral por Secuenciación Masiva PPBSA CP13 060312 Información sobre el servicio de BioSeq 739 La mayoría de tipos de cáncer se

Más detalles

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN.

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. PROGRAMA CONTROL DE CALIDAD DE MUESTRAS El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. El programa completo de control de calidad de muestras de ADN y ARN engloba diferentes

Más detalles

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR)

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) Centro de de Microscopía Electrónica Facultad de de Ciencias Médicas Universidad Nacional de de Córdoba

Más detalles

CÁNCER DE MAMA. Modelo de aplicación de la genética y biología molecular. Dr. Abelardo Arias Velásquez

CÁNCER DE MAMA. Modelo de aplicación de la genética y biología molecular. Dr. Abelardo Arias Velásquez V SIMPOSIO ANDINO DE LABORATORIO Y MEDICINA CÁNCER DE MAMA Modelo de aplicación de la genética y biología molecular Dr. Abelardo Arias Velásquez Jefe de la Unidad de Genética y Biología Molecular Instituto

Más detalles

PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH

PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH Blga. Gisely Hijar Guerra Coordinación del Laboratorio de Biotecnología y Biología Molecular. Responsable de los Procesos de la Prueba

Más detalles

Whole Genix INFORME DE SECUENCIACIÓN DEL GENOMA TUMORAL. Informe de marcadores genéticos

Whole Genix INFORME DE SECUENCIACIÓN DEL GENOMA TUMORAL. Informe de marcadores genéticos WHOLE GENIX INFORME DE SECUENCIACIÓN DEL GENOMA TUMORAL 1 INFORME DE SECUENCIACIÓN DEL GENOMA TUMORAL Identificación del paciente Nombre del paciente Fecha de nacimiento Número de Biopsia Doctor solicitante

Más detalles

DETECCIÓN E IDENTIFICACIÓN GENÉTICA DE MUTACIONES PUNTUALES, INSERCIONES Y DELECIONES EN EL GEN EGFR ASOCIADAS A CÁNCER DE PULMÓN NO MICROCÍTICO

DETECCIÓN E IDENTIFICACIÓN GENÉTICA DE MUTACIONES PUNTUALES, INSERCIONES Y DELECIONES EN EL GEN EGFR ASOCIADAS A CÁNCER DE PULMÓN NO MICROCÍTICO CLART CMA EGFR DETECCIÓN E IDENTIFICACIÓN GENÉTICA DE MUTACIONES PUNTUALES, INSERCIONES Y DELECIONES EN EL GEN EGFR ASOCIADAS A CÁNCER DE PULMÓN NO MICROCÍTICO PARA DIAGNÓSTICO IN VITRO 1 CLART CMA EGFR

Más detalles

CRITERIOS DE HORMONOSENSIBILIDAD. Dra. Nuria Ribelles. Hospital Universitario Virgen de la Victoria. Málaga.

CRITERIOS DE HORMONOSENSIBILIDAD. Dra. Nuria Ribelles. Hospital Universitario Virgen de la Victoria. Málaga. CRITERIOS DE HORMONOSENSIBILIDAD. Dra. Nuria Ribelles. Hospital Universitario Virgen de la Victoria. Málaga. Criterios generales Receptor Estrógeno Receptor Progesterona HER2 Biopsia de la metástasis Nuevos

Más detalles

Le ayudamos a comprender la importancia de los Biomarcadores predictivos RAS en el tratamiento del cáncer colorrectal

Le ayudamos a comprender la importancia de los Biomarcadores predictivos RAS en el tratamiento del cáncer colorrectal Le ayudamos a comprender la importancia de los Biomarcadores predictivos RAS en el tratamiento del cáncer colorrectal... porque la vida importa Objetivos de este folleto Este folleto ha sido elaborado

Más detalles

Respiratory Tract Tumors Program Red Temática de Investigación Cooperativa en Cáncer (RTICC)

Respiratory Tract Tumors Program Red Temática de Investigación Cooperativa en Cáncer (RTICC) Respiratory Tract Tumors Program Red Temática de Investigación Cooperativa en Cáncer (RTICC) J.L. González Larriba Servicio de Oncologia Médica Hospital Clínico San Carlos Reunión 7 de Marzo 2013. Madrid.

Más detalles

PLIEGO DE PRESCRIPCIONES TÉCNICAS

PLIEGO DE PRESCRIPCIONES TÉCNICAS PLIEGO DE PRESCRIPCIONES TÉCNICAS Expediente : 2015/000023 Titulo Localidad : Suministro e instalación de Sistema robotizado de ampliación y cuantificación de ácitos nucleicos en tiempo real, financiado

Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

Actualización en nuevas técnicas de diagnóstico genético molecular disponibles en Chile

Actualización en nuevas técnicas de diagnóstico genético molecular disponibles en Chile Actualización en nuevas técnicas de diagnóstico genético molecular disponibles en Chile Dra. Teresa Aravena Clínica INDISA Hospital Clínico de la Universidad de Chile Hospital Dr. Sótero del Río Exámenes

Más detalles

TaqMan GMO Maize Quantification Kit. Part No: 4481972

TaqMan GMO Maize Quantification Kit. Part No: 4481972 TaqMan GMO Maize Quantification Kit Part No: 4481972 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

Casos de Cáncer de Pulmón

Casos de Cáncer de Pulmón Casos de Cáncer de Pulmón Dr José Javier Gómez Román S. Anatomía Patológica Hospital Universitario Marqués de Valdecilla Universidad de Cantabria. IDIVAL Santander Caso número 1 Mujer de 36 años de edad,

Más detalles

CLART CMA KRAS BRAF PI3K

CLART CMA KRAS BRAF PI3K CLART CMA KRAS BRAF PI3K DETECCIÓN E IDENTIFICACIÓN GENÉTICA DE MUTACIONES PUNTUALES EN TRES DE LOS GENES PERTENECIENTES A LA RUTA DEL EGFR ASOCIADOS A CÁNCER COLORRECTAL KRAS, BRAF y PI3K- PARA DIAGNÓSTICO

Más detalles

Investigación y cooperación frente a los grandes retos sociales

Investigación y cooperación frente a los grandes retos sociales Investigación y cooperación frente a los grandes retos sociales Si un día lográramos dotar de mayor capacidad y eficacia a los servicios técnicos de nuestras células, el cáncer acabaría reduciéndose a

Más detalles

CLUB DE PATOLOGÍA MAMARIA

CLUB DE PATOLOGÍA MAMARIA CLUB DE PATOLOGÍA MAMARIA Congreso Nacional de la SEAP-IAP Cádiz, mayo 2013 Rosario Granados Caso Clínico Mujer de 60 años con nódulo de 1,5 cm en CSE de mama derecha. Tumorectomía. Diagnóstico

Más detalles

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras METODOLOGIA DEL PCR Lic. Jorge Mato Luis Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras Desnaturalización del DNA 5 A G G T T A G T G G A C C C T T G A T 3 3 T C C A

Más detalles

Dr Alejandro Acevedo Gaete Oncólogo Médico Hospital Carlos Van Buren

Dr Alejandro Acevedo Gaete Oncólogo Médico Hospital Carlos Van Buren Dr Alejandro Acevedo Gaete Oncólogo Médico Hospital Carlos Van Buren Introduccion Perspectiva histórica Principios de Biologia molecular del cáncer colorectal Conceptos de biomarcadores Evidencia clínica

Más detalles

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles

CLART CMA KRAS BRAF PI3K

CLART CMA KRAS BRAF PI3K CLART CMA KRAS BRAF PI3K DETECCIÓN E IDENTIFICACIÓN GENÉTICA DE MUTACIONES PUNTUALES EN TRES DE LOS GENES PERTENECIENTES A LA RUTA DEL EGFR ASOCIADOS A CÁNCER COLORRECTAL KRAS, BRAF y PI3K- PARA DIAGNÓSTICO

Más detalles

La familia del EGFR como diana molecular en cáncer

La familia del EGFR como diana molecular en cáncer en cáncer Muchas gracias por la oportunidad de dirigirme a ustedes en este prestigioso evento, aquí en Lima. En los siguientes 20 minutos voy a cubrir algunos aspectos sobre la terapia dirigida contra

Más detalles

INVESTIGACIÓN EN CÁNCER DEL DESARROLLO

INVESTIGACIÓN EN CÁNCER DEL DESARROLLO INVESTIGACIÓN EN CÁNCER DEL DESARROLLO Modelo de terapia de precisión: tratamientos personalizados de rescate para cada paciente (en base a las anomalías genéticas del tumor y el test de fármacos en modelo

Más detalles

A principios de los años ochentas el desarrollo de nuevas tecnologías para la

A principios de los años ochentas el desarrollo de nuevas tecnologías para la Nuevos marcadores para la detección temprana y predicción de sobrevida en blancos terapéuticos. A principios de los años ochentas el desarrollo de nuevas tecnologías para la identificación del ADN del

Más detalles

ALK+ GUÍA INTERACTIVA SOBRE HAGA CLIC PARA COMENZAR QUINASA DEL LINFOMA ANAPLÁSICO POSITIVO

ALK+ GUÍA INTERACTIVA SOBRE HAGA CLIC PARA COMENZAR QUINASA DEL LINFOMA ANAPLÁSICO POSITIVO GUÍA INTERACTIVA SOBRE ALK+ QUINASA DEL LINFOMA ANAPLÁSICO POSITIVO NUESTRA COMPRENSIÓN DEL CÁNCER HA CAMBIADO EL CÁNCER DE CÉLULAS NO PEQUEÑAS (NSCLC) DE UNA SO A SUBTIPOS HAGA CLIC PARA COMENZAR APRENDIENDO

Más detalles

Single Cell Genomics. María Méndez Lago. Seminario tecnológico Facultad de Farmacia, UB 5.05.2015

Single Cell Genomics. María Méndez Lago. Seminario tecnológico Facultad de Farmacia, UB 5.05.2015 Single Cell Genomics María Méndez Lago 5.05.2015 Seminario tecnológico Facultad de Farmacia, UB Contenido 1. Introducción a la secuenciación de nueva generación (NGS) y a la genómica de células individuales

Más detalles

Perfiles de expresión génica y diagnóstico/pronóstico en cáncer. Introducción 6/1/2010. Meritxell Pelicano Esqueta. Genómica y proteómica

Perfiles de expresión génica y diagnóstico/pronóstico en cáncer. Introducción 6/1/2010. Meritxell Pelicano Esqueta. Genómica y proteómica Perfiles de expresión génica y diagnóstico/pronóstico en cáncer Meritxell Pelicano Esqueta Genómica y proteómica Curso 2009/2010 Introducción Expresión génica: Proceso por el cual los organismos transforman

Más detalles

Precisión en la identificación de los tumores Her2

Precisión en la identificación de los tumores Her2 Precisión en la identificación de los tumores Her2 CLASIFICACION MOLECULAR DEL CANCER DE MAMA SUBTIPOS DE CARCINOMAS MAMARIOS DETERMINADOS POR PERFILES DE EXPRESION GENETICA APROXIMACIÓN INMUNOFENOTÍPICA

Más detalles

HOSPITAL UNIVERSITARIO CENTRAL DE ASTURIAS LABORATORIO DE MEDICINA SERVICIO DE ONCOLOGÍA MOLECULAR

HOSPITAL UNIVERSITARIO CENTRAL DE ASTURIAS LABORATORIO DE MEDICINA SERVICIO DE ONCOLOGÍA MOLECULAR HOSPITAL UNIVERSITARIO CENTRAL DE ASTURIAS LABORATORIO DE MEDICINA Edición Nº 01 SERVICIO DE ONCOLOGÍA MOLECULAR CARTERA DE SERVICIOS DEL LABORATORIO DE ONCOLOGÍA MOLECULAR Modificaciones respecto a la

Más detalles

Dr. Horacio Decanini Arcaute Anatomopatólogo

Dr. Horacio Decanini Arcaute Anatomopatólogo Dr. Horacio Decanini Arcaute Anatomopatólogo Consenso general Introducción: La sobre- expresión del gen Her / 2 neu se encuentra Asociada con comportamiento agresivo y es considerada Como factor predictivo

Más detalles

Evaluación de la respuesta y clasificación patológica tras la inducción. Clara Salas HUPHM, MADRID

Evaluación de la respuesta y clasificación patológica tras la inducción. Clara Salas HUPHM, MADRID Evaluación de la respuesta y clasificación patológica tras la inducción Clara Salas HUPHM, MADRID Fundamentos El tratamiento quirúrgico del cáncer de pulmón en estadio IIIA es controvertido Los estadios

Más detalles

Bases moleculares y estudios genéticos

Bases moleculares y estudios genéticos II Jornada Genética Clínica para Médicos de Familia Bases moleculares y estudios genéticos María García-Barcina Unidad de Genética del H. Universitario de Basurto Osakidetza Sede SVMFIC Valencia, 2 de

Más detalles

ONE Step ONE Decision OSNA para el análisis de ganglios centinela en cáncer de mama

ONE Step ONE Decision OSNA para el análisis de ganglios centinela en cáncer de mama ONE Step ONE Decision OSNA para el análisis de ganglios centinela en cáncer de mama OSNA UN paso por delante La biopsia de los ganglios linfáticos centinela (SLN, por sus siglas en inglés) se ha establecido

Más detalles

TEMA 3.- EL LABORATORIO DE DIAGNÓSTICO CLÍNICO EN EL SISTEMA SANITARIO CONTENIDOS

TEMA 3.- EL LABORATORIO DE DIAGNÓSTICO CLÍNICO EN EL SISTEMA SANITARIO CONTENIDOS TEMA 3.- EL LABORATORIO DE DIAGNÓSTICO CLÍNICO EN EL SISTEMA SANITARIO CONTENIDOS 1. Conceptos previos sobre el trabajo del laboratorio clínico. 2. El laboratorio en el hospital. 3. El laboratorio en atención

Más detalles

23/07/2011. 80 x 80 mm. Fecha: Tamaño: Difusión: Página: Sección: LA VANGUARDIA

23/07/2011. 80 x 80 mm. Fecha: Tamaño: Difusión: Página: Sección: LA VANGUARDIA 23/07/2011 Tamaño: 80 x 80 mm. Página: 25 Difusión: 191673 LA VANGUARDIA Sección: 26/07/2011 Tamaño: 240 x 240 mm. Página: 12 Difusión: 47056 DIARIO MEDICO Sección: abc.es ctualidadnoticias.com adn.es

Más detalles

IMPACTO CLINICO DE LA INMUNOFENOTIPIFICION CELULAR IV: Ciclo celular en estados neoplásicos y preneoplásicos. T.M. MSC JUAN LUIS CASTILLO N.

IMPACTO CLINICO DE LA INMUNOFENOTIPIFICION CELULAR IV: Ciclo celular en estados neoplásicos y preneoplásicos. T.M. MSC JUAN LUIS CASTILLO N. IMPACTO CLINICO DE LA INMUNOFENOTIPIFICION CELULAR IV: Ciclo celular en estados neoplásicos y preneoplásicos. T.M. MSC JUAN LUIS CASTILLO N. Centro de Diagnóstico Onco-inmunológicoLtda. Laboratorio de

Más detalles

ALK y cáncer de pulmón. Josep Castellví Hospital Vall d Hebron. Barcelona

ALK y cáncer de pulmón. Josep Castellví Hospital Vall d Hebron. Barcelona ALK y cáncer de pulmón Josep Castellví Hospital Vall d Hebron. Barcelona Anaplastic Lymphoma Kinase Receptor tirosina-quinasa (200kDa) de la superfamilia del receptor de la insulina Linfoma anaplásico

Más detalles

Investigador principal: Dra. Àngels Ginès Gibert Hospital Clínic i Provincial de Barcelona Duración: 3 años

Investigador principal: Dra. Àngels Ginès Gibert Hospital Clínic i Provincial de Barcelona Duración: 3 años ECOENDOSCOPIA CON PUNCIÓN ASPIRATIVA CON AGUJA FINA (USE-PAAF) EN LA REESTADIFICACIÓN MEDIASTÍNICA TRAS TERAPIA NEOADYUVANTE EN PACIENTES CON CÁNCER DE PULMÓN DE CÉLULAS NO PEQUEÑAS (CPCNP) Investigador

Más detalles

Enfermedades genéticas

Enfermedades genéticas Enfermedades genéticas Desórdenes genéticos Mutaciones Rearreglos genómicos Variación en número de cromosomas Monogenéticas, heredables en forma mendeliana. Enfermedades genéticas Poligenéticas o complejas,

Más detalles

TaqMan GMO Screening Kit. Part No: 4466334

TaqMan GMO Screening Kit. Part No: 4466334 TaqMan GMO Screening Kit Part No: 4466334 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan mayor

Más detalles

DNA Alliance. Tu aliado en genética humana

DNA Alliance. Tu aliado en genética humana DNA Alliance Tu aliado en genética humana Incidencia y prevalencia de enfermedades de origen genético Actividades de diagnóstico genético 1 Impacto en salud pública 2 Impacto en la actividad económica

Más detalles

Cáncer Mama, biomarcadores de expresión génica

Cáncer Mama, biomarcadores de expresión génica 1 Cáncer Mama, biomarcadores de expresión génica Dr. Aleix Prat Jefe del Grupo de Genómica Traslacional del Instituto de Oncología Vall d'hebron. Oncólogo Médico del Hospital Universitario Vall d'hebron.

Más detalles

Procesamiento de los frotis de Papanicolaou en el Laboratorio de Citopatología

Procesamiento de los frotis de Papanicolaou en el Laboratorio de Citopatología Procesamiento de los frotis de Papanicolaou en el Laboratorio de Citopatología Carlos Zamorano 1 & Julieta Sepúlveda 1 1 Licenciado en Tecnología Médica, U. de Concepción, Concepción, Chile Introducción

Más detalles

Practica la genética Ficha didáctica del profesorado Bachillerato

Practica la genética Ficha didáctica del profesorado Bachillerato Ficha didáctica del profesorado Bachillerato www.eurekamuseoa.es Extracción de ADN Cuál es la función de cada uno de los ingredientes utilizados para realizar la disolución tampón para la visualización

Más detalles

imegen Alfa-1-AT Manual de Usuario Referencia: IMG-211

imegen Alfa-1-AT Manual de Usuario Referencia: IMG-211 Manual de Usuario imegen Alfa-1-AT Genotipado de las mutaciones Glu342Lys (PI-Z) y Glu264Val (PI-S) del gen SERPINA1 mediante PCR a tiempo real Referencia: Fabricado en España Garantías y responsabilidades

Más detalles

Técnicas utilizadas en el estudio de las cromosomopatías y del cáncer. Aplicaciones clínicas.

Técnicas utilizadas en el estudio de las cromosomopatías y del cáncer. Aplicaciones clínicas. Técnicas utilizadas en el estudio de las cromosomopatías y del cáncer. Aplicaciones clínicas. El análisis cromosómico ha proporcionado un conocimiento básico de los cambios genéticos responsables de las

Más detalles

NOTICIAS CIENTÍFICAS: ANÁLISIS

NOTICIAS CIENTÍFICAS: ANÁLISIS NOTICIAS CIENTÍFICAS: ANÁLISIS José M. Ortiz Melón Editor científico e- mail: edicion@ranf.com Lecciones de Genómica del Cáncer En la ultima década los esfuerzos realizados en la secuenciación de muchos

Más detalles

Técnicas de Biología Molecular

Técnicas de Biología Molecular Técnicas de Biología Molecular DNA I. Enzimas de restricción Análisis Las enzimas de restricción fueron aisladas de bacterias; su función natural es proteger contra DNA extraño II. Separación electroforética

Más detalles

Estudio de los los Ganglios Linfáticos

Estudio de los los Ganglios Linfáticos Estudio de los los Ganglios Linfáticos ANTES Linfadenectomía axilar: disecciónde TODOS los ganglios extirpados, hemisección y 1 corte histológicode 1 de las mitades de cadaganglio! AHORA Ganglio centinela:

Más detalles

Inves&gación Clínica en Tumores G- U: Cambios en el proceso de desarrollo y aprobación de nuevos fármacos Madrid 23 Junio 2015

Inves&gación Clínica en Tumores G- U: Cambios en el proceso de desarrollo y aprobación de nuevos fármacos Madrid 23 Junio 2015 Inves&gación Clínica en Tumores G- U: Cambios en el proceso de desarrollo y aprobación de nuevos fármacos Madrid 23 Junio 2015 Enrique González Billalabei1a Servicio de Hematología y Oncología Hospital

Más detalles

Instructivo para la derivación de material

Instructivo para la derivación de material LABORATORIO ESPECIALIZADO DE HEMATOLOGÍA, ONCOLOGÍA Y GENÉTICA Instructivo para la derivación de material 1. Estudios de Anemia: Extendidos de sangre periférica con gota directa de la aguja (sin anticoagulante)

Más detalles

CATÁLOGO DE SERVICIOS PRUEBAS DE APOYO AL DIAGNÓSTICO

CATÁLOGO DE SERVICIOS PRUEBAS DE APOYO AL DIAGNÓSTICO CATÁLOGO DE SERVICIOS PRUEBAS DE APOYO AL DIAGNÓSTICO CENTRO NACIONAL DE INVESTIGACIONES ONCOLÓGICAS Melchor Fernández Almagro, 3, 28929 MADRID Tlf. +34 912246900; www.cnio.es ÍNDICE Identificación mutaciones

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. info@atgen.com.uy www.atgen.com.uy

Más detalles

INFORME DE RESULTADOS-PRUEBA DE PATERNIDAD

INFORME DE RESULTADOS-PRUEBA DE PATERNIDAD INFORME DE RESULTADOS-PRUEBA DE PATERNIDAD T. 976 22 11 33 WWW.BIOSALUD.ORG RESIDENCIAL PARAÍSO, 9 50006 ZARAGOZA -SPAIN- INFORME DE RESULTADOS-PRUEBA DE PATERNIDAD Han sido remitidas al Centro de Análisis

Más detalles

Terapias que bloquean la activación n de receptores de factores de crecimiento

Terapias que bloquean la activación n de receptores de factores de crecimiento Terapias que bloquean la activación n de receptores de factores de crecimiento Evidencia actual Luis A Martinez G.I.O.C Tabla de contenidos Conceptos básicos. b Función n normal del EGFR. Mecanismo de

Más detalles

Ph.D. Cecilia Díaz Oreiro

Ph.D. Cecilia Díaz Oreiro Estandarización de técnicas genómicas y proteómicas de detección de posibles mutaciones en moléculas que median la resistencia a drogas quimioterapéuticas en cáncer de hígado Nombre de la investigación:

Más detalles

OPTIMIZACIÓN TRATAMIENTO ANTI-EGFR. Ruth Vera Oncología Médica

OPTIMIZACIÓN TRATAMIENTO ANTI-EGFR. Ruth Vera Oncología Médica OPTIMIZACIÓN TRATAMIENTO ANTI-EGFR Ruth Vera Oncología Médica OPTIMIZACIÓN TRATAMIENTO anti-egfr OPTIMIZAR quiere decir: Buscar los mejores resultados Planificar una actividad para obtener los mejores

Más detalles

DIAGNÓSTICO GENÉTICO DE PREIMPLANTACIÓN (PGD)

DIAGNÓSTICO GENÉTICO DE PREIMPLANTACIÓN (PGD) DIAGNÓSTICO GENÉTICO DE PREIMPLANTACIÓN (PGD) Las alteraciones genéticas son una importante causa de esterilidad e infertilidad y pueden ser responsables de algunos defectos congénitos. Estas alteraciones

Más detalles

Los retos de las nuevas tecnologías. Eduardo Tizzano Hospital Sant Pau Barcelona y CIBERER U-705

Los retos de las nuevas tecnologías. Eduardo Tizzano Hospital Sant Pau Barcelona y CIBERER U-705 Avances en genética y discapacidad: Los retos de las nuevas tecnologías Eduardo Tizzano Hospital Sant Pau Barcela y CIBERER U-705 Investigación en enfermedades genéticas Investigación básica: en general

Más detalles

CONGRESO DE LA SEAP-AIP

CONGRESO DE LA SEAP-AIP CONGRESO DE LA SEAP-AIP ZARAGOZA 19-21 Mayo 2001 DETERMINACIÓN INMUNOHISTOQUÍMICA DE HER-2 EN CÁNCER DE MAMA Y GÁSTRICO Inmaculada García Pérez Rodrigo López Castro Angel Concha López HUVN. Granada ESTANDARES

Más detalles

Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario

Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario Cuándo debemos sospechar que un cáncer puede ser hereditario? El cáncer es una enfermedad muy frecuente, es fácil que en una

Más detalles

Una de las consecuencias más beneficiosas derivadas del conocimiento

Una de las consecuencias más beneficiosas derivadas del conocimiento PROTEÓMICA Y MEDICINA Fernando Vivanco. Fundación Jiménez Díaz, Madrid Una de las consecuencias más beneficiosas derivadas del conocimiento del genoma humano ha sido el nacimiento y desarrollo de la proteómica.

Más detalles

CÁNCER DE PULMÓN: LO QUE DEBES SABER

CÁNCER DE PULMÓN: LO QUE DEBES SABER CÁNCER DE PULMÓN: LO QUE DEBES SABER 1 CÁNCER DE PULMÓN, INCIDENCIA Y FACTORES DE RIESGO 2 SIGNOS DE ALERTA 3 TOMA NOTA: FALSOS MITOS 4 HACIA UNA TERAPIA PERSONALIZADA 5 GRUPO ESPAÑOL DE CÁNCER DE PULMÓN

Más detalles

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental.

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Gemma Saucedo. Laboratorio Aguas de Barcelona 22-23 de noviembre de 2006 Introducción PCR: Polymerase Chain Reaction

Más detalles

NEOPLASIA LOBULILLAR IN SITU Predictor de riesgo o lesión preinvasora?

NEOPLASIA LOBULILLAR IN SITU Predictor de riesgo o lesión preinvasora? NEOPLASIA LOBULILLAR IN SITU Predictor de riesgo o lesión preinvasora? Dr. Arturo Espinoza N. Anátomo-Patólogo Laboratorio Citolab Mujer de 57 años. Mama izquierda. Biopsia core. Microcalcificaciones agrupadas

Más detalles

Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario

Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario Cuándo debemos sospechar que un cáncer puede ser hereditario? El cáncer es una enfermedad muy frecuente, es fácil que en una

Más detalles

Genómica y transcriptómica para la generación de datos en Evolución

Genómica y transcriptómica para la generación de datos en Evolución recuadro Genómica y transcriptómica para la generación de datos en Evolución Gabriela Bedó Genómica. Sus objetivos Compilar todas las secuencias de un organismo Establecer la localización de los genes

Más detalles

Clonación molecular. Clonar significa hacer copias idénticas

Clonación molecular. Clonar significa hacer copias idénticas INGENIERÍA GENÉTICA Clonación molecular Clonar significa hacer copias idénticas Este término originalmente fue aplicado al procedimiento de aislar una célula y permitirle reproducirse creando una población

Más detalles