Carga viral y subpoblaciones linfocitarias en la infección con VIH- 1. Comparación entre sus determinaciones basales

Tamaño: px
Comenzar la demostración a partir de la página:

Download "Carga viral y subpoblaciones linfocitarias en la infección con VIH- 1. Comparación entre sus determinaciones basales"


1 Revista Mexicana de Patología Clínica 1998; Volumen 45(3): Carga viral y subpoblaciones linfocitarias en la infección con VIH- 1. Comparación entre sus determinaciones basales NOHEMI PATRICIA CASTILLO TORRES GUSTAVO BARRIGA ANGULO CARLOS ARUMIR ESCORZA MARGARITA SOLIS TREJO Hospital de Infectología. Centro Médico Nacional «La Raza», Instituto Mexicano del Seguro Social (IMSS). Laboratorio Clínico. RESUMEN Se determinaron simultáneamente los niveles plasmáticos de ARN del VIH-1 y las cuentas de células T CD4 (+) en 64 pacientes infectados con VIH-1, en diferentes estadios de la infección. Los niveles basales de ARN VIH-1 plasmático (NASBA VIH-1 RNA QT, OT) MR fueron los mejores índices de predicción de la evolución clínica. Las cuentas de células T CD4 (+) consideradas aisladamente, mostraron una gran variabilidad, un limitado rango dinámico y no fueron el mejor método con el cual estratificar a los pacientes. PALABRAS CLAVE: VIH, SIDA, carga viral, linfocitos. ABSTRACT

2 We determined simultaneously in 64 AIDS patients with different stages of disease the basal HIV-1 RNA plasmatic levels and the CD4 (+) T cells subset. HIV-1 RNA basal levels (NASBA HIV-1 RNA QT OT). TM was the best predictor of clinical outcome, CD4 (+) T cells count subset alone substantial variability, exhibit a limited dynamic range and was not the best tool by which stratify patients. KEY WORDS: HIV, AIDS, viral load, lymphocytes. Introducción El pronóstico de los individuos infectados con VIH-1 es variable; en adultos el promedio de tiempo entre la infección y el desarrollo de SIDA es de 10 a 11 años, aunque una proporción importante de individuos (20%) progresa más rápidamente (5 años) y 12% permanece libre de SIDA por más de 15 años. 1 Se han utilizado numerosos parámetros clínicos y de laboratorio para estimar el pronóstico de la infección con VIH-1; la medición de los niveles de células T CD4 (+) han sido utilizados para decidir el inicio de la profilaxis a varias infecciones oportunistas, como un criterio de clasificación de la infección con el VIH-1 y para la definición de caso de SIDA en adultos y en adolescentes. 2 Sin embargo, estudios recientes ha mostrado que la sola determinación de linfocitos CD4 (+) no es buen parámetro en predecir la respuesta clínica a la terapia antiviral, 3 a diferencia de lo que sucede con la determinación de los niveles plasmáticos de ARN que son el índice más adecuado en la predicción de la evolución clínica y en la respuesta al tratamiento antiviral. 4 En este estudio se presenta un análisis comparativo entre los niveles basales de CD4 (+) y los de ARN VIH-1 plasmático en 64 pacientes con diversos estadios de la infección con VIH-1. Material y métodos Se estudiaron un total de 64 pacientes infectados con VIH-1, de diferentes edades, sexos y estadios clínicos (cuadros I y II). En todos se realizaron determinaciones

3 simultáneas de células T CD4 (+) por citometría de flujo (Coulter electronics) MR y de niveles de ARN VIH-1 plasmático (NASBA VIH-1 QT). MR Esta última consiste en la amplificación isotérmica de ácido nucleico de ARN del VIH-1 utilizando tres enzimas: transcriptasa inversa del virus de la mieloblastosis, la T7 ARN polimerasa y la H ARNasa, la cuantificación de ARN del VIH-1 se obtiene por coamplificación competitiva con tres ARN generados in vitro. Los productos obtenidos se detectan separadamente en forma semiautomática utilizando electroquimioluminescencia (figura 1). Cuadro I. Pacientes estudiados, por edad y sexo. Edad (años) Masculino Femenino Total < Total

4 Cuadro II. Estado clínico. 8 Pacientes estudiados. Estado Clínico Número % C A A B C B Total Figura 1. Diagrama de flujo de la prueba cuantitativa NASBA VIH-I O.T (9).

5 Resultados Cincuenta y cinco de los pacientes estudiados (81%) tuvieron cuentas de células CD4 (+) por microlitro por debajo de 500 células y 10,000 copias o más de ARN del VIH-1, nueve pacientes (13.2%) tenían menos de 10,000 copias de ARN-VIH-1 y cuentas de células T CD4 (+) por debajo de 500; y cuatro pacientes mostraban más de 500 células CD4 T (+) y más de 10,000 copias de ARN-VIH-1. La concordancia entre las cuentas de células T CD4 (+) y los niveles de ARN VIH-1 plasmático en todos los pacientes fue tan solo de 81% (Figuras 2 y 3). Figura 2. Correlación CD4(+)/Carga viral VIH-I.

6 Figura 3. Correlación CD4 (+)/carga viral VIH-1.

7 Comentarios El desarrollo de nuevas técnicas de biología molecular diseñadas para detectar el ARN del VIH-1 han permitido estudiar en detalle la dinámica viral y la patogénesis del VIH-1. Ahora sabemos que se producen hasta 10 billones de nuevas partículas virales cada día y el ciclo de vida media en plasma del virus es de 2.6 días; este extraordinario nivel de replicación viral, destrucción celular y reemplazo celular, han llevado a un nuevo concepto en el manejo clínico de los pacientes y en particular de la terapia antiviral. Los niveles de ARN del VIH-1 plasmáticos son relativamente estables aun cuando no se ha iniciado la terapia antirretroviral (variabilidad biológica: 0.3 de logaritmo) por ello sólo cambios sostenidos mayores de 0.5 de logaritmo reflejan cambios biológicos relevantes en el nivel de replicación viral; una terapia antirretroviral efectiva disminuye significativamente los niveles del ARN VIH-1 en plasma una semana después de iniciar el tratamiento. 5

8 Las cuentas de linfocitos CD4 (+) se han considerado como uno de los mejores métodos para predecir la evolución, sin embargo se ha demostrado que esta sola determinación es inadecuada por sí sola para evaluar el pronóstico y la respuesta a la terapia antirretroviral; las cuentas de CD4 están sujetas a enorme variabilidad biológica y muestran un limitado rango dinámico. 6,7 Por todo lo anterior, es recomendable evaluar a los pacientes infectados por VIH-1 con ambas determinaciones simultáneamente, con objeto de lograr mejores posibilidades de éxito terapéutico y pronóstico. BIBLIOGRAFIA 1. Schellekens P, Koot M, Ross M, Farsinette M, Miedema F. Immunologic and virologic markers determining progression to AIDS. Jour Acquired Immunodeficiency Syndrome Human Retrovirology 1995; 10 (Supplement 2) Centers for disease control Revised Guidelines for deforming CD4 + T cell determinations in persons infected with human immunodeficiency virus. MMWR 1997; 46 (RR-2): Rabaud JM, Haley L, Montaner JSG, Murphy C, Januszewska M, Schechter M. Quatification of the variation due to laboratory and phisiologic jources in CD4 lymphocyte counts of clinically stable HIV-infected individuals. Jour Acq Immun Deficie Syndro Human Retrov 1995; 10 (Suppl 2): Mellor JW, Rinaldo CHR, Gupta P, White RM, Tood JA, Kingsley L. Prognosis in HIV- 1 infection predicte by the quantity of virus in plasma. Science 1996; 272: Ho DD. Viral count in HIV infection. Science 1996; 272: Calindo AM. Methods, interpretation and applications of HIV-1 viral load measurements. Clin Microbiol News 1997; Geman B, Kievits T, Nara P, Huisman HG, Jurrions S, Goudsmit J, Lens P. Qualitative and quantitative detection on HIV-1 RNA by nucleic acid sequence based amplification. AIDS 1993; 7 (Suppl 2): S107-S Centers for Disease Control Revised classification system for HIV infection for

9 AIDS among adolescents and adults. M.M.W.R. 1993; 41: Boom R, Sol C.J.A, Salimans M.M.M, Jansen C.L, Wertheim P.M.E, Noordaa J. Rapid and Simple Method for Purification of Nucleic Acid. Journal Clinical Microbiology , 3,


BIBLIOGRAFÍA INTERNACIONAL BIBLIOGRAFÍA INTERNACIONAL Clinical infectious diseases HIV infection is associated with decreased thrombin generation La infección por VIH se asocia con disminución de la generación de trombina Hsue PY

Más detalles


ARTÍCULO ORIGINAL REPRODUCIBILITY OF A QUANTIFICATION ASSAY, NUCLISENS HIV - 1 QT, IN HIV POSITIVE PLASMA SAMPLES Rev Chil Infect (2002); 19 (1): 25-31 ARTÍCULO ORIGINAL Estudio de reproducibilidad del examen de cuantificación de VIH-1 por la técnica Nuclisens HIV-1 QT en muestras de plasma de pacientes infectados

Más detalles



Más detalles

Tenofovir y su relación con osteoporosis en pacientes con VIH

Tenofovir y su relación con osteoporosis en pacientes con VIH ARTÍCULO ORIGINAL Med Int Méx 2015;31:150-154. Tenofovir y su relación con osteoporosis en pacientes con VIH RESUMEN Antecedentes: la osteoporosis, enfermedad con alta prevalencia, se distingue por disminución

Más detalles

Citometría Capilar Volumétrica Nueva Alternativa en la Determinación de Subpoblaciones Linfocitarias

Citometría Capilar Volumétrica Nueva Alternativa en la Determinación de Subpoblaciones Linfocitarias Página 1 de 14 Patologia Clinica 1999; Volumen 46(2): 69-73 Citometría Capilar Volumétrica Nueva Alternativa en la Determinación de Subpoblaciones Linfocitarias NOHENI PATRICIA CASTILLO TORRES GUSTAVO

Más detalles

Manifestaciones clínicas. Cuadro mononucleósido asociado a la primoinfección. Clasificación de la infección VIH.

Manifestaciones clínicas. Cuadro mononucleósido asociado a la primoinfección. Clasificación de la infección VIH. Manifestaciones clínicas. Cuadro mononucleósido asociado a la primoinfección. Clasificación de la infección VIH. Jose Maria Kindelán. Hospital Universitario Reina Sofía. Córdoba I. Historia natral de la

Más detalles


III CONGRESO NACIONAL DE ATENCIÓN FARMACÉUTICA Adherencia a la terapia antirretroviral en pacientes infectados con el virus de la inmunodeficiencia humana que asisten a una clínica universitaria de enfermedades infecciosas en Venezuela. III CONGRESO

Más detalles



Más detalles

Confirmación de la infección por VIH mediante prueba cualitativa de amplificación de ácidos nucleicos

Confirmación de la infección por VIH mediante prueba cualitativa de amplificación de ácidos nucleicos Rev Med IMSS (Mex) 1998; Volumen 36(5): 349-352 APORTACIONES CLINICAS Confirmación de la infección por VIH mediante prueba cualitativa de amplificación de ácidos nucleicos GUSTAVO BARRIGA ANGULO NOHEMI

Más detalles

El Estudio PARTNER. Le han propuesto incorporarse a este estudio porque es parte de una pareja como miembro VIH positivo.

El Estudio PARTNER. Le han propuesto incorporarse a este estudio porque es parte de una pareja como miembro VIH positivo. Información para los participantes y Consentimiento Informado para el miembro de la pareja VIH positivo El Estudio PARTNER El estudio PARTNER se realiza con parejas en las que: (i) uno de los miembros

Más detalles


PCR EN TIEMPO REAL, UNA HERRAMIENTA EN EL PACIENTE TRASPLANTADO PCR EN TIEMPO REAL, UNA HERRAMIENTA EN EL PACIENTE TRASPLANTADO Dra. Carolina Rodríguez Laboratorio Dr. Stamboulian División Biología Molecular Introducción En la actualidad, el paciente trasplantado,

Más detalles

Vacunación antihepatitis B en el paciente con VIH

Vacunación antihepatitis B en el paciente con VIH José Ángel Rodrigo Pendás Servicio de Medicina Preventiva y Epidemiología Hospital Vall d Hebron 24 de abril de 2008 Contenido Importancia de la vacunación antihepatitis B en personas con VIH Inmunogenicidad

Más detalles

Avances recientes en HIV/SIDA: Patogénesis, historia natural y carga viral.

Avances recientes en HIV/SIDA: Patogénesis, historia natural y carga viral. Avances recientes en HIV/SIDA: Patogénesis, historia natural y carga viral. Recent developments in HIV/SIDA: Pathogenesis, natural history and viral load. Campo Rafael E, MD.* Scerpella Ernesto G. MD.*

Más detalles

Juan de Dios Hospital (Costa Rica).

Juan de Dios Hospital (Costa Rica). Investigación Original / Original Research Impacto de la inducción farmacéutica sobre la adherencia de pacientes VIH/SIDA con tratamiento antirretroviral en el Hospital San Juan de Dios (Costa Rica) Impact

Más detalles

Amplicor HIV-1 monitor como standard predictivo en el tratamiento de pacientes HIV-1 positivos

Amplicor HIV-1 monitor como standard predictivo en el tratamiento de pacientes HIV-1 positivos Amplicor HIV-1 monitor como standard predictivo en el tratamiento de pacientes HIV-1 positivos Amplicor HIV-1 monitor in the treatment of HIV-1 positive patients Zulema Heredia Agurto * Ricardo Wimper

Más detalles

1 Diciembre 2013 Día Mundial del VIH/SIDA

1 Diciembre 2013 Día Mundial del VIH/SIDA 1 Diciembre 2013 Día Mundial del VIH/SIDA Se presentan la información más relevante sobre la vigilancia, las tendencias y las políticas públicas. Informe de la situación nacional de VIH/SIDA Índice Situación

Más detalles


POR QUÉ YA NO SE RECOMIENDA ESPERAR 3 MESES PARA HACERSE LA PRUEBA DEL VIH? QUÉ ES LA PRUEBA DEL VIH? La prueba del VIH es la única forma fiable de saber si una persona está o no infectada por el VIH, el virus del sida. Las pruebas de diagnóstico del VIH que se emplean habitualmente

Más detalles

SIDA EN AFRICA. África Holguín 5 Abril 2016


Más detalles

El 33% de las casi 1.000 infecciones por VIH en HSH detectadas en BCN Checkpoint son infecciones recientes

El 33% de las casi 1.000 infecciones por VIH en HSH detectadas en BCN Checkpoint son infecciones recientes El 33% de las casi 1.000 infecciones por VIH en HSH detectadas en BCN Checkpoint son infecciones recientes F. Pujol, F. Pérez, A. Dalmau-Bueno, J. Saz, H. Taboada, G. Marazzi, A. Pérez, A. Carrillo, A.

Más detalles

Los objetivos de las terapias contra VIH se centran en:

Los objetivos de las terapias contra VIH se centran en: I N T R O D U C C I Ó N Una vez que se identificó al VIH como causante del Síndrome de Inmunodeficiencia Adquirida (SIDA), el principal objetivo científico se convirtió en la búsqueda de algún medio para

Más detalles

Modificaciones en la Ficha Técnica o Resumen de las Características del Producto y del Prospecto presentadas por la Agencia Europea de Medicamentos

Modificaciones en la Ficha Técnica o Resumen de las Características del Producto y del Prospecto presentadas por la Agencia Europea de Medicamentos Anexo II Modificaciones en la Ficha Técnica o Resumen de las Características del Producto y del Prospecto presentadas por la Agencia Europea de Medicamentos Esta Ficha Técnica o Resumen de las Características

Más detalles



Más detalles


ALBERTO JIMÉNEZ BENÍTEZ 1º BACH ALBERTO JIMÉNEZ BENÍTEZ 1º BACH 1.) Las características principales del virus (estructura, genoma ) A pesar de su pequeño tamaño, el genoma es muy complejo. El ARN del VIH contiene instrucciones genéticas

Más detalles


LOS SÍNTOMAS DE LA INFECCIÓN AGUDA POR VIH SERÍAN MÁS VARIADOS DE LO QUE SE PENSABA LOS SÍNTOMAS DE LA INFECCIÓN AGUDA POR VIH SERÍAN MÁS VARIADOS DE LO QUE SE PENSABA Se identifican diversos síntomas atípicos de la primo infección, algunos de ellos graves, aunque poco frecuentes Nota:

Más detalles


BIBLIOGRAFÍA INTERNACIONAL BIBLIOGRAFÍA INTERNACIONAL Antiviral Therapy Predicted effect of direct acting antivirals in the current HIV HCV coinfected Predicción del efecto de los agentes antivirales de acción directa en la población

Más detalles


BIBLIOGRAFÍA INTERNACIONAL BIBLIOGRAFÍA INTERNACIONAL Clinical infectious diseases HIV-infected Ugandan adults taking antiretroviral therapy with CD4 counts > 200 cel/µl who discontinue cotrimoxazole prophylaxis have increased risk

Más detalles


PROGRAMA ESPECIAL DE VIH/Sida e ITS, 2013-2018 SECRETARÍA DE SALUD SUBSECRETARÍA DE PREVENCIÓN Y PROMOCIÓN DE LA SALUD PROGRAMA ESPECIAL DE VIH/Sida e ITS, 2013-2018 Dra. Patricia Uribe Zúñiga Directora General Centro Nacional para la Prevención y

Más detalles

Diagnóstico microbiológico de la infección por HIV

Diagnóstico microbiológico de la infección por HIV Diagnóstico microbiológico de la infección por HIV Juan Carlos Rodríguez Díaz S. Microbiología Hospital General Universitario de Alicante E-mail: http://microbiologí

Más detalles

Informe Día Mundial del SIDA 1 de diciembre de 2012

Informe Día Mundial del SIDA 1 de diciembre de 2012 Informe Día Mundial del SIDA 1 de diciembre de 2012 Documentación incluida: Resumen de de Indicadores de Evaluación del PAVSA Situación del VIH-SIDA en Asturias 2011 Actividades del Día Mundial del SIDA

Más detalles



Más detalles


INFECCIÓN POR VIH-1 UN RETO PARA TODOS Página 1 de 6 INFECCIÓN POR VIH-1 UN RETO PARA TODOS Por el Doctor Luis Enrique Soto La infección por el virus de inmunodeficiencia humana tipo 1 (VIH1) y la consecuencia final de esta, el síndrome de

Más detalles

Que es la PrEP (en inglés), o prevención antes de la exposición?

Que es la PrEP (en inglés), o prevención antes de la exposición? Que es la PrEP (en inglés), o prevención antes de la exposición? JULIO DE 2011 Que es la PrEP? Una persona VIH negativa haría uso de la PrEP (abreviación en inglés de prevención pre-exposición o antes

Más detalles

Día mundial del VIH/SIDA. 1º de diciembre

Día mundial del VIH/SIDA. 1º de diciembre Día mundial del VIH/SIDA 1º de diciembre 2015 Situación epidemiológica del VIH/SIDA en Uruguay Los datos del presente informe se obtienen de las notificaciones recibidas en el Departamento de Vigilancia

Más detalles



Más detalles

Inicio de la terapia antirretroviral: Cúal es el límite de CD4+ recomendado?

Inicio de la terapia antirretroviral: Cúal es el límite de CD4+ recomendado? Inicio de la terapia antirretroviral: Cúal es el límite de CD4+ recomendado? Adaptado de Clinical Care Options por la Fundación Apoyarte DHHS 2009: Cuando empezar Recuento de CD4+

Más detalles

1 de diciembre de 2014 DIA MUNDIAL DEL SIDA

1 de diciembre de 2014 DIA MUNDIAL DEL SIDA 1 de diciembre de 2014 DIA MUNDIAL DEL SIDA DIRIGIDA A POBLACIÓN GENERAL Material elaborado por la Subdirección de Promoción de la Salud y Prevención. Qué es el sida? El sida es una enfermedad producida

Más detalles

SUMARIO Infección por VIH y sida en Navarra, 2010 1 Situación de las E.D.O. en Navarra. Semanas 14 a 26 de 2011 6

SUMARIO Infección por VIH y sida en Navarra, 2010 1 Situación de las E.D.O. en Navarra. Semanas 14 a 26 de 2011 6 Nº 64 Septiembre de 2011 SUMARIO Infección por VIH y sida en Navarra, 2010 1 Situación de las E.D.O. en Navarra. Semanas 14 a 26 de 2011 6 INFECCIÓN POR EL VIH Y SIDA EN NAVARRA, 2010 Nuevas infecciones

Más detalles

El pediatra en los tiempos del Sida - 20 años después The pediatrician in AIDS epoch - 20 years later

El pediatra en los tiempos del Sida - 20 años después The pediatrician in AIDS epoch - 20 years later Comentarios / Arch Argent Pediatr 2007;105(5):385-389 / 389 Comentarios El pediatra en los tiempos del Sida - 20 años después The pediatrician in AIDS epoch - 20 years later Dra. M. Susana Rodríguez de

Más detalles

Volumen 18, Revista No. 02 Mayo-Agosto 2014

Volumen 18, Revista No. 02 Mayo-Agosto 2014 Efecto de la función renal basal, a los 12 y 24 meses en pacientes VIH/SIDA que reciben tratamiento antirretroviral (TAR) con Tenofovir, Lopinavir/Ritonavir Dra. Josselin Morales¹ R, Lic. André Choco²,

Más detalles

Evolución de la carga viral, conteo de CD4+, e infecciones oportunistas en pacientes VIH-positivos con tratamiento antirretroviral

Evolución de la carga viral, conteo de CD4+, e infecciones oportunistas en pacientes VIH-positivos con tratamiento antirretroviral Evolución de la carga viral, conteo de CD4+, e infecciones oportunistas en pacientes VIH-positivos con tratamiento antirretroviral Resumen Dr. Joab Velázquez, Dr. Johana Samayoa, Lic. André Choco, Dr.

Más detalles



Más detalles

Estrategia utilizada

Estrategia utilizada Estrategia utilizada 1) Extracción HIV RNA V3 7114 7218 2) One Step RT-PCR (x triplicado) 3) 2 nd PCR (A1 A2 A3) A1 A2 A3 4) Secuencuiación A1 A2 A3 TGTACAAGACCCAACAACAATACAAGAAAAAGTATACATGTAGGACG AGGGAGATCAATTTATGCAACAGAAAAAATAATAGGAGATACAAAAC

Más detalles

Experiencia del tratamiento con lopinavirritonavir en pacientes del programa de infección por VIH en un hospital universitario, Bogotá, Colombia

Experiencia del tratamiento con lopinavirritonavir en pacientes del programa de infección por VIH en un hospital universitario, Bogotá, Colombia JORGE ALBERTO CORTÉS ET. AL ARTÍCULO ORIGINAL Experiencia del tratamiento con lopinavirritonavir en pacientes del programa de infección por VIH en un hospital universitario, Bogotá, Colombia Experience

Más detalles

A 35 años de la caracterización del sida, investigación de vanguardia en el Cieni

A 35 años de la caracterización del sida, investigación de vanguardia en el Cieni A 35 años de la caracterización del sida, investigación de vanguardia en el Cieni Por Violeta Amapola Nava Ciudad de México. 20 de abril de 2016 (Agencia Informativa Conacyt).- Era 1981 cuando algunos

Más detalles


EL SIDA UN PROBLEMA DE TODOS EL SIDA UN PROBLEMA DE TODOS AIDS PROBLEM OF WHOLES Jorge Alcántara Chávez 1 RESUMEN El presente artículo sobre SIDA, muestra el problema desde un contexto internacional, hasta mostrar la epidemiología

Más detalles

Modelos Matemáticos de Poblaciones

Modelos Matemáticos de Poblaciones Capítulo 1 Modelos Matemáticos de Poblaciones 1.1. Introducción Actualmente, en algunos campos de la Ciencia los esfuerzos van dirigidos, dentro de ciertas limitaciones, a conocer el desarrollo de algunos

Más detalles



Más detalles

Artículo original. Arch Argent Pediatr 2009; 107(3):212-220 / 212

Artículo original. Arch Argent Pediatr 2009; 107(3):212-220 / 212 Artículo original Arch Argent Pediatr 2009; 107(3):212-220 / 212 Tratamiento antirretroviral de gran actividad en niños VIH positivos. Evolución de la enfermedad relacionada con parámetros clínicos, inmunológicos

Más detalles


VICEMINISTERIO DE GOBERNANZA Y VIGILANCIA DE LA SALUD VICEMINISTERIO DE GOBERNANZA Y VIGILANCIA DE LA SALUD Subsecretaría Nacional de Vigilancia de la Salud Dirección Nacional de Estrategias de Prevención y Control Estrategia Nacional del VIH/SIDA-ITS TEMA:

Más detalles

APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR. Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina

APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR. Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina BiologÍa Molecular: es una disciplina que se enfoca principalmente en el estudio

Más detalles

Utilidad de distintos marcadores para el manejo de antirretrovirales: carga viral

Utilidad de distintos marcadores para el manejo de antirretrovirales: carga viral Utilidad de distintos marcadores para el manejo de antirretrovirales: carga viral Consuelo Viladés Laborda Servicio de Medicina Interna, Hospital Universitario de Tarragona Joan XXIII, Tarragona Introducción

Más detalles

TRABAJOS ORIGINALES. Células de Langerhans en Piel de Pacientes con Síndrome de Inmunodeficiencia Adquirida

TRABAJOS ORIGINALES. Células de Langerhans en Piel de Pacientes con Síndrome de Inmunodeficiencia Adquirida TRABAJOS ORIGINALES Células de Langerhans en Piel de Pacientes con Síndrome de Inmunodeficiencia Adquirida Dr. Víctor Delgado Gonzales () Dr Ricardo Mori Yto () Dr. Víctor Delgado Fernández () Dr. César

Más detalles


CRONOGRAMA DE ACTIVIDADES ANEXOS CRONOGRAMA DE ACTIVIDADES Año 2014 Actividades Enero Febrero Marzo Abril Mayo Junio Julio Revisión de la Literatura Revisión de los datos Elaboración del Anteproyecto Presentación Anteproyecto Elaboración

Más detalles

100% tamaño real. Alere Pima CD4. Llegamos más lejos

100% tamaño real. Alere Pima CD4. Llegamos más lejos 100% tamaño real Llegamos más lejos El sistema de diagnóstico inmediato de CD4 arroja un resultado a los 20 minutos, guarda una alta correlación con las pruebas de CD4 de los laboratorios y es muy útil

Más detalles



Más detalles


PERFIL DE LOS NUEVOS CABA 2010-2011 PERFIL DE LOS NUEVOS DIAGNÓSTICOS CABA 2010-2011 Distribución de las notificaciones según sexo y estadio clínico al momento del diagnóstico CABA 2010-2011 Estadio % mujeres % hombres SRA 1,9 1,8 Asintomático

Más detalles

NOCIONES DE EPIDEMIOLOGÍA Y DIAGNOSTICO DE HIV. Dra G Carballal Laboratorio de Virología Clínica CEMIC, 2009

NOCIONES DE EPIDEMIOLOGÍA Y DIAGNOSTICO DE HIV. Dra G Carballal Laboratorio de Virología Clínica CEMIC, 2009 NOCIONES DE EPIDEMIOLOGÍA Y DIAGNOSTICO DE HIV Dra G Carballal Laboratorio de Virología Clínica CEMIC, 2009 La Pandemia de SIDA Personas que viven con el HIV/SIDA Total 40 millones Adultos 38 Niños 2 Nuevas

Más detalles

Métodos de laboratorio para el diagnóstico pediátrico del VIH

Métodos de laboratorio para el diagnóstico pediátrico del VIH Métodos de laboratorio para el diagnóstico pediátrico del VIH Presidenta de la Nación Dra. Cristina Fernández de Kirchner Ministro de Salud Dr. Juan Luis Manzur Secretario de Promoción y Programas Sanitarios

Más detalles

2. Conocer el grado de apoptosis celular en el tejido adiposo subcutáneo de estos pacientes.

2. Conocer el grado de apoptosis celular en el tejido adiposo subcutáneo de estos pacientes. MECANISMOS REGULADORES DE LA ADIPOGÉNESIS EN LA LIPODISTROFIA ASOCIADA AL VIH Investigador principal: Dr. Cristòbal Richart Jurado Centro: Hospital Universitari Joan XXIII. Tarragona Duración: 3 años MEMORIA

Más detalles



Más detalles

Efecto sobre el sistema de la coagulación del zumo de frutas y hortalizas peruanas

Efecto sobre el sistema de la coagulación del zumo de frutas y hortalizas peruanas ARTÍCULOS ORIGINALES Efecto sobre el sistema de la coagulación del zumo de frutas y hortalizas peruanas 1,2 1,5. RESUMEN coagulación sobre la que actúa. Material y Métodos: Palabras clave: Effect on the

Más detalles

Juan E. Losa. Hospital U. F. Alcorcón. Universidad Rey Juan Carlos. Es posible diagnosticar antes el VIH en Medicina Interna?

Juan E. Losa. Hospital U. F. Alcorcón. Universidad Rey Juan Carlos. Es posible diagnosticar antes el VIH en Medicina Interna? Juan E. Losa. Hospital U. F. Alcorcón. Universidad Rey Juan Carlos. Es posible diagnosticar antes el VIH en Medicina Interna? Guión 1. Presentación tardía 2. Necesidad de diagnóstico precoz 3. Suficiente

Más detalles



Más detalles


ESTUDIOS DE POBLACIONES Y SUBPOBLACIONES LINFOCITARIAS POR CMF ESTUDIOS DE POBLACIONES Y SUBPOBLACIONES LINFOCITARIAS POR CMF Dra. Mónica Saracco Instituto de Investigaciones Biomédicas en Retrovirus y SIDA (ex CNRS) Aplicaciones Clínicas Analisis de subpoblaciones

Más detalles

Análisis de alternativas para el financiamiento de medicamentos antirretrovirales en República Dominicana, noviembre 2012

Análisis de alternativas para el financiamiento de medicamentos antirretrovirales en República Dominicana, noviembre 2012 Análisis de alternativas para el financiamiento de medicamentos antirretrovirales en República Dominicana, noviembre 2012 Con apoyo de: Systems for Improved Access to Pharmaceuticals and Services (SIAPS)

Más detalles


AVANCES EN LA INFECCIÓN VIH EN PEDIATRIA AVANCES EN LA INFECCIÓN VIH EN PEDIATRIA Juncal Echeverria Lecuona Neonatologia. Hospital Donostia En la tercera decada de la infección VIH, las nuevas terapias antirretrovirales han transformado la enfermedad

Más detalles

Manifestaciones dermatológicas en los pacientes

Manifestaciones dermatológicas en los pacientes Artículo original Manifestaciones dermatológicas en los pacientes con VIH y su correlación con la cantidad de linfocitos CD4 en la Clínica de Infecciones de Trasmisión Sexual del Centro Dermatológico Dr.

Más detalles

Tratamiento continuo contra interrupciones estructuradas del tratamiento

Tratamiento continuo contra interrupciones estructuradas del tratamiento Los beneficios de los antirretrovirales sobrepasan por mucho sus riesgos Evidencia de ensayos clínicos y de la práctica clínica Numerosos ensayos clínicos y datos observacionales (i.e. estudios derivados

Más detalles



Más detalles



Más detalles



Más detalles


7.- INFECCIÓN POR VIRUS DE INMUNODEFICIENCIA HUMANA (VIH) 1.- INTRODUCCION. 7.- INFECCIÓN POR VIRUS DE INMUNODEFICIENCIA HUMANA (VIH) El tratamiento antirretroviral constituye un punto clave en el manejo de las personas que viven con la infección por el VIH,

Más detalles


QUÉ ES LA HEPATITIS C? CÓMO SE CONTAGIA? QUÉ ES LA HEPATITIS C? La hepatitis C es una inflamación del hígado producida por la infección del virus de la hepatitis C. La inflamación puede causar que el hígado no funcione adecuadamente. Se estima

Más detalles

Guía de Detecció n y Diagnó sticó Integral de VIH/SIDA

Guía de Detecció n y Diagnó sticó Integral de VIH/SIDA Guía de Detecció n y Diagnó sticó Integral de VIH/SIDA Ciudad de México, 2011 Guía de Detección y Diagnóstico Integral de VIH/SIDA - 1 - Índice Antecedentes 3 Objetivos 5 Definiciones operativas 5 Resumen

Más detalles

Informe Día Mundial del SIDA 1 de diciembre de 2015

Informe Día Mundial del SIDA 1 de diciembre de 2015 Informe Día Mundial del SIDA 1 de diciembre de 2015 Documentación: Situación del VIH-SIDA en Asturias 2014 Resumen de Indicadores de Evaluación del PAVSA 2003-2014 Actividades del Día Mundial del SIDA

Más detalles

Lo que debemos saber sobre el virus VIH (HIV) y el SIDA (AIDS) Lidia Belkis Archbold Ministerio de Salud Division Interamericana

Lo que debemos saber sobre el virus VIH (HIV) y el SIDA (AIDS) Lidia Belkis Archbold Ministerio de Salud Division Interamericana Lo que debemos saber sobre el virus VIH (HIV) y el SIDA (AIDS) Lidia Belkis Archbold Ministerio de Salud Division Interamericana El virus del VIH Fue descubierto por el equipo de Luc Montagnier, en Francia,

Más detalles

Caracterización de los pacientes en fase sida con infecciones del sistema nervioso central

Caracterización de los pacientes en fase sida con infecciones del sistema nervioso central MEDISAN 2014; 18(4):469 ARTÍCULO ORIGINAL Caracterización de los pacientes en fase sida con infecciones del sistema nervioso central Characterization of aids patients with infections of the central nervous

Más detalles

Coinfección VIH / VHC Juan E. Losa Hospital U. F. Alcorcón. Universidad Rey Juan Carlos Madrid

Coinfección VIH / VHC Juan E. Losa Hospital U. F. Alcorcón. Universidad Rey Juan Carlos Madrid Coinfección VIH / VHC Juan E. Losa Hospital U. F. Alcorcón. Universidad Rey Juan Carlos Madrid Coinfección y Hepatitis víricas: Nuevas soluciones. Guión 1.- Nuevos tratamientos antivhc: un cambio en la

Más detalles

Diversidad Genética del VIH: Importancia para la Salud Pública Global

Diversidad Genética del VIH: Importancia para la Salud Pública Global Diversidad Genética del VIH: Importancia para la Salud Pública Global Alvaro Carrascal, MD, MPH Director, División de Atención de Salud Instituto del SIDA Departamento de Salud del Estado de Nueva York

Más detalles



Más detalles

Técnicas moleculares.

Técnicas moleculares. Técnicas moleculares. DMTV Carolina Acevedo Curso de Microbiología 2015 SÍNTESIS IN VITRO DE UNA GRAN CANTIDAD DE COPIAS DE UN SEGMENTO DE ADN EXISTENTE EN UNA MUESTRA. O sea. Amplificamos en forma exponencial

Más detalles

DOCUMENTO DE CONSENSO. Spanish GESIDA/Nacional AIDS Plan Recommendations for Antiretroviral Therapy in HIV-infected Adults (October 2004)

DOCUMENTO DE CONSENSO. Spanish GESIDA/Nacional AIDS Plan Recommendations for Antiretroviral Therapy in HIV-infected Adults (October 2004) DOCUMENTO DE CONSENSO Recomendaciones de GESIDA/Plan Nacional sobre el Sida respecto al tratamiento antirretroviral en pacientes adultos infectados por el VIH (octubre 2004) José Antonio Iribarren a, Pablo

Más detalles



Más detalles

GUÍA DE PRÁCTICA CLÍNICA. Detección Precoz del Cáncer de Próstata. Dr. Pablo González Granda

GUÍA DE PRÁCTICA CLÍNICA. Detección Precoz del Cáncer de Próstata. Dr. Pablo González Granda Dr. Pablo González Granda Año 2013 - Revisión: 0 Página 1 de 6 Documento de Base Early Detection of Prostate Cancer: American Urological Association (disponible en

Más detalles


BIBLIOGRAFÍA COMENTADA BIBLIOGRAFÍA COMENTADA Gastroenterology An IL-28B polymorphism determines treatment response of hepatitis C virus genotype 2 or 3 patients who do not achieve a rapid virologic response Un polimorfismo

Más detalles

Información para los participantes y Consentimiento Informado para el miembro de la pareja VIH negativo. El Estudio PARTNER

Información para los participantes y Consentimiento Informado para el miembro de la pareja VIH negativo. El Estudio PARTNER Información para los participantes y Consentimiento Informado para el miembro de la pareja VIH negativo El Estudio PARTNER El estudio PARTNER se realiza con parejas en las que: (i) uno de los miembros

Más detalles

Perinatal Transmisión al bebé, durante el embarazo, parto o lactancia.

Perinatal Transmisión al bebé, durante el embarazo, parto o lactancia. Dr. Horacio Salomón Investigador Principal del CONICET Director del INBIRS (Ex-CNRSIDA) UBA-CONICET Contacto sexual Relaciones sexuales sin protección por contacto directo con fluidos corporales como secreciones

Más detalles

Índice. Prólogo... 11. Introducción... 13. Capítulo Uno Informe del auditor. Capítulo Dos Informe del auditor con salvedades

Índice. Prólogo... 11. Introducción... 13. Capítulo Uno Informe del auditor. Capítulo Dos Informe del auditor con salvedades Índice Capítulo Uno Informe del auditor Generalidades... 17 Modelo de informe del auditor Estados financieros comparativos... 17 Modelo de informe del auditor Cifras correspondientes de periodos anteriores...

Más detalles

Prácticas de riesgo para transmisión de VIH en adultos de la ciudad de General Elizardo Aquino, Diciembre 2014 Enero 2015. Paraguay.

Prácticas de riesgo para transmisión de VIH en adultos de la ciudad de General Elizardo Aquino, Diciembre 2014 Enero 2015. Paraguay. Prácticas de riesgo para transmisión de VIH en adultos de la ciudad de General Elizardo Aquino, Diciembre 2014 Enero 2015. Paraguay. 1. 2 RESUMEN: Material y Métodos: Estudio observacional, descriptivo

Más detalles

Familia: Retroviridae. Género: Lentivirus. Diámetro: 120 nm. Especies: HIV 1, HIV 2. Genoma: 2 ARN monocatenarios positivos.

Familia: Retroviridae. Género: Lentivirus. Diámetro: 120 nm. Especies: HIV 1, HIV 2. Genoma: 2 ARN monocatenarios positivos. 30 de Agosto 2010 Bioq. Alvarez, Juliana Bioq. Archuby, Daniela El Síndrome S Inflamatorio de Reconstitución Inmunológica (IRIS), ocurre en una subpoblación n de pacientes infectados por HIV (10-30%) durante

Más detalles



Más detalles


NOTIFICACIÓN DE CASOS DE NEUMONÍA POR LEGIONELLA. DINAMARCA 2014. NOTIFICACIÓN DE CASOS DE NEUMONÍA POR LEGIONELLA. DINAMARCA 2014. En 2014, se han declarado un total de 157 casos de neumonía por legionella (LP) en Dinamarca. La media de edad fue de 65 años (rango de

Más detalles

Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio

Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio El VIRUS PRUEBAS PRESUNTIVAS ELISA: es la prueba convencional para la detección

Más detalles



Más detalles

GPC. Guía de Referencia Rápida. Tratamiento Antirretroviral del Paciente Pediátrico con Infección por el VIH. Guía de Práctica Clínica

GPC. Guía de Referencia Rápida. Tratamiento Antirretroviral del Paciente Pediátrico con Infección por el VIH. Guía de Práctica Clínica Guía de Referencia Rápida Tratamiento Antirretroviral del Paciente Pediátrico con Infección por el VIH GPC Guía de Práctica Clínica Número de Registro: IMSS-196-10 Guía de Referencia Rápida CIE-10: 1-13

Más detalles


HOSPITAL REGIONAL DE VERACRUZ SECRETARIA DE SALUD PROTOCOLO DE TESIS TÍTULO: HOSPITAL REGIONAL DE VERACRUZ SECRETARIA DE SALUD PROTOCOLO DE TESIS TÍTULO: Prevalencia de infecciones oportunistas en pacientes VIH positivo, y su relación con la necesidad de hospitalización, asociados

Más detalles

Algoritmos diagnósticos para VIH

Algoritmos diagnósticos para VIH Algoritmos diagnósticos para VIH ALGORITMOS DIAGNÓSTICOS PARA VIH Los avances tecnológicos de los distintos ensayos para el tamizaje y diagnóstico de la infección por VIH, conjuntamente con la necesidad

Más detalles



Más detalles

Instrucciones. VIH Célula CD4 Carga viral Terapia combinada Resistencia a los medicamentos

Instrucciones. VIH Célula CD4 Carga viral Terapia combinada Resistencia a los medicamentos Competencias Esenciales: VIH/SIDA: Medicamentos - los Efectos Secundarios & la Resistencia Pregunte al Experto: Dramatización la Lucha Contra el Virus* SOBRE ESTA ACTIVIDAD Tiempo: 35 minutos Objetivos:

Más detalles



Más detalles