Genes con islas CpG amplificados con la mezcla formamida, albúmina sérica bovina y dimetilsulfóxido*

Tamaño: px
Comenzar la demostración a partir de la página:

Download "Genes con islas CpG amplificados con la mezcla formamida, albúmina sérica bovina y dimetilsulfóxido*"

Transcripción

1 Biología Molecular Genes con islas CpG amplificaos con la mezcla formamia, albúmina sérica bovina y imetilsulfóxio* CG-rich genes amplifie with the formamie, bovine seric albumin y imethylsulfoxie mix Genes com Ilhas CpG amplificaos com a mistura formamia, albumina sérica bovina, e imetilsulfóxio `` Miriam Carolina Martínez-López 1, Frey De la Cruz-Ruiz 2, José Luis Cortes-Peñaloza 3, Daniel Caena-Sanoval 2, Erasmo Zamarrón-Licona 2 1 Prof. Inv. Universia Juárez Autónoma e Tabasco, México 2 Estuiante e la Maestría en Ciencias Básicas Bioméicas - UJAT, México 3 Coorinaor el Programa e Maestría en Ciencias Básicas Bioméicas - UJAT, México * Proyecto financiao: FOMIX Apoyo a CA Consoliaos Resumen Diversos aitivos químicos han sio utilizaos para garantizar la polimerización e genes con islas CpG. El objetivo e este trabajo fue iseñar una mezcla potenciaora e PCR para amplificar genes con islas CpG. Con ese fin se analizaron fragmentos e los genes IRS2 y HNF1α con el programa EMBOSS CpG Report. Los iniciaores se iseñaron con el programa Primer 3 y se analizaron con el programa e-pcr. Se usaron tres aitivos químicos: Albúmina sérica bovina (0,1µg/µL), imetilsulfóxio (5%) y formamia (5%) para 5 ensayos e PCR: os usano un solo aitivo, os combinano os aitivos y uno combinano tres aitivos. Las amplificaciones con las mezclas se realizaron con las enzimas Taq Nativa, taq Recombinante y Taq Platinum. La calia e los amplicones se probó por secuenciación. Fragmentos sin islas CpG (HNF-1α) amplificaron con las tres enzimas, sin el uso e los aitivos pero presentaron problemas e pureza en la secuenciación. Los fragmentos el gen IRS2 con islas CpG amplificaron sólo con la combinación e tres aitivos imetilsulfóxio, albúmina sérica bovina y formamia, inepenientemente e la enzima usaa, las secuencias fueron limpias. Se concluye que la mezcla e tres aitivos es una solución que permite obtener amplicones e alta calia en genes con islas CpG, con cromatogramas limpios en la secuenciación. Palabras clave: islas CpG * potenciaores e reacción en caena e la polimerasa* gen sustrato el receptor e la insulina 2 * gen factor nuclear el hepatocito 1α Acta Bioquímica Clínica Latinoamericana Incorporaa al Chemical Abstract Service. Cóigo bibliográfico: ABCLDL. ISSN ISSN en línea ISSN X (CD-ROM) Summary Several chemical aitives have been use to assure polymerization in CpG islans.the aim of the present work was to esign a PCR enhancer mixture in orer to amplify GC-rich genes. Fragments of IRS2 an HNF1α genes were analyze using EMBOSS CpG Report Software. Primers were esigne with the Primer3 Software an were teste with epcr Software. Three aitives Acta Bioquím Bioquim Clín Latinoam 2012; (2):

2 286 Martínez-López MC et al. ADN. Las islas CpG en la secuencia e ADN son inicaores e que la temperatura e esnaturalización será elevaa al momento e la amplificación. Debio a que la alta ensia e islas CpG en la secuencia e ADN ha mostrao ser un interferente e la PCR, iversos autores han propuesto a través el tiempo varias técnicas para resolver el problema e la no amplificación, epenieno e las características intrínsecas e caa gen (5-11). Las aportaciones metoológicas para la amplificación por PCR van ese cambios físicos en la activación e la enzima y esnaturalización e la hebra e ADN como la hot-start (5), hasta el empleo e manera iniviual e moléculas orgánicas potenciaoras e la reacción e PCR como: Betaina (6), DMSO (7), formamia (8) y BSA (9) (10). Algunos contaminantes remanentes en la preparación e la muestra e ADN también pueen ser potentes inhibiores urante la preparación e la muestra biológica, por ejemplo si es extraía e sangre total one el cloruro e hierro o la hemina, prouctos e la egraación e la hemoglobina pueen inhibir la reacción e PCR (11). En este trabajo se analizaron fragmentos e los genes sustrato receptor e la insulina 2 (IRS2) y factor nuclear el hepatocito1α (HNF1α), utilizano el primewere use: BSA (0.1μg/μL), DMSO (5%) an formamie (5%), in five PCR assays, two using one aitive, two combining two aitives an one with all aitives. DNA sequences were amplifie with the following enzymes: Native Taq, recombinant Taq an platinum Taq DNA polymerase. Amplicon quality was examine by sequencing. HNF1α gene was amplifie without aitives; however, the sequences were not amplifie an showe purity problems in sequencing. The gene fragments IRS2 with CpG islans were amplifie with aitives DMSO, BSA an Formamia mixture, notwithstaning the enzyme use. These sequences were clean. DMSO-BSA-Formamie mixture can be a solution to obtain GC-rich DNA amplicons with such a high quality that it generates neat chromatograms uring sequencing. Key wors: CpG islan * chemistry enhancer polymerase chain reaction * insulin receptor substrate 2 gene * hepatic nuclear factor 1α gene Resumo Diversos aitivos químicos têm sio utilizaos para garantir a polimerização e genes com ilhas CpG. O objetivo o trabalho foi esenhar uma mistura que potencie PCR para amplificar genes com ilhas CpG. Para esta finaliae foram analisaos fragmentos os genes IRS2 e HNF1α com o programa EMBOSS CpG Report. Os iniciaores foram esenhaos com o programa Primer 3 e se analisaram com o programa e-pcr. Foram utilizaos três aitivos químicos: Albumina sérica bovina (0,1µg/µlL, Dimetilsulfóxio (5%) e formamia (5%) para 5 ensaios e PCR: ois usano um único aitivo, ois combinano ois aitivos e um combinano três aitivos. As amplificações com as misturas se realizaram com as enzimas, Taq Nativa, taq Recombinante e Taq Platinum. A qualiae as ampliações foi provaa por sequenciação. Fragmentos sem ilhas CpG (HNF-1α) amplificaram com as três enzimas, sem o uso os aitivos porém apresentaram problemas e pureza na sequenciação. Os fragmentos o gene IRS2 com ilhas CpG amplificaram apenas com a combinação e três aitivos imetilsulfóxio, albumina sérica bovina e formamia, inepenentemente a enzima usaa, as sequências foram limpas. A conclusão que a mistura e três aitivos é uma solução que permite obter ampliações e alta qualiae em genes com ilhas CpG, com cromatogramas limpos na secuenciação. Palavras chaves: ilhas CpG* potenciaores e reação em caeia a polimerase * gene substrato receptor a insulina 2 * gene fator nuclear o hepatócito 1α Introucción Las secuencias ricas en el inucleótio Citosina-Guanina (islas CpG)se encuentran roeano la región el promotor así como los sitios hot-spot o sitios calientes para las mutaciones en los genes; por su ubicación son las responsables en el silenciamiento e la expresión e genes tejio-específico en los perfiles e expresión irectos (1).El arreglo en grupos orenaos e los inucleótios CG o regiones isocóricas, prouce una gran región e ADN con un alto grao e temperaturas e fusión o esnaturalización, crea fuertes enlaces en las hebras complementarias y la interacción e la oble hebra con las moléculas e agua hace más fuerte la estabilia e la conformación B el ADN y las hace menos susceptible e esnaturalizar (2) (3). El inucleótio CG necesita 6,9 Kcal/mol para romper este enlace a iferencia el inucleótio AT que sólo necesita 5 Kcal/mol (4). La Reacción en Caena e la Polimerasa (PCR) es la técnica e iagnóstico molecular más utilizaa actualmente para la búsquea e mutaciones. La temperatura meia (Tm) para los ciclos e reacción epene e las características biofísicas e la secuencia e los iniciaores y e la secuencia el

3 Amplificación e genes con islas CpG con aitivos químicos 287 ro como problema y el seguno como control. El gen IRS 2 (12), tiene un único exón e 4017 pb y coifica para una proteína clave en las vías e señalización e la insulina. El gen HNF 1 α (13) consta e 10 exones y coifica para un factor e transcripción el gen e la insulina. El objetivo e este proyecto fue iseñar una mezcla potenciaora que permita obtener un alto renimiento, especificia y sensibilia en los prouctos e reacción e PCR, en el iagnóstico e enfermeaes con genes con alto porcentaje e islas CpG. Materiales y Métoos El ADN genómico se obtuvo e muestras e sangre meiante la ruptura e la membrana celular e los leucocitos con el equipo Wizar Genomic DNA purification (Promega, Maison, Wi, EE.UU.). Posterior a la extracción, la integria el ADN fue corroboraa meiante corrimiento electroforético en gel e agarosa al 1% y tanto la pureza como la concentración e éste, se estimó en un espectrofotómetro e luz ultravioleta a una longitu e ona e 260 nm y 280 nm (Smart Spec 3000, Bio Ra, EE.UU.). Las secuencias e los genes IRS 2 (NM_003749) y HNF 1 α (NM_ ) se obtuvieron e la base e atos Gen Bank (www.ncbi.nlm.nih.gov). Se iviió al gen IRS2 en tres fragmentos e acuero a los sitios hot-spot en: IRS 2 A, IRS 2 B, IRS 2 C. En el gen HNF 1 α se analizaron los fragmentos el exón 1, 2 y 3. Los iniciaores se iseñaron con el programa Primer 3: primer tools (http://biotools. umassme.eu/bioapps/primer3_www.cgi) para IRS 2 y HNF 1 α. Una vez obtenios los iniciaores se les realizó una PCRinsilico con el programa epcr el GenBank (www.ncbi.nlm.nih.gov). Con el programa EMBOSS CpG report (14) se eterminó la presencia e islas CpG en caa fragmento estuiao. Se iseñaron cinco experimentos para caa fragmento e los genes, con tres potenciaores orgánicos, BSA (no. e cat. A G SIGMA), formamia (no. eµl cat USB) y DMSO (no e cat SIGMA). Caa uno e los ensayos fue corrio con tres iferentes tipos e enzima polimerasa, Taq nativa (Promega), Taq recombinante (Invitrogen) y Taq Platinum (Invitrogen). Las os últimas enzimas son recomenaas para iversos problemas e amplificación. Caa uno e los ensayos se realizó por triplicao. La mezcla convencional e PCR se preparó con 100 ng e ADN genómico, 0,4 µm e los iniciaores, ph 8,5, Taq DNA polimerasa 5 U/µL, NTPs 400 µm, MgCl 3 mm y agua libre e nucleasas (Promega, catálogo # M7123). Se agregó a caa ensayo: 1.- formamia (5%); 2.- DMSO (5%); 3.- BSA (0,1 µg/µl) más formamia (5%); 4.- BSA (0,1 µg/µl) más DMSO (5%) y 5.- BSA (0,1µg/µL) más DMSO (5%) más formamia (5%). Finalmente se agregó una gota e 18 µl e aceite mineral para prevenir la evaporación e la mezcla e PCR. La reacción e PCR se inició con un paso e esnaturalización inicial e (5 min, 96 C); 30 ciclos que comprenen esnaturalización (40s, 95 C), alineamiento (40s a: 52 C, 59 C y 54 C para IRS2 y 64 C, 61 C y 62 C para HNF1α), y elongación (40s, 72 C), y un posterior paso e elongación (5 min, 72 C). Se analizaron los amplicones meiante electroforesis (80 volts urante 5 min) en gel e agarosa al 1%, utilizano como marcaor e peso molecular DNA laer (Invitrogen, catálogo # ). Después e haber obtenio el fragmento e ADN por purificación meiante la técnica por columna iónica (15) (Purelink, Quick Gel Extraction Kit, Invitrogen) se llevó a cabo la secuenciación (ABI, Prisma 3100, e 16 capilares) para conocer la conformación e nucleótios e caa uno e los fragmentos amplificaos, la mezcla e reacción e Big Dye (3 µl Buffer 3X más 2 µl el Kit Big Dye más 50 ng el proucto e la PCR más 1 µl e caa Primer a 3,2 pmoles µl, llevar a un volumen final e 20 µl) se sometió a 95 C por 5 min, espués se purificó, liofilizó y reconstituyó la muestra en un volumen e 20 µl H 2 O y se colocó en las columnas el secuenciaor. En el caso e los amplicones el gen HNF 1 α fue necesario agregar un pos tratamiento con DMSO (5%). Resultaos CARACTERIZACIÓN DE LA MUESTRA Las características biofísicas e los fragmentos fueron las siguientes: en el fragmento A el IRS2 el porcentaje e CG es 69% con os islas CpG una e 58 nt y otra e 66 nt. En el fragmento B el porcentaje e CG fue e 73% con os islas e 59 nt y otra e 114 nt. En el fragmento C el mismo gen el porcentaje e CG es e 75% con una isla e 179 nt (Figura 1).Los fragmentos el gen HNF1α no presentaron islas CpG y el porcentaje e CG estuvo por ebajo e los segmentos el gen IRS2 (Tabla I). En el análisis in silico e los fragmentos e los genes IRS2 y HNF 1α, se emostró que son específicos, el tamaño e los fragmentos esperaos, el sitio e amplificación, el cromosoma corresponiente al gen, el número e hits y la ausencia total e gaps en el ADN genómico (atos no presentaos). AMPLIFICACIÓN BIOQUÍMICA DE LOS SEGMENTOS El corrimiento electroforético e los prouctos e la PCR convencional muestra las inespecificiaes o no amplificación e los fragmentos el IRS 2, en comparación con lo observao en los fragmentos el gen HNF1α que amplifica e manera eficiente e inepenientemente e la enzima con la que fue trataa, corroborano los resultaos obtenios en

4 288 Martínez-López MC et al. D e n s i a D e n s i a D e n s i a 0,0 0,2 0,4 0,6 0,8 1,0 1,2 0,0 0,2 0,4 0,6 0,8 0,0 0,2 0,4 0,6 0,8 SEGMENTO A 2 ISLAS LONGITUD LONGITUD N e nucleótios SEGMENTO B LONGITUD 59 LONGITUD ISLAS N e nucleótios SEGMENTO C LONGITUD 58 1 ISLA N e nucleótios Figura 1. Las islas CpG se obtienen e la ensia el inucleótio CG (abscisas) contra el número e nucleótios (orenaas). Los picos en la gráfica hacen referencia a la isla y al número e nucleótios presente en ésta. la epcr para este gen en comparación el gen IRS2 (Figura 2 A). La ébil o inespecífica amplificación con un aitivo se ebe a las regiones isocóricas, las cuales proveen mayores temperaturas e fusión o e esnaturalización locales provocano que los aitivos formamia y DMSO no sean lo suficientemente efectivos en el mejoramiento e los ciclos e polimerización en la amplificación e los segmentos el IRS 2 (Figura 2 B, C). La electroforesis e los prouctos e la PCR con la combinación e los aitivos BSA (0,1 µg/µl) más formamia 5%, revela que con la GoTaq hay amplificaciones el tamaño esperao, sin embargo, con las enzimas Taq Recombinante y Taq Platinum fue muy ineficiente la amplificación. Se obtienen los amplicones esperaos para el gen HNF 1α (Figura 3 A). La mezcla e aitivos entre BSA y DMSO es menos efectiva que la escrita arriba. En relación a la Go Taq se observa que el único amplicon Tabla 1. Características físico-químicas y número e islas CpG en los genes IRS 2 y HNF 1α. El tamaño e la isla se especifica en la columna enominaa Ubicación e la isla. La G en Kcal/mol se ha obtenio a partir e las Islas CpG en el caso el gen IRS 2 y en el caso el HNF 1α e la ensia el inucleótio CG. GENES FRAGMENTOS PORCENTAJES TAMAÑO AMPLIACIÓN NÚMERO ISLAS A T G C GC Pb CpG UBICACIÓN DE LA ISLA ΔG Kcal/ Mol Segmento A IRS2 Segmento B Segmento C Exón HNFa Exón Exón

5 Amplificación e genes con islas CpG con aitivos químicos 289 Pb A B C Go Taq Taq Recombinante Taq Platinum Go Taq Taq Recombinante Taq Platinum Go Taq Taq Recombinante Taq Platinum MW A B C A B C A B C MW A B C A B C A B C MW A B C A B C A B C 600 IRS MW MW MW HNF 1 a Figura 2. Electroforesis en gel e agarosa al 1% e los prouctos e PCR. Panel A, sin aitivo. Panel B, Formamia. Pane lc DMSO. MW marcaor e peso molecular (laer 100 pb, Invitrogene). En el gen IRS 2 las columnas corresponen a los segmentos A, B y C con las enzimas Go Taq, Taq Recombinante y Taq Platinum. En el Gen HNF1α las columnas corresponen a los exones 1, 2 y 3 con las enzimas Go Taq, Taq Recombinante y Taq Platinum. obtenio fue el fragmento C, los otros os fragmentos son inespecíficos. Con las otras os enzimas no hubo amplificación alguna (Figura 3 B). El gen HNF 1α se sigue amplificano e forma semejante a los casos anteriores a iferencia el exón 2 con la enzima Taq Platinum que al parecer esta mezcla interfiere con la polimerización. La reacción e PCR realizaa con los aitivos BSA (0,1 µg/µl), DMSO (5%) y formamia (5%) permite amortiguar el ruio e fono que presenta la secuencia el gen IRS 2 ebio a las islas CpG. Esta mezcla cee energía necesaria para esnaturalizar la oble hebra y evita la formación e estructuras secunarias en la hebra monocatenaria el gen, así como mejora la estabilia térmica e los iniciaores y evitar la asorción e los reactivos por la pare e los tubos permitieno obtener los amplicones esperaos (Figura 3 C). Los amplicones para el gen HNF 1α también se pueen apreciar con esta mezcla, no obstante, el exón 2 con la enzima Go Taq no amplifica proucto alguno. CROMATOGRAMAS DE LOS FRAGMENTOS AMPLIFICADOS CON Y SIN LA MEZCLA DE ADITIVOS El gen HNF 1α se puee amplificar meiante la PCR sin la necesia e ser tratao con la mezcla e aitivos o con tratamientos físicos. Sin embargo, se observaron cromatogramas e baja calia al secuenciar los amplicones e este gen (Figura 4 A). Debio a los interferentes para obtener las secuencias e los exones el gen HNF 1α, se optó por realizar un tratamiento extra. A la mezcla e reacción e la secuencia se agregó DMSO (5%) [16], mejorano la calia el cromatograma e los exones el HNF 1α (Figura 4 A). Un excelente cromatograma se obtuvo e la secuenciación e los amplicones el IRS2 obtenios con la mezcla por PCR, como se emuestra en la Figura 4 B. Caa amplicon se secuenció por triplicao con muestras iferentes para emostrar la reproucibilia e esta metoología. Pb 600 IRS A B C Go Taq Taq Recombinante Taq Platinum Go Taq Taq Recombinante Taq Platinum Go Taq Taq Recombinante Taq Platinum MW A B C A B C A B C MW A B C A B C A B C MW A B C A B C A B C HNF 1 a 600 MW MW MW Figura 3. Electroforesis en gel e agarosa al 1% e los prouctos e PCR. Panel A. BSA-Formamia. Panel B. BSA- DMSO. Panel C. BSA-DMSO-Formamia. MW. marcaor e peso molecular (laer 100 pb, Invitrogene). En el gen IRS 2 las columnas corresponen los fragmentos A, B y C para las enzimas Go Taq, Taq Recombinante y Taq Platinum. En el Gen HNF 1αlas columnas corresponen a los exones 1, 2 y 3 con las enzimas Go Taq, Taq Recombinante y Taq Platinum.

6 290 Martínez-López MC et al. Figura 4. Cromatograma e la secuencia e nucleótios el exón 3 el HNF 1α y el fragmento C el IRS 2. Panel A cromatograma el exón 3, el gen HNF 1α, amplificaa sin aitivos y cromatograma e la secuencia e nucleótios con pos tratamiento con DMSO (5%). Panel B cromatograma e la secuencia e nucleótios el segmento C obtenia, con la mezcla e aitivos y sin pos tratamientos en la mezcla e secuenciación. Discusión y Conclusiones El análisis físico-químico e las islas CpG en la secuencia el gen IRS 2 reveló la formación e estructuras secunarias y la ineficiente separación e la hebra e ADN como consecuencia el aumento e la ΔG por el inucleótio CG el cual es e 6,9 Kcal/ mol (4). El potenciaor químico-formamia (8) reuce la temperatura e fusión e los úplex e ácios nucleícos y es ampliamente usao para mejorar la especificia en la amplificación e muchos fragmentos e ADN con alto contenio el inucleótio CG. El resultao e la amplificación sólo con este aitivo fue poco prometeor en este trabajo ebio a que las amplificaciones fueron inespecíficas o no amplifico. La enzima que mejor funcionó con formamia fue la Go Taq nativa. La activia e las enzimas Taq Platinum y Taq Recombinante fue eficiente ebio a que la formamia no es capaz e interferir en la formación e las estructuras secunarias en la hebra monocatenaria el ADN, lo que propicia la formación e amplicones e bajo renimiento, tamaños no eseaos o simplemente no se amplificó (Figura 2 B). Se ha utilizao al DMSO (18) como agente estabilizante e las estructuras secunarias para evitar la interferencia en la activia e polimerización. Ambos solventes, DMSO y formamia afectan la estabilia térmica e los iniciaores mientras que el DMSO solo regula la estabilia e la hebra simple el ADN y el perfil e la activia catalítica e la ADN Polimerasa. Estas moléculas se han escrito como agentes potenciaores iniviuales para la PCR. En este trabajo no se encontraron los resultaos esperaos e manera inepeniente (8). Diversos autores (9) (10) (17) consieran que la BSA en la mezcla e reacción es inispensable porque permite superar fallos en la amplificación ebio a su capacia para proporcionar estabilia a la Taq Polimerasa y reucir la péria e reactivo a través e la asorción por la pare el tubo. Como la extracción el ADN genómico fue e sangre total, es posible que contaminantes en la extracción, como hemina, bilirrubina, FeCl 3, fueron isminuios con la BSA, e tal forma que la aición e BSA a la reacción e PCR brinó estabilia a la enzima por la remoción e estos agentes interferentes. La mezcla entre formamia (5%) más BSA (0,1 µg/µl) fue probaa para mejorar el renimiento en la reacción e polimerización, obtenieno resultaos con calia mejoraa, más no eficiente. De forma similar se probó la combinación BSA (0,1 µg/µl) más DMSO (5%) con resultaos parciales. En este trabajo se observó que para amplificar los fragmentos el gen IRS 2 se tenían que superar tres características inherentes a la secuencia e este gen; superar la energía libre e activación necesaria para romper los tres enlaces e hirógeno el inucleótio CG, evitar la formación e estructuras secunarias como consecuencia e las islas CpG y estabilizar la enzima Taq Polimerasa. Aemás e estas tres características en relación a la naturaleza el templao e ADN a amplificar, fue elemental tomar a consieración las características e los aitivos: alta potencia, alta especificia y amplio rango e especificia o ventana e aplicabilia, los cuales son factores que hacen a un aitivo ieal (19).

7 Amplificación e genes con islas CpG con aitivos químicos 291 Una amplia ventana e aplicabilia incrementa la probabilia e ientificar un aitivo efectivo urante la búsquea inicial y también incrementa la probabilia el renimiento e resultaos positivos para una variea e amplicones (19). De tal manera que la correcta amplificación e caa uno e los amplicones se obtuvo cuano se combinaron los aitivos BSA (0,1 µg/ µl) (20) más DMSO (5%) (21) más formamia (5%) (22), permitieno obtener alta eficiencia cualitativa y cuantitativa en los amplicones inepenientemente e la enzima: Go Taq, Taq Platinum o Taq Recombinante. Esta mezcla permitió obtener fragmentos ifíciles e amplificar el gen IRS 2 porque presentaban porcentajes e CG e 69%, 73% y 75%. Por otro lao permitió que en la secuenciación se obtuvieran cromatogramas limpios para la lectura y análisis, Figura 4 C. En contraste en la literatura se puee observar que hay secuencias e ADN que son amplificaos con la PCR sin ningún problema pero son resistentes a la secuenciación obtenieno un cromatograma e muy baja calia (Figura 4 A) a no ser que sean trataos con proceimientos extras (16) que permitan obtener el resultao esperao. Obtener una secuencia limpia y e alta calia es inispensable en estuios e análisis e SNPs, clonación, mapeo genético, construcción e bases e atos e secuencias e genes completos one se realizan análisis filogenéticos en relación a haplotipos específicos, eriva génica o BLAST. Se concluye que la combinación e los aitivos BSA más DMSO más formamia- es una solución efectiva potenciaora e la reacción e PCR, lo que permite en genes con islas CpG obtener amplicones e alta calia tanto cualitativa como cuantitativamente. Los amplicones son e tal calia y especificia que no se necesita realizar tratamientos extras para los ciclos e secuenciación, lo que permite obtener secuencias limpias para el análisis e SNPs en genes ricos en CG. AGRADECIMIENTOS Este proyecto fue financiao por el FOMIX en el proyecto e Apoyo a CA Consoliaos, así como por los recursos propios el Laboratorio Clínico e la UJAT. CORRESPONDENCIA DRA. CAROLINA MARTÍNEZ LÓPEZ Centro e Investigación División Acaémica Ciencias e la Salu Universia Juárez Autónoma e Tabasco (UJAT) Av. Ménez 2838-A COL TAMULTÉ CP Referencias bibliográficas 1. Roríguez-Dorantes M, Téllez-Ascencio N, A-Cerbón M, López M, Cervantes A. Metilación el ADN: un fenómeno epigenético e importancia méica. Rev Invest Clin 2004; 56: L-Oliver J, Carpena P, Román-Rolán R, Mata-Balaguer T, Mejías-Romero A, Hackenberg M, et al. Isochore chromosome maps of the human genome. Gene 2002; 300: González E, Ceeño FI, Teplukhin AV, Malenkov GG, Poltev VI. Refinamiento e la metoología e la simulación e la hiratación e los ácios nucleícos. Rev Mex Fís 2000; 2: Arora N, Jayaram B. Energetics of base pairs in B-DNA in solution: an appraisal of potential functions an ielectric treatments. J Phys Chem 1998; 102: Kaijalainen S, Karhunen PJ, LaluK, Linström K. An alternative hot start technique for PCR is small volumes using beas of wax-embee reaction components rie in trehalose. Nucleic Acis Res 1993; 21: Henke W, Herel K, Jung J, Schnorr D, Loenig SA. Betaine improves the PCR amplification of GC-rich DNA sequences. Nucleic Acis Res 1997; 25: Pomp D, Merano JF. Organic solvents as facilitators of polymerase chain reaction. Bio Techniques 1991; 10: Sarkar G, KapelnerS, Sommer S.S. Formamie can ramatically improve the specificity of PCR. Nucleic Acis Res 1990; 18: Kreaer CA. Relief of amplification inhibition in PCR with bovine serum albumin or T4 gene 32 protein. Appl Environ Microbiol 1996; 62: Al-sou WB, Rastrom P. Effects of amplification facilitators on iagnostic PCR in the presence of bloo, feces, an meat. Biochem J. Clin Microbiol 2000; 38: Råström P, Knutsson R, Wolffs P, Lövenklev M, Löfstrôm, C. Pre-PCR processing, strategies to generate PCR-compatible samples. Mol Biotechnol 2004; 26: White MF. The insulin signalling system an the IRS proteins. Diabetologia 1997; 40: S2-S Ryffel GU. Mutations in the human genes encoing the transcription factors of the hepatocyte nuclear factor (HNF) 1 an HNF 4 families: functional an pathological consequences. J Mol Enocrinology 2001; 27: EBI Tools Sequence Analysis EMBOSS CpG Plot/Cp- GReport/Isochore. Disponible en: URL:-http://www. ebi.ac.uk/tools/emboss. (Fecha e acceso 30 enero e 2010). 15. Sambrook J, Fritsch EF, Maniatis T. Recovery of DNA from Low-melting-temperature agarose gels. In: Harste E, R-Broker T, T-Chow L, I-Garrels, ets. New York: Col Spring Harbor Laboratory Press; Jong-Soon C, Jin-Sung K, Cheol-O J, Soohyun K, Kwon- Soo Ha, Young-Mok P. Improve cycle sequencing of GC-rich DNA template. EMM 1999; 31: 20-4.

8 292 Martínez-López MC et al. 17. Promega.Nucleic acis amplifications. Protocols & Applications Guie 2009; 12: Frackman S, Kobs G, Simpson D, Storts D. Betaine an DMSO: Enhancing agents for PCR. Promega Notes, 1998; 65, Chakrabarti R, Schutt CE. The enhancement of PCR amplification by low molecular weight amies. Nucleic Acis Res 2001; 29: Musso M, Bocciari R, Paroi S, Ravazzolo R, Ceccherini I. Betaine, Dimethyl Sulfoxie, an 7-Deaza-Dgtp, a powerful mixture for amplification of GC-rich DNA sequences. JMD 2006; 8: Ralser M, Querfurth R, Warnatz HJ, Lehrach H, Yaspo ML, Krobitsch S. An efficient an economic enhancer mix for PCR. Biochem Biophys Res Communication 2006; 347: Knoche K. Go TaqTM DNA Polimerase: A new enzyme formulation for amplifying DNA fragments. Promega Notes. 2002; 21: 2-5. Aceptao para su publicación el 23 e febrero e 2012

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática.

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Departamento de Bioquímica Médica y Biología Molecular Práctica 3 Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Curso 1 Medicina (Abril) 2012 BIOQUÍMICA

Más detalles

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles

Protocolos de secuenciación de ADN

Protocolos de secuenciación de ADN 1 Protocolos de secuenciación de ADN Introducción El método de secuenciación utilizado aquí es el desarrollado por Sanger en 1975. Este consiste en la incorporación de didesixinucleótidos marcados fluorescentemente

Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR)

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) Centro de de Microscopía Electrónica Facultad de de Ciencias Médicas Universidad Nacional de de Córdoba

Más detalles

PCR. Técnica inventada por Kary Mullis :1987. Premio Nobel 1993. Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN

PCR. Técnica inventada por Kary Mullis :1987. Premio Nobel 1993. Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN PCR PCR Técnica inventada por Kary Mullis :1987 Premio Nobel 1993 Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN Aprovecha los requerimientos de la replicación Templete ADN Nucleótidos

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

Técnicas moleculares.

Técnicas moleculares. Técnicas moleculares. DMTV Carolina Acevedo Curso de Microbiología 2015 SÍNTESIS IN VITRO DE UNA GRAN CANTIDAD DE COPIAS DE UN SEGMENTO DE ADN EXISTENTE EN UNA MUESTRA. O sea. Amplificamos en forma exponencial

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. info@atgen.com.uy www.atgen.com.uy

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles

III. METODOLOGÍA EXPERIMENTAL

III. METODOLOGÍA EXPERIMENTAL III. METODOLOGÍA EXPERIMENTAL 3.1 Análisis Previos Se utilizaron los filtros con muestra de partículas suspendidas en el aire PM 10 que el Instituto Municipal de Ecología (IME) proporcionó para llevar

Más detalles

P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA"

P.C.R. Técnica de amplificación enzimática de secuencias específicas de DNA P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA" Paso 1: Desnaturalización del DNA Paso 2: Hibridación de los "Primers" Paso 3: Extensión Paso 1: Desnaturalización del DNA

Más detalles

Técnicas de Biología Molecular. Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO

Técnicas de Biología Molecular. Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO Técnicas de Biología Molecular Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO 2004 Extracción de ácidos nucleicos o o DNA RNA Tipos de Muestras Sangre total (EDTA) Saliva Líquido Amniótico Bulbo

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

DETERMINACIÓN DEL FACTOR Rh por PCR

DETERMINACIÓN DEL FACTOR Rh por PCR Ref.PCRRh DETERMINACIÓN DEL FACTOR Rh por PCR 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

Reacción en cadena de la Polimerasa (PCR)

Reacción en cadena de la Polimerasa (PCR) Explicación de TP Nº 2 Reacción en cadena de la Polimerasa (PCR) Química Biológica Patológica Dra. Mariana L. Ferramola Dra. Gabriela Lacoste 2015 Definición de PCR Es la amplificación enzimática de un

Más detalles

Boletín audioprotésico número 35

Boletín audioprotésico número 35 Boletín auioprotésico número 35 Cómo asegurar la ganancia in-situ correcta Noveaes el epartamento e Investigación auioprotésica y comunicación 9 502 1041 004 / 06-07 Introucción Normalmente, los auífonos

Más detalles

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN.

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. PROGRAMA CONTROL DE CALIDAD DE MUESTRAS El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. El programa completo de control de calidad de muestras de ADN y ARN engloba diferentes

Más detalles

UNIVERSIDAD NACIONAL MAYOR DE SAN MARCOS. Métodos multivariantes en control estadístico de la calidad

UNIVERSIDAD NACIONAL MAYOR DE SAN MARCOS. Métodos multivariantes en control estadístico de la calidad UNIVESIDAD NACIONAL MAYO DE SAN MACOS FACULTAD DE CIENCIAS MATEMÁTICAS E.A.P. DE ESTADÍSTICA Métoos multivariantes en control estaístico e la calia Capítulo I. Gráficos e control estaístico univariaa TABAJO

Más detalles

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri OBJETIVO Desarrollar un banco de datos a partir de plantas de origen indudable y del uso

Más detalles

MATERIALES Y MÉTODOS. Cepas Utilizadas

MATERIALES Y MÉTODOS. Cepas Utilizadas MATERIALES Y MÉTODOS Cepas Utilizadas Para el presente trabajo se utilizaron tres cepas Tipo: Mycobacterium aviumintracellulare (proporcionada al Laboratorio Estatal de Salud Pública por el Instituto Nacional

Más detalles

PROBLEMAS MÁS FRECUENTES Y POSIBLES SOLUCIONES

PROBLEMAS MÁS FRECUENTES Y POSIBLES SOLUCIONES PROBLEMAS MÁS FRECUENTES Y POSIBLES SOLUCIONES NO SE PRODUCE REACCIÓN O ÉSTA DECAE POCO DESPUÉS DE COMENZAR No hay ADN o hay menos del necesario No hay cebador o la concentración es inferior a la necesaria.

Más detalles

Tipos de Muestras. Técnicas de Biología Molecular. Extracción de ácidos nucleicos. Extracción de DNA genómico. Muestra de sangre en papel filtro

Tipos de Muestras. Técnicas de Biología Molecular. Extracción de ácidos nucleicos. Extracción de DNA genómico. Muestra de sangre en papel filtro Técnicas de Biología Molecular Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO 2004 Tipos de Muestras Extracción de ácidos nucleicos o DNA o RNA Sangre total (EDTA) Saliva Líquido Amniótico Bulbo

Más detalles

GUÍA PARA LA SECUENCIACIÓN AUTOMÁTICA DE DNA

GUÍA PARA LA SECUENCIACIÓN AUTOMÁTICA DE DNA Página 1 de 16 GUÍA PARA LA SECUENCIACIÓN AUTOMÁTICA DE DNA SERVICIO DE SECUENCIACIÓN-S.C.S.I.E. UNIVERSITAT DE VALÈNCIA Página 2 de 16 CONTENIDOS: 1.- Secuenciación automática de DNA 2.- Tipos de molde

Más detalles

Técnicas de Biología Molecular

Técnicas de Biología Molecular Técnicas de Biología Molecular DNA I. Enzimas de restricción Análisis Las enzimas de restricción fueron aisladas de bacterias; su función natural es proteger contra DNA extraño II. Separación electroforética

Más detalles

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now.

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now. Unidad Curricular: Virología y Micología Veterinaria 1 TRABAJO PRÁCTICO No. 3 AMPLIFICACIÓN DE GENES VIRALES Reacción en Cadena de la Polimerasa, conocida como PCR (por sus siglas en inglés: Polimerase

Más detalles

Criterios para diseñar primers. Iván Ferrer Rodríguez, Ph.D. Catedrático

Criterios para diseñar primers. Iván Ferrer Rodríguez, Ph.D. Catedrático Criterios para diseñar primers Iván Ferrer Rodríguez, Ph.D. Catedrático 1 Qué es un primer? Es una cadena corta de nucleótidos, un oligonucleótido. Sirve como punto de partida para la replicación del DNA.

Más detalles

PCR Punto de No Retorno de la Biología Molecular

PCR Punto de No Retorno de la Biología Molecular TÉCNICAS DE ANÁLISIS EN BIOLOGÍA MOLECULAR CURSO DE BIOTECNOLOGÍA ELEMENTAL Biotechnology Explorer Julio 2012 PCR Punto de No Retorno de la Biología Molecular Qué es un gen Técnicas de aislamiento y estudio

Más detalles

Metodologías basadas en la identificación del ADN: PCR, hibridación, secuenciación y análisis de secuencias.

Metodologías basadas en la identificación del ADN: PCR, hibridación, secuenciación y análisis de secuencias. Metodologías basadas en la identificación del ADN: PCR, hibridación, secuenciación y análisis de secuencias. Dra. Sonia Arduino Dep. de Clínica Estomatología Facultad de Postgrado en Ciencias de la Salud

Más detalles

Índice. 4. Protocolo de envío de muestras 9 5. Problemas más frecuentes durante la secuenciación 10 6. Algunos datos y formulas de utilidad 17

Índice. 4. Protocolo de envío de muestras 9 5. Problemas más frecuentes durante la secuenciación 10 6. Algunos datos y formulas de utilidad 17 Índice Introducción 1 1. Modalidades de secuenciación 2 a. Secuenciación de una sola cadena 2 b. Secuenciación analítica 3 c. Secuenciación diagnóstica 3 2. Oligonucleótidos disponibles 5 3. Protocolo

Más detalles

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental.

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Gemma Saucedo. Laboratorio Aguas de Barcelona 22-23 de noviembre de 2006 Introducción PCR: Polymerase Chain Reaction

Más detalles

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras METODOLOGIA DEL PCR Lic. Jorge Mato Luis Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras Desnaturalización del DNA 5 A G G T T A G T G G A C C C T T G A T 3 3 T C C A

Más detalles

Laboratorio de Biotecnología Molecular. Módulo de Bioquímica y Farmacia. FCEQyN. UNaM. Av. Mariano Moreno 1375, 3300 Posadas Misiones Argentina.

Laboratorio de Biotecnología Molecular. Módulo de Bioquímica y Farmacia. FCEQyN. UNaM. Av. Mariano Moreno 1375, 3300 Posadas Misiones Argentina. PROTOCOLO DE EXTRACCIÓN DE DNA POR SALTING-OUT PARA PEQUEÑOS VOLÚMENES DE SANGRE Autores Riera, Mario A.; Rojas, Maria E.; Zapata, Pedro D. Dirección Laboratorio de Biotecnología Molecular. Módulo de Bioquímica

Más detalles

Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala

Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala IICA/Red SICTA-CIAT INFORME DE AVANCE Gerardo Gallego - Harold

Más detalles

M.B.N. Lara-Chávez, H. Guillén-Andrade, J. A. Vidales-Fernández, M. Gutiérrez- Contreras, J. López-Medina, M. E. Ángel-Palomares y T. Chávez-Bárcenas.

M.B.N. Lara-Chávez, H. Guillén-Andrade, J. A. Vidales-Fernández, M. Gutiérrez- Contreras, J. López-Medina, M. E. Ángel-Palomares y T. Chávez-Bárcenas. Proceedings VI World Avocado Congress (Actas VI Congreso undial del Aguacate) 2007. Viña Del ar, Chile. 12 16 Nov. 2007. ISBN No 978-956-17-0413-8. CARACTERIZACIÓN DE AISLADOS DE Phytophthora cinnamomi

Más detalles

Electromagnetismo Pedagogía en Física R. Lagos. PROBLEMAS RESUELTOS

Electromagnetismo Pedagogía en Física R. Lagos. PROBLEMAS RESUELTOS PROBLEMAS RESUELTOS. Un capacitor e lleno e aire está compuesto e os placas paralela, caa una con un área e 7 6 [ 2 ], separaas por una istancia e,8 [mm]. Si se aplica una iferencia e potencial e 20 [V]

Más detalles

Diseño de un Convertidor CC-CC Doble Boost Acoplado.

Diseño de un Convertidor CC-CC Doble Boost Acoplado. Diseño e un Convertior - Doble Boost Acoplao. Sergio González, Paul Puleston,2, Enric Fossas-Colet 3 CONICET y LEICI, Dpto. e Electrotecnia, Universia Nacional e La Plata [UNLP], Argentina. 2 IIF Marie

Más detalles

Practica la genética Ficha didáctica del profesorado Bachillerato

Practica la genética Ficha didáctica del profesorado Bachillerato Ficha didáctica del profesorado Bachillerato www.eurekamuseoa.es Extracción de ADN Cuál es la función de cada uno de los ingredientes utilizados para realizar la disolución tampón para la visualización

Más detalles

Técnicas descritas en el curso 7.28

Técnicas descritas en el curso 7.28 Técnicas descritas en el curso 7.28 Técnica: Clase 1 Experimento de incorporación de dntps Ensayo de extensión del cebador Ensayo de unión en filtro Electroforesis en gel Análisis de ADN Helicasa Polaridad

Más detalles

Tabla 26.15. Criterios de diseño para digestores aerobios

Tabla 26.15. Criterios de diseño para digestores aerobios Tabla 26.15. Criterios e iseño para igestores aerobios Parámetro Tiempo e retención hiráulico a 2ºC, Loo primario Loo activao Loo activao sin tratamiento primario Loo activao + loo primario Loo primario+loo

Más detalles

Práctico: Genética bacteriana 2007.

Práctico: Genética bacteriana 2007. Práctico: Genética bacteriana 2007. Actividad integrada Departamento de Genética Departamento de Bacteriología y Virología. OBJETIVOS Objetivos generales El estudiante al terminar la actividad práctica

Más detalles

PRINCIPIOS DE LAS INVESTIGACIONES EPIDEMIOLOGICAS Y MEDICIÓN DE EFECTO-CAUSALIDAD PROGRAMA

PRINCIPIOS DE LAS INVESTIGACIONES EPIDEMIOLOGICAS Y MEDICIÓN DE EFECTO-CAUSALIDAD PROGRAMA PRINCIPIOS DE LAS INVESTIGACIONES EPIDEMIOLOGICAS Y MEDICIÓN DE EFECTO-CAUSALIDAD Curso: 25 Hrs. Asistentes: 25 Costo: $15,000 (Quince Mil Pesos 00/100 M.N) OBJETIVO: Conocer algunos conceptos básicos

Más detalles

CLONACIÓN Y EXPRESIÓN DE LA CISTEÍN PROTEINASA RECOMBINANTE TVLEGU-1 DE Trichomonas vaginalis.

CLONACIÓN Y EXPRESIÓN DE LA CISTEÍN PROTEINASA RECOMBINANTE TVLEGU-1 DE Trichomonas vaginalis. CLONACIÓN Y EXPRESIÓN DE LA CISTEÍN PROTEINASA RECOMBINANTE TVLEGU-1 DE Trichomonas vaginalis. Rodríguez Cabrera N. A. 1, Ortega Arroyo J. 2, Arroyo Verástegui R. A. 3, Brieba de Castro L. 2 y Ortega López

Más detalles

PROBLEMAS MAS FRECUENTES DURANTE LA SECUENCIACIÓN NO SE PRODUCE REACCION O ESTA DECAE POCO DESPUÉS DE COMENZAR

PROBLEMAS MAS FRECUENTES DURANTE LA SECUENCIACIÓN NO SE PRODUCE REACCION O ESTA DECAE POCO DESPUÉS DE COMENZAR PROBLEMAS MAS FRECUENTES DURANTE LA SECUENCIACIÓN NO SE PRODUCE REACCION O ESTA DECAE POCO DESPUÉS DE COMENZAR Las causas pueden ser las siguientes: No hay ADN o se encuentra en muy baja concentración.

Más detalles

Materiales para la secuenciación de ADN

Materiales para la secuenciación de ADN Introduccion La Secuenciación Sanger es un método de secuenciación de ADN en el que el ADN diana se desnaturaliza y se hibrida con un cebador de oligonucleótidos, que se extiende entonces gracias a la

Más detalles

7/13/2009. Breve introducción a la biología molecular y sus aplicaciones. Victoria koala. Queensland koala. Morfología vs. ADN? Phascolarctus cinereus

7/13/2009. Breve introducción a la biología molecular y sus aplicaciones. Victoria koala. Queensland koala. Morfología vs. ADN? Phascolarctus cinereus Morfología vs. ADN? Phascolarctus cinereus Queensland koala Victoria koala New South Wales koala 3 subespecies Morfológicamente: Diferencias en tamaño y color principalmente Molecularmente: Un grupo dividido

Más detalles

PCR. Qué es la PCR? T a de fusión de oligonucleótidos (t m )

PCR. Qué es la PCR? T a de fusión de oligonucleótidos (t m ) % a de fusión de oligonucleótidos (t m ) Qué es la PCR? La reacción en cadena de la polimerasa (PCR: polymerase chain reaction) es una técnica de amplificación de secuencias de DNA in vitro t m = 2 (A

Más detalles

Catálogo de Servicios GenXPro

Catálogo de Servicios GenXPro Catálogo de Servicios GenXPro Aplicando las mejores y más sensibles técnicas de preparación de muestras, en combinación con las técnicas más modernas de secuenciación de última generación, GenXPro ofrece

Más detalles

CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015

CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 DEFINICIÓN PCR: Constituye la técnica más importante para amplificar ácidos nucleicos in vitro. Ambas hebras del DNA de interés son replicadas

Más detalles

Guía de PCR en tiempo real

Guía de PCR en tiempo real Guía de PCR en tiempo real Michelle C. Chirinos-Arias michelle.christine16@gmail.com Índice Introducción. 2 Algunos conceptos. 2 PCR (reacción en cadena de la polimerasa)... 2 PCR en tiempo real (qpcr)..

Más detalles

Clonación molecular. Clonar significa hacer copias idénticas

Clonación molecular. Clonar significa hacer copias idénticas INGENIERÍA GENÉTICA Clonación molecular Clonar significa hacer copias idénticas Este término originalmente fue aplicado al procedimiento de aislar una célula y permitirle reproducirse creando una población

Más detalles

La Biología Molecular Aplicada a la detección de patógenos en alimentos

La Biología Molecular Aplicada a la detección de patógenos en alimentos La Biología Molecular Aplicada a la detección de patógenos en alimentos La detección fiable y rápida de microorganismos patógenos en el mercado alimentario es de especial importancia no sólo por sus efectos

Más detalles

RECOMENDACIÓN 326-6. (Cuestión 59/1)

RECOMENDACIÓN 326-6. (Cuestión 59/1) Rc. 326-6 RECOMENDACIÓN 326-6 DETERMINACIÓN Y MEDICIÓN DE LA POTENCIA DE LOS TRANSMISORES RADIOELÉCTRICOS (Cuestión 59/) Rc. 326-6 (95-959-963-966-974-978-982-986-990) El CCIR, CONSIDERANDO a) que el artículo

Más detalles

PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH

PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH Blga. Gisely Hijar Guerra Coordinación del Laboratorio de Biotecnología y Biología Molecular. Responsable de los Procesos de la Prueba

Más detalles

Reacción en cadena de la polymerasa (PCR)

Reacción en cadena de la polymerasa (PCR) Reacción en cadena de la polymerasa (PCR) 1 PCR Que es? Es una técnica in vitro diseñada para amplificar una región específica de DNA. Es extremadamente sensible, con la capacidad de amplificar millones

Más detalles

Tecnologías basadas en la PCR

Tecnologías basadas en la PCR Tecnologías de marcadores moleculares para estudios de diversidad genética de plantas: Módulo de aprendizaje Tecnologías basadas en el ADN Tecnologías basadas en la PCR Fundamentos de la PCR Derechos de

Más detalles

MÉTODOS CROMATOGRÁFICOS: 1. Exclusión molecular 2. Intercambio iónico 3. Afinidad SSN

MÉTODOS CROMATOGRÁFICOS: 1. Exclusión molecular 2. Intercambio iónico 3. Afinidad SSN MÉTODOS CROMATOGRÁFICOS: 1. Exclusión molecular 2. Intercambio iónico 3. Afinidad SSN Propiedades de una proteína que son útiles para su purificación por cromatografía Peso molecular Carga iónica Hidrofobicidad

Más detalles

MANUAL DE PRÁCTICAS DE LABORATORIO

MANUAL DE PRÁCTICAS DE LABORATORIO MANUAL DE PRÁCTICAS DE LABORATORIO INGENIERIA ENBIOTECNOLOGÍA INGENIERÍA GENÉTICA FICHA TECNICA FICHA TÉCNICA SEMINARIO DE BIOTECNOLOGÍA MÉDICO-FARMACÉUTICA Fecha: Nombre del catedrático: 10-Julio-2012

Más detalles

Avances de la investigación en la Amazonía Iquitos, 12 y 13 de diciembre del 2012

Avances de la investigación en la Amazonía Iquitos, 12 y 13 de diciembre del 2012 Avances de la investigación en la Amazonía Iquitos, 12 y 13 de diciembre del 2012 NOMBRE DE LA INVESTIGACIÓN ANÁLISIS DE DIVERSIDAD GENÉTICA DE UNA COLECCIÓN DE AGUAJE DE Mauritia flexuosa (Aracaceae:

Más detalles

PREREQUISITOS: Biología Molecular de la Célula, Biomoléculas: estructura, función y propiedades, Fisiología y Metabolismo Microbiano.

PREREQUISITOS: Biología Molecular de la Célula, Biomoléculas: estructura, función y propiedades, Fisiología y Metabolismo Microbiano. 80111 LABORATORIO DE TÉCNICAS EXPERIMENTALES Pág 1 de 5 ASIGNATURA: LABORATORIO DE TÉCNICAS EXPERIMENTALES ESTUDIOS: MÁSTER EN BIOINGENIERÍA CÓDIGO: 80135 TIPO: O SEMESTRE: 1º CRÉDITOS: 9 (15 horas/semana)

Más detalles

3/22/2010. Iván Ferrer Rodríguez, PhD Catedrático. En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR.

3/22/2010. Iván Ferrer Rodríguez, PhD Catedrático. En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR. Iván Ferrer Rodríguez, PhD Catedrático En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR. Síntesis "in vitro" de secuencias específicas de ADN son amplificadas.

Más detalles

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica TÉCNICAS GENÓMICAS Utilidad/Objetivos: 1) Detección de microorganismos directamente en muestras clínicas identificando un fragmento específico del genoma del microorganismo concreto 2) Cuantificación del

Más detalles

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa?

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa? 2º BIOQUÍMICA CUESTIONES 1. Por qué la PCR convencional no es cuantitativa? En la PCR convencional, la cuantificación del ADN de la muestra es complicada debido a que la eficacia de amplificación va disminuyendo

Más detalles

Polymerase Chain Reaction (PCR)

Polymerase Chain Reaction (PCR) Polymerase Chain Reaction (PCR) Un poco de historia La técnica de PCR fue inventada por Kary B. Mullis en 1983. La primer publicación sobre PCR apareció en 1985, aunque el principio básico de replicar

Más detalles

REVISTA INVESTIGACION OPERACIONAL Vol. 23, No. 1, 2002

REVISTA INVESTIGACION OPERACIONAL Vol. 23, No. 1, 2002 REVISTA INVESTIGACION OPERACIONAL Vol. 23, No. 1, 2002 OPTIMIZACION DE MULTIPLES RESPUESTAS POR EL METODO DE LA FUNCION DE CONVENIENCIA PARA UN DISEÑO DE MEZCLAS Margarita Nuñez e Villavicencio Ferrer

Más detalles

FAQs preguntasfrecuentes

FAQs preguntasfrecuentes FAQs preguntasfrecuentes 1.- Diferencias entre el MethylDetector y el MethylCollector. ir a respuesta 2.- Se puede hacer ChipIT a partir de muestras de tejidos? ir a respuesta 3.- A veces se producen incidencias

Más detalles

Reacción en cadena de la polimerasa (PCR)

Reacción en cadena de la polimerasa (PCR) Dr. Alejandro Leal Reacción en cadena de la polimerasa (PCR) La reacción en cadena de la polimerasa (PCR, por sus siglas en inglés de "polymerase chain reaction") es un método de amplificación in vitro

Más detalles

38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa

38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa 38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa José Luis Caballero Repullo, Enriqueta Moyano, Juan Muñoz Blanco Departamento de Bioquímica y Biología Molecular, Campus

Más detalles

EDUCACION CONTINUADA. Introducción. Caso clínico

EDUCACION CONTINUADA. Introducción. Caso clínico EDUCACION CONTINUADA L. Castaño, J.R. Bilbao, B. Calvo An Esp Pediatr 1997;47:201-206. Introducción a la biología molecular y aplicación a la pediatría (6): Caso clínico: Trastorno molecular en la diabetes

Más detalles

Técnica de PCR. Beatriz Bellosillo. Servei de Patologia, Hospital del Mar, Barcelona, Spain

Técnica de PCR. Beatriz Bellosillo. Servei de Patologia, Hospital del Mar, Barcelona, Spain Técnica de PCR Beatriz Bellosillo Servei de Patologia, Hospital del Mar, Barcelona, Spain Biología Molecular Estudio de los procesos que se desarrollan en los seres vivos desde un punto de vista molecular

Más detalles

EVALUACION EXTERNA DEL DESEMPEÑO PARA LA DETECCION DEL VIRUS DE INFLUENZA TIPO A MEDIANTE LA TÉCNICA DE RT- PCR PANEL x (20xx)

EVALUACION EXTERNA DEL DESEMPEÑO PARA LA DETECCION DEL VIRUS DE INFLUENZA TIPO A MEDIANTE LA TÉCNICA DE RT- PCR PANEL x (20xx) 1. OBJETIVO Evaluar el desempeño de los Laboratorios de Salud Pública participantes en cuanto a la detección del virus de la Influenza A mediante la técnica de RT PCR. 2. ALCANCE Este documento se tomo

Más detalles

40. Identificación de clones y fragmentos de ADNc mediante la reacción en cadena de la polimerasa (PCR)

40. Identificación de clones y fragmentos de ADNc mediante la reacción en cadena de la polimerasa (PCR) 40. Identificación de clones y fragmentos de ADNc mediante la reacción en cadena de la polimerasa (PCR) José Luis Caballero Repullo, Enriqueta Moyano Cañete, Juan Muñoz Blanco Departamento de Bioquímica

Más detalles

CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA. Grado en Medicina

CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA. Grado en Medicina DEPARTAMENTO DE BIOQUÍMICA Y BIOLOGÍA MOLECULAR III FACULTAD DE MEDICINA UNIVERSIDAD COMPLUTENSE DE MADRID CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA Grado en Medicina CURSO ACADÉMICO 2014/2015 INDICE

Más detalles

Kit PunchSolution INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC9271.

Kit PunchSolution INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC9271. Technical Manual Kit PunchSolution INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC9271. IMPRESO EN ESTADOS UNIDOS 5/12 Kit PunchSolution Toda la bibliografía técnica está disponible en Internet, en el sitio

Más detalles

VENTAJAS NORMAS DE ENSAYO

VENTAJAS NORMAS DE ENSAYO . VENTAJAS 8000S SISTEMA DE ENSAYO DE P.A.T. DE ALTA POTENCIA Los sistemas e tierra e alta potencia (subestaciones, líneas e transmisión, etc.) eben ser monitoreaos perióicamente para ver si cumplen con

Más detalles

CAPÍTULO VI. Expresión de genes relacionados con apoptosis

CAPÍTULO VI. Expresión de genes relacionados con apoptosis CAPÍTULO VI Expresión de genes relacionados con apoptosis 1.- Introducción 2.- Protocolos para análisis genéticos 3.- Resultados en MCF-7 4.- Discusión 1.- Introducción Como se ha descrito anteriormente,

Más detalles

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082 Página 1 de 5 1. OBJETIVO Detectar la presencia de Campylobacter jejuni en hamburguesa de pollo mediante técnica de PCR. 2. CAMPO DE APLICACIÓN Y ALCANCE Aplicar este procedimiento a muestras de hamburguesa

Más detalles

J.H. Calvo, A. Martínez-Royo, P. Sánchez, J.L. Alabart, J. Folch SEXAJE DE EMBRIONES EN OVINO MEDIANTE PCR ESPECÍFICA Y PCR-DUPLEX.

J.H. Calvo, A. Martínez-Royo, P. Sánchez, J.L. Alabart, J. Folch SEXAJE DE EMBRIONES EN OVINO MEDIANTE PCR ESPECÍFICA Y PCR-DUPLEX. J.H. Calvo, A. Martínez-Royo, P. Sánchez, J.L. Alabart, J. Folch SEXAJE DE EMBRIONES EN OVINO MEDIANTE PCR ESPECÍFICA Y PCR-DUPLEX Separata ITEA INFORMACIÓN TÉCNICA ECONÓMICA AGRARIA, VOL. 102 N.º 4 (354-359),

Más detalles

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas ELEMENTOS BÁSICOS DE LA INVESTIGACIÓN EN GENES Análisis

Más detalles

UNIVERSIDAD DE PUERTO RICO EN HUMACAO DEPARTAMENTO DE BIOLOGÍA PRONTUARIO DEL CURSO DE BIOTECNOLOGÍA EXPERIMENTAL BIOL 4895.

UNIVERSIDAD DE PUERTO RICO EN HUMACAO DEPARTAMENTO DE BIOLOGÍA PRONTUARIO DEL CURSO DE BIOTECNOLOGÍA EXPERIMENTAL BIOL 4895. UNIVERSIDAD DE PUERTO RICO EN HUMACAO DEPARTAMENTO DE BIOLOGÍA PRONTUARIO DEL CURSO DE BIOTECNOLOGÍA EXPERIMENTAL BIOL 4895 Preparado por: DRA. CARMEN BAERGA 1997 Actualizado por: DRA. ISABEL G. CINTRÓN

Más detalles

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA BIOLOGIA MOLECULAR Hemos elaborado un programa en 3 niveles, en función del tipo de estudiante y las posibilidades del centro educativo: 1. NIVEL BASICO 2. NIVEL MEDIO DANAEXTRACTOR KIT Práctica que constituye

Más detalles

I.S.P.I. N 9009 San Juan Bautista de La Salle INTRODUCCIÓN A LA BIOTECNOLOGÍA Y TECNOLOGÍAS ESPECÍFICAS

I.S.P.I. N 9009 San Juan Bautista de La Salle INTRODUCCIÓN A LA BIOTECNOLOGÍA Y TECNOLOGÍAS ESPECÍFICAS I.S.P.I. N 9009 San Juan Bautista de La Salle INTRODUCCIÓN A LA BIOTECNOLOGÍA Y TECNOLOGÍAS ESPECÍFICAS Asignatura: Frecuencia: Docente a cargo: Destinatarios: Anual 5 horas por semana Lic. César R. Olsina

Más detalles

PCR? PCR en el diagnóstico? Objetivo: Obtener un gran número de copias de un fragmento particular de ADN a partir de una cantidad mínima original.

PCR? PCR en el diagnóstico? Objetivo: Obtener un gran número de copias de un fragmento particular de ADN a partir de una cantidad mínima original. PCR? Objetivo: Obtener un gran número de copias de un fragmento particular de ADN a partir de una cantidad mínima original. PCR en el diagnóstico? A partir de una mezcla compleja de ADN, se puede realizar

Más detalles

Miguel Dita (1) Einar Martínez de la Parte (2) Monica Blanco (3)

Miguel Dita (1) Einar Martínez de la Parte (2) Monica Blanco (3) Generalidades de la PCR: MÉTODO DE DIAGNÓSTICO MOLECULAR DE Foc RT4 Miguel Dita (1) Einar Martínez de la Parte (2) Monica Blanco (3) 1) Bioversity International, Costa Rica 2) INISAV Cuba. 3) Universidad

Más detalles

Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez

Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez 1 Objetivos Entender la técnica: Reacción de Polimerasa en Cadena (PCR por sus siglas en inglés)

Más detalles

Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón

Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón Reacción en Cadena de la INTRODUCCION: Polimerasa (RCP) Década de los 70: Grandes

Más detalles

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS Prácticas docentes en la COD: 10-71 APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS FUNDAMENTO TEÓRICO La PCR es una técnica que permite llevar a cabo la síntesis in vitro de fragmentos de ADN. Está basada

Más detalles

QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA. Julio A. Carrasco Vallejo Julio 2014

QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA. Julio A. Carrasco Vallejo Julio 2014 QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA Julio A. Carrasco Vallejo Julio 2014 Definiciones Biología Molecular: Estudio de los flujos de información genética en una célula Biotecnología: Uso de sistemas

Más detalles

Experiencias en Q-PCR para la aplicación y diagnóstico en Medicina Humana

Experiencias en Q-PCR para la aplicación y diagnóstico en Medicina Humana Experiencias en Q-PCR para la aplicación y diagnóstico en Medicina Humana MSc. Gonzalo Manrique Laboratorio de Biología Molecular Asociación Española Junio de 2009 INDICE INTRODUCCION (conceptos básicos,

Más detalles

TEMA 3. ESTRUCTURA Y EVOLUCIÓN DEL GENOMA EUCARIOTA

TEMA 3. ESTRUCTURA Y EVOLUCIÓN DEL GENOMA EUCARIOTA TEMA 3. ESTRUCTURA Y EVOLUCIÓN DEL GENOMA EUCARIOTA Genes y genomas. Estructura del genoma eucariota. Genómica comparada. Evolución del tamaño, del número y de la complejidad de los genes. Origen y evolución

Más detalles

DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino

DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino DIAGNOSTICO VIROLOGICO MOLECULAR Dr. Gerardo Andino DIAGNÓSTICO MOLECULAR La tecnología empleada para la detección de genomas virales mediante la amplificación de secuencias específicas (PCR y reacciones

Más detalles

MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR)

MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) OBJETIVOS - Definir PCR, conocer los reactivos que

Más detalles

PRÁCTICAS DE MICROBIOLOGIA CLINICA

PRÁCTICAS DE MICROBIOLOGIA CLINICA PRÁCTICAS DE MICROBIOLOGIA CLINICA Juan Carlos Rodríguez Hospital General Universitario de Alicante E-mail: rodriguez_juadia@gva.es http://microbiologia-alicante.umh.es CASO CLINICO: Rubéola Evolución

Más detalles

6. PROBLEMAS DE MARKETING

6. PROBLEMAS DE MARKETING 6. PROBLEMAS DE MARKETING PROBLEMA 1 (POSICIONAMIENTO DEL PRODUCTO) Se ha realizao una encuesta sobre un grupo e consumiores e vino tinto e mesa para que, sobre una escala e 0 a 10, califiquen a las iferentes

Más detalles

4. CARACTERIZACIÓN DE LA MUESTRA:... 16

4. CARACTERIZACIÓN DE LA MUESTRA:... 16 1. INTRODUCCIÓN:... 3 2. OBJETIVOS:... 3 3. GENERAIDADES:... 4 3.1. MINERA:... 4 3.2. CASIFICACIÓN DE OS MINERAES SEGÚN SU COMPOSICIÓN QUÍMICA Y ESTRUCTURA:... 4 3.3. CARACTERIZACIÓN DE PARTÍCUAS:... 4

Más detalles

Instrucciones de uso. Wipe test. Control de Contaminación. Kit de pruebas para la detección de contaminaciones basado en genética molecular REF 7091

Instrucciones de uso. Wipe test. Control de Contaminación. Kit de pruebas para la detección de contaminaciones basado en genética molecular REF 7091 Instrucciones de uso Wipe test Control de Contaminación Kit de pruebas para la detección de contaminaciones basado en genética molecular REF 7091 40 Reacciones 1. Descripción del Producto El uso de la

Más detalles

FUNDAMENTOS DE LA TÉCNICA PCR

FUNDAMENTOS DE LA TÉCNICA PCR FUNDAMENTOS DE LA TÉCNICA PCR 1 2 PCR Qué es? REACCIÓN EN CADENA DE LA POLIMERASA Técnica que nos permite amplificar selectivamente un segmento específico de DNA, hasta obtener una cantidad suficiente

Más detalles