La mortalidad de los embriones de la tortuga marina en función del microambiente de microbios en los nidos en una playa de arribada en Costa Rica

Tamaño: px
Comenzar la demostración a partir de la página:

Download "La mortalidad de los embriones de la tortuga marina en función del microambiente de microbios en los nidos en una playa de arribada en Costa Rica"

Transcripción

1 1 Bézy La mortalidad de los embriones de la tortuga marina en función del microambiente de microbios en los nidos en una playa de arribada en Costa Rica Resolución No ACT-OR-DR R OT-CONAGEBIO Informe Final 30 Marzo 2014 Vanessa Bézy, B.S. Biología Marina, Estudiante de Maestría Investigadora Principal Roldán A. Valverde, Ph.D. y Craig Plante, Ph.D. Profesores Tutor

2 2 INTRODUCCIÓN La tortuga lora (Lepidochelys olivacea) es catalogada por el IUCN como vulnerable y se caracteriza por su polimórfico comportamiento de anidación, con algunas hembras anidando solitariamente y otras anidando en arribadas (Bernardo y Plotkin, 2007). A pesar de la gran cantidad de hembras que anidan, la tasa de eclosión en las playas de arribadas es baja (0-32%) y por lo tanto es una preocupación por la sostenibilidad de este fenómeno natural y por la conservación internación de esta especie (Cornelius et al., 1991; Valverde et al., 2012). Los datos actuales sobre el efecto aislado de la densidad de nidos (i.e., competición entre embriones por requisitos fisiológicos) en la tasa de eclosión demuestran que la densidad de nidos en las playas de arribadas no es necesariamente bastante alta para disminuir la tasa de eclosión hasta los niveles drásticamente bajos observados (Honarvar et al., 2008). En lugar de la densidad de nidos, muchos proponen que la mortalidad excesiva de embriones esta relacionada con la alta carga microbiana de la arena resultando de la descomposición de huevos quebrados por la superposición de nidos (Cornelius et al., 1991; Honarvar et al., 2008; Valverde et al., 1998). El éxito de reproducción en los reptiles ovíparos depende de una interacción entre los característicos bióticos y abióticos del ambiente del nido para crear una gama de condiciones adecuadas para el desarrollo de los embriones. Por ejemplo, los característicos físicos del substrato del nido (e.g., tamaño de grano de la arena, contenido de materia orgánica) tienen un papel importante en establecer la difusión adecuada de elementos (O 2, CO 2, H 2 O, y calor) dentro de la cámara del nido, por consiguiente afectando la viabilidad y tasa de desarrollo de los nidos (Ackerman, 1997; Mortimer,

3 3 1990). Por otro lado, factores bióticos tal como el numero de huevos y la actividad de microbios tienen el potencial de indirectamente afectar la tasa de eclosión por cambiar las temperaturas y el contenido de oxigeno dentro del nido (Ackerman, 1980; Clusella Trullas y Paladino, 2007). Las playas de arribadas presentan un ambiente de nido único para la tortuga lora debido a la alta densidad de nidos y alta tasa de destrucción de nidos asociados con este comportamiento (Ocana et al., 2012). Precisamente por eso, estas playas presentan un gradiente temporal y espacial en la tasa de eclosión cual correlaciona con la distribución y cadena de las arribadas (Valverde et al., 2012). Una investigación en una playa de arribada reporto una disminución en la tasa de eclosión en nidos naturales in situ en comparación con nidos localizados en arena limpia del vivero, en conjunto con temperaturas más altas y un contenido más bajo de oxigeno dentro del nido (Clusella Trullas y Paladino, 2007). Las mareas y tasa de erosión alta proveen por un reemplazo de arena natural en las playas de arribadas, cual es asociado con una tasa de eclosión mayor (Clusella Trullas y Paladino, 2007; Cornelius et al., 1991; Honarvar et al., 2011). De hecho, un estudio reciente descubrió que aunque había una diversidad mayor de bacterias en áreas de alta densidad de nidos en asociación con una baja tasa de eclosión, la zona baja de la playa donde había exposición frecuente a las mareas no concordaba con estas tendencias (Honarvar et al., 2011). Varias investigaciones han identificado la presencia de microorganismos en asociación con los nidos de tortugas marinas. En particular, se han cultivado y identificado bacterias y hongos desde la arena del nido y huevos tanto como el fluido de cloaca de las hembras (Mo et al., 1990; Phillott y Parmenter, 2001; Wyneken et al.,

4 4 1988). La infección de los huevos de tortugas marinas por microbios se ha tradicionalmente pensado como oportunista y estudios limitados de laboratorio no han encontrado ningún efecto significativo de la presencia de bacterias o hongos en la tasa de eclosión de la tortuga lora (Mo et al., 1990; Mo et al., 1995). Sin embargo, varios otros estudios sugieren una correlación negativa entre la diversidad de bacterias presente en el nido y la tasa de eclosión (Honarvar et al., 2011; Wyneken et al., 1988). Adicionalmente, investigaciones recientes sobre el complejo de especie Fusarium solani han identificado varios patógenos de los huevos de tortugas marinas (Sarmiento-Ramírez et al., 2010; Sarmiento-Ramírez et al., 2014). Aunque bastantes estudios han identificado una diversidad de bacterias y hongos en relación con huevos de tortugas marinas fallecidos, todavía faltan estudios directamente conectando la mortalidad del embrión y la presencia o abundancia de microbios por las restricciones en obtener permisos y dirigir investigaciones sobre especies protegidas (Mo et al., 1995; Ocana et al., 2012). Estudios previos sobre tortugas han tenido éxito en esterilizar huevos y el substrato del nido para eliminar patógenos y aumentar la tasa de eclosión. El tratamiento de huevos de Trachemys scripta elegans con una solución de sodio hipoclorito (NaOCl, cloro) exitosamente elimino patógenos para la comercialización segura de crías (Michael- Marler et al., 1983; Mitchell et al., 2007). Los huevos de la tortuga lora han sido esterilizado exitosamente con yodo y 70% alcohol sin causar mortalidad del embrión (Mo et al., 1990; Mo et al., 1995). Sin embargo, la subsiguiente incubación de estos huevos en arena esterilizada no aumento la tasa de eclosión en comparación con otros substratos. Por otro lado, un estudio comparando la tasa de eclosión de huevos incubados en la arena de un vivero, arena de la playa, y arena esterilizada en una playa de anidación solitaria

5 5 observo una escasa aumentación de la tasa de eclosión en la arena esterilizada en una solución de cloro (Patino-Martinez et al., 2012). Además, este estudio observo un desarrollo del embrión mayor y crías más grandes en la arena esterilizada. Estos descubrimientos sugieren que las interacciones no-patogénicas entre los microbios y el embrión de tortuga marina pueden tener un impacto en el desarrollo de la tortuga marina aunque estudios similares todavía faltan para mejor explorar este hipótesis in situ. Aunque el efecto negativo de la abundancia de microbios en la tasa de eclosión se ha presumido por mucho tiempo, ninguna investigación previa ha directamente cuantificado la abundancia de microbios y los efectos directos o indirectos asociados en la tasa de eclosión en una playa de anidación natural. La carga microbiana particularmente alta en las playas de arribadas y la variabilidad espacial y temporal provee una oportunidad única para investigar la relación entre las tortugas marinas y los microbios durante el desarrollo del embrión. Además, este fenómeno provee un tamaño de muestra grande que permite manipulaciones experimentales simultaneas y repetitivas que tienen poco impacto en la población local dado a la magnitud de hembras anidando. Debido a los varios factores que determinan la mortalidad de los embriones de las tortugas marinas, es necesario evaluar el ambiente entero del nido para entender las relaciones verdaderas entre los huevos y el microecosistema que consta del nido de la tortuga marina (Madden et al., 2008; Wyneken et al., 1988). Por determinar variables importantes y medir tasas relevantes a la descomposición de materia orgánica, podemos construir un punto de vista holístico de la actividad microbiana y el efecto que resulta de la descomposición microbiana en el ambiente del nido y, últimamente, en el desarrollo del embrión de la tortuga marina.

6 6 Ostional, Costa Rica es una de las playas de anidación más importantes para la tortuga lora, con arribadas estimadas hasta aproximadamente 500,000 hembras anidando en un periodo de hasta siete días (Valverde et al., 2012). Esta población de tortuga lora sostiene un programa legal de cosecha de huevos basado en la comunidad misma de Ostional, el cual está dirigido a reducir el número de nidos destruidos por las tortugas mismas durante las arribadas (Cornelius et al., 1991). Aunque los últimos datos no demuestran ninguna prueba de un impacto negativo de la cosecha sobre la población que anida, la abundancia anual de arribadas parece haber bajado en comparación con datos históricos; la baja tasa de eclosión de aproximadamente 8% ha sido sugerida como la causa principal (Cornelius et al., 2007; Valverde et al., 2012). Por la inversión de la comunidad en la población de tortugas marinas como recurso natural, investigaciones aplicadas con implicaciones en las ciencias ciudadanas, conservación comunitaria, y el manejo de recursos naturales es de importancia particular en Ostional. Avances recientes en las técnicas moleculares permiten el estudio detallado de la ecología microbiana con metodologías independientes del cultivo que evitan sin el prejuicio y las limitaciones del cultivo de microbios en el laboratorio. La tecnología cuantitativa de reacción de polimerasa en tiempo real (qpcr) permite la cuantificación precisa de los transcriptos de PCR tras el uso de un tinte que fluoresce en proporción a la cantidad de producto de ADN amplificado. La fluorescencia esta registrada al final de cada ciclo de PCR y se obtiene la cuantificación de ADN inicial por medir el ciclo umbral (Ct) en cual la fluorescencia excede el ruido de fondo. En esta fase inicial y exponencial de PCR, la cantidad de producto amplificado es directamente proporcional a la cantidad inicial y por lo tanto se puede usar un estándar conocido para valorar la

7 7 cantidad inicial de ADN con confidencia. Estudios previos han usado el qpcr para cuantificar las comunidades microbianas dentro de muestras ambientales de tierra, biofilm marino, y sedimentos contaminados, tanto como otros substratos (Bacchetti De Gregoris et al., 2011; Fierer et al., 2005; Luna et al., 2012). Esta técnica es ventajosa por su requisito de poca ADN mientras produce un análisis robusto, reproducible, y extremadamente sensitivo por un costo relativamente bajo (Bacchetti De Gregoris et al., 2011; Smith y Osborn, 2009). Aunque la cuantificación de copias de genes no se puede transformar directamente a una cantidad de células (dado a la variación grande de copias de genes entre especies), se puede usar esta cuantificación en representación relativa de abundancia general (Chemidlin Prévost-Bouré et al., 2011; Fierer et al., 2005; Guidot et al., 2002). El objetivo principal de este estudio era de determinar el efecto de la descomposición microbiana en el ambiente del nido y la tasa de eclosión en Ostional, Costa Rica. Los objetivos específicos eran de determinar (1) si existen diferencias en la tasa de eclosión en asociación con varias abundancias de microbios en la arena del nido, (2) si efectos indirectos de la abundancia de microbios en la arena del nido (i.e., cambios en la temperatura, oxigeno, y contenido de materia orgánica) correlacionan con la tasa de eclosión, y (3) implementaciones potenciales de estos descubrimientos a la conservación y el manejo de esta y otras especies de tortugas marinas. Con el fin de aislar la relación entre la descomposición microbiana y la tasa de eclosión, monitoreamos las condiciones del nido y la tasa de eclosión en nidos trasladados dentro de cuadrantes experimentales y cuantificamos la abundancia de microbios dentro de la arena del nido con qpcr.

8 8 METODOLOGIA Sitio del Estudio Este estudio se llevo a cabo en Playa Ostional durante la temporada lluviosa (Mayo hasta Noviembre) de 2013, cuando las arribadas son típicamente más abundante y concentradas en la playa principal. Pero, durante la temporada de anidación del ano 2013, las arribadas se desplazaron por los rayos 1-3 y eran más esporádicas en ritmo en comparación a la temporada de anidación del ano Por este cambio de comportamiento, y por razones logísticas, el área de tratamientos experimentales se localizo en una área de la playa con una densidad de nidos y abundancia de microbios relativamente alta además del acceso a un fuente de agua dulce de un estero cercano por su uso en los tratamientos experimentales. Tratamientos Experimentales Los tratamientos se aplicaron en cuadrantes (50 x 50 cm en área de superficie y 60 cm de profundidad) en una área de alta densidad de anidación en rayo 3, donde presuntamente había una alta carga microbiana en la arena. Cada tratamiento se hizo en replica quince veces y se dejaron cinco de estas replicas sin nido. Estos cuadrantes, aquí dentro mencionado como controles sin nido, se usaron para medir el nivel de oxigeno y las temperaturas basal en la arena. Los cuadrantes experimentales se colocaron usando un diseño de bloque cuadro latino y se separaron con una zona intercesora de 50 cm por todos lados. Los tratamientos de remojo se aplicaron sacando la arena de la playa y dejándola remojar 24 horas con el respectivo tratamiento antes de lavarla con agua dulce. El tratamiento antimicrobiano era una dilución de 5% cloro (6% hipoclorito de sodio). Los

9 9 tratamientos controles eran de un remojo en agua dulce (aquí dentro llamado remojo ) y de arena sucia solamente quitada y recolocada (aquí dentro llamado remplazo). Se lavo la arena añadiendo agua dulce, mezclando, y escurriendo el agua. Los niveles relativo de cloro de esta agua se midieron para asegurar que la arena era bien enjuagada hasta llevar al nivel control (agua dulce) de aproximadamente 0 ppm cloro total. Una vez terminado el tratamiento, la arena se volvió a colocar y compactar en el cuadrante respectivo. Los tratamientos tópicos se aplicaron tópicamente a la arena de la playa vertiendo baldes (aprox. 120 L en total) por la superficie de la arena, cual era encerrada con un cuadrante de madera (50 x 50 x 15 cm) cual era parcialmente enterrado bajo la superficie para asegurar que cada tratamiento quedo dentro del cuadrante respectivo cuando se aplico. El tratamiento tópico, antimicrobiano natural era de agua de mar (25-35 psu) colectado directamente de océano adyacente al área de tratamientos en la playa de anidación. Los tratamientos controles eran de una aplicación tópica de agua dulce y de arena sucia sin ningún tratamiento. Se consiguió todo el agua dulce del estero cercano (0 psu). Los áreas de tratamientos de remojo y tópicos (cada uno aproximadamente 7 x 8 m) se ubicaron directamente adyacente uno al otro y arriba de la línea de mareas altas. Esta área del estudio entero se encerró con malla y se rodeó con troncos grandes para impedir que entran tortugas durante arribadas. Los nidos que se encontraron dentro de este área antes del principio de los experimentos se reubicaron afuera para asegurar una densidad baja y consistente de nidos a lo largo de este área. Todos los cuadrantes de tratamientos experimentales se prepararon por lo menos una semana antes de la arribada de muestreo. El área entero de este estudio se cubrió con sarán negro después del quinto

10 10 día de incubación para proteger los nidos del inicio de la temporada seca, cual amenaza el exitoso desarrollo de los embriones de la tortuga marina con temperaturas letales (Valverde et al., 2010). Se trasladaron todos los nidos de este estudio dentro de las primeras dos noches en seguidas de la arribada que ocurrió durante de el cuarto menguante de Octubre Esto aseguró que todos los nidos incubaron durante el mismo tiempo y ayuda a estandarizar cualquier variables incontrolables que podrían afectar la tasa de eclosión, tanto como la temperatura ambiental y la pluviosidad. Los nidos se recolectaron directamente desde la cloaca de la hembra en una bolsa de plástico estéril. Se juntaron todos los huevos antes de trasladarlos al azar, cien huevos por cuadrante, en una cámara replica dentro de un cuadrante experimental de 0.25 m 2 hasta que se llenaron todos los cuadrantes. Todas las cámaras de nidos se construyeron con aproximadamente las mismas dimensiones. Para evitar la contaminación cruzada de la arena, se uso un plástico con un huevo de 50 x 50 cm en el centro para guardar la arena que se quito para crear la cámara del nido separada de la zona intercesora. Se colocó un datalogger y un tubo de oxigeno dentro de cada cámara de nido a los 50 huevos. Se colocó una caja de malla sobre cada nido para impedir la depredación y guardar las crías hasta que se contaron desde el día 40 de incubación hasta la eclosión. Desde este punto, se monitorearon los nidos entre por lo menos tres veces al día (amanecer, anochecer, y medianoche) para contar y liberar las crías lo más pronto como era posible. Se escogieron (a ciegas) hasta diez crías de cada nido que se observo emergiendo y se pesaron antes de liberarlas (Pesola, Lightline Spring Scale, g ± 0.03 g exactitud).

11 11 Colección y Análisis de Arena Una muestra de arena de aproximadamente 50 g de arena en total se recogió directamente en tubos estériles desde el centro de la cámara del nido durante la exhumación del nido. Las muestras se guardaron sobre hielo inmediatamente después de la recolección y se congelaron o se preservaron en formalina (2% formaldehido) hasta el análisis. El análisis de materia orgánica se realizó por el método de pérdida de masa por ignición. El contenido de agua se calculó por la perdida de masa después de secado. Una submuestra de arena de aproximadamente 2 g se transfirió a un crisol y se seco en un honro (12+ h a 70 C) antes de combustir (8 h a 500 C). El análisis de tamaño de grano se realizó con un equipo estándar de tamices (0.063, 0.125, 0.250, 0.500, 0.710, 1.000, 1.400, y mm). Se determino el promedio y las medida de ordeno y asimétrica del tamaño de grano por masa usando los interceptos de los percentiles de 5, 16, 50, 84, y 95 en unidades phi, según Folk (1966). Las muestras preservadas en formalina se usaron para conteos por microscopio como método segundario de cuantificar la abundancia de bacterias. Las muestras se centrifugaron por 10 min a 14,000 rpm en un microcentrifugador antes de cuidadosamente quitar el exceso de formalina. Se diluyo la arena en agua estéril y se sometió a ultrasonido por 20 s a 30 W (Sonifier S-250A, Branson). El liquido flotante que resulto se mancho con SybrGold por conteo de microscopio con un microscopio epifluorescencia (Optiphot-2, Nikon). po 2 y Temperatura del Nido El contenido de oxígeno de todos los nidos se monitoreó con el uso de mangueras colocadas dentro del nido que llegaron hasta la superficie de la arena donde había una válvula y cápsula para impedir el intercambio de gas adicional (Clusella Trullas &

12 12 Paladino, 2007; Honarvar et al., 2008; Wallace et al., 2004). La presión parcial de oxigeno (po 2 ) dentro del nido se midió usando un analizador de oxigeno (S108 Oxygen Analyzer, Qubit Systems) que se calibro antes de la temporada de muestreo usando nitrógeno y antes de cada grupo de muestras usando aire atmosférica. Se quito el aire del tubo (aproximadamente 10 ml) antes del muestreo para asegurar que la muestra de aire era desde dentro de la cámara del nido. Las muestras de aire se sacaron con jeringas (60 ml) y se analizaron dentro de 1 h del muestreo. Las muestras se inyectaron lentamente tras una bomba de aire, medidor de flujo, columna deshidratante, y el sensor de O 2 a una tasa de flujo de aproximadamente 50 ml min -1. Las muestras se analizaron cada 5 días por los primeros 30 días de incubación, y luego cada 4 días hasta el final del periodo de incubación. Los porcentajes de gases se convirtieron a la presión parcial usando la presión barométrica del ambiente. Las temperaturas dentro de los nidos se monitorearon usando dataloggers de temperatura HOBO (Onset Computer Corporation) colocados dentro del nido y programados para registrar la temperatura cada 1 h empezando a medianoche la noche de traslado hasta la emergencia de crías. Se revisaron los dataloggers antes del experimento para asegurar que no había diferencias significativas entre los registros de temperatura individuales y el promedio de todos los registros por cada hora tras un periodo de 72 h (datas de la prueba χ 2 no demostrados). Se uso el promedio de temperaturas de cada día para comparar las temperaturas de los nidos. Se uso un HOBO Optic USB Base Station (Onset Computer Corporation) para colectar los datos de los dataloggers usando el HOBOware Pro software (Onset Computer Corporation). Además, se incluyeron datos de temperatura ambientales (Weather Underground, Inc., wunderground.com) y

13 13 precipitación (B. Johnson, pers. comm.) que podrían haber afectado las temperaturas de los nidos. Exhumaciones Se usaron guantes esterilizados para todas las exhumaciones que se cambiaron entre el contacto con nidos diferentes. Las exhumaciones se llevaron a cabo el día después de emergencia para cuantificar la tasa de eclosión y evaluar el estadío de desarrollo de todos los huevos que quedan en el nido. La tasa de eclosión era el número de crías que salen del huevo en comparación con el número total de huevos en cada nido (Miller, 1999). Los estadíos de desarrollo se determinaron para estimar aproximadamente el periodo en cual los embriones murieron (Chacón et al., 2007). En resumen, los estadios embrionarios eran: Estadio 0 (ningún embrión visible), Estadio I (embrión ocupa 1-25% de la cavidad amniótica), Estadio II (26-50%), Estadio III (51-75%), Estadio IV (76-100%), Estadio V (cascara de huevo vacía de cría que emergió del nido). Huevos con desarrollo indefinido, típicamente por infestación de larvas, se clasificaron como desarrollo indefinido. Se calculo un índice de desarrollo para cada nido como medida cuantitativa para comparar el desarrollo de los embriones total para todos los nidos del estudio. Esto era la suma del numero total de huevos en cada estadio multiplicado por el numero del estadio respectivo (0-5) y dividido por el numero total de huevos en el nido (R. Valverde, comm. pers.). Los huevos con desarrollo indefinido se excluyeron de este análisis. Análisis Molecular Extracción de ADN. Cada muestra se descongelo y se homogeneizo antes de colectar una submuestra para la extracción de ADN. Se extrajo la ADN desde una

14 14 submuestra de 1 g por cada nido usando un PowerSoil DNA Isolation Kit (Mo Bio Laboratories, Inc.) con algunas modificaciones al protocolo para aumentar el rinde de ADN. Se sometieron las muestras a 5 min a aprox. 2,000 oscilaciones por min en un bead beater (Mini Beadbeater-8, Biospec Products), seguido de tres ciclos congelodescongelo ( 20 C y 70 C por 30 min cada uno). Adicionalmente, solamente 50 µl del C6 elución buffer se uso en la etapa ultima, seguido de la centrifugación y colección del ADN en un tubo estéril. Por cada grupo de extracciones, un control negativo de extracción de ADN se llevo a cabo en cual no se añado arena para asegurar que no había señal del proceso de extracción únicamente. Las muestras de ADN se diluyeron para reducir la inhibición y optimizar la eficacia y el valor Ct dentro de la gama de la curva estándar. Análisis qpcr. Se llevo a cabo el qpcr absoluto usando un icycler iq TM Real- Time PCR Detection System (Bio-Rad Laboratories, Inc.) en una placa de 96 pocillos. Se analizaron los resultados usando el iq5 software (Bio-Rad Laboratories, Inc.). Los primers universales de bacterias 926F (5'-AAA CTC AAA KGA ATT GAC GG-3') y 1062R (5'-CTC ACR RCA CGA GCT GAC-3') que se dirige al gen 16S rrna se usaron basado en un estudio previo por Bacchetti De Gregoris et al. (2011). Cada reacción de 10-µl tenia los siguientes contenidos: 5 µl de ABsolute qpcr Master Mix (ABgene), 0.1 µl bovine serum albumin (10 µg µl -1 ; Thermo Scientific), 0.3 µl de cada primer (10 µm, concentración final de 300 nm; Integrated DNA Technologies), 3.9 µl H 2 O, y 0.4 µl de la muestra de ADN. Las condiciones de PCR eran 15 min a 95 C, seguido de 40 ciclos de 95 C por 15 s, 15 s a la temperatura de recocido de 57º C, y 72 C por 20 s.

15 15 Los primers universales de hongos FR1 (5 -AICCATTCAATCGGTAIT-3 ) y FF390 (5 -CGATAACGAACGAGACCT-3 ) que se dirigen al gen 18S rrna se usaron basados en previos estudios (Chemidlin Prévost-Bouré et al., 2011; Vainio y Hantula, 2000). Cada reacción de 10-µl tenia los siguientes contenidos: 5 µl de ABsolute qpcr Master Mix (ABgene), 0.1 µl bovine serum albumin (10 µg µl -1 ; Thermo Scientific), 0.1 µl de cada primer (10 µm, concentración final de 100 nm; Integrated DNA Technologies), 4.3 µl H 2 O, y 0.4 µl muestra de ADN. Las condiciones de PCR eran de 15 min a 95 C, seguido de 40 ciclos de 95 C por 15 s, 30 s a la temperatura de recocido de 50º C, y 72 C por 1 min. Estándares. Estándares externos y fijos se crearon tras la amplificación y cuantificación de ADN de bacterias y hongos usando pares de primer que se dirigen a los genes enteros de la secuencia de 16S/18S rrna. La muestra de ADN por el estándar de bacteria y hongo eran generosamente provistas de cultivos de Bacillus pumilus (W. Hook, Grice Marine Laboratory, College of Charleston, Charleston, SC) y Phytophthora capsici (J. Ikerd, U.S. Vegetable Laboratory, USDA, ARS, Charleston, SC), respectivamente. Para bacterias, los primers universales 8F (5 -AGAGTTTGATCCTGGCTCAG-3 ) y 1492R (5 GGTTACCTTGTTACGACTT-3 ) se usaron con las siguientes condiciones de PCR: 3 min a 95 C, seguido de 30 ciclos a 95 C por 1 min, 1 min a la temperatura de recocido de 45º C, y 72 C por 1.5 min, con una etapa final de elongación de 4 min a 72 C (Lane, 1991; Turner et al., 1999). Para hongos, los primers universales NS1 (5 - GTAGTCATATGCTTGTCTC-3 ) y NS8 (5 TCCGCAGGTTCACCTACGGA-3 ) se usaron con las siguientes condiciones de PCR: 4 min a 95 C, seguido de 30 ciclos a 95 C por 1 min, 2 min a la temperatura de recocido de 55º C, y 72 C por 1.5 min, con una

16 16 etapa final de elongación de 10 min a 72 C (Uemura et al., 2008; White et al., 1990). Cada reacción de 25-µl tenia los siguientes contenidos: 5 µl de buffer (5X colorless GoTaq Flexi Buffer, Promega), 3 µl de MgCl 2 (25 mm; Promega), 0.25 µl bovine serum albumin (10 µg µl -1 ; Promega), 0.5 µl dntp (10mM; Thermo Scientific), 0.5 µl de cada primer (5 µm; Integrated DNA Technologies), 0.1 µl de DNA polymerase (5 U µl -1 ; GoTaq Flexi DNA polymerase, Promega), µl H 2 O, y 2 µl muestra de ADN. Los productos de PCR de bacteria y hongo se recorrieron en un gel de 0.5% agarose gel, se purificaron con un Qiaquick Gel Extraction Kit (Qiagen), y se eluyo en 30 µl en la etapa final. Los estándares se cuantificaron usando el Qubit dsdna BR Assay Kit (Invitrogen, Life Technologies) y un Qubit 2.0 Fluorometer (Qubit Systems) para determinar la cantidad de ADN en la etapa final. La longitud del producto se uso para calcular la cantidad de copias por cada µl, bajo la asunción que el peso molecular de cada bp es 650. La curva estándar se genero usando diluciones 10-veces de estos estándares tras 8 ordenes de magnitud, por lo tanto estandarizando los resultados de qpcr por cantidad de copias. Cada placa tenia reacciones en triplicas por cada muestra de ADN y por la curva estándar, tanto como un control sin-plantilla para verificar que no había contaminación. Una curva de derrito (1 min a 95 C, 1 min a 55 C, +0.5 C 10 s -1 hasta 95 C) se usa al final de cada experimento de qpcr para asegurar que el señal de fluorescencia origino de un producto especifico de PCR más que un primer dimer o producto no-especifico. El tinte fluoresceína incluido en el master mix permitió la normalización estándar del error a través de las muestras. Los ciclos umbral (Ct) se calcularon automáticamente por el software basado en el promedio de ruido de fondo. Los triplicas que variaron más de 1

17 17 desviación estándar del promedio se excluyeron del análisis. Muestras con menos de un orden de magnitud de separación (valor de 3.3 Ct) del control sin muestra se excluyeron dado que eran fuera del limite de detección del análisis presente (Smith et al., 2006; Smith y Osborn, 2009). Análisis Estadístico Los análisis estadísticos se llevaron a cabo usando JMP 10 (SAS Institute, La tasa de eclosión, el índice de desarrollo, el peso de las crías, la temperatura, po 2, el contenido de agua, el contenido de materia orgánica, y los datos de tamaño de grano se analizaron usando ANOVA. Cuando no se pudo asegurar la suposición de normalidad y homogeneidad, se usaron pruebas no-paramétricas (Wilcoxon/Kruskal-Wallis). Se agrupo los nidos de cada tipo de tratamiento (remojo vs. tópico) para comparación. Los resultados estadísticamente significativos se probaron en seguido con una prueba de Tukey s HSD post-hoc test para determinar las diferencias significativas tras los tratamientos experimentales. Las relaciones entre variables (tasa de eclosión, peso de crías, po 2, temperatura, tamaño de grano, contenido de materia orgánica, y cantidad de copias 16S/18S) se evaluaron usando coeficientes de correlación de Spearman s rank. Un Generalized Linear Model (distribución normal) se uso para analizar el efecto de cada de estos variables y cualquier interacción potencial entre ellos en la tasa de eclosión. Como el desarrollo del embrión de las tortugas marinas es limitado dentro de la primera mitad de incubación, las diferencias en el contenido de oxigeno y la temperatura dentro de este periodo se puede presuntamente atribuir a la actividad microbiana (Ackerman, 1981b; Clusella Trullas y Paladino, 2007). Por lo tanto, el promedio de po 2

18 18 del nido y la temperatura se analizaron por la primera y segunda mitad de incubación por separado. Medidas repetitivas de temperatura y oxigeno se analizaron con un MANOVA de medidas repetitivas. Para la comparación de muestras tras placas de qpcr, una ANCOVA se uso para asegurar que no había diferencias significativas entre las curvas estándares entre ellas. Todos los valores se presentan como promedio ± error estándar (SE). Datos de porcentaje (tasa de eclosión) y abundancia microbiana (cantidad de copias) se transformaron arcsin y log, respectivamente, antes del análisis con estadísticos paramétricos. El promedio de tamaño de grano se convirtió desde unidos phi (φ) hasta mm para la presentación de datos. La cantidad de copias 16S/18S ul -1 de muestra se convirtió a una cantidad de 16S/18S g -1 de arena del nido para permitir la comparación tras muestras. Todos los análisis se probaron por significancia estadística a α < RESULTADOS La arribada de muestreo ocurrió en Octubre 2013 (estimado de 186,076 hembras anidando) y otra arribada (Noviembre 2013; estimado de 110,263 hembras anidando) ocurrió antes de las exhumaciones cual se llevaron a cabo al final de Diciembre (R. Valverde, comm. pers.). La densidad de nidos en el área de la playa adyacente al vivero durante las exhumaciones era de aproximadamente 1.6 nidos m -2 y la tasa de eclosión de los nidos (naturales) puestos en esta parte de la playa durante la arribada de Octubre era de aproximadamente 27% (R. Valverde, comm. pers.). Se observo infestaciones de larvas, tanto como de bacterias y hongos, en la mayoridad de nidos naturales y experimentales en esta parte da la playa. Hubo un efecto significativo de tratamiento en la tasa de eclosión (p = ; Fig. 1) y los tratamientos de remojo tuvieron una tasa de eclosión significativamente más

19 19 alta (52%) que los tratamientos tópicos (32%, p = ). Además, los nidos ubicados en el tratamiento de agua dulce tuvieron un índice de desarrollo más bajo que los nidos de todos los otros tratamientos, aunque se excluyo una gran proporción de huevos de todos los nidos de este análisis por las infestaciones de larvas (p = ; datas del índice de desarrollo no incluidos). Adicionalmente, hubo un efecto significativo de los tratamientos en el peso de las crías (p = ; Fig. 2). Las crías de los nidos ubicados en la arena tratada con agua de mar (15.2 ± 0.4 g) y arena sin ningún tratamiento (14.1 ± 0.2 g) pesaron menos de todos los otros tratamientos. La tasa de eclosión era positivamente correlacionada con el peso de las crías (r = , p = ). Los resultados del General Linearized Model indicaron que la presión parcial de oxigeno en los nidos durante la primera mitad de incubación era el factor más importante en determinar la tasa de eclosión (p = ). La interacción entre la abundancia de hongos (cantidad de copias 18S) y el contenido de materia orgánica tanto como la presión parcial de oxigeno en la primera mitad de incubación también tuvieron un efecto significativo en determinar la tasa de eclosión (p = y p = , resp.). El Contenido de Oxigeno en el Nido Hubo un efecto significativo de los tratamientos en el promedio de contenido de oxigeno en el nido en la primera mitad de incubación (p < ), pero no en la segunda mitad de incubación (Fig. 3). Los nidos ubicados en arena sin ningún tratamiento tuvieron niveles de oxígeno significativamente más bajos en la primera mitad de incubación en comparación con todos los tratamientos de remojo (cloro, p = ; remojo, p = ; remplazo, p=0.0001). La presión parcial de oxigeno en los nidos de tratamientos tópicos (18.50 ± 0.18 kpa) era significativamente más baja en la primera

20 20 mitad de incubación en comparación con los nidos de los tratamientos remojo (19.50 ± 0.09 kpa; p < ). No hubo un efecto significativo de tratamiento en la presión parcial de oxigeno en los nidos tras el periodo entero de incubación. Sin embargo, hubo un efecto del día de incubación y un efecto de interacción entre el día de incubación y el tratamiento en el contenido de oxigeno en el nido (Tabla 1). También hubo un efecto significativo en el tipo de tratamiento (remojo vs. tópico) en el contenido de oxigeno por la duración entera de incubación (Tabla 2). Además, hubo una correlación positiva entre la tasa de eclosión y el contenido de oxigeno en el nido en la primera mitad de incubación (Tabla 3). La Temperatura del Nido No hubo un efecto significativo de los tratamientos en la temperatura de los nidos en la primera y segunda mitad de incubación (Fig. 4). No obstante, los tratamientos de remojo tuvieron temperaturas significativamente más bajas (30.51 ± 0.05 C) que los tratamientos tópicos (30.78 ± 0.10 C) en la primera mitad de incubación (p = ). Los eventos de lluvia tras la primera mitad de incubación eran asociados con temperaturas disminuidas en los nidos, con temperaturas aumentando consistentemente después del decrece de lluvia por el principio de la temporada seca en la segunda mitad de incubación (Fig. 5). No hubo efecto de los tratamientos en las temperaturas de los nidos tras el periodo entero de incubación, aunque hubo un efecto del día de incubación tanto como una interacción entre estos dos factores (Tabla 1). Por otro lado, hubo un efecto significativo del tipo de tratamiento y el día de incubación además de una interacción entre estos dos factores (Tabla 2). La temperatura promedia por día en la mayoría de los nidos no sobrepaso el limite letal (35 C), aunque las temperaturas de los

TaqMan GMO Maize Quantification Kit. Part No: 4481972

TaqMan GMO Maize Quantification Kit. Part No: 4481972 TaqMan GMO Maize Quantification Kit Part No: 4481972 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

GUÍA PARA LA PRESENTACIÓN DE REPORTES DE MONITOREO EN ACUICULTURA

GUÍA PARA LA PRESENTACIÓN DE REPORTES DE MONITOREO EN ACUICULTURA GUÍA PARA LA PRESENTACIÓN DE REPORTES DE MONITOREO EN ACUICULTURA OBJETIVO Guiar a los titulares de derechos acuícolas (que cuenten con Declaración de Impacto Ambiental, Estudio de Impacto Ambiental o

Más detalles

Factores físicos que afectan al grano almacenado

Factores físicos que afectan al grano almacenado Factores físicos que afectan al grano almacenado 1. Introducción Los granos y las semillas almacenadas están sujetas a los cambios ambientales. Esto cambios pueden ser de índole física, biológica, química

Más detalles

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Para la purificación de ADN genómico de todos los kits de colección Oragene y ORAcollect. Visite nuestro sitio

Más detalles

DANAGENE RNA PURIFICATION KIT

DANAGENE RNA PURIFICATION KIT DANAGENE RNA PURIFICATION KIT REF.0801.1 100 EXTRACCIONES REF.0801.2 500 EXTRACCIONES 1.INTRODUCCION Este kit permite la permite la obtención de ARN total a partir de cultivos celulares, tejidos animales,

Más detalles

Manual de lnstrucciones. HI 83900 Lisímetro de Succión. www.hannachile.com

Manual de lnstrucciones. HI 83900 Lisímetro de Succión. www.hannachile.com Manual de lnstrucciones Estimado Cliente, Gracias por elegir productos Hanna instruments. Por favor lea este manual de instrucción cuidadosamente antes de utilizar el equipo. Este manual le proporcionara

Más detalles

Control de calidad del Hormigón

Control de calidad del Hormigón Control de calidad del Hormigón Calidad Hay muchos factores involucrados en la producción del hormigón, desde los materiales, la dosificación de la mezcla, el transporte, la colocación, el curado y los

Más detalles

GPA2286: Análisis extendido para Gas Natural y Mezclas Gaseosas similares por Cromatografía de Gases de Temperatura programada

GPA2286: Análisis extendido para Gas Natural y Mezclas Gaseosas similares por Cromatografía de Gases de Temperatura programada GPA2286: Análisis extendido para Gas Natural y Mezclas Gaseosas similares por Cromatografía de Gases de Temperatura programada Tiempo de análisis inferior a 30 minutos Alta sensibilidad, linealidad, exactitud

Más detalles

TEMA 13: ESTERILIZACIÓN INDUSTRIAL Dr. Pedro F. Mateos

TEMA 13: ESTERILIZACIÓN INDUSTRIAL Dr. Pedro F. Mateos TEMA 13: ESTERILIZACIÓN INDUSTRIAL Dr. Pedro F. Mateos I. INTRODUCCION Para poder llevar a cabo una fermentación con éxito es imprescindible y obligatorio tener en todas las etapas cultivos libres de contaminantes,

Más detalles

3. Principios de medición de la calidad del aire

3. Principios de medición de la calidad del aire 3. Principios de medición de la calidad del aire 3.1. Medición. Medir es contar, comparar una unidad con otra, dar una valoración numérica, asignar un valor, asignar números a los objetos. Todo lo que

Más detalles

PRINCIPIOS DE LAS INVESTIGACIONES EPIDEMIOLOGICAS Y MEDICIÓN DE EFECTO-CAUSALIDAD PROGRAMA

PRINCIPIOS DE LAS INVESTIGACIONES EPIDEMIOLOGICAS Y MEDICIÓN DE EFECTO-CAUSALIDAD PROGRAMA PRINCIPIOS DE LAS INVESTIGACIONES EPIDEMIOLOGICAS Y MEDICIÓN DE EFECTO-CAUSALIDAD Curso: 25 Hrs. Asistentes: 25 Costo: $15,000 (Quince Mil Pesos 00/100 M.N) OBJETIVO: Conocer algunos conceptos básicos

Más detalles

Reglamento de uso y consideraciones generales del laboratorio de cultivo de células animales (Aprobado por CoDep DBBE e IFIByNE; Septiembre 2009)

Reglamento de uso y consideraciones generales del laboratorio de cultivo de células animales (Aprobado por CoDep DBBE e IFIByNE; Septiembre 2009) Reglamento de uso y consideraciones generales del laboratorio de cultivo de células animales (Aprobado por CoDep DBBE e IFIByNE; Septiembre 2009) Departamento de Biodiversidad y Biología Experimental (DBBE)

Más detalles

BENTLEY BactoCount IBC

BENTLEY BactoCount IBC BENTLEY BactoCount IBC Características del equipo El BactoCount IBC es un equipo automático para contar rápido e individualmente las bacterias de la leche cruda. Capacidad: de 50 hasta 150 muestras / hora.

Más detalles

5. MATERIALES Y MÉTODOS

5. MATERIALES Y MÉTODOS 5. MATERIALES Y MÉTODOS 5.1 Equipos Los siguientes termocicladores se emplearon para la amplificación por PCR: - Perkin Elmer, GeneAmp PCR System 2400. - Perkin Elmer, GeneAmp PCR System 9600. - Applied

Más detalles

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a Introducción Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a los investigadores verificar la expresión de una proteína, determinar la cantidad relativa

Más detalles

Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala

Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala IICA/Red SICTA-CIAT INFORME DE AVANCE Gerardo Gallego - Harold

Más detalles

1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de Quant- it PicoGreen dsaadnssay Kit (Invitrogen ).

1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de Quant- it PicoGreen dsaadnssay Kit (Invitrogen ). 1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de QuantiT PicoGreen dsaadnssay Kit (Invitrogen ). 2. Finalidad. El presente documento describe el Procedimiento Normalizado de

Más detalles

Guía de PCR en tiempo real

Guía de PCR en tiempo real Guía de PCR en tiempo real Michelle C. Chirinos-Arias michelle.christine16@gmail.com Índice Introducción. 2 Algunos conceptos. 2 PCR (reacción en cadena de la polimerasa)... 2 PCR en tiempo real (qpcr)..

Más detalles

Métodos de esterilización y desinfección

Métodos de esterilización y desinfección Objetivo Métodos de esterilización y desinfección Curso: Métodos en Fitopatología 24 de abril de 2012 Ing. Agr. MSc. Vivienne Gepp Que el estudiante se familiarice con los procesos de desinfección y esterilización

Más detalles

UNA GUIA PRACTICA PARA MONITOREAR GASES PELIGROSOS

UNA GUIA PRACTICA PARA MONITOREAR GASES PELIGROSOS UNA GUIA PRACTICA PARA MONITOREAR GASES PELIGROSOS El monitoreo de gases peligrosos para calidad del aire en el área de trabajo y seguridad es un tema complejo. A diferencia de otros tipos relativamente

Más detalles

Acción Enzimática: Actividad de la Catalasa

Acción Enzimática: Actividad de la Catalasa Acción Enzimática: Actividad de la Catalasa Experimento 3 Muchos organismos pueden descomponer el peróxido de hidrógeno (H 2 O 2 ) por la acción de las enzimas. Las enzimas son proteínas globulares responsables

Más detalles

Protocolos de secuenciación de ADN

Protocolos de secuenciación de ADN 1 Protocolos de secuenciación de ADN Introducción El método de secuenciación utilizado aquí es el desarrollado por Sanger en 1975. Este consiste en la incorporación de didesixinucleótidos marcados fluorescentemente

Más detalles

TaqMan GMO Screening Kit. Part No: 4466334

TaqMan GMO Screening Kit. Part No: 4466334 TaqMan GMO Screening Kit Part No: 4466334 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan mayor

Más detalles

Prueba de Software de Conteo Celular

Prueba de Software de Conteo Celular Prueba de Software de Conteo Celular Act. Guadalupe Siordia Montero Universidad Autónoma de Yucatán 25 de Octubre del 2006 Índice 1. Antecedentes 2 2. Planteamiento del problema 4 2.1. Objetivo del trabajo............................

Más detalles

Preparación de medios de cultivo

Preparación de medios de cultivo Objetivos Preparación de medios de cultivo Curso: Métodos en fitopatología 24 de abril de 2009 Dr. Pedro Mondino Conocer a que denominamos medio de cultivo en el laboratorio de Fitopatología. Reconocer

Más detalles

CAPITULO 5. PROCESO DE SECADO. El secado se describe como un proceso de eliminación de substancias volátiles (humedad)

CAPITULO 5. PROCESO DE SECADO. El secado se describe como un proceso de eliminación de substancias volátiles (humedad) CAPITULO 5. PROCESO DE SECADO. 5.1 Descripción general del proceso de secado. El secado se describe como un proceso de eliminación de substancias volátiles (humedad) para producir un producto sólido y

Más detalles

PRINCIPIOS Y DIRECTRICES PARA EL ESTABLECIMIENTO Y LA APLICACIÓN DE CRITERIOS MICROBIOLÓGICOS RELATIVOS A LOS ALIMENTOS

PRINCIPIOS Y DIRECTRICES PARA EL ESTABLECIMIENTO Y LA APLICACIÓN DE CRITERIOS MICROBIOLÓGICOS RELATIVOS A LOS ALIMENTOS PRINCIPIOS Y DIRECTRICES PARA EL ESTABLECIMIENTO Y LA APLICACIÓN DE CRITERIOS MICROBIOLÓGICOS RELATIVOS A LOS ALIMENTOS CAC/GL 21-1997 1. INTRODUCCIÓN 1. Las enfermedades causadas por patógenos transmitidos

Más detalles

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental.

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Gemma Saucedo. Laboratorio Aguas de Barcelona 22-23 de noviembre de 2006 Introducción PCR: Polymerase Chain Reaction

Más detalles

Tema 4 Difusión en estado sólido

Tema 4 Difusión en estado sólido Tema 4 Difusión en estado sólido Sabemos que los materiales están formados por átomos. Se ha modelado el agrupamiento de los átomos como un conjunto de esferas sólidas ordenadas siguiendo un patrón definido.

Más detalles

CICLO 2 : Fraccionamiento subcelular

CICLO 2 : Fraccionamiento subcelular Curso de Fisicoquímica Biológica 2006 Licenciatura de Bioquímica. Facultad de Ciencias. CICLO 2 : Fraccionamiento subcelular OBJETIVOS GENERALES: 1) Obtención de preparados enriquecidos en fracciones subcelulares

Más detalles

Materiales para la secuenciación de ADN

Materiales para la secuenciación de ADN Introduccion La Secuenciación Sanger es un método de secuenciación de ADN en el que el ADN diana se desnaturaliza y se hibrida con un cebador de oligonucleótidos, que se extiende entonces gracias a la

Más detalles

III. METODOLOGÍA EXPERIMENTAL

III. METODOLOGÍA EXPERIMENTAL III. METODOLOGÍA EXPERIMENTAL 3.1 Análisis Previos Se utilizaron los filtros con muestra de partículas suspendidas en el aire PM 10 que el Instituto Municipal de Ecología (IME) proporcionó para llevar

Más detalles

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN 5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN Materiales - Eppendorf de 1,5 ml estériles - Eppendorf de pared fina para PCR - Puntas de pipeta estériles desechables - Guantes

Más detalles

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR)

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) Centro de de Microscopía Electrónica Facultad de de Ciencias Médicas Universidad Nacional de de Córdoba

Más detalles

ORGANISMO DE EVALUACIÓN Y FISCALIZACIÓN AMBIENTAL DIRECCIÓN DE EVALUACIÓN EQUIPOS DE MEDICION DE LA CALIDAD DEL AIRE

ORGANISMO DE EVALUACIÓN Y FISCALIZACIÓN AMBIENTAL DIRECCIÓN DE EVALUACIÓN EQUIPOS DE MEDICION DE LA CALIDAD DEL AIRE OEFA ORGANISMO DE EVALUACIÓN Y FISCALIZACIÓN AMBIENTAL DIRECCIÓN DE EVALUACIÓN EQUIPOS DE MEDICION DE LA CALIDAD DEL AIRE MONITOREO DE LA CALIDAD DEL AIRE Métodos Pasivos Métodos Activos Métodos Automáticos

Más detalles

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles

Control de calidad del. Ciudad de La Rioja Mayo 2013

Control de calidad del. Ciudad de La Rioja Mayo 2013 Control de calidad del Hormigón Ciudad de La Rioja Mayo 2013 Control de calidad Desde que se comenzó con la producción de bienes, se han hecho intentos en controlar el proceso de manera de mejorar la calidad

Más detalles

CAPITULO 6 ANALISIS Y ESTUDIO DE SECADO. El secado de sólidos se puede definir de distintas maneras, según el enfoque que se

CAPITULO 6 ANALISIS Y ESTUDIO DE SECADO. El secado de sólidos se puede definir de distintas maneras, según el enfoque que se 52 CAPITULO 6 ANALISIS Y ESTUDIO DE SECADO 6.1 Definición de secado El secado de sólidos se puede definir de distintas maneras, según el enfoque que se desee adoptar. En los estudios más teóricos se pone

Más detalles

Hidrosfera. 1) En las aguas epicontinentales se incluyen el mar Caspio, el Aral y el mar Muerto, además de lagos, ríos, etc.

Hidrosfera. 1) En las aguas epicontinentales se incluyen el mar Caspio, el Aral y el mar Muerto, además de lagos, ríos, etc. Hidrosfera Formación Cuando la Tierra se fue formando, hace unos 4600 millones de años, las altas temperaturas hacían que toda el agua estuviera en forma de vapor. Al enfriarse por debajo del punto de

Más detalles

ENUMERACION BACTERIANA: EL NUMERO MAS PROBABLE

ENUMERACION BACTERIANA: EL NUMERO MAS PROBABLE CUARTA PARTE ENUMERACION BACTERIANA: EL NUMERO MAS PROBABLE EL METODO DE NUMERO MAS PROBABLE (NMP) es una estrategia efeciente de estimación de densidades poblacionales especialmente cuando una evaluación

Más detalles

REGLAMENTO RTCA 11.03.39: 06 TÉCNICO CENTROAMERICANO

REGLAMENTO RTCA 11.03.39: 06 TÉCNICO CENTROAMERICANO ANEXO DE LA RESOLUCIÓN No. 188-2006 (COMIECO-XL) REGLAMENTO RTCA 11.03.39: 06 TÉCNICO CENTROAMERICANO PRODUCTOS FARMACÉUTICOS. VALIDACIÓN DE MÉTODOS ANALÍTICOS PARA LA EVALUACIÓN DE LA CALIDAD DE LOS MEDICAMENTOS

Más detalles

Resumen Ejecutivo. 1 Introducción

Resumen Ejecutivo. 1 Introducción Resumen Ejecutivo 1 Introducción El clima de una zona o región corresponde al conjunto de condiciones atmosféricas que la caracterizan, es entonces un estado promedio del tiempo atmosférico determinado

Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri OBJETIVO Desarrollar un banco de datos a partir de plantas de origen indudable y del uso

Más detalles

Kit PunchSolution INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC9271.

Kit PunchSolution INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC9271. Technical Manual Kit PunchSolution INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC9271. IMPRESO EN ESTADOS UNIDOS 5/12 Kit PunchSolution Toda la bibliografía técnica está disponible en Internet, en el sitio

Más detalles

BIOCOMBUSTIBLES Y CALDERAS DE BIOMASA

BIOCOMBUSTIBLES Y CALDERAS DE BIOMASA BIOCOMBUSTIBLES Y CALDERAS DE BIOMASA LA BIOMASA, UNA OPORTUNIDAD PARA LAS ENTIDADES LOCALES David Sánchez- dsanchez@cener.com Arbizu, 11 de junio de 2012 í n d i c e 1. Biocumbustibles sólidos Tipos y

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles

La ARRIBADA. La vida de la Tortuga Marina Lora y la vida de la Comunidad de Ostional. Ostional, Costa Rica

La ARRIBADA. La vida de la Tortuga Marina Lora y la vida de la Comunidad de Ostional. Ostional, Costa Rica La ARRIBADA La vida de la Tortuga Marina Lora y la vida de la Comunidad de Ostional Ostional, Costa Rica Programa de Educación Biológica y Ambiental Ostional, Guanacaste, Costa Rica 2001-2002 DERECHOS

Más detalles

Mejoras en detectores de incendio utilizando sensores múltiples

Mejoras en detectores de incendio utilizando sensores múltiples Mejoras en detectores de incendio utilizando sensores múltiples Introducción Los detectores de incendio están diseñados para detectar los incendios desde su fase inicial con un alto grado de fiabilidad.

Más detalles

VALIDACIÓN DEL CONTROL HIGIÉNICO DE PRODUCTOS FARMACÉUTICOS NO OBLIGATORIAMENTE ESTERILES

VALIDACIÓN DEL CONTROL HIGIÉNICO DE PRODUCTOS FARMACÉUTICOS NO OBLIGATORIAMENTE ESTERILES VALIDACIÓN DEL CONTROL HIGIÉNICO DE PRODUCTOS FARMACÉUTICOS NO OBLIGATORIAMENTE ESTERILES Validación del Control Higiénico de Productos Farmacéuticos No obligatoriamente estériles Objetivo de la validación

Más detalles

MICROBIOLOGY LAB AUTOMATION

MICROBIOLOGY LAB AUTOMATION MICROBIOLOGY LAB AUTOMATION IUL: INTRODUCCIÓN IUL diseña, fabrica y comercializa instrumentos y consumibles para la automatización del laboratorio microbiológico. Los productos de IUL añaden innovaciones

Más detalles

CUANTIFICACIÓN DE ADENOSIN DESAMINASA (ADA)

CUANTIFICACIÓN DE ADENOSIN DESAMINASA (ADA) CUANTIFICACIÓN DE ADENOSIN DESAMINASA (ADA) PROTOCOLO ADA FUNDAMENTO DEL METODO: La adenosindesaminasa (ADA) es una enzima del catabolismo de las purinas que cataliza la conversión de la adenosina en inosina

Más detalles

CROMATOGRAFÍA DE GASES ACOPLADO A UN DETECTOR DE MASAS GC/MS

CROMATOGRAFÍA DE GASES ACOPLADO A UN DETECTOR DE MASAS GC/MS CROMATOGRAFÍA DE GASES ACOPLADO A UN DETECTOR DE MASAS GC/MS La cromatografía es una técnica para separar las sustancias químicas que se basa en las diferencias en conductas partitivas de una fase móvil

Más detalles

Control interno de los métodos de análisis

Control interno de los métodos de análisis Aseguramiento de la Calidad Control interno de los métodos de análisis Universidad Nacional Sede Medellín Facultad de Ciencias Escuela de Geociencias Orlando Ruiz Villadiego, Químico MSc. Coordinador Laboratorio

Más detalles

EL PARQUE NACIONAL MARINO LAS BAULAS DE GUANACASTE Y SU APORTE EN LA CONSERVACIÓN DE LAS TORTUGAS BAULAS DEL PACÍFICO ORIENTAL TROPICAL

EL PARQUE NACIONAL MARINO LAS BAULAS DE GUANACASTE Y SU APORTE EN LA CONSERVACIÓN DE LAS TORTUGAS BAULAS DEL PACÍFICO ORIENTAL TROPICAL III CONGRESO MESOAMERICANO DE ÁREAS PROTEGIDAS Simposio Fortalecimiento y Expansión de Áreas Protegidas Costero. Marinas Mérida Yucatán México 8 12 de Marzo del 2010 EL PARQUE NACIONAL MARINO LAS BAULAS

Más detalles

UNIVERSIDAD NACIONAL AGRARIA Escuela de Post-Grado. Estadistica Aplicada a la FORESTERIA II INDICE DE TEMAS

UNIVERSIDAD NACIONAL AGRARIA Escuela de Post-Grado. Estadistica Aplicada a la FORESTERIA II INDICE DE TEMAS UNIVERSIDAD NACIONAL AGRARIA Escuela de Post-Grado Estadistica Aplicada a la FORESTERIA II 2007 INDICE DE TEMAS Metodos Generales: 1. Principios basicos del diseño experimental 2. Tipos de experimentos

Más detalles

SwabSolution Kit INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC8271.

SwabSolution Kit INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC8271. Technical Manual SwabSolution Kit INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC8271. IMPRESO EN ESTADOS UNIDOS Nro. de pieza: TMD037 SwabSolution Kit Toda la bibliografía técnica está disponible en Internet,

Más detalles

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

EXPERIMENTACIÓN. Eduardo Jiménez Marqués

EXPERIMENTACIÓN. Eduardo Jiménez Marqués EXPERIMENTACIÓN Eduardo Jiménez Marqués 1 CONTENIDO: 1. Experimentación...3 1.1 Concepto...3 1. Definición...4 1.3 Dificultad...4 1.4 Ventaja...5 1.5 Planificación...5 1.6 Aplicaciones...5 1.7 Metodología...6

Más detalles

AIREACIÓN C = 475. 33,5 x t. C = expresado en partes por millón

AIREACIÓN C = 475. 33,5 x t. C = expresado en partes por millón 1 AIREACIÓN El rol de los dispositivos de aireación colocados en los fermentadores, es de proveer a los microorganismos del oxigeno necesario para su crecimiento. Por otra parte el fin de la agitación

Más detalles

ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA

ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA FACULTAD DE VETERINARIA DEPARTAMENTO DE SANIDAD ANIMAL ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA GUIÓN DE PRÁCTICAS DE LABORATORIO CURSO 2014 2015 MÓDULO: PORCINO Síndrome respiratorio y reproductor

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. info@atgen.com.uy www.atgen.com.uy

Más detalles

Especialmente recomendado para: El regadío y los Embalses de los Campos de

Especialmente recomendado para: El regadío y los Embalses de los Campos de DEPURADORAS PARA PURIFICAR AGUA DE EMBALSES PARA RIEGO DE CAMPOS DE GOLF (DESNITRIFICACIÓN) ELIMINACIÓN DE BACTERIAS, HONGOS, LEVADURAS, MOHOS, ETC. ELIMINA PARÁSITOS, CLORO, FLÚOR, DIOXINAS. PESTICIDAS

Más detalles

El olor, el sabor y la turbidez son los indicadores más importantes de la calidad del agua potable. Principio de medición. Calibración de fábrica

El olor, el sabor y la turbidez son los indicadores más importantes de la calidad del agua potable. Principio de medición. Calibración de fábrica Turbidez y Sólidos Suspendidos Turbidez El olor, el sabor y la turbidez son los indicadores más importantes de la calidad del agua potable. Este último es una medición cuantitativa de los sólidos no disueltos

Más detalles

Sistemas de Purificación PURIFICACIÓN DE AGUA

Sistemas de Purificación PURIFICACIÓN DE AGUA Sistemas de Purificación PURIFICACIÓN DE AGUA DEL TOTAL DEL AGUA DEL MUNDO: 3% es Agua Dulce 97 % se encuentra en océanos y mares. De ese 3%: 79% está en la cresta de los glaciares, 20% se encuentra en

Más detalles

Instrumentos de Medición y Muestreo. Medición de gases y vapores

Instrumentos de Medición y Muestreo. Medición de gases y vapores Instrumentos de Medición y Muestreo Medición de gases y vapores 1 Medición de gases y vapores Para realizar la medición de la presencia de gases y vapores en el ambiente podemos utilizar: Instrumentos

Más detalles

La GIRH como herramienta para la adaptación a los cambios climáticos. Factores e impactos de los

La GIRH como herramienta para la adaptación a los cambios climáticos. Factores e impactos de los La GIRH como herramienta para la adaptación a los cambios climáticos Factores e impactos de los cambios climáticos Resumen de la presentación Esta sesión abordará: Los factores o la base de las ciencias

Más detalles

Preparación Y ESTERILIZACIÓN de materiales de laboratorio

Preparación Y ESTERILIZACIÓN de materiales de laboratorio Preparación Y ESTERILIZACIÓN de materiales de laboratorio Área de Bacteriología. Depto. de Ciencias Microbiológicas Facultad de Veterinaria UdelaR 2015 Esterilización Definición Esterilización: proceso

Más detalles

Alternativas De Control De Combustión En Calderas Industriales

Alternativas De Control De Combustión En Calderas Industriales Alternativas De Control De Combustión En Calderas Industriales Iván Pezoa 1 1 Area de Instrumentación y Automatización, Escuela Tecnológica, USACH, Chile. Resumen. Las calderas industriales son usadas

Más detalles

Curso de biología molecular CIMAT 2010

Curso de biología molecular CIMAT 2010 Curso de biología molecular CIMAT 2010 INTRODUCCIÓN Este curso-taller tiene como propósito mostrar de manera teórica y práctica algunos principios básicos de biología molecular e ingeniería genética. Conocerás

Más detalles

Universidad Tecnológica de Panamá Centro de Investigaciones Hidráulicas e Hidrotécnicas Laboratorio de Sistemas Ambientales

Universidad Tecnológica de Panamá Centro de Investigaciones Hidráulicas e Hidrotécnicas Laboratorio de Sistemas Ambientales Página: 1 de 5 1. Introducción: La medición de nitratos en aguas residuales se hace en mg/l. El método es conocido usualmente con el nombre de Reducción de Cadmio, que es donde los iones de nitrito reaccionan

Más detalles

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles

Rosamil Rey, Ph.D. CHEM 4160

Rosamil Rey, Ph.D. CHEM 4160 Rosamil Rey, Ph.D. CHEM 4160 Los métodos analíticos se pueden clasificar en: Métodos Clásicos Métodos Instrumentales Métodos Clásicos Precipitación Extracción Destilación Medidas gravimétricas Medidas

Más detalles

CAPÍTULO III MATERIALES Y MÉTODOS. El propósito de este capitulo es describir a detalle cada uno de los procedimientos y

CAPÍTULO III MATERIALES Y MÉTODOS. El propósito de este capitulo es describir a detalle cada uno de los procedimientos y CAPÍTULO III MATERIALES Y MÉTODOS El propósito de este capitulo es describir a detalle cada uno de los procedimientos y técnicas de laboratorio utilizadas en este proyecto para evaluar la eficiencia de

Más detalles

MATERIAL PARTICULADO COMO PM 10 EN EL AIRE DE LA CIUDAD DE VALENCIA VENEZUELA

MATERIAL PARTICULADO COMO PM 10 EN EL AIRE DE LA CIUDAD DE VALENCIA VENEZUELA MATERIAL PARTICULADO COMO PM 10 EN EL AIRE DE LA CIUDAD DE VALENCIA VENEZUELA LEYDA M. ESCALONA (*) Laboratorio Tecnológico del Ambiente, LabTA, Universidad de Carabobo, Licenciada en Química,, Master

Más detalles

ÁREA DE ESTUDIOS MEDIOAMBIENTALES

ÁREA DE ESTUDIOS MEDIOAMBIENTALES ÁREA DE ESTUDIOS MEDIOAMBIENTALES SERVICIO DE ESTUDIOS MEDIOAMBIENTALES ANÁLISIS FOTOSINTÉTICO (IRGA) AUTOANALIZADOR DE FLUJO CONTÍNUO CÁMARA DE CULTIVOS ESTUFA REFRIGERADA FLUORÍMETRO DE CAMPO JARDÍN

Más detalles

Monitoreo de pasturas y vegetación natural Planilla final La planilla final se utiliza para juntar la información de todos los meses. Esta forma de presentar la información brinda un panorama amplio de

Más detalles

ESTERILIZACION ESTERILIZACION

ESTERILIZACION ESTERILIZACION ESTERILIZACION La esterilización puede definirse como la ausencia de todas las formas de vida viables. En la practica, la muerte de un microorganismo se alcanza cuando no es posible detectarlo en un medio

Más detalles

Contribución del Grupo de Trabajo II al Quinto Informe de Evaluación del IPCC. Capítulo 4: Ecosistemas Terrestres y de Agua dulce

Contribución del Grupo de Trabajo II al Quinto Informe de Evaluación del IPCC. Capítulo 4: Ecosistemas Terrestres y de Agua dulce Contribución del Grupo de Trabajo II al Quinto Informe de Evaluación del IPCC Capítulo 4: Ecosistemas Terrestres y de Agua dulce José Manuel Moreno Universidad de Castilla-La Mancha Editor de la Revisión

Más detalles

DT040A Sensor de Dióxido de carbono gaseoso

DT040A Sensor de Dióxido de carbono gaseoso Sensor de CO 2 DT040A Sensor de Dióxido de carbono gaseoso El sensor de CO 2 puede ser conectado a los recolectores de datos ITP-C, MultiLogPRO o TriLink. El sensor de CO 2 mide la concentración de dióxido

Más detalles

GUÍA DE BIOLOGÍA: CICLOS BIOGEOQUÍMICOS

GUÍA DE BIOLOGÍA: CICLOS BIOGEOQUÍMICOS GUÍA DE BIOLOGÍA: CICLOS BIOGEOQUÍMICOS NIVEL: 7º Ciclo del carbono: ciclo de utilización del carbono por el que la energía fluye a través del ecosistema terrestre. El ciclo básico comienza cuando las

Más detalles

Laboratorio. Investigación Científica. Objetivos I N T R O D U C C I Ó N. Al finalizar este laboratorio podrá:

Laboratorio. Investigación Científica. Objetivos I N T R O D U C C I Ó N. Al finalizar este laboratorio podrá: Laboratorio 2 Investigación Científica Objetivos Al finalizar este laboratorio podrá: 1. Identificar y formular preguntas que puedan contestarse con el método científico. 2. Formular una hipótesis y describir

Más detalles

Ciencia de la crecida repentina

Ciencia de la crecida repentina Capítulo 2 Ciencia de la crecida repentina Una crecida repentina generalmente se define como una inundación de corta duración que alcanza un caudal máximo relativamente alto (Organización Meteorológica

Más detalles

(SSAT) INSTRUCCIONES DE INSTALACION Y OPERACIÓN

(SSAT) INSTRUCCIONES DE INSTALACION Y OPERACIÓN TUBOS DE ACCESO A LA SOLUCION DEL SUELO IRROMETER (SSAT) INSTRUCCIONES DE INSTALACION Y OPERACIÓN MUESTREO DEL AGUA DEL SUELO LISIMETRIA DE SUCCION Antecedentes Esta tecnología es un método simple, de

Más detalles

Medición de CO 2. en incubadoras - Preguntas y respuestas / NOTA DE APLICACIÓN

Medición de CO 2. en incubadoras - Preguntas y respuestas / NOTA DE APLICACIÓN / NOTA DE APLICACIÓN INCUBADORAS SEPTIEMBRE DE 2009 Medición de CO 2 en incubadoras - Preguntas y respuestas PRIMARY IMAGE AREA El propósito de este documento es responder las preguntas más frecuentes

Más detalles

DETERMINACIÓN DEL CONTENIDO GRAVIMÉTRICO DE AGUA (HUMEDAD)

DETERMINACIÓN DEL CONTENIDO GRAVIMÉTRICO DE AGUA (HUMEDAD) DETERMINACIÓN DEL CONTENIDO GRAVIMÉTRICO DE AGUA (HUMEDAD) 1 - ALCANCE 1.1 - Esta norma describe y regula el método de ensayo para la determinación en el laboratorio del contenido gravimétrico de agua

Más detalles

Microbiología General 2008-2009

Microbiología General 2008-2009 Microbiología General 2008-2009 Eliminación de microorganismos Teoría de la esterilización (conceptos de valores D y z). Tratamientos industriales de esterilización: la Pasteurización, tratamientos HTST

Más detalles

y desinfección. Medios de cultivo. Objetivos Métodos de esterilización Definiciones Calor seco Calor seco MECÁNICOS FISICOS: QUIMICOS

y desinfección. Medios de cultivo. Objetivos Métodos de esterilización Definiciones Calor seco Calor seco MECÁNICOS FISICOS: QUIMICOS Métodos de esterilización y desinfección. n. Medios de cultivo. Curso: Diagnósticos en Fitopatología 17 de setiembre de 2015 Ing. Agr. MSc. Vivienne Gepp Objetivos Familiarizarse con los procesos de desinfección

Más detalles

EFECTO DEL USO Y MANEJO SOBRE LA RESPIRACIÓN EDAFICA y BIOMASA MICROBIAL DE UN SUELO DEL DISTRITO DE RIEGO DEL RIO ZULIA

EFECTO DEL USO Y MANEJO SOBRE LA RESPIRACIÓN EDAFICA y BIOMASA MICROBIAL DE UN SUELO DEL DISTRITO DE RIEGO DEL RIO ZULIA EFECTO DEL USO Y MANEJO SOBRE LA RESPIRACIÓN EDAFICA y BIOMASA MICROBIAL DE UN SUELO DEL DISTRITO DE RIEGO DEL RIO ZULIA IBONNE GEANETH VALENZUELA BALCAZAR RAFAEL GELVEZ ACEVEDO EFRAIN FRANCISCO VISCONTI

Más detalles

LISTA DE FIGURAS. Pagina

LISTA DE FIGURAS. Pagina TABLA DE CONTENIDO TABLA DE CONTENIDO 5 LISTA DE FIGURAS... 6 LISTA DE TABLAS 8 RESUMEN 10 1. INTRODUCCIÓN 13 2. MATERIALES Y MÉTODOS 23 2.1. Área de estudio 23 2.2. Diseño de muestreo 25 2.2.1. Variables

Más detalles

Protocolo de Humedad y Temperatura del Suelo Empleando la Estación Davis

Protocolo de Humedad y Temperatura del Suelo Empleando la Estación Davis Protocolo de Humedad y Temperatura del Suelo Empleando la Estación Davis Objetivo General Registrar los datos de suelos utilizando una estación Davis para medir la humedad del suelo y temperatura. Visión

Más detalles

PET-RPLA KIT para DETECCIÓN de TOXINAS. Código: TD0930

PET-RPLA KIT para DETECCIÓN de TOXINAS. Código: TD0930 PET-RPLA KIT para DETECCIÓN de TOXINAS Código: TD0930 Kit para detección de enterotoxina tipo A de Clostridium perfringens en muestras fecales o en filtrados de cultivos por aglutinación pasiva de látex

Más detalles

Productos para la Horticultura

Productos para la Horticultura Distribuido por: 2010 Colwave s.a.s Sistemas de Monitoreo del Medio Ambiente y Meteorología. Celular.: +57-3137434895 e-mail: comercial@colwave.com Sitio Web: www.colwave.com Medellín Colombia CE ph Nitrato

Más detalles

ANÁLISIS DE DATOS CONTROL DE CALIDAD. Ing. Carlos Brunatti

ANÁLISIS DE DATOS CONTROL DE CALIDAD. Ing. Carlos Brunatti ANÁLISIS DE DATOS CONTROL DE CALIDAD Ing. Carlos Brunatti Montevideo, ROU, junio 2015 Control de calidad No resulta sorprendente que el hormigón sea un material variable, pues hay muchos factores involucrados

Más detalles

POLIETILENO DE ALTA Y BAJA DENSIDAD

POLIETILENO DE ALTA Y BAJA DENSIDAD Universidad de Chile Facultad de Ciencias Físicas y Matemáticas Departamento de Ingeniería Química y Biotecnología IQ5432- Tecnología de Materiales Plásticos POLIETILENO DE ALTA Y BAJA DENSIDAD SOY PAZ

Más detalles

GUIA PARA LA PREPARACION Y PESAJE DE FILTROS EN EL MONITOREO ATMOSFÉRICO

GUIA PARA LA PREPARACION Y PESAJE DE FILTROS EN EL MONITOREO ATMOSFÉRICO GUIA PARA LA PREPARACION Y PESAJE DE FILTROS EN EL MONITOREO ATMOSFÉRICO M.I. Arturo Alberto Campos Ramos Jefe de Departamento Dirección de Investigación Experimental en Contaminación Atmosférica acampos@ine.gob.mx

Más detalles

1 MATERIALES Y MÉTODOS

1 MATERIALES Y MÉTODOS 1 MATERIALES Y MÉTODOS El presente protocolo experimental contempla la amplificación del DNA de las bacterias y virus causantes de las ETS Neisseria gonorrhoeae, Chlamydia trachomatis y VPH mediante PCR

Más detalles