Protocolos de secuenciación de ADN

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamaño: px
Comenzar la demostración a partir de la página:

Download "Protocolos de secuenciación de ADN"

Transcripción

1 1 Protocolos de secuenciación de ADN Introducción El método de secuenciación utilizado aquí es el desarrollado por Sanger en Este consiste en la incorporación de didesixinucleótidos marcados fluorescentemente a una cadena de ADN durante el proceso de copiado de la misma. Los didesixinucleótidos no poseen un grupo 3 -OH necesario para la formación del enlace fosfodiester que permite la unión entre nucleótidos, por lo tanto se interrumpe la elongación de la cadena cada vez que uno de estos es incorporado en ella. De este modo se generan secuencias de diferentes tamaños. Estas se hacen migran a través de un gel de poliacrilamida donde se separan por tamaños. El equipo de secuenciación cuenta con un dispositivo que permite captar la emisión de luz de los cuatro didesixinucleótidos. La lectura se hace entonces partiendo de las secuencias más cortas hasta la secuencia completa, y se genera un gráfico con picos de emisión de luz en la posición de cada uno de los nucleótidos de la secuencia de interés (cromatograma). El proceso de secuenciación se hace en seis pasos. Primero se prepara la secuencia de interés o templado de la reacción de secuencia. Esto consiste en la amplificación de la misma vía PCR. Una vez culminado el PCR la secuencia debe ser limpiada para eliminar los restos de primer y posibles inhibidores de la reacción de secuencia. Es recomendable mirar el producto de PCR antes de la limpieza y hacerlo migrar unos tres dedos en un gel de agarosa, para estar seguros de que la secuencia no presenta dobles bandas ni barridos. Si este es el caso, es necesario aislar la banda de interés del gel y limpiarla. El segundo paso es la cuantificación del producto de PCR limpio. La reacción de secuencia es muy sensible a la concentración del ADN templado, grandes cantidades inhiben la reacción (los reactivos se consumen rápidamente, como resultado se obtienen secuencias truncadas) y las pequeñas cantidades generan intensidades de luz pequeñas que pueden ser confundidas con el ruido de fondo. Adicionalmente se tiene establecida la cantidad de ADN templado para varios tipos y tamaños de secuencias (ver tabla 1). El tercer paso es la reacción de secuencia. Esta consiste en el copiado de la secuencia patrón, no es una amplificación de la secuencia como en el caso de la PCR, de allí que la concentración del ADN inicial sea tan restrictiva. La reacción de secuencia necesita de la hebra molde, uno solo de los primers (la inclusión de los dos primers genera dos secuencias superpuestas ilegibles), una enzima polimerasa de ADN, el cofactor de la enzima MgCl2, una solución tampón (buffer), los cuatro desoxinucleotidos (dntps) y los cuatro didesoxinucleotidos marcados (ddntps). Generalmente los kit de secuenciación traen una solución con la mezcla adecuada de dntps, ddntps, la enzima y el

2 2 MgCl2. En nuestro caso, utilizamos el kit Big Dye Terminator v3.1 Cycle Sequencing (Applied Biosystems) y la mezcla de reactivos de denomina Terminator Ready Reaction mix o Big Dye. La reacción de secuencia se lleva a cabo en un termociclador donde se repite un programa de extensión que consta de, un paso de desnatulalización de la secuencia de ADN a 96 C, uno para el anhealing de la secuencia a una temperatura de 50 C y el de la extensión de la secuencia a 60 C. Tabla 1: Cantidad de ADN templado para una reacción de secuencia, dependiendo del tipo y tamaño de la secuencia de interés. Tipo de Templado Tamaño de templado (pb) Cantidad de ADN inicial (ng) Producto de PCR > ADN de hebra simple ADN de doble hebra Cósmidos/BAC ADN genómico bacteriano El cuarto paso es la precipitación de la reacción de secuencia. En este se eliminan los reactivos sobrantes de la reacción y otras moléculas que puedan interferir en la lectura del secuenciador. Existen varios métodos de precipitación de la secuencia, aquí se muestran dos de ello uno basado en etanol e isopropanol y otro donde se utilizan perlitas magnéticas para capturar el ADN. El quinto paso es la resuspensión de la secuencia marcada en formamida de alta pureza (Formamida Hi-Di). Finalmente el último paso consiste en el montaje de la muestra en el equipo de secuenciación.

3 3 1. Protocolo para PCR 1. 1Materiales - Termociclador -Tubos de 1,5ml -Tubos de y 0,2ml -Pipetas de 0.2-2uL, 2-20uL y de uL -Guantes de látex sin polvo. 1.2 Reactivos - Taq polimerasa de alta fidelidad de copia - Buffer 10X de la reacción de secuencia -MgCl2 -Primer Forward y Reverse -dntps -Agua MilliQ 1.3 Preparación de la reacción de PCR Reactivo Concentración en el stock Concentración o cantidad en una reacción Buffer 10X 1X MgCl2 25mM 3mM dntps 20mM (cada uno a 5mM) 0.4mM Primer F y R (para cada uno) 10uM 0.5uM Taq polimerasa - 1U ADN total 5ng/uL 5ng Agua Nota: La reacción se prepara en un volumen final de 10uL. Se recomienda tener alícuotas de los reactivos y servir de ultima la enzima.

4 4 1.4 Protocolo 1) Preparar la mezcla de reactivos de la PCR sin incluir el ADN total en un tubo de 0,2ml. Si va preparar varias reacciones a la vez, utilice un tubo de 1,5ml para hacer la mezcla. Prepare una reacción adicional por cada 10 muestras a amplificar. Esto es para no quedarse corto cuando reparta la mezcla. 2) Alicuotar el ADN en un tubo de PCR de 0.2ml. Si solo está amplificando una muestra agregue el ADN al tubo donde está la mezcla. 3) Amplificar la muestra en el termociclador utilizando uno de los siguientes programas: a) PCR común b) PCR touch down Nota: El programa de PCR Touch down es un programa de amplificación doble, que sirve para eliminar amplificaciones inespecíficas. Este consta de ciclos de amplificación selectiva al principio y de amplificaciones laxa después, lo que se consigue variando la temperatura de anhealing.

5 5 4) almacenar a -20 C hasta su uso 1.5 Resultados El resultado ideal de una PCR es un producto relativamente limpio de primers, altamente concentrado (100ng/uL en adelante) y sin amplificaciones inespecíficas. Este resultado se puede logar estandarizando la reacción de PCR y el programa de amplificación. La optimización de la reacción se hace variando la concentración de MgCl2, la cantidad inicial de ADN templado y la de la enzima. Mientras que la optimización del programa de amplificación consiste en la modificación de la temperatura de anhealing (aumentando la temperatura mejora la especificidad de la enzima por la secuencia de ADN) y el tiempo de extensión de la cadena (debe ser más larga para las secuencias grandes). En ocasiones la optimización de la PCR no se logra con facilidad a pesar de jugar con las condiciones mencionadas. Cuando esto ocurre generalmente se debe al diseño inadecuado de primers, en ese caso lo mejor es diseñar unos nuevos y estandarizar la PCR con estos. Figura 3: Productos de PCR de una secuencia del gen COI en mariposas, vistos en un gel de agarosa al 1,2% teñido con Syber Safe. A. Producto de PCR con una cantidad de primer excesiva (mancha en la parte inferior de la columna) B. y C. Producto de PCR con una amplificación inespecífica (banda doble) D. Producto de PCR con una amplificación baja.

6 6 2. Reacción de secuencia 2.1 Materiales - Termociclador -Tubos de 1,5ml -Tubos de y 0,2ml -Pipetas de 0.2-2uL, 2-20uL y de uL -Guantes de látex sin polvo. 2.2 Reactivos - Big Dye Terminator v3.1 (del kit Big Dye Terminator v3.1 Cycle Sequencing (Applied Biosystems)) - Buffer 5X de la reacción de secuencia (del kit Big Dye Terminator v3.1 Cycle Sequencing (Applied Biosystems)) -Producto de PCR -Primer Forward o Reverse -Agua MilliQ 2.3 Preparación de la reacción de secuencia Reactivo Concentración inicial Concentración en Cantidad para una la reacción reacción (ul) - 0,5 Terminator ready reaction mix (Big Dye) Buffer del kit 5X 1X 2,0 Primer F ó R 10uM 0,2 Producto de PCR - - Agua Completar el volumen Nota: La reacción se prepara en un volumen final de 10uL. Se recomienda tener alícuotas de los reactivos de secuencia. El Big Dye es sensible a la luz y el calor, almacenarlo en recipiente oscuro y descongelar al cuando se vaya a terminar la reacción de secuencia.

7 7 2.4 Protocolo 1) Hacer la mezcla de la reacción de secuencia en un tubo de 0,2uL. 2) Correr la reacción de secuencia en un termociclador siguiendo este programa de elongación. Nota: El tiempo de cambio entre temperaturas (rampa del termociclador) debe ser de 1 C por segundo. Si se utiliza el Big Dye diluido y/o la secuencia es grande (800pb en adelante) debe utilizarse un número de ciclos elevado, 40 ciclos. Si la secuencia de interés es pequeña (300pb) con 20 ciclos es suficiente Materiales 3. Limpieza de la reacción de secuencia 3.1 Protocolo con etanol e isopropanol -Pipetas de 2-20uL, de uL -Plancha de calentamiento - Centrifuga para tubos de 1,5 ml, que alcance rpm - Vortex -Tubos de 1,5ml -Guantes de látex sin polvo Reactivos -Isopropanol al 65% -Etanol al 60% -Formamida Hi-Di

8 Protocolo Para una reacción de secuencia en un volumen de 10ul. 1) Agregar al tubo con la reacción de secuencia 40uL de isopropanlo al 65% y transferir a un tubo nuevo de 1,5mL. 2) Mezclar vigorosamente (vortex). 3) Dar un spin. 4) Guardar en la oscuridad a temperatura ambiente durante 20 min. 5) Centrifugar a rpm durante 25 minutos, a temperatura ambiente. 6) Remover el isopropanol por inversión del tubo. 7) Agregar 100uL de etanol al 60% 8) Mezclar vogorosamente (vortex) 9) Centrifugar a rpm durante 5 min. 10) Secar la muestra en una plancha de calentamiento a 60ªC durante 10 min. 11) Resuspender en 10uL de Formamida Hi-Di. La formamida debe estar fuera de la nevera 10 min antes de ser utilizada para evitar la incorporación de cristales en la muestra Resultados obtenidos con este método de limpieza El resultado de la limpieza de las secuencias con este método es variable. Generalmente se observan picos de emisión luz a través del electroferograma correspondientes a rastros de etanol en la muestra. Este problema puede ser corregido secando muy bien la muestra antes de resuspenderla en la formamida. Adicionalmente se pierden un buen número de bases al inicio de la secuencia contrariamente a lo que se obtiene utilizando el método de Magnesil Green (Promega).

9 9 Figura 3: Electroferograma de una secuencia del gen COI de mariposas que presenta rastros de etanol Materiales 3.2 Protocolo con Magnesil Green de Promega -Pipetas de 2-20uL, de uL -Plancha de calentamiento - Centrifuga para tubos de 1,5 ml, que alcance rpm - Vortex -Tubos de 1,5ml -Magneto Reactivos -Magnesil Green (Promega) -Formamida Hi-Di Protocolo Para una reacción de secuencia en un volumen de 10ul. 1) En un tubo de 1,5mL mezclar el producto de secuenciación con 90uL de Magnesil Green. 2) Mezclar con pipeta. 3) Almacenar en la oscuridad a temperatura ambiente por 10min. 4) Poner tubo en el magneto.

10 10 5) Retirar el sobrenadante con pipeta sin llevarse las perlitas de metal. 6) Retirar el tubo del magneto. 7) Agregar al tubo 90uL de etanol al 90%. 8) Mezclar vigorosamente (vortex). 9) Esperar 5 min. 10) Poner el tubo en el magneto y retirar el sobrenadante con pipeta. 11) Repetir el lavado con etanol, pasos 7 a ) Retirar tubo del magneto e incubarlo a 65ªC por 10min. 13) Resuspender en 15uL de formamida Hi-Di. La formamida debe estar fuera de la nevera 10 min antes de ser utilizada para evitar la incorporación de cristales en la muestra. 14) Dejara a temperatura ambiente por 10 min. 15) Poner tubo en magneto y recuperar 13uL del liquido. Esto evita llevarse las perlas magnéticas. Figura 4: A. Magneto B. Magnesil Green cuando se ha agitado y después de ponerlo en el magneto. Observe como las perlitas magnéticas de la solución (marrón oscuro) se congregan al ser colocadas en el magneto.

11 Resultados obtenidos con este método de limpieza En general las secuencias que se limpian con este método son muy buenas. Generalmente no se observan picos de emisiones de luz a través del electroferograma. Adicionalmente la secuencia puede empezar a ser leída mas cercanamente del extremo del primer, es decir que se pierden menos bases al inicio de la secuencia. 4.1 Materiales 4. Corrida en el secuenciador -Secuenciador automático. En este caso se emplea el 3130 Genetic Analyser de Applied Biosystems. -Placa de 96 pozos adaptada al secuenciador. -Cubre placa de 96 pozos. -Termociclador. -Pipetas de 2-20uL, de uL. -Guantes de látex sin polvo. 4.2 Reactivos -Buffer de corrida -Agua MilliQ -Polímero POP7 -Formamida Hi-Di 4.3 Protocolo La corrida de las muestras en el secuenciador se hace en tres pasos. El primero consiste en la preparación de las muestras (desnaturalización del ADN y montaje en la placa de corrida), el segundo en la preparación del archivo con las condiciones de corrida y el último en el montaje de las muestras en el equipo y la corrida en sí. Siempre debe verificar el nivel de polímero, buffer y agua de los compartimientos del equipo destinados para ello antes de empezar a secuenciar. 1) Una vez resuspendida la muestra en formamida Hi-Di, pasarla a la placa de corrida del secuenciador. Es importante que no queden burbujas en el pozo ni tampoco gotas en las paredes, las primeras introducen aire a los capilares y las segundas generar puentes eléctricos ocasionando cortos en el equipo.

12 12 2) Desnaturalice la muestra en el termociclador a 94 C por 2 min y llévela a 4 C hasta su uso. No utilice hielo para el enfriamiento, las gotas de agua en las afueras de la placa generan puentes eléctricos. 3) Prepare el archivo con los parámetros de corrida de la muestra. Esto consiste en nombrar la muestra, ubicarla dentro de la placa de secuenciación, indicarle al equipo con que velocidad se va a hacer la corrida de la muestra, cuánto tiempo se va a tardar en inyectarla, que tipo de marcaje fluorescente lleva la muestra y si esta contiene un marcador de tamaño molecular (esto para el caso de microsatélites). Esto se hace en la ventana Plate Manager. 4) Saque la bandeja del secuenciador presionando el botón Tray. 5) Abra la puerta del secuenciador y monte la placa en él. Verifique que esta tenga la tapa bien puesta y que esté al mismo nivel de los tanques de agua y buffer. Cierre la puerta del secuenciador. 5) Asocie la placa con el archivo de parámetro de corrida en la ventana Run Scheduler. Esto se hace seleccionando la planilla y después la placa. 6) Dele inicio a la corrida presionando el icono de la flecha verde en la ventana Run View. 7) Puede monitorear la corrida a través de la ventana Status. Para una explicación más detallada de los pasos a seguir consulte la guía de Preparación del ABI 3130 para electroforesis adjunta.

Materiales para la secuenciación de ADN

Materiales para la secuenciación de ADN Introduccion La Secuenciación Sanger es un método de secuenciación de ADN en el que el ADN diana se desnaturaliza y se hibrida con un cebador de oligonucleótidos, que se extiende entonces gracias a la

Más detalles

5. MATERIALES Y MÉTODOS

5. MATERIALES Y MÉTODOS 5. MATERIALES Y MÉTODOS 5.1 Equipos Los siguientes termocicladores se emplearon para la amplificación por PCR: - Perkin Elmer, GeneAmp PCR System 2400. - Perkin Elmer, GeneAmp PCR System 9600. - Applied

Más detalles

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS Prácticas docentes en la COD: 10-71 APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS FUNDAMENTO TEÓRICO La PCR es una técnica que permite llevar a cabo la síntesis in vitro de fragmentos de ADN. Está basada

Más detalles

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR Módulo 1 Amplificación de un fragmento de ADN genómico por PCR En este primer módulo se amplificará por PCR, mediante el uso de oligonucleótidos específicos, un fragmento de ADN genómico de Aspergillus

Más detalles

PROBLEMAS MÁS FRECUENTES Y POSIBLES SOLUCIONES

PROBLEMAS MÁS FRECUENTES Y POSIBLES SOLUCIONES PROBLEMAS MÁS FRECUENTES Y POSIBLES SOLUCIONES NO SE PRODUCE REACCIÓN O ÉSTA DECAE POCO DESPUÉS DE COMENZAR No hay ADN o hay menos del necesario No hay cebador o la concentración es inferior a la necesaria.

Más detalles

DETERMINACIÓN DEL FACTOR Rh por PCR

DETERMINACIÓN DEL FACTOR Rh por PCR Ref.PCRRh DETERMINACIÓN DEL FACTOR Rh por PCR 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

PROBLEMAS MAS FRECUENTES DURANTE LA SECUENCIACIÓN NO SE PRODUCE REACCION O ESTA DECAE POCO DESPUÉS DE COMENZAR

PROBLEMAS MAS FRECUENTES DURANTE LA SECUENCIACIÓN NO SE PRODUCE REACCION O ESTA DECAE POCO DESPUÉS DE COMENZAR PROBLEMAS MAS FRECUENTES DURANTE LA SECUENCIACIÓN NO SE PRODUCE REACCION O ESTA DECAE POCO DESPUÉS DE COMENZAR Las causas pueden ser las siguientes: No hay ADN o se encuentra en muy baja concentración.

Más detalles

CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA. Grado en Medicina

CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA. Grado en Medicina DEPARTAMENTO DE BIOQUÍMICA Y BIOLOGÍA MOLECULAR III FACULTAD DE MEDICINA UNIVERSIDAD COMPLUTENSE DE MADRID CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA Grado en Medicina CURSO ACADÉMICO 2014/2015 INDICE

Más detalles

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml)

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml) PCR SIMULADA Ref.PCR Simulada (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. info@atgen.com.uy www.atgen.com.uy

Más detalles

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G.

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G. C825T Sistema para la detección de la mutación C825T en el gene de la proteína G. Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. Info@atgen.com.uy www.atgen.com.uy

Más detalles

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now.

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now. Unidad Curricular: Virología y Micología Veterinaria 1 TRABAJO PRÁCTICO No. 3 AMPLIFICACIÓN DE GENES VIRALES Reacción en Cadena de la Polimerasa, conocida como PCR (por sus siglas en inglés: Polimerase

Más detalles

CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL

CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL LIBRO DE MEMORIAS 2 CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL Santiago de Cali, 23 al 28 de agosto de 2010 3 Libro de memorias

Más detalles

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082 Página 1 de 5 1. OBJETIVO Detectar la presencia de Campylobacter jejuni en hamburguesa de pollo mediante técnica de PCR. 2. CAMPO DE APLICACIÓN Y ALCANCE Aplicar este procedimiento a muestras de hamburguesa

Más detalles

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles

P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA"

P.C.R. Técnica de amplificación enzimática de secuencias específicas de DNA P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA" Paso 1: Desnaturalización del DNA Paso 2: Hibridación de los "Primers" Paso 3: Extensión Paso 1: Desnaturalización del DNA

Más detalles

GUÍA PARA LA SECUENCIACIÓN AUTOMÁTICA DE DNA

GUÍA PARA LA SECUENCIACIÓN AUTOMÁTICA DE DNA Página 1 de 16 GUÍA PARA LA SECUENCIACIÓN AUTOMÁTICA DE DNA SERVICIO DE SECUENCIACIÓN-S.C.S.I.E. UNIVERSITAT DE VALÈNCIA Página 2 de 16 CONTENIDOS: 1.- Secuenciación automática de DNA 2.- Tipos de molde

Más detalles

DANAGENE SALIVA KIT. Ref.0603.4 50 Extracciones / Ref.0603.41 160 Extracciones

DANAGENE SALIVA KIT. Ref.0603.4 50 Extracciones / Ref.0603.41 160 Extracciones DANAGENE SALIVA KIT Ref.0603.4 50 Extracciones / Ref.0603.41 160 Extracciones 1.INTRODUCCION DANAGENE SALIVA Kit provee un método para la extracción de ADN genómico de alta calidad a partir de muestras

Más detalles

Reacción en cadena de la polimerasa (PCR)

Reacción en cadena de la polimerasa (PCR) Dr. Alejandro Leal Reacción en cadena de la polimerasa (PCR) La reacción en cadena de la polimerasa (PCR, por sus siglas en inglés de "polymerase chain reaction") es un método de amplificación in vitro

Más detalles

Guía de PCR en tiempo real

Guía de PCR en tiempo real Guía de PCR en tiempo real Michelle C. Chirinos-Arias michelle.christine16@gmail.com Índice Introducción. 2 Algunos conceptos. 2 PCR (reacción en cadena de la polimerasa)... 2 PCR en tiempo real (qpcr)..

Más detalles

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN 5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN Materiales - Eppendorf de 1,5 ml estériles - Eppendorf de pared fina para PCR - Puntas de pipeta estériles desechables - Guantes

Más detalles

Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala

Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala IICA/Red SICTA-CIAT INFORME DE AVANCE Gerardo Gallego - Harold

Más detalles

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a Introducción Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a los investigadores verificar la expresión de una proteína, determinar la cantidad relativa

Más detalles

3/22/2010. Iván Ferrer Rodríguez, PhD Catedrático. En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR.

3/22/2010. Iván Ferrer Rodríguez, PhD Catedrático. En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR. Iván Ferrer Rodríguez, PhD Catedrático En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR. Síntesis "in vitro" de secuencias específicas de ADN son amplificadas.

Más detalles

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

Reacción en cadena de la polymerasa (PCR)

Reacción en cadena de la polymerasa (PCR) Reacción en cadena de la polymerasa (PCR) 1 PCR Que es? Es una técnica in vitro diseñada para amplificar una región específica de DNA. Es extremadamente sensible, con la capacidad de amplificar millones

Más detalles

TaqMan GMO Maize Quantification Kit. Part No: 4481972

TaqMan GMO Maize Quantification Kit. Part No: 4481972 TaqMan GMO Maize Quantification Kit Part No: 4481972 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan

Más detalles

velocidades de movimiento mediante la aplicación de un campo eléctrico a través de una matriz porosa

velocidades de movimiento mediante la aplicación de un campo eléctrico a través de una matriz porosa INTRODUCCIÓN En general, la electroforesis es una técnica que separa las moléculas en base a sus diferentes velocidades de movimiento mediante la aplicación de un campo eléctrico a través de una matriz

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

1 MATERIALES Y MÉTODOS

1 MATERIALES Y MÉTODOS 1 MATERIALES Y MÉTODOS El presente protocolo experimental contempla la amplificación del DNA de las bacterias y virus causantes de las ETS Neisseria gonorrhoeae, Chlamydia trachomatis y VPH mediante PCR

Más detalles

Laboratorio Biología Molecular: EPSH. Universidad de Zaragoza

Laboratorio Biología Molecular: EPSH. Universidad de Zaragoza GEL DE POLIACRILAMIDA A) Preparación del soporte del gel: Para hacer el gel se utilizan dos láminas de vidrio (cristal en "U" y cristal recto) unidas con cinta adhesiva. Estas láminas son diferentes, se

Más detalles

TaqMan GMO Screening Kit. Part No: 4466334

TaqMan GMO Screening Kit. Part No: 4466334 TaqMan GMO Screening Kit Part No: 4466334 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan mayor

Más detalles

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica TÉCNICAS GENÓMICAS Utilidad/Objetivos: 1) Detección de microorganismos directamente en muestras clínicas identificando un fragmento específico del genoma del microorganismo concreto 2) Cuantificación del

Más detalles

NORMAS DE TRABAJO EN BIOLOGÍA MOLECULAR Y GUÍA DE PROBLEMAS HABITUALES Y SU SOLUCIÓN

NORMAS DE TRABAJO EN BIOLOGÍA MOLECULAR Y GUÍA DE PROBLEMAS HABITUALES Y SU SOLUCIÓN NORMAS DE TRABAJO EN BIOLOGÍA MOLECULAR Y GUÍA DE PROBLEMAS HABITUALES Y SU SOLUCIÓN 1. PROCEDIMIENTOS BÁSICOS: En este apartado pretendemos detallar algunos factores muy importantes a la hora de realizar

Más detalles

MANUAL DE PROCEDIMIENTOS DE LOS TERMOCICLADORES DE PCR EN TIEMPO REAL: STEP-ONE-PLUS Y QUANTSTUDIO 12K FLEX de Applied Biosystems

MANUAL DE PROCEDIMIENTOS DE LOS TERMOCICLADORES DE PCR EN TIEMPO REAL: STEP-ONE-PLUS Y QUANTSTUDIO 12K FLEX de Applied Biosystems MANUAL DE PROCEDIMIENTOS DE LOS TERMOCICLADORES DE PCR EN TIEMPO REAL: STEP-ONE-PLUS Y QUANTSTUDIO 12K FLEX de Applied Biosystems INDICE I. Introducción II. Objetivo General del Manual III. Políticas de

Más detalles

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA BIOLOGIA MOLECULAR Hemos elaborado un programa en 3 niveles, en función del tipo de estudiante y las posibilidades del centro educativo: 1. NIVEL BASICO 2. NIVEL MEDIO DANAEXTRACTOR KIT Práctica que constituye

Más detalles

ELECTROFORESIS AVANZADA

ELECTROFORESIS AVANZADA Ref.ELECAVANZADA (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO ELECTROFORESIS AVANZADA El objetivo de este experimento es introducir a los alumnos en el conocimiento de la teoría electroforética y familiarizarse

Más detalles

DANAGENE RNA PURIFICATION KIT

DANAGENE RNA PURIFICATION KIT DANAGENE RNA PURIFICATION KIT REF.0801.1 100 EXTRACCIONES REF.0801.2 500 EXTRACCIONES 1.INTRODUCCION Este kit permite la permite la obtención de ARN total a partir de cultivos celulares, tejidos animales,

Más detalles

Índice. 4. Protocolo de envío de muestras 9 5. Problemas más frecuentes durante la secuenciación 10 6. Algunos datos y formulas de utilidad 17

Índice. 4. Protocolo de envío de muestras 9 5. Problemas más frecuentes durante la secuenciación 10 6. Algunos datos y formulas de utilidad 17 Índice Introducción 1 1. Modalidades de secuenciación 2 a. Secuenciación de una sola cadena 2 b. Secuenciación analítica 3 c. Secuenciación diagnóstica 3 2. Oligonucleótidos disponibles 5 3. Protocolo

Más detalles

MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR)

MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) OBJETIVOS - Definir PCR, conocer los reactivos que

Más detalles

Laboratorio. Objetivos I N T R O D U C C I Ó N. Al finalizar este laboratorio el estudiante podrá:

Laboratorio. Objetivos I N T R O D U C C I Ó N. Al finalizar este laboratorio el estudiante podrá: Laboratorio 12 Biología molecular Objetivos Al finalizar este laboratorio el estudiante podrá: 1. Conocer los principios básicos de la técnica de electroforesis y su aplicación al análisis del ADN. 2.

Más detalles

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa?

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa? 2º BIOQUÍMICA CUESTIONES 1. Por qué la PCR convencional no es cuantitativa? En la PCR convencional, la cuantificación del ADN de la muestra es complicada debido a que la eficacia de amplificación va disminuyendo

Más detalles

III. METODOLOGÍA EXPERIMENTAL

III. METODOLOGÍA EXPERIMENTAL III. METODOLOGÍA EXPERIMENTAL 3.1 Análisis Previos Se utilizaron los filtros con muestra de partículas suspendidas en el aire PM 10 que el Instituto Municipal de Ecología (IME) proporcionó para llevar

Más detalles

Tecnologías basadas en la PCR

Tecnologías basadas en la PCR Tecnologías de marcadores moleculares para estudios de diversidad genética de plantas: Módulo de aprendizaje Tecnologías basadas en el ADN Tecnologías basadas en la PCR Fundamentos de la PCR Derechos de

Más detalles

SECUENCIACIÓN SANGER DE ADN: GUÍA DE SOLUCIONES TÉCNICAS

SECUENCIACIÓN SANGER DE ADN: GUÍA DE SOLUCIONES TÉCNICAS SECUENCIACIÓN SANGER DE ADN: GUÍA DE SOLUCIONES TÉCNICAS Secugen recomienda que para la visualización de las secuencias se usen programas que permitan ver el dato crudo, ya que a partir de ese dato se

Más detalles

MMP. MÉTODOS DE MUESTREO Y PRUEBA DE MATERIALES

MMP. MÉTODOS DE MUESTREO Y PRUEBA DE MATERIALES LIBRO: PARTE: TÍTULO: CAPÍTULO: MMP. MÉTODOS DE MUESTREO Y PRUEBA DE MATERIALES 5. MATERIALES PARA SEÑALAMIENTO Y DISPOSITIVOS DE SEGURIDAD 01. Pinturas para Señalamiento 003. Contenido de Pigmento en

Más detalles

AUTOR: JORGE CONTRERAS PINEDA 1. Titulo:

AUTOR: JORGE CONTRERAS PINEDA 1. Titulo: Página 1 de 1 1. Titulo: Electroforesis de DNA 2. Objetivo Conocer los principios básicos de la electroforesis horizontal en geles de agarosa y aplicarlo para la separación de DNA humano, plasmídico, recombinante

Más detalles

1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de Quant- it PicoGreen dsaadnssay Kit (Invitrogen ).

1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de Quant- it PicoGreen dsaadnssay Kit (Invitrogen ). 1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de QuantiT PicoGreen dsaadnssay Kit (Invitrogen ). 2. Finalidad. El presente documento describe el Procedimiento Normalizado de

Más detalles

SwabSolution Kit INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC8271.

SwabSolution Kit INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC8271. Technical Manual SwabSolution Kit INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC8271. IMPRESO EN ESTADOS UNIDOS Nro. de pieza: TMD037 SwabSolution Kit Toda la bibliografía técnica está disponible en Internet,

Más detalles

ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA

ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA FACULTAD DE VETERINARIA DEPARTAMENTO DE SANIDAD ANIMAL ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA GUIÓN DE PRÁCTICAS DE LABORATORIO CURSO 2014 2015 MÓDULO: PORCINO Síndrome respiratorio y reproductor

Más detalles

Recomendaciones para el envío de muestras para análisis de Anisoles

Recomendaciones para el envío de muestras para análisis de Anisoles Recomendaciones para el envío de muestras para análisis de Anisoles Se ha demostrado que todo el material plástico de los envases, (p/ej tapas de los envases, bolsas de polietileno, corchos sintéticos,

Más detalles

DETERMINACIÓN DE GLUTEN EN ALIMENTOS PARA CELÍACOS INDICE

DETERMINACIÓN DE GLUTEN EN ALIMENTOS PARA CELÍACOS INDICE DETERMINACIÓN DE GLUTEN EN ALIMENTOS PARA CELÍACOS INDICE 1 Objetivo 2 2 Alcance 2 3 Desarrollo 2 4 Anexo 8 1.0. Objetivo Determinación de gluten en alimentos para celíacos. 2.0. Alcance Este método analítico

Más detalles

Práctico: Genética bacteriana 2007.

Práctico: Genética bacteriana 2007. Práctico: Genética bacteriana 2007. Actividad integrada Departamento de Genética Departamento de Bacteriología y Virología. OBJETIVOS Objetivos generales El estudiante al terminar la actividad práctica

Más detalles

Tecnología HaloPlex by Genycell Biotech España

Tecnología HaloPlex by Genycell Biotech España Paneles de genes custom-made Tecnología HaloPlex by Genycell Biotech España SERVICIO NGS CLÍNICA HALO: OVERVIEW 1. DISEÑO DEL PANEL DE GENES Y DEL KIT DE CAPTURA 2. PREPARACIÓN DE LA MUESTRA EN EL LABORATORIO

Más detalles

Kit PunchSolution INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC9271.

Kit PunchSolution INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC9271. Technical Manual Kit PunchSolution INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC9271. IMPRESO EN ESTADOS UNIDOS 5/12 Kit PunchSolution Toda la bibliografía técnica está disponible en Internet, en el sitio

Más detalles

39. Aislamiento y purificación del DNA de un plásmido recombinante

39. Aislamiento y purificación del DNA de un plásmido recombinante 39. Aislamiento y purificación del DNA de un plásmido recombinante Aurora Galván Cejudo, Manuel Tejada, Antonio Camargo, José Javier Higuera, Vicente Mariscal, Emilio Fernández Reyes Departamento de Bioquímica

Más detalles

Curso de biología molecular CIMAT 2010

Curso de biología molecular CIMAT 2010 Curso de biología molecular CIMAT 2010 INTRODUCCIÓN Este curso-taller tiene como propósito mostrar de manera teórica y práctica algunos principios básicos de biología molecular e ingeniería genética. Conocerás

Más detalles

LABORATORIO NACIONAL DE VIALIDAD HORNO IGNICION Y CENTRIFUGA

LABORATORIO NACIONAL DE VIALIDAD HORNO IGNICION Y CENTRIFUGA LABORATORIO NACIONAL DE VIALIDAD HORNO IGNICION Y CENTRIFUGA Rodrigo Uribe Olivares Jefe Área de Asfalto Curso de Capacitación 8 Junio 2015 a).- Ensaye: Extracción 8.302.36 (LNV 11) : Método para determinar

Más detalles

TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO

TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO TEST de PATERNIDAD Este experimento introduce a los alumnos en el uso del ADN y la PCR para simular una determinación de paternidad. Los estudiantes

Más detalles

I. 15microlitros de agua esteril, perforar el pozo y diluir. II. Se tomaron 2 microlitros para la primera transformación.

I. 15microlitros de agua esteril, perforar el pozo y diluir. II. Se tomaron 2 microlitros para la primera transformación. 23 de agosto 2007 Se comenzó la elaboración de la bitácora Medio LB Broth, Billar (Luria-Bertani) 25gr/litro Se preparó 500 mililitros agregando 12.5 gramos Se diluyó y esterilizó por autoclave Medio LB

Más detalles

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR)

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) Centro de de Microscopía Electrónica Facultad de de Ciencias Médicas Universidad Nacional de de Córdoba

Más detalles

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Para la purificación de ADN genómico de todos los kits de colección Oragene y ORAcollect. Visite nuestro sitio

Más detalles

ELECTROFORESIS BASICA

ELECTROFORESIS BASICA Ref.ELECBASICA (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO ELECTROFORESIS BASICA El objetivo de este experimento es introducir a los alumnos en el conocimiento de la teoría electroforética y familiarizarse

Más detalles

CUANTIFICACIÓN DE ADENOSIN DESAMINASA (ADA)

CUANTIFICACIÓN DE ADENOSIN DESAMINASA (ADA) CUANTIFICACIÓN DE ADENOSIN DESAMINASA (ADA) PROTOCOLO ADA FUNDAMENTO DEL METODO: La adenosindesaminasa (ADA) es una enzima del catabolismo de las purinas que cataliza la conversión de la adenosina en inosina

Más detalles

NMX-F-070-1964. MÉTODO DE PRUEBA PARA LA DETERMINACIÓN DE TIAMINA. THIAMINE DETERMINATION. TEST METHOD. NORMAS MEXICANAS. DIRECCIÓN GENERAL DE NORMAS.

NMX-F-070-1964. MÉTODO DE PRUEBA PARA LA DETERMINACIÓN DE TIAMINA. THIAMINE DETERMINATION. TEST METHOD. NORMAS MEXICANAS. DIRECCIÓN GENERAL DE NORMAS. NMX-F-070-1964. MÉTODO DE PRUEBA PARA LA DETERMINACIÓN DE TIAMINA. THIAMINE DETERMINATION. TEST METHOD. NORMAS MEXICANAS. DIRECCIÓN GENERAL DE NORMAS. ASUNTO Con fundamento en lo dispuesto en los Artículos

Más detalles

FACULTAD REGIONAL ROSARIO

FACULTAD REGIONAL ROSARIO FACULTAD REGIONAL ROSARIO CATEDRA BIOTECNOLOGIA ROFESOR: Ing. Eduardo Santambrosio JTP: Ing. Marta Ortega AUX 1ª : Ing. Pablo Garibaldi PCR (Polymerase chain reaction) Reacción en cadena de la polimerasa

Más detalles

Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez

Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez 1 Objetivos Entender la técnica: Reacción de Polimerasa en Cadena (PCR por sus siglas en inglés)

Más detalles

TRABAJO PRÁCTICO Nº 5: ÁCIDOS NUCLEICOS DESCRIPCIÓN DE LOS MÉTODOS A UTILIZAR

TRABAJO PRÁCTICO Nº 5: ÁCIDOS NUCLEICOS DESCRIPCIÓN DE LOS MÉTODOS A UTILIZAR TRABAJO PRÁCTICO Nº 5: ÁCIDOS NUCLEICOS DOCENTES: Andrés Ciocchini, Gabriela Niemirowicz. DESCRIPCIÓN DE LOS MÉTODOS A UTILIZAR Purificación de ácido desoxiribonucleico (ADN) por partición diferencial

Más detalles

Obsevación y recuento de células sanguíneas. Semestre B-2010

Obsevación y recuento de células sanguíneas. Semestre B-2010 1 Práctica 2 Obsevación y recuento de células sanguíneas Semestre B-2010 Introducción En la sangre se encuentran los leucocitos o glóbulos blancos que son las células móviles del sistema inmunitario. Todos

Más detalles

Técnicas. Sorbetes. Granizados

Técnicas. Sorbetes. Granizados HELADOS Los helados destacan por su cremosidad y los sorbetes por su textura levemente crujiente. Ambos son apreciados por su dulce frescor y forman parte de los postres más consumidos en todo el mundo.

Más detalles

CAPÍTULO 10 APÉNDICE A CARACTERIZACIÓN DEL SUELO. A.1. Determinación del ph. (Domínguez et al, 1982)

CAPÍTULO 10 APÉNDICE A CARACTERIZACIÓN DEL SUELO. A.1. Determinación del ph. (Domínguez et al, 1982) CAPÍTULO 10 APÉNDICE A CARACTERIZACIÓN DEL SUELO A.1. Determinación del ph (Domínguez et al, 1982) Pesar 10 gramos de suelo y colocarlos en un vaso de precipitados. Agregar 25 ml de agua destilada y agitar

Más detalles

Instrucciones de Uso GenDx SBTexcellerator

Instrucciones de Uso GenDx SBTexcellerator Octavo Edición Julio de 2011 Instrucciones de Uso GenDx SBTexcellerator Para Tipificación Basada en Secuenciación de HLA de alta resolución Genome Diagnostics B.V. Teléfono: +31 302 523 799 Correo electrónico:

Más detalles

Reacción en cadena de la Polimerasa (PCR)

Reacción en cadena de la Polimerasa (PCR) Explicación de TP Nº 2 Reacción en cadena de la Polimerasa (PCR) Química Biológica Patológica Dra. Mariana L. Ferramola Dra. Gabriela Lacoste 2015 Definición de PCR Es la amplificación enzimática de un

Más detalles

PCR. Técnica inventada por Kary Mullis :1987. Premio Nobel 1993. Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN

PCR. Técnica inventada por Kary Mullis :1987. Premio Nobel 1993. Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN PCR PCR Técnica inventada por Kary Mullis :1987 Premio Nobel 1993 Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN Aprovecha los requerimientos de la replicación Templete ADN Nucleótidos

Más detalles

SEPARACIÓN DE PROTEÍNAS POR CROMATOGRAFÍA DE EXCLUSIÓN MOLECULAR

SEPARACIÓN DE PROTEÍNAS POR CROMATOGRAFÍA DE EXCLUSIÓN MOLECULAR SEPARACIÓN DE PROTEÍNAS POR CROMATOGRAFÍA DE EXCLUSIÓN MOLECULAR INTRODUCCION La cromatografía es una técnica que permite la separación de moléculas diferentes presentes en una misma muestra. El método

Más detalles

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada La PCR La Reacción en Cadena de la Polimerasa es la herramienta más utilizada PCR- Ventajas y Usos Amplificación ilimitada de secuencias de interés. Rápida, Sencilla y Eficaz. Técnica altamente sensible

Más detalles

MATERIALES Y MÉTODOS. Cepas Utilizadas

MATERIALES Y MÉTODOS. Cepas Utilizadas MATERIALES Y MÉTODOS Cepas Utilizadas Para el presente trabajo se utilizaron tres cepas Tipo: Mycobacterium aviumintracellulare (proporcionada al Laboratorio Estatal de Salud Pública por el Instituto Nacional

Más detalles

Procesos de fundición

Procesos de fundición Procesos de fundición Fundición a la arena. Arena, moldes, modelos, corazones y terminado Procesos especiales de fundición fundición a la arena. Arena, moldes, modelos, corazones y terminado El proceso

Más detalles

PowerPlex Fusion System INSTRUCCIONES PARA UTILIZAR LOS PRODUCTOS DC2402 Y DC2408.

PowerPlex Fusion System INSTRUCCIONES PARA UTILIZAR LOS PRODUCTOS DC2402 Y DC2408. Technical Manual PowerPlex Fusion System INSTRUCCIONES PARA UTILIZAR LOS PRODUCTOS DC2402 Y DC2408. IMPRESO EN ESTADOS UNIDOS PowerPlex Fusion System Toda la bibliografía técnica está disponible en Internet,

Más detalles

Intrucciones de uso KwikPen. ABASAGLAR 100 unidades/ml solución inyectable en una pluma precargada Insulina glargina

Intrucciones de uso KwikPen. ABASAGLAR 100 unidades/ml solución inyectable en una pluma precargada Insulina glargina Intrucciones de uso KwikPen ABASAGLAR 100 unidades/ml solución inyectable en una pluma precargada Insulina glargina POR FAVOR LEA ESTAS INSTRUCCIONES ANTES DE USAR Lea las instrucciones de uso antes de

Más detalles

Técnicas moleculares.

Técnicas moleculares. Técnicas moleculares. DMTV Carolina Acevedo Curso de Microbiología 2015 SÍNTESIS IN VITRO DE UNA GRAN CANTIDAD DE COPIAS DE UN SEGMENTO DE ADN EXISTENTE EN UNA MUESTRA. O sea. Amplificamos en forma exponencial

Más detalles

Instrucciones de uso. Wipe test. Control de Contaminación. Kit de pruebas para la detección de contaminaciones basado en genética molecular REF 7091

Instrucciones de uso. Wipe test. Control de Contaminación. Kit de pruebas para la detección de contaminaciones basado en genética molecular REF 7091 Instrucciones de uso Wipe test Control de Contaminación Kit de pruebas para la detección de contaminaciones basado en genética molecular REF 7091 40 Reacciones 1. Descripción del Producto El uso de la

Más detalles

PRÁCTICA 5. CALORIMETRÍA

PRÁCTICA 5. CALORIMETRÍA PRÁCTICA 5. CALORIMETRÍA INTRODUCCIÓN Al mezclar dos cantidades de líquidos a distinta temperatura se genera una transferencia de energía en forma de calor desde el más caliente al más frío. Dicho tránsito

Más detalles

SÍNTESIS DEL ÁCIDO ACETIL SALICÍLICO

SÍNTESIS DEL ÁCIDO ACETIL SALICÍLICO PRÁCTICA 10: SÍNTESIS DEL ÁCIDO ACETIL SALICÍLICO 1. INTRODUCCIÓN En esta práctica llevaremos a cabo un proceso sencillo de síntesis de un fármaco: la síntesis del ácido acetilsalicílico. El extracto de

Más detalles

8º CONGRESO IBEROAMERICANO DE INGENIERIA MECANICA Cusco, 23 al 25 de Octubre de 2007

8º CONGRESO IBEROAMERICANO DE INGENIERIA MECANICA Cusco, 23 al 25 de Octubre de 2007 8º CONGRESO IBEROAMERICANO DE INGENIERIA MECANICA Cusco, 23 al 25 de Octubre de 2007 SIMULACIÓN Y ANÁLISIS TÉRMICO DE UN PROTOTIPO DE PORTA MUESTRAS PARA UN TERMOCICLADOR PARA USO EN INGENIERÍA Y BIOLOGÍA

Más detalles

LABORATORIO DE QUÍMICA FACULTAD DE FARMACIA CRISTALIZACIÓN.

LABORATORIO DE QUÍMICA FACULTAD DE FARMACIA CRISTALIZACIÓN. CRISTALIZACIÓN. Un compuesto orgánico cristalino está constituido por un empaquetamiento tridimensional de moléculas unidas principalmente por fuerzas de Van der Waals, que originan atracciones intermoleculares

Más detalles

CAPÍTULO VI. Expresión de genes relacionados con apoptosis

CAPÍTULO VI. Expresión de genes relacionados con apoptosis CAPÍTULO VI Expresión de genes relacionados con apoptosis 1.- Introducción 2.- Protocolos para análisis genéticos 3.- Resultados en MCF-7 4.- Discusión 1.- Introducción Como se ha descrito anteriormente,

Más detalles

UNIVERSIDAD DE MAYORES PRÁCTICAS DE MICROBIOLOGÍA DEPARTAMENTO DE BIOMEDICINA Y BIOTECNOLOGÍA MICROBIOLOGÍA I

UNIVERSIDAD DE MAYORES PRÁCTICAS DE MICROBIOLOGÍA DEPARTAMENTO DE BIOMEDICINA Y BIOTECNOLOGÍA MICROBIOLOGÍA I UNIVERSIDAD DE MAYORES PRÁCTICAS DE MICROBIOLOGÍA DEPARTAMENTO DE BIOMEDICINA Y BIOTECNOLOGÍA MICROBIOLOGÍA I DRAS. MARÍA LUISA ORTIZ Y ANA PEDREGOSA 1 PRÁCTICAS DE MICROBIOLOGÍA DEPARTAMENTO DE BIOMEDICINA

Más detalles

Medición de ph y dureza

Medición de ph y dureza Medición de ph y dureza 363 Medición de ph y dureza Isabel Romero Terán Medición de ph Campo de aplicación Este procedimiento complementario es útil para todos los ensayos de toxicidad que requieran medir

Más detalles

Práctica 1: Observación de fenómenos osmóticos en epidermis de cebolla

Práctica 1: Observación de fenómenos osmóticos en epidermis de cebolla Práctica 1: Observación de fenómenos osmóticos en epidermis de cebolla 1. A qué se debe la gran extensión de la coloración de la célula tras la tinción con rojo neutro? Al sumergir la epidermis en la disolución

Más detalles

PROTOCOLO DE EXTRACCIÓN DE MUESTRAS FRESCAS DE TEJIDO DE AVES PARA ESTUDIOS GENÉTICOS

PROTOCOLO DE EXTRACCIÓN DE MUESTRAS FRESCAS DE TEJIDO DE AVES PARA ESTUDIOS GENÉTICOS PROTOCOLO DE EXTRACCIÓN DE MUESTRAS FRESCAS DE TEJIDO DE AVES PARA ESTUDIOS GENÉTICOS La mejor fuente de tejido fresco para la realización de estudios genéticos son los músculos. En el caso de aves la

Más detalles

Instrucciones técnicas Aparato de extracción y filtración en caliente para sistemas de microondas

Instrucciones técnicas Aparato de extracción y filtración en caliente para sistemas de microondas Instrucciones técnicas Aparato de extracción y filtración en caliente para sistemas de microondas Las condiciones experimentales de un experimento con microondas dependen de los datos técnicos del aparto

Más detalles

Int. Cl. 7 : G01N 33/04

Int. Cl. 7 : G01N 33/04 k 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 k Número de publicación: 2 144 36 21 k Número de solicitud: 009800009 1 k Int. Cl. 7 : G01N 33/04 A23C 11/10 k 12 SOLICITUD DE PATENTE A1 22 kfecha

Más detalles

SECUENCIACIÓN. 1.1.1. Purificación mediante columnas. 1.1.2. Protocolos manuales.

SECUENCIACIÓN. 1.1.1. Purificación mediante columnas. 1.1.2. Protocolos manuales. SECUENCIACIÓN En la Unidad se realiza la secuenciación automática del DNA mediante electroforesis capilar y mediante el uso de la química BigDye Terminator v3.1 de Applied Biosystems. Todas las muestras

Más detalles

Características del kit:

Características del kit: ! La detección de clonalidad mediante análisis molecular por PCR de reordenamientos de los genes de las inmunoglobulinas (Ig) y TCR, es un instrumento de gran valor en el diagnóstico de los procesos linfoproliferativos

Más detalles

UTILIZACIÓN DE UNA CUENTA DE CORREO ELECTRÓNICO (NUEVO) Acceso al correo electrónico

UTILIZACIÓN DE UNA CUENTA DE CORREO ELECTRÓNICO (NUEVO) Acceso al correo electrónico Acceso al correo electrónico Pasamos ahora a lo que sería usar la cuenta de correo que nos hicimos en la clase anterior. Lo primero que hacemos es entrar en la página web de Yahoo y localizar el icono

Más detalles

Experimento con reactivos de la vida cotidiana!

Experimento con reactivos de la vida cotidiana! Experimento con reactivos de la vida cotidiana Laura Martínez Martín- 1º Grado Genética - UAB Abril de 2015 1 Índice Introducción 3 Objetivos 3 Material. 3 Procedimiento 4 Explicaciones científicas del

Más detalles

BIOSEGURIDAD EN MICROBIOLOGIA: NUEVOS Y VIEJOS RETOS

BIOSEGURIDAD EN MICROBIOLOGIA: NUEVOS Y VIEJOS RETOS BIOSEGURIDAD EN MICROBIOLOGIA: NUEVOS Y VIEJOS RETOS JUAN CARLOS RODRÍGUEZ S. MICROBIOLOGÍA HOSPITAL GENERAL UNIVERSITARIO DE ALICANTE E-MAIL: rodriguez_juadia@gva.es http://microbiologia-alicante.umh.es

Más detalles