3M Seguridad Alimentaria. XIII MRAMA UAB 27 de Noviembre Barcelona

Tamaño: px
Comenzar la demostración a partir de la página:

Download "3M Seguridad Alimentaria. XIII MRAMA UAB 27 de Noviembre 2014 - Barcelona"


1 3M Seguridad Alimentaria XIII MRAMA UAB 27 de Noviembre Barcelona

2 2 3M es una empresa de innovación que nunca deja de inventar, porque nos apasiona hacer que tenga lugar el progreso. Mantenemos a nuestros clientes competitivos con nuestra cultura de colaboración para proporcionar una evolución sin fin de ideas y tecnologías y resolver los problemas más críticos M. All Rights Reserved.

3 3M: A Global Diversified Technology Company Global Sales: $29.9 Billion (65% International) Net Income: $4.4 Billion R&D & Related Investment: $1.6 Billion Earned 527 U.S. Patents Global Reach: Sales in ~200 Countries 40 technological platform Employees: ~81,000 (~63% International) Six Market-Leading Business Groups

4 Six Market-Leading Business Segments Industrial & Transportation Health Care Safety, Security & Protection Services Consumer & Office Display & Graphics Electro & Communications

5 Ingenious Solutions Transforming Health Reducing infection rates Medical: Infection Prevention / Skin & Wound Care Protecting skin to reduce suffering Drug Delivery Systems Advancing wound care Restoring breath with novel asthma inhalers Vaccinations without needles Enabling telemedicine Health Care Food Safety Oral Care: Dental / Orthodontics Invisible braces for healthy smiles Preventing tooth damage and decay Stronger aesthetic dental restorations Health Information Systems Enabling electronic medical records Increasing hospital efficiency Protecting our food supply

6 3 millones de personas mueren cada año de intoxicación alimentaria y de enfermedades transmitidas por el agua M. All Rights Reserved. In the U.S. alone, food poisoning strikes an estimated 48 million people each year leading to 128,000 hospitalizations and 3,000 deaths (Sources: World Health Organization, U.S. Centers for Disease Prevention & Control)

7 3M dedicado a la Seguridad Alimentaria Entiende todos los eslabones de la cadena alimentaria Soluciones de confianza para las pruebas Impacto Exito de su marca

8 Principales tendencias mundiales muestran una preocupación creciente por la Seguridad Alimentaria Legislación de Seguridad Alimentaria Cambios en las dietas de consumo Globalización comercio de los alimentos El aumento de conciencia pública El creciente consumo de Carne y lácteos en las economías en desarrollo 8

9 Desafíos actuales Rotación de los Técnicos Nueva Legislación Tiempo de respuesta Globalización del mercado alimentario Laboratorio microbiología Preocupación social Presión presupuestaria Volumen de trabajo

10 Qué pide el mercado? Facilidad de uso Menos transferencias Menor tiempo hasta resultado Coste total Mayor fiabilidad Aprobaciones Software sencillo y útil Equipos robustos Menor tiempo Precisión

11 De la granja. Patógenos Indicatores Higien Prep.Muestra MLS Tiempo &Temp. A la mesa.

12 3M Soluciones Seguridad Alimentaria Awarded Corporate Excellence in Food Safety & Quality (IAFP 2008) Pruebas de organismos indicadores Control de higiene Preparación de la muestra/ Medios 3M Petrifilm Placas y lector 3M Clean -Trace Pruebas control higiene 3M Preparación de la muestra Pruebas de patógenos Detección Producto final 12 3M Sistema de Detección Molecular 3M Sistema Luminiscencia Microbiano

13 3M Preparación de la muestra 3M Petrifilm Placas y Lector 3M Clean-Trace Sistema control Higiene 3M Sistema de Detección Molecular Patógenos 3M MLSII Análisis Esterilidad de la leche UHT 13

14 Preparación muestra / Medios 3M Preparación de la muestra 3M Preparación de la muestra 3M Petrifilm Placas y Lector 3M Clean-Trace Sistema control Higiene 3M Sistema de Detección Molecular Patógenos 3M MLSII Análisis Esterilidad de la leche UHT 14

15 3M Preparación de la muestra Productos de alta calidad Desarrollado en colaboración con clientes Diseño innovador para mayor comodidad y facilidad de uso Mejora la precisión de pruebas, la coherencia y la eficiencia Ayudar a cumplir las normas de calidad internas

16 3M Preparación de la muestra Recuerda que.. 16

17 3M Preparación de la muestra Toma de Muestras Esponjas e Hisopos Transporte Bolsas para muestras Preparación Medios de enriquecimientos preparados Analizar Pipetas, tubos diluciones

18 3M Preparación de la muestra Plantas de alimentación Toma de muestras Las muestras se recogen en las plantas, ya sea ambientales (superficies, equipos, aire) o de producto alimenticio Transporte Laboratorio Preparación Enriquecimiento Después de que se recogió la muestra se transporta al laboratorio, que puede estar en las instalaciones de la planta o fuera ("laboratorios contratados") Una vez recibida la muestra en el laboratorio, se prepara el ensayo. Dependiendo del tipo de muestra, se mezclan (stomacher) para extraer un fluido concentrado que se diluirá para el proceso de la prueba Esta etapa es donde los micoorganismos han"crecido" a la concentración adecuada para el ensayo de prueba. Este paso requiere un medio de enriquecimiento 18 Hisopos rápidos Bolsas para muestras Botellas dilución Flip-Top Bolsas enriquecimiento Esponja hidratadaesponja hidratada Mini botellas Flip-Top Medios deshidratados Esponja-palo Esponja-Palo Bolsas muestras Bolsas dilución Pipetas electrónicas

19 3M Preparación de la muestra 3M ofrece productos / servicios que permiten a nuestros clientes reducir las actividades de toma de muestras y decicarse a otros pasos más críticos de las pruebas... Lo que dicen nuestros clientes Al utilizar botellas de dilución de 3M han sido capaces de reducir su tiempo de mezclado diluciones / enriquecimientos en un 30% de la mano de obra del tiempo del técnico y así realizar otras tareas más críticas Cuando analizan los precios, se dan cuenta que han reducido el coste total en los productos "de laboratorio" en un 12-15% Debido a que 3M es un proveedor certificado ISO, han reducido el número de pruebas de confirmación, en un 10%, confiando en que sus sistemas están apoyados por 3M 19

20 Análisis organismos indicadores 3M Preparación de la muestra 3M Petrifilm Placas y Lector 3M Petrifilm Placas y Lector 3M Clean-Trace Sistema control Higiene 3M Sistema de Detección Molecular Patógenos 3M MLSII Análisis Esterilidad de la leche UHT 20

21 3M Placas Petrifilm Este punto rojo cambió la microbiología hace 30 años Las placas 3M Petrifilm comenzaron con la curiosidad de un microbiólogo y la colaboración con otros científicos, condujo a nuevos descubrimientos convirtiendose en la marca líder mundial de pruebas de indicador en alimentación Fue revolucionario 21 Para saber más.

22 3M Petrifilm Placas y Lector Análisis de alimentos y bebidas Fácil de usar, alta productividad Validadas por AOAC, AFNOR Herramienta de efectividad de coste para los laboratorios. más de 200 evaluaciones por agencias de validación Ampliamente usadas en las pruebas de organismo indicador. 22

23 Valor de las placas Petrifilm Lectura automática PRODUCTIVIDAD / Ahorro mano de obra Consistencia Standard ampliamente aceptado en la industria Fácil de usar, Validaciones por terceros/ certificaciones AOAC y AFNOR Ahorro de espacio Respeta el medio ambiente

24 3M Placas Petrifilm Prueba rápida y precisa en tan solo 3 pasos Inocular Incubar Contar

25 3M Familia Petrifilm : Placas Recuento de: Aerobios Enterobacteriaceas Coliformes Rápida Coliformes Mohos y Levaduras Alta Sensiblidad de Coliformes Select E. coli E.coli/ Coliforme Staph Express Listeria Ambiental

26 Placa 3M Petrifilm Recuento rápido de Mohos y Levaduras Resultados a las 48 horas Fácil interpretación : tecnología especial que evita que las colonias de mohos se propaguen y superpongan Foam añadido a la placa para una inoculación más fácil Validación AOAC y AFNOR Imagen de la placa de post-incubación: colonias indica por el color azul

27 Puede ser utilizado para el control ambiental Muestra de aire Muestras contacto superficie Muestra con hisopo

28 Placas 3M Petrifilm para análisis de agua Para Agua embotellada Agua de manantial en botellas (sin gas o carbonatadas) Agua tratada en botellas Placas 3M Petrifilm Aqua para recuento: (AQHC) Heterotrófico (AQCC ) Coliformes (AQEB) Enterobacterias (AQYM) Mohos y Levaduras Se utiliza con filtros de membrana y técnica de siembra directa Filtro de membrana que se coloca en la placa Petrifilm Imagen del filtro de membrana con unidades formadoras de colonias

29 Placa 3M Petrifilm Aqua Resultados Coliformes y Enterobacterias confirmado en 24 horas Gas atrapado alrededor de colonias de color rojo indica una colonia de coliformes confirmada, eliminando la necesidad de una etapa posterior confirmación Caducidad 18 meses, más que las placas de agar preparadas

30 Placa 3M Petrifilm Agua Uso Filtración por Membrana 1) Hidratación de la placa con agua estéril 3) Coloque el filtro en la placa hidratada. Placa AQHC Levante la película superior y vierta 1 ml de hidratante Placas AQCC, AQEB Levante la película superior y vierta 1 ml de hidratante. Levante la película superior de la placa hidratada. El gel y nutrientes están en la película superior Coloque la membrana en la pelicula de fondo de la placa. Baje la película superior; presione el aplicador para distribuir el hidratante. Deslice la pelicula superior; presione el aplicador para distribuir el hidratante. Esperar por lo menos 60 minutos a que solidifique el gel. Protéjalas de la luz y manténgalas refrigeradas por un máximo de 7 días. 2) Filtre la muestra de agua a través de un filtro de membrana 4) Incube las placas cara arriba Baje la película superior. Presione suavemente para asegurara contacto uniforme y eliminar burbujas. Nota: las placas AQYM (Mohos y Levaduras) se hidratan con 1 ml después de colocar el filtro, no antes.

31 Placa 3M Petrifilm Agua Uso Filtración por Membrana Placas AQYM (Mohos y Levaduras): 1) Filtre la muestra de agua a través de un filtro de membrana 2) Levante la película superior, coloque el filtro en el centro de la placa 3) Con pipeta, vierta 1 ml de hidratante 4) Deslice la película superior y. distribuya el líquido usando el aplicador para Levaduras y Mohos 5) Incube las placas cara arriba

32 3M Petrifilm Lector de placas Lectura en 4 segundos: aumenta la productividad y reduce la mano de obra Lee las placas de AC, EC/CC, CC, SEC y las placas de EB que representan la mayoría (>80%) de las placas que se usan Conectividad a LIMS Exporta datos a excel 32

33 3M Petrifilm Lector de placas Visualización recuento de resultados en la pantalla Elimina la variación Entre los técnicos

34 3M Preparación de la muestra 3M Petrifilm Placas y Lector 3M Clean-Trace Sistema control Higiene 3M Sistema de Detección Molecular Patógenos 3M MLSII Análisis Esterilidad de la leche UHT 34

35 Interview con John Holah sobre la higiene en la industria alimentaria "... La mayor dificultad es cómo controlar todas las superficies involucradas (del equipo, contenedores, guantes utilizados por los trabajadores, etc.) Durante el proceso de producción que los microorganismos consiguen pasar de un elemento a otro... " 35 Alimentatec, Edición digital Julio 2012

36 Principios APPCC El uso eficiente del APPCC depende del empleo de datos de control generados a tiempo real capaces de ser entendidos por parte de operarios entrenados al objeto de poder emprender las acciones oportunas Dr. A. C. Baird-Parker Head of Microbiology Unilever Research Laboratory, UK Journal of Food Control, July 1990

37 Nuestra solución Sistema control de higiene 3M Clean-Trace ATP Superficies y Aguas Hisopos preparados para tomar la muestras Dispositivo Software personalizable para seguimiento de tendencias

38 3M Clean-Trace ATP Basado en la medición del Adenosin Trifosfato (ATP) La molécula de energía de los seres vivos: animales, vegetales, bacterias, y hongos Detecta la presencia de contaminación de origen biológico: Microorganismos restos de tejidos/fluidos residuos, alimentos

39 Fuentes típicas de ATP Micro organisms Bacteria Mohos y Levaduras Seres humanos!! Alimentos Frutas Productos lácteos Vegetales Carne etc LUCIFERIN LUCIFERASE + ATP =

40 mayor cantidad de luz (RLU) Unidades relativas de luz mayor nivel de ATP a mayor cantidad de microorganismos o materia orgánica

41 ventajas de usar el ATP como indicador de riesgo microorganismos residuos orgánicos riesgo directo contaminación, infección riesgo indirecto fomenta el crecimiento de microorganismos y posible contaminación cruzada la presencia de ATP indica riesgo Directos e Indirectos

42 Líder en el Mercado Primero en el mercado con la tecnología ATP Más de 300 industrias de limentación y bebidad Clean Trace - Resultados en menos de 30 segundos. - Datos en tiempo real para implementar soluciones inmediatas

43 Como se verifica la limpieza? Valoración Visual Pruebas Microbiológicas ATP metría* Rápido Sensible Cuantitativo Detecta residuos de producto Simple Para verificar la limpieza, se necesita más que la simple vista. Ensayos microbiológicos requieren esperar 18 horas Es necesario un sistema rápido y fiable para ayudar a gestionar el proceso de control de la higiene. *La ATPmetría se basa en la medida del ATP.Detecta la presencia de residuos orgánicos además de microorganismos, que permanecen en una superficie tras una limpieza o desinfección inadecuada

44 Vea las ventajas de 3M Clean Trace Rápida, específica y sensible Cantidad de luz es proporcional a la cantidad de ATP Resultados en tiempo real, permitiendo una acción correctiva inmediata. Límite de detección bajo Muy fácil de usar Análisis automático de datos e interpretación de resultados Fotomultiplicador (frente fotodiodo)

45 Los datos y las tendencias Determinar exactamente dónde se produjo un problema de limpieza/desinfección Encuentra las áreas problemáticas en su línea de fabricación. Predece donde los problemas podrían ocurrir. Identificar las tendencias con el equipo y los procesos. Ver tendencias para repetir pruebas y descubrir posibles áreas de preocupación. Ver el punto de origen. El software de tendencia le ayuda a identificar donde comenzó el problema, para que pueda solucionarlo rápidamente antes de que afecte su producto Ver la efectividad de sus empleados. Esta gráfica ayudó a evaluar y mejorar la eficacia del equipo de saneamiento de fin de semana.

46 Análisis de Patógenos 3M Preparación de la muestra 3M Petrifilm Placas y Lector 3M Sistema Detección Molecular 3M Clean-Trace Sistema control Higiene 3M Sistema de Detección Molecular Patógenos 3M MLSII Análisis Esterilidad de la leche UHT 46

47 Una tecnología mejor Amplificación Isotérmica del ADN Detección por Bioluminiscencia 47 Una innovadora combinación de tecnologías que proporcionan el nivel de precisión molecular esperado por los ususarios, sin sacrificar productividad, sencillez y con un coste ajustado

48 Cómo funciona? Amplificación Isotérmica del ADN Iniciadores múltiples reconocen distintas regiones del genoma y una ADN Bst Polimerasa que aporta eficiencia, rapidez y amplificación continua del ADN diana Detección por Bioluminiscencia Una Luciferasa termoestable que emplea el ATP para generar luz y que es detectada por el equipo como indicador de la presencia del AND objetivo. El ATP se produce como consecuencia de la amplificación del ADN 3. Una enzima llamada ATP Sulfurilasa produce ATP 1. Iónes Pirofosfato generados en la amplificación 2. Combinados con Adenosin 5 fosfosulfato (APS) 4. Una Luciferasa termoestable produce Luz

49 Detección en Tiempo Real Amplificación exponenecial del ADN objetivo Produce una reacción que da tanto un rápido aumento y disminución de la luz cuando se amplifica la secuencia diana Bajada de Luminiscencia

50 Cómo se desarrollan la amplificación y detección? ADN Primer específico Adenosin 5 fosfosulfato (APS) ADN polimerasa isotérmica ATP Sulfurilasa Luciferasa dntp s Cadena de ADN bacteriano A Las dntps una Con Luciferasa enzima adenosina moléculas ADN temperatura Durante cada son Polimerasa Una ATP La las base En es ATP la de 5 Los vez Sulfurilasa moléculas el la 'fosfosulfato etapa ATP constante de Sulfurilasa primer enzima Primer que dntp isotérmica que de el paso Primer lisis base combina son que de (APS) es producen cualquier los permite 60 el se utilizadas una se Primer componente C, añade las es ha enzima la moléculas a unido, se ADN se las muchas a para consumen la une luciérnagas que se nueva Polimerasa la construir que a ADN libera es PPi copias una precursora dotan capaz hebra Polimerasa con por desde región las que del al isotérmica moléculas hebras ensayo enzima brillen. el altamente producir ADN que interior isotérmica diana se de una de Luciferasa La produce de combina ADN. moléculas su de enzima APS específica especificidad. las un Con para una células período con para al capaz cada PPi de consumir hebra de el producir ATP PPi se bacterianas, ADN de base muy de libera a unirse. para ATP partir diana. ADN corto moléculas de fotones crear como dntp de de a alta iónes ATP. un de que de la complementario energía. Sólo se se añade unen mediante a a la una continuación cadena secuencia la tiempo adición luz. por Pirofosfato Esta la una genética acción a de una luz muestra nucleótidos ATP producto emitida temperatura de (PPi) altamente emite la de enzima y se 20ul por la dntp fotones detecta Adenosina constante el específica se DNA proceso. a transfiere la Polimerasa secuencia. luz. el 5'-Fosfosulfato de que instrumento. al 60 tubo una Cencuentra de molécula ensayo. (APS) el PPi organismo se libera. objetivo.

51 Por qué es diferente? 3M Amplificación Isotérmica de ADN PCR (Reacción en cadena de la polimerasa) Enzima Bst ADN Polimerasa Taq ADN Polimerasa Desnaturalización Desplazamiento de cadena Calor Temperatura de reacción Isotérmica (60ºC) Ciclos de calentamiento y enfriamiento para la desnaturalización (94ºC) y replicación enzimática del ADN ( 55ºC y 72ºC) Amplificación Continua Cíclica Detección Bioluminiscencia Fluorescencia

52 Por qué debes elegir el Sistema de Detección Molecular de 3M? 3M Sistema Detección Molecular Valor para usted Tecnología puntera Precisión molecular Resultados en tiempo real Valor para el laboratorio Aumento eficiencia del técnico Menor probabilidad de error contaminación cruzada. Fácil de usar ocupa poco espacio 52

53 Simplificado para mejorar la Productividad 3M Método Salmonella 37 C ±1 C o 41.5 C ±1 C hrs 3M Método E.coli O157 (incluye H7) 41.5 C ±1 C 8-24 hrs 3M Método Listeria 37 C ±1 C hrs 3M Método Listeria monocytogenes 37 C ±1 C hrs Transferir 20 µl de muestra enriquecida al tubo de Lisis. Calentar 15 min 100 C ±1 C. Enfriar 10 min. Reposar 5 min. Transferir 20 µl lisado al tubo de reagente (Pellet liofilizado). Protocolo único para los diferentes patógenos Situar los tubos en el instrumento. Iniciar ensayo. Desarrollo de la amplificación y detección en min. Resultados mediante código de color.

54 Ensayo único 15 minutos para obtener un positivo Amplificación y detección simultanea completada en 75 Flexibilidad (1 a 96) Múltiples test de patógenos simultaneamente Tubos de los ensayos codificados por colores Reactivos listos para su uso

55 Instrumento muy robusto Mínimo mantenimiento Sin partes móviles ni ventiladores No necesita termocicladores ni filtros ni flourómetros Desmontable para fácil limpieza y descontaminación Autodiagnóstico con el encendido

56 Software sencillo y potente Posibilidad de simultanear tareas durante los ensayos Capacidad de controlar hasta 4 equipos simultaneamente Interpretación automática de los resultados y representados en tiempo real con códigos sencillos de leer Sistema seguro con password, con categorías de ususario y archivos de auditoría Compatibilidad con LIMS

57 Kit de cada ensayo Tapones extra Tubos de Lisis Tubos de reactivo de ensayo Control de reactivos Control negativo

58 3M Sistema de Detección Molecular Flujo de trabajo Abrir el software y el equipo 5 Ejecutar el programa de software e imprimir el diseño de ejecución 6 Configurar los ensayos 58 Click en el botón de inicio del software Coloque la bandeja de carga del instrumento y cierre la tapa para comenzar el ensayo Controlar los resultados y ver el informe

59 Certificaciones y validaciones Ensayo de Salmonella AOAC RI PTM Cert (Abril 2012) AOAC OMA (08/2013) AFNOR (Dic 2012) y ext 6/14 Ensayo E.coli O157: H7 - AOAC RI PTM Certi (07/ 2012) - AFNOR 06/13 (Abril 2013) Ensayo Listeria spp. (ambiental y alimentos) -AOAC RI PTM Cert (08/ 2 y 02/13) Ensayo Listeria mono (alimentos y superficies) - AOAC RI PTM Cert (Jun 2014)

60 Datos de rendimiento 3M Sistema de Detección Molecular Boletines Técnicos Selectividad del Método (inclusividad y exclusividad) Estudios de verificación Límites de detección Detección de serotipos Matrices ensayadas

61 Detección Producto final 3M Preparación de la muestra 3M Petrifilm Placas y Lector 3M Sistema Luminiscencia Microbiano 3M Clean-Trace Sistema control Higiene 3M Sistema de Detección Molecular Patógenos 3M MLSII Análisis Esterilidad de la leche UHT 61

62 3M MLSII Análisis Esterilidad de la leche UHT 1. Pre-Incubar muestras Leches UHT Batidos Natas 18-40% Leches de Soja. Postres lácteos 2. Agitar muestra 3. Pipetear 50µl de muestra en cada pocillo 4. Colocar la micro-placa en el MLSII y seleccionar Ensayo UHT 5. Resultados en tiempo real

63 Ensayo UHT Poner 50 µl de muestra en los pocillos de la placa y el aparato añadirá: 1. ATPasa para eliminar el ATP libre 2. Se incuba 15 minutos para dejar tiempo a la ATPasa funcionar 3. El extractante para abrir los microorganismos y liberar su ATP 4. La Luciferina/ Luciferasa(LL1) para reaccionar con el ATP microbiano 5. Mide la luz de la reacción LL1- ATP. A 30 URL APTO LL Extractante ATPasa A A A A Muestra Limpia A A 9735 URL FALLO LL Extractante ATPasa A A A A A A Muestra contaminada

64 Cuál es el beneficio principal del ATP? Métodos Tradicionales Microbiología (placa) Pre-Incubación 7 días Incubación Placas hrs ph 5 días Método Acelerado Microbiología (placa) Método MLS II hrs 48 hrs hrs Ensayo MLS <1hr aprox 40 minutos.

65 3M Seguridad Alimentaria Soluciones de confianza Usted 3M Seguridad Alimentaria Partnership Entendimiento de Productos y Procesos Gestión de Calidad conocimiento de la marca Conciencia & Conianza de Marca Soporte mundial Tecnología puntera Gama completa de soluciones Rentabilidad Aumento de la productividad Valor añadido Resultados consistentes y de confianza 65


Pathatrix Auto System Análisis de patógenos simplificado

Pathatrix Auto System Análisis de patógenos simplificado Pathatrix Auto System Análisis de patógenos simplificado Perfecto para su procedimiento de detección de patógenos Conozca el sistema Pathatrix Auto System, rápido, preciso, rentable y fácil de utilizar.

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles


DEFINICIÓN Y CARACTERÍSTICAS DE LA TÉCNICA: EQUIPO AUTOMÁTICO PARA LA DETECCIÓN DE PATÓGENOS minividas-vidas DEFINICIÓN Y CARACTERÍSTICAS DE LA TÉCNICA: Sistema automático de inmunodetección rápida de patógenos basado en la técnica ELFA (Enzyme

Más detalles

TaqMan GMO Screening Kit. Part No: 4466334

TaqMan GMO Screening Kit. Part No: 4466334 TaqMan GMO Screening Kit Part No: 4466334 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan mayor

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

TaqMan GMO Maize Quantification Kit. Part No: 4481972

TaqMan GMO Maize Quantification Kit. Part No: 4481972 TaqMan GMO Maize Quantification Kit Part No: 4481972 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan

Más detalles

3M Placas Petrifilm TM para el Recuento de Aerobios

3M Placas Petrifilm TM para el Recuento de Aerobios 3M Placas Petrifilm TM para el Recuento de Aerobios Recomendaciones de uso Para detallar información sobre PRECAUCIONES, COMPENSACIONES POR GARANTÍA / GARANTÍA LIMITADA, LIMITACIONES POR RESPONSABILIDAD

Más detalles

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a Introducción Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a los investigadores verificar la expresión de una proteína, determinar la cantidad relativa

Más detalles

Avances Tecnológicos en PCR para la Detección Rápida de Patógenos en Alimentos y Medio Ambiente

Avances Tecnológicos en PCR para la Detección Rápida de Patógenos en Alimentos y Medio Ambiente Avances Tecnológicos en PCR para la Detección Rápida de Patógenos en Alimentos y Medio Ambiente M.Sc. Viviana Fino - DuPont N&H ACHIPIA 2015 8 de octubre de 2015 Santiago, Chile Necesidades de la Industria

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. info@atgen.com.uy www.atgen.com.uy

Más detalles



Más detalles


TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO TEST de PATERNIDAD Este experimento introduce a los alumnos en el uso del ADN y la PCR para simular una determinación de paternidad. Los estudiantes

Más detalles

Detección de microorganismos patógenos en los alimentos. Prof. Dr. Luis M. Medina

Detección de microorganismos patógenos en los alimentos. Prof. Dr. Luis M. Medina Detección de microorganismos patógenos en los alimentos Prof. Dr. Luis M. Medina ANÁLISIS MICROBIOLÓGICOS EN ALIMENTOS Indicadores recuento total (BAM ) enterobacteriáceas totales coliformes totales E.

Más detalles


DANAGENE RNA PURIFICATION KIT DANAGENE RNA PURIFICATION KIT REF.0801.1 100 EXTRACCIONES REF.0801.2 500 EXTRACCIONES 1.INTRODUCCION Este kit permite la permite la obtención de ARN total a partir de cultivos celulares, tejidos animales,

Más detalles


CONTROL DE LA PRESENCIA DE BIOFILMS EN LAS INDUSTRIAS ALIMENTARIAS Higiene y seguridad alimentaria Imagen de microscopía electrónica de un biofilm formado por un gran número de bacterias Staphylococcus aureus y una estructura gelatinosa compuesta por la matriz extracelular

Más detalles

Workshop sobre el rol de las mediciones microbiológicas trazables y confiables para asegurar la calidad y seguridad de los alimentos.

Workshop sobre el rol de las mediciones microbiológicas trazables y confiables para asegurar la calidad y seguridad de los alimentos. Workshop sobre el rol de las mediciones microbiológicas trazables y confiables para asegurar la calidad y seguridad de los alimentos. Disertante: Dr. Celia Puglisi Departamento de Metrología Cientíca e

Más detalles


DETERMINACIÓN DEL FACTOR Rh por PCR Ref.PCRRh DETERMINACIÓN DEL FACTOR Rh por PCR 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

Materiales para la secuenciación de ADN

Materiales para la secuenciación de ADN Introduccion La Secuenciación Sanger es un método de secuenciación de ADN en el que el ADN diana se desnaturaliza y se hibrida con un cebador de oligonucleótidos, que se extiende entonces gracias a la

Más detalles

3M Microbiología 3M Clean-Trace Sistema para el Monitoreo de Higiene. Máxima. Higiene. en Su Planta

3M Microbiología 3M Clean-Trace Sistema para el Monitoreo de Higiene. Máxima. Higiene. en Su Planta 3M Microbiología 3M Clean-Trace Sistema para el Monitoreo de Higiene Máxima Higiene en Su Planta Las pruebas 3M Clean-Trace para monitorear la 1,2 higiene ofrecen alta repetibilidad y excelente sensibilidad,

Más detalles


PLIEGO DE PRESCRIPCIONES TÉCNICAS PLIEGO DE PRESCRIPCIONES TÉCNICAS Expediente : 2015/000023 Titulo Localidad : Suministro e instalación de Sistema robotizado de ampliación y cuantificación de ácitos nucleicos en tiempo real, financiado

Más detalles


MICROPLANET EQUIPO MÚLTIPLES PRUEBAS REPORTE INTEGRADO. Resultados Inmediatos UN EQUIPO MÚLTIPLES PRUEBAS REPORTE INTEGRADO Resultados Inmediatos SISTEMA MVP El LIGHTNING MVP es el primer sistema de control que utiliza un mismo equipo para muestrear, analizar y presentar datos de

Más detalles


APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS Prácticas docentes en la COD: 10-71 APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS FUNDAMENTO TEÓRICO La PCR es una técnica que permite llevar a cabo la síntesis in vitro de fragmentos de ADN. Está basada

Más detalles


BENTLEY BactoCount IBC BENTLEY BactoCount IBC Características del equipo El BactoCount IBC es un equipo automático para contar rápido e individualmente las bacterias de la leche cruda. Capacidad: de 50 hasta 150 muestras / hora.

Más detalles

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml)

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml) PCR SIMULADA Ref.PCR Simulada (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

PCR a tiempo real. Análisis de patógenos en alimentos. APPLUS+ Laboratorio de Genética 20.11.2007

PCR a tiempo real. Análisis de patógenos en alimentos. APPLUS+ Laboratorio de Genética 20.11.2007 PCR a tiempo real. Análisis de patógenos en alimentos APPLUS+ Laboratorio de Genética 20.11.2007 Índice 0_ Applus + 1_ Roche 2_ Real Time PCR 3_ LightCycler 480 4_ Detección de patógenos Applus+ 00 Applus+

Más detalles

Microorganismos marcadores: índices e indicadores

Microorganismos marcadores: índices e indicadores Microorganismos marcadores: índices e indicadores 1 Dentro de los microorganismos marcadores encontramos: 1. Índices Su presencia en un alimento indica la posible presencia simultánea de microorganismos

Más detalles

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental.

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Gemma Saucedo. Laboratorio Aguas de Barcelona 22-23 de noviembre de 2006 Introducción PCR: Polymerase Chain Reaction

Más detalles



Más detalles

1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de Quant- it PicoGreen dsaadnssay Kit (Invitrogen ).

1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de Quant- it PicoGreen dsaadnssay Kit (Invitrogen ). 1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de QuantiT PicoGreen dsaadnssay Kit (Invitrogen ). 2. Finalidad. El presente documento describe el Procedimiento Normalizado de

Más detalles

LIMS Laboratory Information Management Systems. Paola Vital Business Consultant

LIMS Laboratory Information Management Systems. Paola Vital Business Consultant LIMS Laboratory Information Management Systems Paola Vital Business Consultant 1 Division Informatics Thermo Fisher Scientific Informatics 30 años de experiencia Soluciones LIMS +400 empleados +5.000 clientes

Más detalles


5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN 5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN Materiales - Eppendorf de 1,5 ml estériles - Eppendorf de pared fina para PCR - Puntas de pipeta estériles desechables - Guantes

Más detalles



Más detalles



Más detalles

Autoclaves Verticales. Systec Serie-V

Autoclaves Verticales. Systec Serie-V Autoclaves Verticales Systec Serie-V Systec Serie-V Autoclaves verticales Autoclaves especialmente desarrolladas para procedimientos de esterilización en laboratorios. Realice estos procedimientos de forma

Más detalles

Práctico: Genética bacteriana 2007.

Práctico: Genética bacteriana 2007. Práctico: Genética bacteriana 2007. Actividad integrada Departamento de Genética Departamento de Bacteriología y Virología. OBJETIVOS Objetivos generales El estudiante al terminar la actividad práctica

Más detalles



Más detalles


MICROBIOLOGY LAB AUTOMATION MICROBIOLOGY LAB AUTOMATION IUL: INTRODUCCIÓN IUL diseña, fabrica y comercializa instrumentos y consumibles para la automatización del laboratorio microbiológico. Los productos de IUL añaden innovaciones

Más detalles

OBJETIVO. Al finalizar el curso, los alumnos serán capaces de:

OBJETIVO. Al finalizar el curso, los alumnos serán capaces de: OBJETIVO El objetivo principal del curso es adquirir conocimientos sobre la esencia y los fundamentos de los Sistemas de Gestión de Calidad, Normas ISO, Gestión de Calidad en las empresas, Auditorías Internas,

Más detalles

Microbiología a la velocidad de la luz.

Microbiología a la velocidad de la luz. Microbiología a la velocidad de la luz. El Problema, DEFINIDO Los métodos de prueba microbiológicos tradicionales han demostrado que requieren demasiado tiempo para muchos fabricantes. Esto es porque la

Más detalles

Universidad Tecnológica de Panamá Centro de Investigaciones Hidráulicas e Hidrotécnicas Laboratorio de Sistemas Ambientales

Universidad Tecnológica de Panamá Centro de Investigaciones Hidráulicas e Hidrotécnicas Laboratorio de Sistemas Ambientales Página: 1 de 5 1. Introducción: Colilert detecta simultáneamente Coliformes Totales y E. Coli en el agua, se basa en la tecnología de sustratos definidos (DST), cuando los coliformes totales metabolizan

Más detalles



Más detalles

Soluciones de climatización CPD. Soluciones de climatización CPD

Soluciones de climatización CPD. Soluciones de climatización CPD La tendencia de instalación de servidores de alta densidad, presenta desafíos significativos que nos obligan a utilizar novedosas estrategias de refrigeración, orientadas a incrementar la eficiencia y

Más detalles



Más detalles

Sistema de Filtración Pall Oenofil Automatización, Control y Seguridad para las Líneas de Embotellado FBOENOFILES

Sistema de Filtración Pall Oenofil Automatización, Control y Seguridad para las Líneas de Embotellado FBOENOFILES Sistema de Filtración Pall Oenofil Automatización, Control y Seguridad para las Líneas de Embotellado FBOENOFILES Sistema de Filtración Pall Oenofil El control del proceso de filtración constituye un elemento

Más detalles


ORGANIZACIÓN ENSAYOS INTERLABORATORIALES SALMONELOSIS ORGANIZACIÓN ENSAYOS INTERLABORATORIALES SALMONELOSIS Ensayos Interlaboratoriales de Detección e Identificación de Salmonella 2 anuales Para Laboratorios Oficiales: 24 laboratorios Para Laboratorios Autorizados

Más detalles


AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO E l estudio del genoma de los seres vivos a sido uno d los principales objetivos de la Biología. Desde los trabajos de Mendel (1866),

Más detalles



Más detalles



Más detalles

Durante mi estancia en la empresa ALKEMI S.A. he podido. realizar diversos procedimientos utilizados de cara al control de

Durante mi estancia en la empresa ALKEMI S.A. he podido. realizar diversos procedimientos utilizados de cara al control de INTRODUCCIÓN: Durante mi estancia en la empresa ALKEMI S.A. he podido realizar diversos procedimientos utilizados de cara al control de calidad de aguas, alimentos, medicamentos, piensos También en dichos

Más detalles


RECOMENDACIÓN JULIO 2015. CHECKLIST DE LIMPIEZA TERMINAL Dr. Fabián Vítolo NOBLE S.A. # 1 RECOMENDACIÓN JULIO 2015 CHECKLIST DE LIMPIEZA TERMINAL Dr. Fabián Vítolo NOBLE S.A. La evidencia demuestra que muchas de las infecciones asociadas al cuidado de la salud (IACS), se relacionan con

Más detalles

FACTS Microorganismos en el agua potable

FACTS Microorganismos en el agua potable FACTS Microorganismos en el agua potable INTRODUCCIÓN Los microorganismos son organismos (como bacterias, virus y protozoos) que son demasiado pequeños para que se puedan ver sin la ayuda de un microscopio.

Más detalles

Primary Test Manager (PTM) Pruebas y software de gestión de activos primarios

Primary Test Manager (PTM) Pruebas y software de gestión de activos primarios Primary Test Manager (PTM) Pruebas y software de gestión de activos primarios La herramienta ideal para pruebas de diagnóstico y evaluaciones de Primary Test Manager TM (PTM) es la herramienta de software

Más detalles



Más detalles


FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles


PET-RPLA KIT para DETECCIÓN de TOXINAS. Código: TD0930 PET-RPLA KIT para DETECCIÓN de TOXINAS Código: TD0930 Kit para detección de enterotoxina tipo A de Clostridium perfringens en muestras fecales o en filtrados de cultivos por aglutinación pasiva de látex

Más detalles

Miel de abejas - Determinación de Clostridium sulfitoreductores

Miel de abejas - Determinación de Clostridium sulfitoreductores Vencimiento consulta pública: 2007.09.07 PROYECTO DE NORMA EN CONSULTA PUBLICA NCh3123.c2007 Miel de abejas - Determinación de Clostridium sulfitoreductores - Método de recuento Preámbulo El Instituto

Más detalles

Validación de los métodos microbiológicos PROTOCOLO DE VALIDACIÓN

Validación de los métodos microbiológicos PROTOCOLO DE VALIDACIÓN Validación de los métodos microbiológicos PROTOCOLO DE VALIDACIÓN Norma ISO 17025 Bqca. QM Alicia I. Cuesta, Consultora Internacional de la FAO Objetivos a desarrollar Validación de métodos: Intentamos

Más detalles


ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles



Más detalles

SECADO DE EMBUTIDOS. es una fuente propicia para el desarrollo de bacterias y mohos.

SECADO DE EMBUTIDOS. es una fuente propicia para el desarrollo de bacterias y mohos. SECADO DE EMBUTIDOS Imtech DryGenic ayuda a los fabricantes con procesos de secado de embutidos a obtener embutidos de mayor calidad, en un entorno libre de bacterias, limpio y a una temperatura y humedad

Más detalles

Sistema Milliflex Quantum Sistema de detección microbiológica rápida por tinción fluorescente, no destructivo y fácil de usar

Sistema Milliflex Quantum Sistema de detección microbiológica rápida por tinción fluorescente, no destructivo y fácil de usar Data Sheet Ficha técnica Sistema Milliflex Quantum Sistema de detección microbiológica rápida por tinción fluorescente, no destructivo y fácil de usar Método no destructivo que permite la identificación

Más detalles



Más detalles

MICROBIOLOGÍA DE ALIMENTOS. Resumen de las prácticas de Microbiología de Alimentos

MICROBIOLOGÍA DE ALIMENTOS. Resumen de las prácticas de Microbiología de Alimentos MICROBIOLOGÍA DE ALIMENTOS Resumen de las prácticas de Microbiología de Alimentos 1 Ingeniero Técnico Agrícola Industrias Agrarias y Alimentarias CURSO 2004-2005 Profesora: Cristina Solano Goñi e-mail:

Más detalles

11 knúmero de publicación: 2 137 373. 51 kint. Cl. 6 : C12Q 1/70

11 knúmero de publicación: 2 137 373. 51 kint. Cl. 6 : C12Q 1/70 k 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 knúmero de publicación: 2 137 373 1 kint. Cl. 6 : C12Q 1/70 C12Q 1/04 C12Q 1/66 12 k TRADUCCION DE PATENTE EUROPEA T3 86 knúmero de solicitud europea:

Más detalles

Protocolos de secuenciación de ADN

Protocolos de secuenciación de ADN 1 Protocolos de secuenciación de ADN Introducción El método de secuenciación utilizado aquí es el desarrollado por Sanger en 1975. Este consiste en la incorporación de didesixinucleótidos marcados fluorescentemente

Más detalles

Frigoríficos Balay. Frigorífico 3FCP-1667 y congelador 3GFP-1667

Frigoríficos Balay. Frigorífico 3FCP-1667 y congelador 3GFP-1667 Frigoríficos Balay Balay posee en su amplia gama de frío, frigoríficos americanos, combinados No-Frost, frigoríficos y congeladores de una y dos puertas, frío integrable, vinoteca y arcones congeladores.

Más detalles



Más detalles


TEMA 13: ESTERILIZACIÓN INDUSTRIAL Dr. Pedro F. Mateos TEMA 13: ESTERILIZACIÓN INDUSTRIAL Dr. Pedro F. Mateos I. INTRODUCCION Para poder llevar a cabo una fermentación con éxito es imprescindible y obligatorio tener en todas las etapas cultivos libres de contaminantes,

Más detalles



Más detalles


REQUISITOS DE HIGIENE DE SEGURIDAD DE PRODUCTOS ALIMENTICIOS EN CONSERVA Anexo 1 REQUISITOS DE HIGIENE DE SEGURIDAD DE PRODUCTOS ALIMENTICIOS EN CONSERVA Según el contenido del alimenticio en conserva (conservas), grado de acidez activa (ph) y contenido de sustancias secas,

Más detalles



Más detalles


PROCEDIMIENTO NMP PARA LA DETERMINACION DE COLIFORMES FECALES EN AGUAS POR METODO A-1 PRT-712.02-006 Página 1 de 6 1. OBJETIVO Este análisis se realiza para estimar la densidad de coliformes fecales en agua, con una incubación de 24 hrs. por lo cual se obtienen resultados en menor tiempo que el método

Más detalles

6.4.5. Esterilización por gas plasma (Sterrad )

6.4.5. Esterilización por gas plasma (Sterrad ) 6.4.5. Esterilización por gas plasma (Sterrad ) Indicaciones Esterilización de material termosensible (resistente a temperaturas < 60ºC) e instrumental de superficies lisas. No puede esterilizarse instrumental

Más detalles


EUROTUBO DELTALAB 4. PLACAS Y ASAS 81 82 Placa Petri 90 x 14 mm Fabricadas en poliestireno. Con tres vientos. Presentadas en bolsas cerradas por calor de 20 unidades. Código 200200 aséptico. Código 200209 estéril por radiación. Aptas para

Más detalles


MOLECULAR DIAGNOSTIC KITS CATALOGUE MOLECULAR DIAGNOSTIC KITS CATALOGUE KITS DE DIAGNÓSTICO MOLECULAR IELAB le presenta, enmarcada dentro de su línea de productos de diagnóstico molecular, una nueva gama de kits de diagnóstico, que han sido

Más detalles

Limpieza y desinfección en el control de Listeria en industrias alimentarias

Limpieza y desinfección en el control de Listeria en industrias alimentarias Listeria monocytogenes: biofilms y persistencia en industrias alimentarias Limpieza y desinfección en el control de Listeria en industrias alimentarias 30 de mayo de 2013 San Adrián Contenido o Importancia

Más detalles

Enfriadora RTAC de la serie R de 500 a 1500 kw Valor sin igual de las enfriadoras de condensación por aire de eficiencia clase A

Enfriadora RTAC de la serie R de 500 a 1500 kw Valor sin igual de las enfriadoras de condensación por aire de eficiencia clase A Enfriadora RTAC de la serie R de 500 a 1500 kw Valor sin igual de las enfriadoras de condensación por aire de eficiencia clase A Enfriadora de líquido de condensación po un rendimiento que aporta dividendos

Más detalles

Solución para determinar la fibra cruda y la fibra en detergente Fibertec M6

Solución para determinar la fibra cruda y la fibra en detergente Fibertec M6 Solución para determinar la fibra cruda y la fibra en detergente Fibertec M6 El sistema Fibertec M6 consta de unidades de extracción en caliente y en frío para la determinación sencilla de fibra cruda

Más detalles

CONTROL HIGIENICO DE PRODUCTOS NO OBLIGATORIAMENTE ESTERILES. FUENTE: Centro de Documentación e Información del Ministerio de Economía - Argentina

CONTROL HIGIENICO DE PRODUCTOS NO OBLIGATORIAMENTE ESTERILES. FUENTE: Centro de Documentación e Información del Ministerio de Economía - Argentina CONTROL HIGIENICO DE PRODUCTOS NO OBLIGATORIAMENTE ESTERILES FUENTE: Centro de Documentación e Información del Ministerio de Economía - Argentina En este artículo se especifican los ensayos necesarios

Más detalles

Crecimiento Bacteriano Benintende, Silvia y Sanchez, Cecilia

Crecimiento Bacteriano Benintende, Silvia y Sanchez, Cecilia Unidad Temática 3 Crecimiento Bacteriano Benintende, Silvia y Sanchez, Cecilia Introducción En un sistema biológico se define al crecimiento como el aumento ordenado de las estructuras y los constituyentes

Más detalles

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica TÉCNICAS GENÓMICAS Utilidad/Objetivos: 1) Detección de microorganismos directamente en muestras clínicas identificando un fragmento específico del genoma del microorganismo concreto 2) Cuantificación del

Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

TREKVIEW - Registrador de temperatura inalámbrico

TREKVIEW - Registrador de temperatura inalámbrico TREKVIEW - Registrador de temperatura inalámbrico Especificaciones Técnicas Un revolucionario sistema que coloca el control de la cadena de frío en sus manos El TrekView es un gran adelanto tecnológico

Más detalles


5. MATERIALES Y MÉTODOS 5. MATERIALES Y MÉTODOS 5.1 Equipos Los siguientes termocicladores se emplearon para la amplificación por PCR: - Perkin Elmer, GeneAmp PCR System 2400. - Perkin Elmer, GeneAmp PCR System 9600. - Applied

Más detalles

y desinfección. Medios de cultivo. Objetivos Métodos de esterilización Definiciones Calor seco Calor seco MECÁNICOS FISICOS: QUIMICOS

y desinfección. Medios de cultivo. Objetivos Métodos de esterilización Definiciones Calor seco Calor seco MECÁNICOS FISICOS: QUIMICOS Métodos de esterilización y desinfección. n. Medios de cultivo. Curso: Diagnósticos en Fitopatología 17 de setiembre de 2015 Ing. Agr. MSc. Vivienne Gepp Objetivos Familiarizarse con los procesos de desinfección

Más detalles


SISTEMAS DE DETECCIÓN DE PATÓGENOS POR PCR A TIEMPO REAL. Guía de interpretación de resultados SISTEMAS DE DETECCIÓN DE PATÓGENOS POR PCR A TIEMPO REAL Guía de interpretación de resultados Sistemas de detección de patógenos por PCR a tiempo real Microbial ofrece sistemas para la detección de patógenos

Más detalles


PROTOCOLO DE SANITIZACIÓN DE DISPENSADORES DOMÉSTICOS PROTOCOLO DE SANITIZACIÓN DE DISPENSADORES DOMÉSTICOS Con este protocolo se pretende detallar la desinfección de los dispensadores de agua a los efectos de conseguir las condiciones de salubridad apropiadas

Más detalles


ECOLOGÍA MICROBIANA Y COMPORTAMIENTO BACTERIANO COMUNITARIO 5 TRABAJO PRÁCTICO ECOLOGÍA MICROBIANA Y COMPORTAMIENTO BACTERIANO COMUNITARIO OBJETIVOS: 1 Observar y comprender la diversidad bacteriana que coexiste en un mismo nicho en un dado ecosistema y las interrelaciones

Más detalles

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri OBJETIVO Desarrollar un banco de datos a partir de plantas de origen indudable y del uso

Más detalles

abastecedora gráfica Software de formulación de color en textiles

abastecedora gráfica Software de formulación de color en textiles Color Match Software de formulación de color en textiles abastecedora gráfica Master Dealer en Argentina, Bolivia, Paraguay y Uruguay Cochabamba 670 - Ciudad de Bs As Te: 54 11 4362 6492 Rot - Fax int

Más detalles

La microbiología del futuro Silvia Michanie silvia@michanie.com.ar

La microbiología del futuro Silvia Michanie silvia@michanie.com.ar Revista: Énfasis Alimentos Oct/Nov. 1999: 16-22 Herramientas para la Vigilancia Sanitaria de los Alimentos La microbiología del futuro Silvia Michanie silvia@michanie.com.ar Copete: Las necesidades de

Más detalles

C V C. Instrucciones de uso de Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02. Revisión 2. Julio de 2014

C V C. Instrucciones de uso de Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02. Revisión 2. Julio de 2014 DOT142v1 Instructions for Use Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Página 1 de 7 Instrucciones de uso de Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Revisión 2 Julio de

Más detalles



Más detalles

Soluciones validadas que aumentan la eficiencia en la rutina de trabajo de tu laboratorio

Soluciones validadas que aumentan la eficiencia en la rutina de trabajo de tu laboratorio Cristina Gómez, X workshop MRAMA iq-check TM Real Time PCR y medios cromogénicos RAPID Soluciones validadas que aumentan la eficiencia en la rutina de trabajo de tu laboratorio BIO-RAD la compañía Fundada

Más detalles



Más detalles

Microbiología General 2008-2009

Microbiología General 2008-2009 Microbiología General 2008-2009 Eliminación de microorganismos Teoría de la esterilización (conceptos de valores D y z). Tratamientos industriales de esterilización: la Pasteurización, tratamientos HTST

Más detalles


Kit PunchSolution INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC9271. Technical Manual Kit PunchSolution INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC9271. IMPRESO EN ESTADOS UNIDOS 5/12 Kit PunchSolution Toda la bibliografía técnica está disponible en Internet, en el sitio

Más detalles

Nuevo Detergente Multienzimático Removedor de Biofilm de 3M

Nuevo Detergente Multienzimático Removedor de Biofilm de 3M 3M División Prevención de Infecciones EVIDENCIA CIENTÍFICA l Nuevo Detergente Multienzimático Removedor de Biofilm de 3M Visítenos en www.3msalud.cl Rinde hasta 400 veces su volumen Compatible con instrumentos

Más detalles