Tamaño: px
Comenzar la demostración a partir de la página:

Download "ARLEQUIN. URL ="


1 ARLEQUIN URL = estimas intra- e inter-poblacionales de variabilidad: Gene diversity (h) Mean number of pairwise differences---nucleotide diversity Theta (2M : M = 2N en diploides) Hom, S, k, π (homocigosidad, sitios polimórficos, número de alelos, mean number of pairwise differences) Mismatch distribution Frecuencias haplotípicas H-W equilibrium Test de neutralidad Ligamiento Estructura poblacional (AMOVA) Population pairwise distances (F ST ) Exact test Mantel test 1

2 Fichero de datos: datos27_alu.xls 1) Se prepara una hoja EXCEL: Hoja: Datos crudos 1ª columna: nombre del alelo, HT ó HG Siguientes columnas: poblaciones Columna C 1ª Fila: abreviaturas de las poblaciones (importan las mayúsculas) 2ª Fila: sample size Fila 5 3ª y siguientes: HT ó HG ó Alelos Matriz (D6: AD143) Fila 3 Hoja Datos: Fila 2 y 3: 27 poblaciones Fila 5: sample size = tamaño muestral Columna B: HT = haplotype Columna A: HG = haplogroup Columna C: nombre del HT y del HG Nota: eliminar filas vacías: sumar en una nueva columna, valores, buscar y eliminar 0 FICHERO DE DATOS- excel Crear una matriz con las frecuencias absolutas de cada HG - Linea 146: Tabla para estimar las frecuencias absolutas de los HG--- complétela rango ; criterio ; rango-suma Casilla E146: =SUMAR.SI($A$6:$A$140;$A146;E$6:E$140) - Comprobamos que todo es correcto. Para ello creamos las filas 170 (suma de los valores de cada HG) y 171 (diferencia entre éstos y los tamaños muestrales) - Si todo está correcto, transformamos las fórmulas en valores. Para ello: Copiamos las filas de la 146 a la 169 y las insertamos en la fila 173, luego: Botón derecho- valores - Comprobar que no ha habido errores creando una matriz en la línea 223 que sea la diferencia entre los valores que acabas de pegar y los que están en la matriz verde. 2

3 FICHERO DE DATOS de texto.arp Se prepara el archivo en el word (ó en el bloc de notas), pero salvándolo como texto y la extensión.arp NOTA: en el nombre no debe haber espacios. SECCIONES-APARTADOS Hay apartados obligatorios y apartados optativos [Profile] Title= NbSamples = # nº del 1 al 1000 DataType = frequency DNA, RFLP, Standard, Microsat GenotypicData = 0 0 = haplotypic 1 = genotypic data FICHERO DE DATOS de texto.arp SECCIONES-APARTADOS OPCIONALES LocusSeparator = WHITESPACE GameticPhase = 1 RecessiveData = 0 MissingData =? Frequency = ABS CompDistMatrix = 0 FrequencyThreshold =1e-5 EpsilonValue =1e-7 TAB, NONE,cualquiera excepto # y missing data 0 = desconocida, 1 = conocida 0 = codominante, 1 = recesivo cualquiera entre únicas ó dobles comillas ABS (absolutos) ó REL (relativos = frecuencias) 0=usa la especificada (Dist), 1= la computa (HT) nº de digitos para freq de HT (0.01 a 1e-7) criterio de convergencia para los algoritmos EM (frecht y desequilibrio) # cualquier renglón precedido de # no se tiene en cuenta 3

4 [Data] FICHERO DE DATOS de texto.arp SECCIONES-APARTADOS [[HaplotypeDefinition]] HaplListName = sec_ht HaplList = { H1 ATCG H2 ATCA } También podemos escribirlo: [[HaplotypeDefinition]] HaplListName = nombre HaplList = EXTERN hapl_file.hap FICHERO DE DATOS de texto.arp SECCIONES-APARTADOS [Data] [[DistanceMatrix]] MatrixName = sec_dist MatrixSize =# nº líneas = nº OTUs, sec.,... MatrixData = { H1 H2 H3 identificadores OTUs, sec., } También podemos escribirlo: [[DistanceMatrix]] MatrixName = nombre MatrixSize =# MatrixData = EXTERN mat_file.hap 4

5 [Data] FICHERO DE DATOS de texto.arp SECCIONES-APARTADOS [[Samples]] SampleName = abreviatura SampleSize = # nº entero = tamaño muestral SampleData = { H1 1 tb se puede poner la definición del HT aquí H2 5 si usamos FREQUENCY, sólo ID y # } se repite tantas veces como muestras tengamos. Si se trata de genotipos: SampleData = { G1 1 ATTCGCGATTCG ATTCGCAATTCA G } Introduzcan los datos de las dos poblaciones que faltan (AST y POT) y completen GAL 1º) pinchen en la fila 6---VISTA---Inmovilizar---Inmovilizar paneles 2º) busquen la fila 196 (la última de su suma en valores = HG24) 3º) marquen filas, comenzando en la 196 y terminando en la 172 y ahora DATOS---filtro 4º) Oculten la columna D: Marcar la columna, botón dcho, ocultar 5º) Pinchen el el filtro de la E172, quiten la marca del ACEPTAR 6º) Marquen las casillas que quedaron en la columna C y E (entre filas 173 y 196)---Botón Dcho---Copiar 7º) en el bloc de notas del archivo AmovaHG27.arp colóquense al principio del renglón } y peguen (CtrlV). Y en el sample size escriban el valor de la casilla E5 8º) Anular el filtro: en la casilla del Excel E172, pinchen en el filtro: --- Seleccionar todo --- ACEPTAR 9º) En el archivo *.arp, entre Galicia y Guinea, introduzcan AST y POT NOTA: Conviene que cuando terminen, en el Excel, abran todos los filtros y las columnas ocultas. 5

6 [Data] FICHERO DE DATOS de texto.arp SECCIONES-APARTADOS [[Structure]] StructureName = nombre NbGroups = # nº entero = tamaño muestral IndividualLevel = 0 1 si tenemos datos genotípicos Group = { population abreviation population abreviation } se repite tantas veces como grupos tengamos. Recordatorio: # indica que no se lee esa línea, pero nunca puede ir entre dos {} 6

7 [Data] FICHERO DE DATOS de texto.arp SECCIONES-APARTADOS [[Structure]] StructureName = nombre NbGroups = # nº entero = tamaño muestral IndividualLevel = 0 1 si tenemos datos genotípicos Group = { population abreviation importante coincidan population abreviation con la de los datos } se repite tantas veces como grupos tengamos. Recordatorio: # indica que no se lee esa línea, pero nunca puede ir entre dos {} Consejo: problemas con copiar otra anterior FICHERO DE DATOS de texto.arp SECCIONES-APARTADOS [Data] [[Mantel]] MatrixSize = # MatrixNumber = 2 si ponemos 3, tenemos que definir 3 DistMatMantel, para que correlacione Y con estas dos X YMatrix = fst, log_fst,slatkinlinearfst, log_slatkinlinearfst, nm custom es decir, matriz de distancias genéticas YMatrixlabels = { population population... Todas } DistMatMantel = { Se repite 2 ó 3 veces 0.00 la primera es Y y las demás X } UsedYMatrixLabels = { population population... si queremos definir un subgrupo } 7

8 FICHERO DE DATOS de texto.arp [Profile] Title="AMOVA, Title="" 27 poblaciones, HG" NbSamples=27 DataType=FREQUENCY GenotypicData=0 Frequency=ABS [Data] [[Samples]] SampleName="GAL" SampleSize=191 SampleData= { HG01 39 HG } [[Structure]] StructureName="regiones" NbGroups=5 IndividualLevel=0 Group={ "GAL" "AST" } Uso del ARLEQUIN Open Project---Buscar el archivo ---ABRIR 8

9 Uso del ARLEQUIN Nos da la información del proyecto y vamos a la pestaña SETTINGS Uso del ARLEQUIN Aspecto de la pestaña SETTINGS 9

10 Uso del ARLEQUIN Marcamos AMOVA y luego, Standard AMOVA Uso del ARLEQUIN POPULATION COMPARISONS Compute pairwise FST ---- Slatkin s distance Como no le dimos datos moleculares: Use conventional F-statistics (haplotype frequencies only) 10

11 Uso del ARLEQUIN POPULATON DIFFERENTIATION --- Exact test of population differentiation Uso del ARLEQUIN MOLECULAR DIVERSITY INDICES --- Standard diversity indices 11

12 Uso del ARLEQUIN START Uso del ARLEQUIN Computations are over File---close project --- cerrar 12

13 FICHERO DE SALIDA Creó una carpeta con el nombre de tu archivo e introdujo 5 ficheros: amovahg27_sb.htm amovahg27_sb.js amovahg27_sb_main.htm amovahg27_sb_tree.htm Arlequin_log.txt (avance del proceso) Y otro externo con los datos usados: randseed.txt Usamos amovahg27_sb.htm que lo abrimos con WORD y lo salvamos como.txt 13

14 FICHERO DE SALIDA - errores, y luego el nº y la fecha de la ejecución - Información acerca del proyecto y varias secciones ANALYSES AT THE INTRA-POPULATION LEVEL: ======================================================== == Sample : GAL =========================================================== Standard diversity indices : No. of gene copies: 191 No. haplotypes : 19 No. of loci : 0 No. of usable loci : 0 loci with less than 5.00 % missing data No. of polymorphic loci : 0 Haplotype-level computations Sum of square freqs. : Gene diversity : / (Standard deviation is for the sampling process) ================================ == Molecular diversity indices : (GAL) ================================ TABLA DE FRECUENCIAS 1) Preparar archivo excel con una matriz con las frecuencias de los alelos, HT, HG, 2) 1ª columna = nombre los alelos, HT, HG; restantes: cada población 3) 1ª fila: nombre de las poblaciones 4) 2º fila: Sample size 5) 3ª y siguientes: cada HG con su frecuencia 6) Al final: nº de HT y en las siguientes Gene diversity (H ± s) - Copiar la hoja Datos en otra hoja, que llamamos frec y dejar sólo la matriz con los valores absolutos de cada HG - Copiar filas de siglas de las POB. Copiar columna con nombre de alelos - Calcular las frecuencias (en % con 1 decimal), extender. 14

15 Estos datos se incluyen en la tabla de frecuencias de las poblaciones 15

16 FICHERO DE SALIDA ANALYSES AT THE INTRA-POPULATION LEVEL: ================================ == Molecular diversity indices : (GAL) ================================ Sample size : No. of haplotypes : 19 Allowed level of missing data : % Number of polymorphic loci : 0 Number of usable loci : 0 Theta(Hom) : S.D. Theta(Hom) : Theta(k) : % confidence interval limits for theta(k) : [ , ] Unable to compute theta(s) for standard data type Unable to compute theta(pi) for standard data type Al no haber datos moleculares, faltan algunas Theta FICHERO DE SALIDA =================================================== == GENETIC STRUCTURE ANALYSIS AMOVA ====================================================== 16

17 FICHERO DE SALIDA =================================================== == GENETIC STRUCTURE ANALYSIS AMOVA ====================================================== Ordenamos los F ST : (1-FSC)*(1-FCT) = (1-FST) Variación: en una población: 99.38% FSC(entre poblaciones dentro de grupos)= var = 0.29% P-value = FCT(entre grupos)= var = 0.32% P-value = p<0.001 p<0.001 FST(total)= P-value = p<0.001 Conclusión: las regiones son distintas, pero hay mucha mas estructuración de la que planteamos, pues es significativa la variación dentro de regiones FICHERO DE SALIDA =================================================== == Comparisons of pairs of population samples ====================================================== List of labels for population samples Population pairwise FSTs FST P values Matrix of significant Fst P values Significance Level= Matrix of Slatkin linearized FSTs as t/m=fst/(1-fst) (M=N for haploid data, M=2N for diploid data) Matrix of M values (M=Nm for haploid data, M=2Nm for diploid data) Exact Test of Sample Differentiation Based on Haplotype Frequencies : List of labels for population samples Global test of differentiation among sample Non-differentiation exact P values (Differentiation test between all pairs of samples) Table of significant differences (level 0.05) 17

18 F ST Podemos pasar los datos (FST y exact test) a un excel para poder mover filas y columnas 1) Copiamos cada matriz en un fichero.txt 2) Desde el excel, abrimos los ficheros F ST Podemos pasar los datos (FST y exact test) a un excel para poder mover filas y columnas 1) Copiamos cada matriz en un fichero.txt 2) Desde el excel, abrimos los ficheros 18

19 F ST Podemos pasar los datos (FST y exact test) a un excel para poder mover filas y columnas 1) Copiamos cada matrix en un fichero.txt 2) Desde el excel, abrimos los ficheros 19

20 FICHERO DE SALIDA =================================================== == GENETIC STRUCTURE ANALYSIS AMOVA ====================================================== FICHERO DE SALIDA =================================================== == GENETIC STRUCTURE ANALYSIS AMOVA ====================================================== Ordenamos los FST: (1-FSC)*(1-FCT) = (1-FST) Variación: en una población: 99.64% FSC(entre poblaciones dentro de grupos)= var = 0.08% P-value = FCT(entre grupos)= var = 0.27% P-value = FST(total)= P-value = p = n.s. p<0.001 p<0.001 Conclusión: las regiones son distintas, y las poblaciones dentro de regiones son homogéneas la población está estructurada 20

21 SPSS-MDS 1) Preparar archivo: hoja de excel con una matriz con los F ST 2) En la diagonal mayor se ponen 0 3) Los nombres de las poblaciones en la 1º fila y en la 1º columna. SPSS-MDS Abrimos el SPSS - Crear una nueva consulta mediante el asistente para bases de datos, y se nos abre una ventana donde le diremos: Excel files siguiente Se nos abre otra ventana que nos permite examinar el ordenador para buscar el archivo que nos interesa mediante: Examinar abrir y Aceptar En la nueva ventana tenemos que pasar la hoja que nos interesa de tablas disponibles a recuperar los campos en este orden, bien sea arrastrándola de izq a derecha ó marcándola y presionando la flecha. A continuación: Siguiente Siguiente Siguiente Finalizar. De esta manera se abre el archivo de datos y empieza a escribirse el de resultados. Normalmente le ponemos: Escala, Numérico, Ancho = 8 y Decimales = 4 21

22 SPSS-MDS - Pinchamos ANALIZAR y luego Escala y Escalamiento multidimensional (ASCAL) - Marcamos todas las variables (poblaciones) y las pasamos. - Pinchamos MODELO: Nivel de medida: intervalo, condicionalidad: matriz, Dimensiones 2x2 y modelo de escalamiento: Distancia euclídea. CONTINUAR - Pinchamos OPCIONES: marcamos para visualizar las 4 y CONTINUAR - ACEPTAR Ahora podemos mirar los resultados: STRESS: (<0 230 bueno, <0 763 muy bueno) R 2 = RSQ correlación alta muy bueno, luego cuanto mayor mejor, por ejemplo ó más. Ahora vemos el gráfico y lo retocamos para la publicación SPSS-MDS 22


24 SPSS-MDS SPSS-PCA 1) Preparar archivo excel con una matriz con las frecuencias de los alelos, HT, HG, 2) 1ª columna = nombre de las poblaciones; restantes: cada alelo 3) Poblaciones en las filas - Copiar la hoja frec, en una nueva hoja, que llamamos SPSS, como valores - Dejar sólo las filas con las siglas de las POB y las de los HG. - Copiar filas de siglas de las POB. Copiar columna con nombre de alelos - Dividir por 100 las frecuencias. Extender - Copiar la matriz y pegarla como valores - Copiar la matriz y pegarla transpuesta con formato de 4 decimales - Copiar las filas de esta matriz en una hoja nueva que llamamos PCA. 24

25 SPSS-PCA Abrimos el SPSS - Crear una nueva consulta mediante el asistente para bases de datos, y se nos abre una ventana donde le diremos: Excel files siguiente Se nos abre otra ventana que nos permite examinar el ordenador para buscar el archivo que nos interesa mediante: Examinar abrir y Aceptar En la nueva ventana tenemos que pasar la hoja que nos interesa de tablas disponibles a recuperar los campos en este orden, bien sea arrastrándola de izq a derecha ó marcándola y presionando la flecha. A continuación: Siguiente Siguiente Siguiente Finalizar. De esta manera se abre el archivo de datos y empieza a escribirse el de resultados. DATOS: Definir las propiedades de las variables: Normalmente le ponemos: Escala, Numérico, Ancho = 8 y Decimales = 4 Comprobar no sobran filas ni columnas SPSS-PCA - Pinchamos ANALIZAR y luego Reducción de dimensiones y factor - Marcamos todas las variables (poblaciones) y las pasamos. - Pinchamos DESCRIPTIVOS: Estadísticos: Solución inicial; Matriz de correlaciones: Coeficientes y Niveles de significación. CONTINUAR. - EXTRACCIÓN: Analizar: Matriz de correlaciones; Visualización: Solución factorial sin rotar y Gráfico de sedimentación. Extraer: Nº fijo de factores =2. CONTINUAR - ROTACIÓN: Varimax CONTINUAR. - PUNTUACIONES: Guardar como variables (Regresión).CONTINUAR - Pinchamos OPCIONES: marcamos Excluir casos según lista y Ordenados por tamaño. CONTINUAR - ACEPTAR 25

26 SPSS-PCA - Pinchamos GRAFICOS y luego Cuadro de diálogos antiguos - Dispersión/Puntos - Pinchamos DISPERSIÓN SIMPLE y luego, DEFINIR. - Marcamos REGR factor score 1 for analysis 1 [FAC1_1] al eje X - Marcamos REGR factor score 2 for analysis 2 [FAC2_1] al eje Y - Marcamos F1 y lo pasamos a Etiquetar los casos mediante. - Pinchamos OPCIONES: marcamos Excluir casos según lista y Mostrar el gráfico con las etiquetas de caso. CONTINUAR - ACEPTAR En el archivo de resultados, pinchar Dispersión de FAC2_1FAC1_1 para ver el gráfico SPSS-PCA - Con el editor de gráficos sustituir el nombre de los componentes por: 1st component (#%) and second component (#%) # se obtienen de Varianza total explicada, Suma de las saturaciones al cuadrado de la rotación Cambiamos con botón derecho y Propiedades a Arial 14, Aplicar y cerrar - Pinchando en los nombres: - Arial 9 - Etiquetas de valor de datos: desmarcamos Suprimir etiquetas superpuestas y Mostrar líneas de conexión con etiqueta Aplicar y cerrar - Pinchamos en el fondo: Relleno blanco, aplicar y cerrar - Pinchamos en la línea del eje X: Formato de numeración: Cifras decimales = 1. APLICAR y cerrar - Pinchamos en la línea del eje Y: Formato de numeración: Cifras decimales = 1. APLICAR y cerrar - En los iconos de la barra, pinchamos en Añadir una línea de referencia al eje X--- Posición = 0; APLICAR y cerrar - En los iconos de la barra, pinchamos en Añadir una línea de referencia al eje Y--- Posición = 0; APLICAR y cerrar - Colorear los puntos - Botón derecho: COPIAR y llevar a un PPT 26

27 SPSS-PCA A veces, no vemos bien con qué punto está asociado cada POB, para ello: - Pasas a papel el gráfico - Abres el SPSS pinchando en el archivo de resultados ó mediante: ARCHIVO- ABRIR-RESULTADOS- ubicación del archivo.spv - En el gráfico, pinchas 2 veces para abrir el editor de gráficos y luego EDITAR-Propiedades; y así puedes modificar el Tamaño del gráfico (Alto 375 y ancho 468,75 que tiene por lo que quieras). Como está marcado Mantener la relación de aspecto, con que modifiques uno de ellos se modifica el otro. SPSS-PCA Ahora vas a Matriz de componentes rotados - la copias como texto (A) en el excel, y lo salvas como componentes.xls - Eliminar todo lo que no te interesa. - En la columna D pon una serie de contaje - Marca en el componente 1 los mayores valores positivos en amarillo y los negativos en azul. - Marca las filas de los HG y ordénalas por C para marcar los valores mayores - Abre una columna en A y marca las filas de los HG y ordénalas por B - Copia del fichero original el nombre de los HG y pégalos en la columna A - Elimina la columna B. - Marca las filas de los HG, ordena por D y elimina la columna D - Ajusta el ancho de las columnas y copia la tabla en el PPT, manteniendo el formato de origen. 27

28 PCA analysis Componente 1 2 HG06=U5b,677,221 HG08=U2,641,215 HG17=J1 -,595,563 HG01=H(CRS) -,563 -,405 HG20,517,296 HG12,453,331 HG09,452 -,093 HG18,429 -,111 HG07,420 -,026 HG24,350 -,015 HG10 -,326,115 HG15,313,031 HG23,188 -,186 HG03=R0/R -,282 -,705 HG19=N1 -,147,663 HG13=T(xT1 2) -,214,536 HG16=J -,481,515 HG14,202,514 HG11 -,027 -,493 HG05,235 -,418 HG02 -,117 -,395 HG21,069 -,374 HG04,045,217 HG22,042,162 OTRAS POSIBILIDADES Datos moleculares No solo podemos usar la frecuencia de los HT ó HG de un marcador haploide. Podemos hacer uso de más información. Por ejemplo: si usamos los HT para comparar las poblaciones podríamos usar la divergencia (medida, por ejemplo, por el número de diferencias) molecular entre ellos, para ponderar las diferencias. ARLEQUIN-Esta información se la damos en [Data], generalmente antes de [[Samples]], y podemos hacerlo de dos maneras: A) Suministrándole los haplotipos como datos binarios (cada RFLP ó cada SNP) ó multiestados (ó cada base, sería una posición), incorporando el apartado [[HaplotypeDefinition]] B) También podemos darle directamente la matriz de diferencias entre los HT, incluyendo en DATA el apartado: [[DistanceMatrix]] 28

29 FICHERO DE DATOS de texto.arp SECCIONES-APARTADOS [Data] [[HaplotypeDefinition]] HaplListName = nombre HaplList = { H1 ATCG H2 ATCA } También podemos escribirlo: [[HaplotypeDefinition]] HaplListName = nombre HaplList = EXTERN hapl_file.hap RESULTADOS: - El nº de loci: posiciones que le hemos puesto. - Mean number of pairwise differences, equivalente a pi - Diferentes Theta, basadas en Homocigosis, nº alelos, nº sitios polimórficos y pi B) También podemos darle directamente la matriz de diferencias entre los HT, [Data] [[DistanceMatrix]] MatrixName="genetic distance between 56 HT" MatrixSize= 56 #LabelPosition=LINE MatrixData=EXTERN "amovadis.dis Otra manera de ponerlo sería: [[DistanceMatrix]] MatrixName = nombre MatrixSize = # MatrixData = { H1 H2 H } nº líneas = nº OTUs, sec.,... identificadores OTUs, sec.,... 29

30 HAPLOSEARCH Tenemos que crear un archivo con el siguiente formato: START: 065^p >CRS^p GACTCACCCATCAACAACCGCTATGTATTTCGTACATTACTGCCAGCC ACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACAT AAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAGT ACAGCAATCAACCCTCAACTATCACACATCAACTGCAACTCCAAAGCC ACCCCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAGTA CATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCC CTTCTCGTCCCCATGG^p >SEQ5^p 093^p >SEQ6^p 094^p Esto lo hacemos a partir del excel: HAPLOSEARCH A) Nosotros hemos analizado entre las posiciones y 16370, por lo que en la primera línea tenemos que poner START: 065 B) Ahora preparamos la sec. del CRS, para ello abrimos el archivo RE_rCRS.txt y seleccionamos de la posición a la Cuando ya lo tenemos sin espacios, sin marcas de párrafo y en mayúsculas, lo añadimos a la segunda fila como >CRS^pSecuencia en mayúsculas^p C) Ahora en las restantes filas escribimos >HT#^p motivo HT ^p. - Para ello abrimos el excel, copiamos los HT y los pegamos en un Bloc de notas. Lo salvamos Ej: HT135.txt - Lo abrimos con WORD y sustituimos H por >H - reemplazamos 2 espacios por uno (tantas veces como necesario) - reemplazamos ^t por ^p - reemplazamos espacio^p por ^p - revisamos que no queden espacios al final de las posiciones de los HT, - lo salvamos como.txt (texto sin formato) 30

31 HAPLOSEARCH D) lo corremos en el programa Procesar, examinar (Buscar el archivo y Abrir), obtener secuencia (get sequence), Genét, de poblaciones (populations genetics), procesar. - Esperar---abrir con WORDPAD, aceptar, Guardar como matriz.txt E) preparar la matriz para el arlequín, cuyo formato es:: [Data] [[HaplotypeDefinition]] HaplListName="U3" HaplList={ H01.. TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTCTTTTTTTTTTTTAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA^p H02.. } [Data] FICHERO DE DATOS de texto.arp SECCIONES-APARTADOS [[HaplotypeDefinition]] HaplListName = nombre HaplList = { H1 ATCG H2 ATCA } También podemos escribirlo: [[HaplotypeDefinition]] HaplListName = nombre HaplList = EXTERN hapl_file.hap 31

32 Pasos: FICHERO DE DATOS de texto.arp Abrimos matriz.txt con el WORD Quitamos la 1ª fila y la sec. del CRS reemplazamos ^p por 2 espacios^p reemplazamos 2 espacios^p> por $ reemplazamos 2 espacios^p por 2 espacios reemplazamos $ por ^p Si es necesario se abre con el bloc de notas para comprobar Copiamos el archivo amovahg27_alu.arp como amovaht135.arp Ahora introducimos en DATA de amova_ht135.arp el contenido del fichero matriz.txt En DataType ponemos DNA y añadimos: LocusSeparator=none CompDistMatrix=1 Si está bien se te activaran los Molecular diversity indices NOTA: También existe la posibilidad de usar un archivo externo, ver los modelos del arlequín Ahora tenemos que darle las frecuencias de cada HT en cada población Ahora tenemos que darle las frecuencias de cada HT en cada población Ahora existe la posibilidad de calcular los FST basados sólo en las frecuencias o pedirle que nos compute distance matriz usando pairwise differences También le podemos pedir: - que nos imprima la matriz de distancia entre los HT - los índices moleculares de diversidad: Theta RESULTADOS: El nº de loci: posiciones que le hemos puesto Mean number of pairwise differences, equivalente a pi, y te da las diferentes Theta, basadas en Homocigosis, nº alelos, nº sitios polimórficos y pi 32

33 Resultados en Matriz de componentes rotados Componente Error en % componentes: 1º<2º 1 2 HG17 =J1 -,840,046 HG13=T -,577,069 HG16= -,570 -,251 HG19= -,531 -,290 HG05=U5a,519 -,365 HG09=U3,505 -,241 HG18=,497,105 HG02,434 -,264 HG01 -,388 -,136 HG24,369,277 HG20,360,058 HG21,313,215 HG07,312,288 HG04 -,297,028 HG23,296 -,032 HG15,170,003 HG12=K -,055,779 HG14=T1 -,046,666 HG11=others U,338 -,620 HG03=RO/R -,090 -,604 HG08,305,574 HG10,040 -,537 HG06,301,310 HG22,009,068 33


TALLER COMPUTACIÓN II Prof. Martín Ferreyra TALLER COMPUTACIÓN II MANEJO AVANZADO DE MS WORD COMBINAR CORRESPONDENCIA Combinar Correspondencia Instituto Secundario John Kennedy Unidad 2. Combinar correspondencia (I) Mediante

Más detalles

Para comenzar, abra el programa Inmediatamente aparecerá una ventana llamada editor de datos que tiene la siguiente forma:

Para comenzar, abra el programa Inmediatamente aparecerá una ventana llamada editor de datos que tiene la siguiente forma: 1. Descripción Generales del Paquete Estadístico SPSS. SPSS es un paquete estadístico orientado -en principio- al ámbito de aplicación de las Ciencias Sociales y que lleva en el mercado alrededor de 25

Más detalles

Instalación del programa PSPP y obtención de una distribución de frecuencias.

Instalación del programa PSPP y obtención de una distribución de frecuencias. Práctica 2. Instalación del programa PSPP y obtención de una distribución de frecuencias. Con esta práctica instalaremos el programa PSPP. El programa es un software específico para el análisis estadístico

Más detalles

Capítulo 6. Modificar archivos de datos. Ordenar casos

Capítulo 6. Modificar archivos de datos. Ordenar casos Capítulo 6 Modificar archivos de datos Los archivos de datos no siempre están organizados de forma idónea. En ocasiones podemos desear cambiar el orden de los casos, o transponer las filas y las columnas,

Más detalles

Combinar correspondencia (I)

Combinar correspondencia (I) Combinar correspondencia (I) Mediante la opción Combinar correspondencia Word2007 nos permite incluir en un documento, datos almacenados en otro sitio. De esta forma podremos obtener copias de un mismo

Más detalles

Qué es una base de datos?

Qué es una base de datos? Qué es una base de datos? Una base de datos es un conjunto de datos organizados en filas y columnas. Access 2010 es una base de datos relacional, con lo que aún estando los datos guardados en tablas diferentes

Más detalles


Jornadas de INCLUSION DIGITAL. a través de las TIC ORGANIZAN: CAPACITA: CLAEH Jornadas de INCLUSION DIGITAL a través de las TIC ORGANIZAN: CAPACITA: CLAEH Con Google Docs puedes crear, compartir y editar documentos online con facilidad. A continuación te indicamos algunas acciones

Más detalles

Combinar correspondencia

Combinar correspondencia Combinar correspondencia Mediante la opción Combinar correspondencia Word2010 nos permite incluir en un documento, datos almacenados en otro sitio. De esta forma podremos obtener copias de un mismo documento

Más detalles


TÉCNICAS DE GESTIÓN ADMINISTRATIVA PARA PEQUEÑAS EMPRESAS COMBINAR CORRESPONDENCIA CON OFFICE 2003 Combinar correspondencia nos permite incluir en un documento datos almacenados en otro lugar. De esta forma podremos obtener copias de un mismo documento pero con

Más detalles

Operación de Microsoft Word

Operación de Microsoft Word Generalidades y conceptos Combinar correspondencia Word, a través de la herramienta combinar correspondencia, permite combinar un documento el que puede ser una carta con el texto que se pretende hacer

Más detalles

2_trabajar con calc I

2_trabajar con calc I Al igual que en las Tablas vistas en el procesador de texto, la interseccción de una columna y una fila se denomina Celda. Dentro de una celda, podemos encontrar diferentes tipos de datos: textos, números,

Más detalles

2. Seleccionar Insertar función:

2. Seleccionar Insertar función: Estadística I Curso 2014/2015 Guión de la Práctica 1 Introducción a la Estadística con Excel; Estadística Descriptiva En el siguiente guión vamos a ver cómo realizar Estadística Descriptiva con el software

Más detalles

bla bla Documentos Guía del usuario

bla bla Documentos Guía del usuario bla bla Documentos Guía del usuario Documentos Documentos: Guía del usuario fecha de publicación Miércoles, 25. Febrero 2015 Version 7.6.2 Copyright 2006-2015 OPEN-XCHANGE Inc., La propiedad intelectual

Más detalles

vbnmqwertyuiopasdfghjklzxcvbnmrty uiopasdfghjklzxcvbnmqwertyuiopasdf ghjklzxcvbnmqwertyuiopasdfghjklzxc

vbnmqwertyuiopasdfghjklzxcvbnmrty uiopasdfghjklzxcvbnmqwertyuiopasdf ghjklzxcvbnmqwertyuiopasdfghjklzxc vbnmqwertyuiopasdfghjklzxcvbnmrty uiopasdfghjklzxcvbnmqwertyuiopasdf ghjklzxcvbnmqwertyuiopasdfghjklzxc COMBINACIÓN DE CARTAS Y CORRSPONDENCIA vbnmqwertyuiopasdfghjklzxcvbnmqw ertyuiopasdfghjklzxcvbnmqwertyuiop

Más detalles

Apuntes de ACCESS. Apuntes de Access. Campos de Búsqueda:

Apuntes de ACCESS. Apuntes de Access. Campos de Búsqueda: Apuntes de ACCESS Campos de Búsqueda: Los campos de búsqueda permiten seleccionar el valor de un campo de una lista desplegable en lugar de tener que escribirlos. El usuario sólo tiene que elegir un valor

Más detalles

Para iniciar Excel es posible realizarlo de varias maneras, una de ellas es: Desde el menú Inicio.

Para iniciar Excel es posible realizarlo de varias maneras, una de ellas es: Desde el menú Inicio. Alexander Siniscalchi Agosto 2005 Introducción Este documento está adaptado al curso de Excel que se dicta a estudiantes que se inician con poco o ningún conocimiento de las herramientas de hojas de cálculos,

Más detalles

BASES DE DATOS - Microsoft ACCESS 2007-

BASES DE DATOS - Microsoft ACCESS 2007- BASES DE DATOS - Microsoft ACCESS 2007- Una base de datos es un archivo estructurado de datos que nos permite almacenarlos, modificarlos, ordenarlos, generar informes etc., de manera rápida. Un listín

Más detalles

LAS CONSULTAS ACCESS 2007. Manual de Referencia para usuarios. Salomón Ccance CCANCE WEBSITE

LAS CONSULTAS ACCESS 2007. Manual de Referencia para usuarios. Salomón Ccance CCANCE WEBSITE LAS CONSULTAS ACCESS 2007 Manual de Referencia para usuarios Salomón Ccance CCANCE WEBSITE LAS CONSULTAS En esta unidad veremos cómo crear consultas y manejarlas para la edición de registros de tablas

Más detalles

Capítulo 8. Editar tablas de resultados

Capítulo 8. Editar tablas de resultados Capítulo 8 Editar tablas de resultados Los objetos del Visor de resultados adoptan, según sabemos ya, tres tipos de formato: texto, tablas y gráficos. Pero la mayor parte de los objetos adoptan formato

Más detalles

TEMA 5: HOJAS DE CÁLCULO. Edición de hojas de cálculo con OpenOffice Calc

TEMA 5: HOJAS DE CÁLCULO. Edición de hojas de cálculo con OpenOffice Calc TEMA 5: HOJAS DE CÁLCULO Edición de hojas de cálculo con OpenOffice Calc Qué vamos a ver? Qué es una hoja de cálculo y para qué sirve El entorno de trabajo de OpenOffice Calc Edición básica de hojas de

Más detalles

Gobierno del Estado de México

Gobierno del Estado de México Gobierno del Estado de México Escuela Preparatoria Oficial No. 82 José Revueltas Hay que alcanzar la exaltación verdadera, para lograrlo, hay que ser serenos, sin prisas, estudiar, trabajar y disciplinarse

Más detalles

El programa Minitab: breve introducción a su funcionamiento. Para mostrar la facilidad con la que se pueden realizar los gráficos y cálculos

El programa Minitab: breve introducción a su funcionamiento. Para mostrar la facilidad con la que se pueden realizar los gráficos y cálculos El programa Minitab: breve introducción a su funcionamiento Para mostrar la facilidad con la que se pueden realizar los gráficos y cálculos estadísticos en la actualidad, el libro se acompaña, en todo

Más detalles



Más detalles



Más detalles



Más detalles

Curso Excel 2010 Rangos y tablas Teoría 3. Rangos y tablas... 1. Contenido... 1. Operaciones con rangos... 2. Copia de un rango...

Curso Excel 2010 Rangos y tablas Teoría 3. Rangos y tablas... 1. Contenido... 1. Operaciones con rangos... 2. Copia de un rango... RANGOS Y TABLAS Los rangos y tablas en Excel son la base de los tipos de libros más usados, como listados, bases de datos, resúmenes estadísticos, etc. En las últimas versiones se ha ido dando cada vez

Más detalles

La ventana de Microsoft Excel

La ventana de Microsoft Excel Actividad N 1 Conceptos básicos de Planilla de Cálculo La ventana del Microsoft Excel y sus partes. Movimiento del cursor. Tipos de datos. Metodología de trabajo con planillas. La ventana de Microsoft

Más detalles

Tabla dinámica. Vamos a crear una tabla dinámica a partir de un conjunto de datos.

Tabla dinámica. Vamos a crear una tabla dinámica a partir de un conjunto de datos. Tabla dinámica Una tabla dinámica consiste en el resumen de un conjunto de datos, atendiendo a uno o varios criterios de agrupación, representado como una tabla de doble entrada que nos facilita la interpretación

Más detalles Página 1 Página 1 Capítulo 1. CREACIÓN DE BBDD Y VALIDACIÓN DE DATOS... 4 1.1. Crear una BBDD... 4 1.2. Formulario de entrada de datos... 5 1.3. Importación de datos... 7 1.4. Ordenación de registros... 10 1.5. Autofiltros...

Más detalles

El Explorador es una de las aplicaciones más importantes con que cuenta

El Explorador es una de las aplicaciones más importantes con que cuenta El Explorador de Windows Características del Explorador de Windows Windows. El Explorador es una de las aplicaciones más importantes con que cuenta A través del Explorador se pueden realizar muchas tareas

Más detalles

CONCEPTOS BASICOS. Febrero 2003 Página - 1/10

CONCEPTOS BASICOS. Febrero 2003 Página - 1/10 CONCEPTOS BASICOS Febrero 2003 Página - 1/10 EL ESCRITORIO DE WINDOWS Se conoce como escritorio la zona habitual de trabajo con windows, cuando iniciamos windows entramos directamente dentro del escritorio,

Más detalles

Centro de Profesorado Luisa Revuelta (Córdoba) TEMA 6 TABLAS Y GRÁFICOS EN IMPRESS

Centro de Profesorado Luisa Revuelta (Córdoba) TEMA 6 TABLAS Y GRÁFICOS EN IMPRESS Centro de Profesorado Luisa Revuelta (Córdoba) TEMA 6 TABLAS Y GRÁFICOS EN IMPRESS Antes que nada tenemos que hablar de la distinción entre tabla y hoja de cálculo. Una tabla es una estructura formada

Más detalles


CLASE 12.-INSERTAR COLUMNAS CLASE 10.-DIBUJAR TABLA Para Dibujar una Tabla primero llenamos los datos que queremos seleccionamos los datos que queremos dibujar la tabla. Luego nos vamos a la barra de herramientas en fuente y realizamos

Más detalles

Elaborando WebQuest usando Power Point

Elaborando WebQuest usando Power Point Módulo WebQuest Elaborando WebQuest usando Power Point 2.1.- Creación de WebQuest usando el Miscrosoft Power Point En el Power Point le colocamos un Estilo a nuestra Diapositiva para iniciar nuestra Creación

Más detalles


CALCULAR NOTAS CON EXCEL CALCULAR NOTAS CON EXCEL Este documento pretende ser una iniciación sencilla a Excel. Empezaremos indicando cómo se abre un libro Excel. A continuación debemos pensar cómo queremos organizar nuestra información

Más detalles

Winplot DIBUJAR LA GRÁFICA DE UNA FUNCIÓN. Ventana > 2-dim: aparece la ventana sinnombre1.wp2. Ecua > Explícita: aparece la ventana de edición y=f(x).

Winplot DIBUJAR LA GRÁFICA DE UNA FUNCIÓN. Ventana > 2-dim: aparece la ventana sinnombre1.wp2. Ecua > Explícita: aparece la ventana de edición y=f(x). 1 DIBUJAR LA GRÁFICA DE UNA FUNCIÓN Winplot Ventana > 2-dim: aparece la ventana sinnombre1.wp2. Ecua > Explícita: aparece la ventana de edición y=f(x). En el recuadro f(x)= se escribe la expresión de la

Más detalles

1 Introducción al SPSS

1 Introducción al SPSS Breve guión para las prácticas con SPSS 1 Introducción al SPSS El programa SPSS está organizado en dos bloques: el editor de datos y el visor de resultados. En la barra de menú (arriba de la pantalla)

Más detalles


TEMA 2 WINDOWS XP Lección 4 BLOC DE NOTAS TEMA 2 WINDOWS XP Lección 4 BLOC DE NOTAS 1) EL PEQUEÑO EDITOR El Bloc de notas de Windows XP es un básico editor de texto con el que podemos escribir anotaciones, de hasta 1024 caracteres por línea y

Más detalles

Word XP (Continuación) Salto de página vs. Salto de Sección

Word XP (Continuación) Salto de página vs. Salto de Sección Word XP (Continuación) Salto de página vs. Salto de Sección 1 Salto. Salto de página Cuando se llena una página con texto o gráficos, Microsoft Word inserta un salto de página automático y comienza una

Más detalles

Unidad 1: El Cuadro de control de Excel

Unidad 1: El Cuadro de control de Excel Unidad 1: El Cuadro de control de Excel 1,0 Introducción Excel nos ayuda a comprender los datos mejor al disponerlos en celdas (que forman filas y columnas) y usando fórmulas para realizar los cálculos

Más detalles

Database Manager Manual del usuario DMAN-ES-01/09/10

Database Manager Manual del usuario DMAN-ES-01/09/10 Database Manager Manual del usuario DMAN-ES-01/09/10 La información que contiene este manual no tiene carácter contractual y puede estar sujeta a cambios sin previo aviso. La aplicación a la que se hace

Más detalles

Calle La Lila 33002 OVIEDO Tel. 984 083 400 Fax 984 083 401. Curso Ofimática Básica: Microsoft Excel 1

Calle La Lila 33002 OVIEDO Tel. 984 083 400 Fax 984 083 401. Curso Ofimática Básica: Microsoft Excel 1 Curso Ofimática Básica: Microsoft Excel Microsoft Excel 1 INDICE I.- Introducción Qué es? Características II.- Operaciones Básicas Celdas Copiar Mover Formato de celdas Insertar Comentarios Formato condicional

Más detalles

Tablas dinámicas. Tablas dinámicas

Tablas dinámicas. Tablas dinámicas Tablas dinámicas Con las tablas dinámicas se pueden procesar de manera rápida grandes cantidades de datos. Desde deporwin se puede trabajar con los datos de los listados, en forma de tabla dinámica. Así,

Más detalles

Curso de Word. Objetivo del curso

Curso de Word. Objetivo del curso Formación Curso de Word Objetivo del curso Aprenderás a utilizar este procesador de textos del paquete Office de Microsoft Windows. Este curso te permitirá integrarlo con otras herramientas, como Outlook

Más detalles

Base de datos OpenOffice 2.0. 2ª parte. por Pedro Peregrín González 18002693 CEIP San Juan de Dios Granada -España-

Base de datos OpenOffice 2.0. 2ª parte. por Pedro Peregrín González 18002693 CEIP San Juan de Dios Granada -España- Base de datos OpenOffice 2.0 2ª parte por Pedro Peregrín González 18002693 CEIP San Juan de Dios Granada -España- En la primera parte creamos una base de datos y un formulario. En esta segunda parte vamos

Más detalles

Análisis estadístico con Microsoft Excel

Análisis estadístico con Microsoft Excel Análisis estadístico con Microsoft Excel Microsoft Excel ofrece un conjunto de herramientas para el análisis de los datos (denominado Herramientas para análisis) con el que podrá ahorrar pasos en el desarrollo

Más detalles


SESIÓN 6 INTRODUCCIÓN A WORD. SESIÓN 6 INTRODUCCIÓN A WORD. I. CONTENIDOS: 1. La pantalla de Word. 2. Partes de la pantalla de Word. 3. Funcionamiento de los menús. 4. Distintas formas de ver un documento. 5. Trabajar con varios documentos

Más detalles

La Administración de Proyectos

La Administración de Proyectos La Administración de Proyectos La administración de proyectos es el proceso de planear, organizar y administrar tareas y recursos para alcanzar un objetivo concreto, generalmente con delimitaciones de

Más detalles

Estadística con Excel Informática 4º ESO ESTADÍSTICA CON EXCEL

Estadística con Excel Informática 4º ESO ESTADÍSTICA CON EXCEL 1. Introducción ESTADÍSTICA CO EXCEL La estadística es la rama de las matemáticas que se dedica al análisis e interpretación de series de datos, generando unos resultados que se utilizan básicamente en

Más detalles

Tekla Structures Guía de Componentes Personalizados. Versión del producto 21.1 agosto 2015. 2015 Tekla Corporation

Tekla Structures Guía de Componentes Personalizados. Versión del producto 21.1 agosto 2015. 2015 Tekla Corporation Tekla Structures Guía de Componentes Personalizados Versión del producto 21.1 agosto 2015 2015 Tekla Corporation Contenido 1 Qué es un componente personalizado... 5 2 Crear componentes personalizados...

Más detalles

Microsoft Access proporciona dos métodos para crear una Base de datos.

Microsoft Access proporciona dos métodos para crear una Base de datos. Operaciones básicas con Base de datos Crear una Base de datos Microsoft Access proporciona dos métodos para crear una Base de datos. Se puede crear una base de datos en blanco y agregarle más tarde las

Más detalles

Indicaciones específicas para los análisis estadísticos.

Indicaciones específicas para los análisis estadísticos. Tutorial básico de PSPP: Vídeo 1: Describe la interfaz del programa, explicando en qué consiste la vista de datos y la vista de variables. Vídeo 2: Muestra cómo crear una base de datos, comenzando por

Más detalles

Indice. Marketing-CRM Clientes. Fórmulas y Otros Elementos...8 H Herramientas de Edición... 18. B Borrado de Cubo... 12 C

Indice. Marketing-CRM Clientes. Fórmulas y Otros Elementos...8 H Herramientas de Edición... 18. B Borrado de Cubo... 12 C M a n u a l Cubo Indice B Borrado de Cubo... 12 C Cálculo de Cubo... 12 Cálculo e Impresión...6 Cálculo de Nivel...6 Consideraciones Generales...5 D Descripción de Campos...5 Definición de Parámetros...

Más detalles

Instalación del programa PSPP y obtención de una distribución de frecuencias.

Instalación del programa PSPP y obtención de una distribución de frecuencias. Práctica 2. Instalación del programa PSPP y obtención de una distribución de frecuencias. Con esta práctica instalaremos el programa PSPP. El programa es un software específico para el análisis estadístico

Más detalles

... Formas alternativas de escribir un texto. Columnas. anfora CAPÍTULO 4

... Formas alternativas de escribir un texto. Columnas. anfora CAPÍTULO 4 CAPÍTULO 4. Formas alternativas de escribir un texto........ Columnas Para fijar columnas se posiciona el Punto de Inserción donde se desee que comiencen las columnas, o bien se selecciona el texto que

Más detalles


COMBINAR CORRESPONDENCIA EN MICROSOFT WORD COMBINAR CORRESPONDENCIA EN MICROSOFT WORD Combinar documentos consiste en unir dos documentos diferentes sin que se modifiquen los datos que aparecen en ellos. Esta operación es muy útil y muy frecuente

Más detalles


TEMA 7 ANÁLISIS DE DATOS: INTRODUCCIÓN AL SPSS TEMA 7 ANÁLISIS DE DATOS: INTRODUCCIÓN AL SPSS 1. Introducción 2. Definición de variables 3. Introducción de los datos 4. Análisis de los datos 5. Otras utilidades 1. INTRODUCCIÓN El SPSS es un paquete

Más detalles

Microsoft Excel 97 y 2000

Microsoft Excel 97 y 2000 Microsoft Excel 97 y 2000 Trucos para la hoja de cálculo de Office Formato a texto y datos 1 Cambio del tamaño y el tipo de letra por defecto Por defecto, Excel siempre sacará el mismo tipo de letra y

Más detalles

Para aquellos que tengan conocimientos de Access es lo más parecido a una consulta de referencias cruzadas, pero con más interactividad.

Para aquellos que tengan conocimientos de Access es lo más parecido a una consulta de referencias cruzadas, pero con más interactividad. Las tablas dinámicas Crear una tabla dinámica Una tabla dinámica consiste en el resumen de un conjunto de datos, atendiendo a varios criterios de agrupación, representado como una tabla de doble entrada

Más detalles

Excel 2010 Edición de la Información

Excel 2010 Edición de la Información Excel 2010 Edición de la Información Contenido CONTENIDO... 1 TIPOS DE ENTRADA DE DATOS... 2 RANGO DE CELDAS... 3 RANGOS EN EXCEL WEB APP... 9 EDITAR EL CONTENIDO DE UNA CELDA... 10 MOVER Y COPIAR INFORMACIÓN...

Más detalles

Curso Combinado de Predicción y Simulación Edición 2004

Curso Combinado de Predicción y Simulación Edición 2004 Curso Combinado de Predicción y Simulación Edición 2004 UNIDAD 2: TÉCNICAS ELEMENTALES DE PREDICCIÓN LECTURAS ADICIONALES 3.- Tratamiento de la información en Excel. Algunas de las

Más detalles

INSTITUTO POLITÉCNICO NACIONAL ESCUELA SUPERIOR DE MEDICINA Academia de Informática Médica Laboratorio de Informática Médica Access 2

INSTITUTO POLITÉCNICO NACIONAL ESCUELA SUPERIOR DE MEDICINA Academia de Informática Médica Laboratorio de Informática Médica Access 2 Relaciones entre tablas INSTITUTO POLITÉCNICO NACIONAL ESCUELA SUPERIOR DE MEDICINA Academia de Informática Médica Laboratorio de Informática Médica Access 2 Usando relaciones entre objetos, se evita la

Más detalles

La pestaña Inicio contiene las operaciones más comunes sobre copiar, cortar y pegar, además de las operaciones de Fuente, Párrafo, Estilo y Edición.

La pestaña Inicio contiene las operaciones más comunes sobre copiar, cortar y pegar, además de las operaciones de Fuente, Párrafo, Estilo y Edición. Microsoft Word Microsoft Word es actualmente (2009) el procesador de textos líder en el mundo gracias a sus 500 millones de usuarios y sus 25 años de edad. Pero hoy en día, otras soluciones basadas en

Más detalles

Paint es una herramienta de diseño de dibujos los cuales son almacenados como mapa de bits (archivos de imágenes tipo *.bmp).

Paint es una herramienta de diseño de dibujos los cuales son almacenados como mapa de bits (archivos de imágenes tipo *.bmp). Aplicación Paint Generalidades Paint es una herramienta de diseño de dibujos los cuales son almacenados como mapa de bits (archivos de imágenes tipo *.bmp). Para ejecutar la aplicación Paint se debe seleccionar

Más detalles

Práctica 5. Contrastes paramétricos en una población

Práctica 5. Contrastes paramétricos en una población Práctica 5. Contrastes paramétricos en una población 1. Contrastes sobre la media El contraste de hipótesis sobre una media sirve para tomar decisiones acerca del verdadero valor poblacional de la media

Más detalles

Microsoft Power Point es un programa que sirve para crear presentaciones que podrán ser vistas en pantalla o impresas.

Microsoft Power Point es un programa que sirve para crear presentaciones que podrán ser vistas en pantalla o impresas. INTRODUCCION. Microsoft Power Point es un programa que sirve para crear presentaciones que podrán ser vistas en pantalla o impresas. Algunas de las características de Power Point son que a las diapositivas

Más detalles

Creando el balance de mí presupuesto familiar.

Creando el balance de mí presupuesto familiar. Creando el balance de mí presupuesto familiar. Microsoft Excel Xp es la planilla de cálculo mas utilizada hoy en día, forma parte de la Suite de Microsoft Office Xp. Una diferencia con cualquier programa,

Más detalles

1.- MENU DE CONTROL O MENU VENTANA: permite cerrar la ventana cambiarla de tamaño y pasar a otra ventana

1.- MENU DE CONTROL O MENU VENTANA: permite cerrar la ventana cambiarla de tamaño y pasar a otra ventana EXCEL PRÓLOGO Microsoft Excel es una hoja de cálculo de gran capacidad y fácil uso. Excel no solo es una hoja de calculo, sino también tiene capacidad para diseñar bases de datos (listas) de forma totalmente

Más detalles

Título: Manual Básico de Calc. Parte I: Introducción a Calc de

Título: Manual Básico de Calc. Parte I: Introducción a Calc de Título: Manual Básico de Calc. Parte I: Introducción a Calc de Autora: Mª del Pilar Pavón Rosano DNI: 52.923.715-W INTRODUCCIÓN Este manual está dirigido a los alumnos y alumnas del módulo

Más detalles

Tutorial de Dreamweaver MX 2004

Tutorial de Dreamweaver MX 2004 1 Tutorial de Dreamweaver MX 2004 Dreamweaver MX 2004 es una aplicación para el diseño de espacios web que incorpora múltiples posibilidades de edición. 1. Configurar un sitio local El método más común

Más detalles

Formato condicional... 3. Herramientas para el manejo de datos... 4. Tablas (Listas)... 4. Subtotales... 6. Filtros Avanzados... 7

Formato condicional... 3. Herramientas para el manejo de datos... 4. Tablas (Listas)... 4. Subtotales... 6. Filtros Avanzados... 7 Contenido Formato condicional... 3 Herramientas para el manejo de datos... 4 Tablas (Listas)... 4 Subtotales... 6 Filtros Avanzados... 7 Validación de datos... 9 Consolidar datos... 12 Análisis Y si...

Más detalles

Ministerio de Educación. Base de datos en la Enseñanza. Open Office. Módulo 3: Edición de formularios

Ministerio de Educación. Base de datos en la Enseñanza. Open Office. Módulo 3: Edición de formularios Ministerio de Educación Base de datos en la Enseñanza. Open Office Módulo 3: Edición de formularios Instituto de Tecnologías Educativas 2011 Edición de formularios Una vez creado el formulario nos pueden

Más detalles

Nos dirigimos a la siguiente página web.

Nos dirigimos a la siguiente página web. 1. INTRODUCCIÓN A OPENOFFICE IMPRESS 1.1. INTRODUCCIÓN es una suite ofimática de software libre y código abierto de distribución gratuita. Está disponible para muchas plataformas: como Microsoft

Más detalles


Clase Nº 9 OPERADOR PC. P á g i n a 1 HOJA DE CALCULO MICROSOFT EXCEL P á g i n a 1 Clase Nº 9 HOJA DE CALCULO MICROSOFT EXCEL Para acceder a este programa se debe hacer clic en el botón INICIO, luego en PROGRAMAS, luego en MICROSOFT OFFICE y finalmente en MICROSOFT EXCEL.

Más detalles

Microsoft Office XP PowerPoint XP

Microsoft Office XP PowerPoint XP PRÁCTICA 9 DISEÑO DE PRESENTACIONES Microsoft Office XP PowerPoint XP 1. Introducción a PowerPoint XP. Entrar en Windows 98 (ver práctica 1), y en el PowerPoint abriendo el icono Microsoft Office del escritorio

Más detalles

Compartir carpetas en XP

Compartir carpetas en XP Introducción Explicación Paso 1 Paso 2 Paso 3 Paso 4 Paso 5 Paso 6 Paso 7 Paso 8 Paso 9 Paso 10 Materiales: Sistema Operativo Windows XP Tiempo: 2 minutos Dificultad: Media Descripción. Proceso que permite

Más detalles

Arsys Backup Online Manual de Usuario

Arsys Backup Online Manual de Usuario Arsys Backup Online Manual de Usuario 1 Contenido 1. Instalación del Programa Cliente... 3 Pasos previos... 3 Instalación... 3 Configuración del acceso... 6 Ubicación del servidor de seguridad... 6 Datos

Más detalles


CASO PRÁCTICO HERRAMIENTAS DE BASES DE DATOS EN EXCEL CASO PRÁCTICO HERRAMIENTAS DE BASES DE DATOS EN EXCEL Nuestra empresa es una pequeña editorial que maneja habitualmente su lista de ventas en una hoja de cálculo y desea poder realizar un análisis de sus

Más detalles

Capítulo 9. Archivos de sintaxis

Capítulo 9. Archivos de sintaxis Capítulo 9 Archivos de sintaxis El SPSS permite generar y editar archivos de texto con sintaxis SPSS, es decir, archivos de texto con instrucciones de programación en un lenguaje propio del SPSS. Esta

Más detalles

Wikis Trabajando en una Wiki


Más detalles


100 EJERCICIOS DE MICROSOFT WORD 100 EJERCICIOS DE MICROSOFT WORD 1. COMO SE ACTIVAN Y SE DESACTIVAN LAS BARRAS DE HERRAMIENTAS Clic derecho en la Barra de Menú Clic en el nombre de la barra que desee activar o desactivar. Clic en el

Más detalles

H O T E L W I N Configuración del motor de Reservas on line

H O T E L W I N Configuración del motor de Reservas on line H O T E L W I N Configuración del motor de Reservas on line Introducción Dado el enorme desarrollo de Internet en los últimos años y al sin fin de oportunidades que Internet brinda tanto a clientes como

Más detalles


TEMA 2 WINDOWS XP Lección 3 PROGRAMA WORDPAD TEMA 2 WINDOWS XP Lección 3 PROGRAMA WORDPAD 1) TRATAMIENTO DE TEXTOS Uno de los programas accesorios más útiles entre los que vienen con Windows XP es WordPad: un tratamiento de textos pequeño, pero potente,

Más detalles

Manual de Usuario Announcer Pro 4.14

Manual de Usuario Announcer Pro 4.14 Manual de Usuario Announcer Pro 4.14 Presencia Web SA de CV Todos los derechos reservados Esta guía no puede ser reproducido ni distribuida en su totalidad ni en parte, en cualquier forma o

Más detalles

Open-Xchange Server. Guía Rápida

Open-Xchange Server. Guía Rápida Open-Xchange Server Guía Rápida Open-Xchange Server Open-Xchange Server: Guía Rápida publicado Friday, 28. January 2011 Version 6.18.2 Copyright 2006-2011 OPEN-XCHANGE Inc., Este documento es propiedad

Más detalles

Tutorial de Introducción a la Informática Tema 0 Windows. Windows. 1. Objetivos

Tutorial de Introducción a la Informática Tema 0 Windows. Windows. 1. Objetivos 1. Objetivos Este tema de introducción es el primero que debe seguir un alumno para asegurar que conoce los principios básicos de informática, como el manejo elemental del ratón y el teclado para gestionar

Más detalles


ESCUELA SUPERIOR DE INFORMATICA Prácticas de Estadística UNA SESIÓN EN SPSS UNA SESIÓN EN SPSS INTRODUCCIÓN. SPSS (Statistical Product and Service Solutions) es un paquete estadístico orientado, en principio, al ámbito de aplicación de las Ciencias sociales, es uno de las herramientas

Más detalles



Más detalles



Más detalles

1. El botón de Inicio lo podemos encontrar en: a) La barra de herramientas b) La barra de tareas c) La barra de estado

1. El botón de Inicio lo podemos encontrar en: a) La barra de herramientas b) La barra de tareas c) La barra de estado Test Nº1 1. El botón de Inicio lo podemos encontrar en: a) La barra de herramientas b) La barra de tareas c) La barra de estado 2. De los iconos que podemos encontrar en el escritorio, cual de estos no

Más detalles

ÍNDICE WORD 2007. 2da. Parte

ÍNDICE WORD 2007. 2da. Parte ÍNDICE WORD 2007 2da. Parte PÁG. 02 05 08 12 13 15 16 17 18 19 20 22 25 TEMAS 27- Tabla de Ilustraciones 28- Índice 29- Tablas 30- Viñetas 31- Numeraciones 32- Esquemas. Esquemas numerados 33- Secciones.

Más detalles

NORMA 34.14(SEPA) 05/11/2013

NORMA 34.14(SEPA) 05/11/2013 NORMA 34.14(SEPA) 05/11/2013 1. Descripción La aplicación de generación de ficheros de transferencias permite generar fácilmente órdenes para que se efectúe el pago de transferencias a los beneficiarios

Más detalles


MICROSOFT OFFICE: EXCEL (35 HORAS) MICROSOFT OFFICE: EXCEL (35 HORAS) Introducción. (2 horas: 1,30 teoría y 0,30 práctica) 1. Introducción 1.1. Abrir Excel 1.2. Cerrar Excel 2. Entorno de Trabajo 2.1. Partes de la Ventana de Excel 2.2.

Más detalles

Tècnic Auxiliar en Disseny Industrial - Manual Autocad 2011. Atributos. Un atributo es un objeto que se crea e incluye con una definición de bloque.

Tècnic Auxiliar en Disseny Industrial - Manual Autocad 2011. Atributos. Un atributo es un objeto que se crea e incluye con una definición de bloque. ATRIBUTOS Un atributo es un objeto que se crea e incluye con una definición de bloque. Los atributos pueden almacenar datos como números de serie, nombres de productos, etc. Ejemplos de algunas aplicaciones

Más detalles

2_dar formato al texto / documentos I

2_dar formato al texto / documentos I Es posible ejecutar el comando tantas veces como copias se desee hacer, ya que tras pegar el texto, una copia del mismo sigue en el Portapapeles. Se dispone de varios caminos para llegar a estas opciones:

Más detalles

Database Manager Manual del usuario DMAN-ES-10/10/05

Database Manager Manual del usuario DMAN-ES-10/10/05 Database Manager Manual del usuario DMAN-ES-10/10/05 La información que contiene este manual no tiene carácter contractual y puede estar sujeta a cambios sin previo aviso. La aplicación a la que se hace

Más detalles

Qlik Sense Cloud. Qlik Sense 2.0.2 Copyright 1993-2015 QlikTech International AB. Reservados todos los derechos.

Qlik Sense Cloud. Qlik Sense 2.0.2 Copyright 1993-2015 QlikTech International AB. Reservados todos los derechos. Qlik Sense Cloud Qlik Sense 2.0.2 Copyright 1993-2015 QlikTech International AB. Reservados todos los derechos. Copyright 1993-2015 QlikTech International AB. Reservados todos los derechos. Qlik, QlikTech,

Más detalles

Comencemos a programar con. Entrega 01

Comencemos a programar con. Entrega 01 Comencemos a programar con VBA - Access Entrega 01 Introducción 01-2 Planteamiento Este cursillo nace como respuesta a las continuas demandas por parte de los intervinientes en los foros de Access, de

Más detalles

Logística Computación I Pág.: 1 FUNCIÓN AUTORRESUMEN

Logística Computación I Pág.: 1 FUNCIÓN AUTORRESUMEN Computación I Pág.: 1 FUNCIÓN AUTORRESUMEN La Función Autorresumen se usa para confeccionar automáticamente resúmenes con los principales puntos de un documento. Esta función analiza el documento según

Más detalles