CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA. Grado en Medicina

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamaño: px
Comenzar la demostración a partir de la página:

Download "CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA. Grado en Medicina"

Transcripción

1 DEPARTAMENTO DE BIOQUÍMICA Y BIOLOGÍA MOLECULAR III FACULTAD DE MEDICINA UNIVERSIDAD COMPLUTENSE DE MADRID CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA Grado en Medicina CURSO ACADÉMICO 2014/2015

2 INDICE 1. Práctica #1: Aislamiento del DNA Plasmídico 2. Práctica #2: La Técnica de la PCR

3 AISLAMIENTO DE DNA PLASMIDICO INTRODUCCIÓN Un elemento central en la tecnología del DNA recombinante es el aislamiento y propagación dentro de un organismo (bacteria) de moléculas idénticas de DNA. Estas moléculas de DNA se copian (amplificación) utilizando la maquinaria de replicación de la célula huésped. Llamamos plásmido o vector a una molécula de DNA circular que porta la información necesaria para replicarse de forma autónoma (sin integrarse en el DNA celular) en la célula huésped. Estos plásmidos contienen genes que confieren resistencia a antibióticos, de forma que podemos seleccionar, por resistencia al antibiótico, aquellas bacterias que lo contienen frente a las que no. Otra característica importante de los plásmidos es que contienen secuencias específicas donde cortan determinadas enzimas de restricción, de forma que esto nos permite introducir en dichos sitios fragmentos de DNA de cualquier procedencia, como por ejemplo fragmentos de DNA humano, que se unirán al plásmido por medio de una ligasa. Este fragmento de DNA introducido en el vector será replicado por la célula huésped al igual que el resto del DNA de dicho vector. Este proceso de poder replicar dentro de un huésped un fragmento de DNA de otra procedencia es lo que llamamos clonaje.

4 El plásmido que vamos a aislar se denomina PUC18. El tamaño de este plásmido es de 2682 pares de bases y contiene el gen de la β-lactamasa, que le confiere resistencia al antibiótico ampicilina. Contiene también un sitio de inicio de replicación del DNA (sitio ori) y los genes laci y lacz de E. coli. Lac Z codifica para el enzima galactosidasa. Este enzima no lo contiene la cepa de E. colí que vamos a utilizar (cepa DH5α) y es capaz de transformar el sustrato artificial X-Gal en un producto coloreado de forma que aquellas bacterias que contienen el PUC18 podrían distinguirse de las que no lo contienen porque se tiñen de azul cuando ponemos X-Gal en la placa donde crecen. Pero el propósito de este enzima no es éste, ya que para ello tenemos la resistencia al antibiótico, sino que su propósito es permitirnos distinguir bacterias que contienen el plásmido PUC18 original de aquellas que contienen el plásmido con un fragmento de DNA foráneo (plásmido recombinante). Esto es así debido a que el sitio de corte de los enzimas de restricción está en la secuencia que codifica para este enzima, secuencia que queda interrumpida cuando se introduce un DNA foráneo. MÉTODO Preparación del gel de agarosa Esta preparación la llevara a cabo el Profesor como una demostración a los alumnos. El gel una vez enfriado se utilizara en esta misma práctica para cargar el DNA plasmídico. La separación de fragmentos de DNA de distinto tamaño se lleva a cabo en geles de agarosa, que se corren en cubetas horizontales. Los geles se pueden preparar con distintos porcentajes dc agarosa en función de los tamaños de los fragmentos a separar. Nosotros vamos a separar DNA plasmídico en geles de agarosa al 1 % en tampón TBE 1x (TBE: 90 mm Tris, 90 mm ácido bórico, 10 mm EDTA ph 8). La preparación del gel es como sigue: 1) Se pesa la cantidad adecuada de agarosa en polvo (0,4 g) y se añade al volumen adecuado de tampón (40 ml) TBE 1x. 2) Se calienta hasta ebullición el tiempo necesario para que se forme una solución transparente, y se deja enfriar durante unos minutos. 3) Se añade 4 μl de GelRed 10000X y se vierte la solución de agarosa, aun caliente y liquida, en un recipiente adecuado que contenga el denominado peine 4) Se deja transcurrir un tiempo hasta que la solución se hace un gel por enfriamiento, Se retirará el peine del gel creando así unos pocillos donde se cargarán las muestras en una solución de carga más densa que el TBE y que además contiene un colorante, azul de bromofenol, que nos marcará el frente de la carrera.

5 Obtención de DNA plasmídico. 1) Coger 1 ml de suspensión de bacterias E. coli que contienen el plásmido y ponerlo en un tubo eppendorf. 2) Centrifugar durante l minuto en la microcentrífuga. Desechar el sobrenadante hasta sequedad. Las últimas gotas sobre papel de filtro 3) Resuspender el precipitado en 300 µl de tampón TELT (50mM Tris-ClH ph 8, 62,5 mm EDTA, 2,5 M LiCI, 4% Tritón X-100) para romper la pared bacteriana. Agitar suavemente 4) Añadir 600 µl de cloroformo: isopropanol (24:1). Agitar 15 segundos y centrifugar 4 minutos en la microcentrífuga. De esta manera se eliminan la mayor parte de las proteínas y DNA genómico de las bacterias. 5) Recoger la fase acuosa (superior, unos 200 µl), que es la que contiene los ácidos nucleicos, y transferirla a un tubo eppendorf limpio. 6) Añadir 1 ml de etanol absoluto frío y mezclar agitando. Los ácidos nucleicos son insolubles en etanol y esto permite su precipitación. 7) Centrifugar durante 10 minutos en la microcentrífuga, y desechar el sobrenadante. 8) Repetir los pasos 6 y 7 con 1 ml de etanol al 70% a temperatura ambiente 9) Disolver el precipitado en 10 µl de agua destilada.

6 Separación electroforética 1) Tomar los 10 µl de la solución de DNA plasmídico, añadir 5 µl de tampón de carga y calentar a 70ºC durante 3 minutos para evitar la formación de agregados que no sean capaces de entrar en el gel. 2) Cargar esta muestra en el gel de agarosa y hacerla migrar a 100 voltios durante 30 minutos. (Durante este tiempo se llevara a cabo el cálculo de la concentración y pureza de una muestra de DNA según se indica en este guión). Visualización de los ácidos nucleicos. Los fragmentos de DNA en el gel se pueden visualizar en presencia de GelRed, ya que el GelRed se intercala entre el DNA y emite una intensa fluorescencia rosa cuando se hace incidir luz ultravioleta. La movilidad de un fragmento de DNA en un gel de agarosa es inversamente proporcional al logaritmo de su tamaño (número de pares de bases), de forma que los más pequeños migran más rápido que los más grandes. En nuestro caso, dado que es un DNA circular obtendremos una imagen en la que se observarán más de una banda. Ello se debe a que el DNA circular puede estar relajado o superenrollado. El superenrollado migra con mayor rapidez que el relajado y el relajado a su vez dado que es un DNA circular migra un poco más lento que un DNA de igual tamaño pero lineal. La razón de todo ello es fácil de comprender si se tiene en cuenta que, por ejemplo, la molécula de DNA superenrollado es más compacta que la misma molécula relajada y por tanto puede penetrar más fácilmente a través de la trama de la agarosa. Aparte de las formas mencionadas también se observan con cierta frecuencia formas enlazadas o diméricas del plásmido. Estas serán las bandas correspondientes al plásmido y además aparecerá una banda que migra con mayor rapidez que está formada por fragmentos de degradación del RNA. Calculo de la concentración y pureza de una muestra de DNA. Se puede cuantificar una muestra de DNA midiendo su absorción de luz ultravioleta a 260 nm en un espectrofotómetro. Usamos cubetas eppendorf: añadimos 10 µl del DNA y 490 µl de agua estéril (volumen final 500 µl) y leemos a 260 nm. Para comprobar la posible contaminación con proteínas leemos también la absorbancia a 280 nm.

7 Calculo concentración: A 260 x dilución muestra (50) x 50 μg/ml Calculo pureza: A 260 / A 280 = 1,8 puro < 1,8 contaminación con proteínas > 1,8 contaminación con RNA Preguntas. 1) Indicar el signo de la carga de los ácidos nucleicos y hacia que polo migrarán en un campo eléctrico. 2) Por qué un ácido nucleico de un tamaño único puede separarse en varias bandas en un gel de agarosa? Haga un esquema de las bandas que observa en el gel e interprete los resultados. 3) Indicar dos características útiles del DNA plasmídico.

8 UTILIZACIÓN DE LA TÉCNICA DE LA PCR (Polymerase chain reaction) PARA AMPLIFICAR UN DETERMINADO FRAGMENTO DE DNA EN EL QUE SE SOSPECHA LA EXISTENCIA DE UN POLIMORFISMO RELACIONADO CON LA DESAPARICIÓN DE UNA DIANA DE RESTRICCIÓN PARA EL ENZIMA BamHI. Se llevaran a cabo los siguientes tres pasos: -1) Amplificar por PCR un fragmento de ~1000 pb de un DNA determinado, que se sospecha contiene el polimorfismo que sustituye una adenina por una timina en la posición 3422 (3422 A T) lo que implica la desaparición de una diana de restricción para el enzima BamHI. Esto se traduce en una proteína anómala que tiene, en la sexta posición, una Val en vez de una Glu. A la proteína portadora de tal anomalía la denominaremos Proteína Mutada. Esta mutación puede ser la responsable de una determinada enfermedad congénita. Un caso parecido es el de la anemia falciforme, donde muta un nucleótido que forma parte de un sitio de restricción sensible a otro enzima. -2) Incubar el producto de la PCR con el enzima de restricción BamHI -3) Visualizar el producto de dicha incubación mediante una separación electroforética en gel de agarosa. Se observara solo una banda (~1000 pb) cuando el fragmento amplificado no sea sensible a la enzima de restricción, mientras que se observarán dos bandas de menor tamaño (de ~425 pb y de ~475 pb) si el fragmento amplificado fuera sensible al enzima de restricción BamHI. La existencia de una única banda representará la presencia del polimorfismo.

9 PASO 1: AMPLIFICACIÓN POR PCR Se basa en la replicación del DNA en un tubo de ensayo utilizando un termociclador con tiempo y temperatura programables. Consta de las siguientes fases: a) Fase de desnaturalización: Para poder iniciar la replicación se requiere que las dos hebras del DNA molde se encuentren separadas, lo que puede conseguirse aumentando la temperatura del medio entre ºC durante 3-5 min. b) Fase de hibridación o annealing: Requiere dos cebadores o primers. Estos cebadores deben ser diseñados como secuencias complementarias de cada uno de los dos extremos 3 de la región del DNA que se va a amplificar. Normalmente, se conocen como primer forward y primer reverse. Estos cebadores permiten a la enzima DNA polimerasa el inicio de la síntesis del DNA enlazando los desoxirribonucleotidos (datp, dttp, dctp y dgtp) o dntps. Para la unión de los cebadores a las secuencias complementarias del DNA se requiere una bajada de la temperatura hasta aproximadamente a ºC. Para lograrlo, la DNA polimerasa a usar debe ser termoestable. Esta característica la tiene la Taq polimerasa. La temperatura se selecciona para que el procedimiento tenga el máximo de especificidad y sensibilidad. El tiempo de hibridación de los cebadores suele estar entre seg. c) Fase de extensión: Se incrementará la temperatura del medio hasta alcanzar la temperatura óptima de funcionamiento de la Taq polimerasa (alrededor de los 72ºC). Los tiempos de elongación pueden estar entre 20 seg para fragmentos de 500 pb, hasta el doble para fragmentos de >1,2 Kb.

10 d) Fase de desnaturalización: Las hélices de DNA formadas se separaran por aumento de la temperatura a (90-95ºC) usando tiempos más cortos que la primera desnaturalización. Las fases b) c) y d) se repiten n veces hasta alcanzar la amplificación deseada. Hay que tener en cuenta la vida media de la Taq polimerasa a altas temperaturas. También deben añadirse en cantidad suficiente los cebadores y los dntps. e) Fase de extensión final: A veces, tras el último ciclo se añade un periodo de incubación a 72ºC de 5-12 min para completar la elongación de los productos que hayan quedado parcialmente sintetizados. MATERIAL DNA de partida (MUESTRAS 1-9): Partimos de 2 tipos de fragmentos de DNA distintos (normal y mutado). Ambos tipos contienen la secuencia de ~1000 pb que queremos amplificar. Se encuentran en disolución a una concentración de 2 ng/µl. La cantidad final añadida al tubo de reacción serán 50 ng.

11 Master Mix: Comprende todos los otros elementos necesarios para llevar a cabo la reacción de PCR Buffer 10X dntps Primers (F + R) Taq Polimerasa Concentración final 1X (Contiene Mg 2+ 2 mm) 200 µm/cada 1 µm/cada 1 U Agua MilliQ estéril -- PROCEDIMIENTO Cada pareja preparará 1 sólo tubo de PCR con el fin de identificar si la muestra amplificada contiene el DNA normal o el mutado. 1. Rotular un tubo de PCR con el nº de muestra elegido (del 1 al 9) 2. Añadir 25 µl del DNA problema 3. Añadir 25 µl de Master Mix al tubo de PCR. 4. Introducir en el termociclador, presionar EJECUTAR, seleccionar el programa practicas en el display, presionar EJECUTAR y luego INICIAR. El programa practicas desarrolla el siguiente protocolo de amplificación: Ciclos Tª Tiempo 1 94 ºC 5 min Desnaturalización inicial 94 ºC 30 seg Desnaturalización ºC 30 seg Hibridación 72 ºC 60 seg Extensión 1 72 ºC 10 min Extensión final Hold 4 ºC Hold Conservación de la muestra 5. Cuando finalice el programa practicas" (± 2h) se retiran los tubos del termociclador y se conservan a 4ºC (en la nevera) para el día siguiente.

12 PASO 2: CORTE CON EL ENZIMA DE RESTRICCIÓN BamHI MATERIAL Agua Milli Q autoclavada, para diluir el producto de la PCR. Buffer 10X Green: es el medio en el que trabaja el enzima de restricción y, además, contiene tampón de carga. Esto permitirá cargar más adelante en un gel de agarosa, directamente, el producto final de la digestión. Productos de amplificación del día anterior (del 1 al 9) conservados a 4ºC. Cada pareja trabajará con la muestra del mismo número que preparó para la PCR en el paso anterior. PROCEDIMIENTO 1. Añadir 150 µl de agua Milli Q autoclavada directamente en el eppendorf de 0.2 ml, para diluir el producto de la PCR. 2. En otro tubo eppendorf de 1,5 ml preparar la digestión con el enzima de restricción: a. Añadir: Volumen Agua MilliQ estéril 21 µl Buffer 10X Green 3 µl BamHI 2 µl DNA de la PCR 4 µl 3. Incubar 5 minutos a 37 ºC 4. Incubar 5 minutos a 80 ºC, para desactivar el enzima

13 PASO 3: VISUALIZAR LOS RESULTADOS MATERIAL Solución TBE 1X (90 mm Tris/90 mm ácido bórico/10 mm EDTA) ph 8.0 Patrón de longitud de fragmentos de DNA: Patrón comercial. Cargar 1-2 µl. Gel de agarosa al 1% (0.4 gr de agarosa en 40 ml de TBE + 4 µl GelRed 10000X). El Gel Red es un intercalante del DNA que nos va a permitir visualizar la muestra de DNA en el gel cuando este se estimula con luz UV. PROCEDIMIENTO 1. Cargar el producto de la reacción de digestión (10-12 µl) en un gel de agarosa al 1%. 2. Paralelamente, cargar un patrón de longitud de fragmentos de DNA ya preparado en otro pocillo (1-2 µl). 3. Correr el gel 40 minutos a 110 V. 4. Visualizar las bandas en el transiluminador Se observara una banda de ~1000 pb cuando el fragmento amplificado no sea sensible al enzima de restricción y dos bandas de ~425 pb y de ~475 pb si el fragmento amplificado fuera sensible al enzima de restricción BamHI. La existencia de una única banda representara la presencia del polimorfismo que vamos buscando. Con el patrón podemos calcular el tamaño de la banda en pares de bases (pb).

14 CUESTIONES A RESOLVER 1.- Consultando la tabla de enzimas de restricción que se aporta indique el palíndromo específico para este enzima de restricción BamHI. 2.- Diga para qué se desnaturaliza la muestra inicial de DNA y como se hace. 3.-Diga de qué factores dependería el número de ciclos de la PCR. 4-Dibuje un esquema del gel resultante, que contenga un estándar de fragmentos de DNA, el fragmento no digerido y los fragmentos digeridos por BamHI.

15

16

Práctico: Genética bacteriana 2007.

Práctico: Genética bacteriana 2007. Práctico: Genética bacteriana 2007. Actividad integrada Departamento de Genética Departamento de Bacteriología y Virología. OBJETIVOS Objetivos generales El estudiante al terminar la actividad práctica

Más detalles

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS Prácticas docentes en la COD: 10-71 APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS FUNDAMENTO TEÓRICO La PCR es una técnica que permite llevar a cabo la síntesis in vitro de fragmentos de ADN. Está basada

Más detalles

Materiales para la secuenciación de ADN

Materiales para la secuenciación de ADN Introduccion La Secuenciación Sanger es un método de secuenciación de ADN en el que el ADN diana se desnaturaliza y se hibrida con un cebador de oligonucleótidos, que se extiende entonces gracias a la

Más detalles

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR Módulo 1 Amplificación de un fragmento de ADN genómico por PCR En este primer módulo se amplificará por PCR, mediante el uso de oligonucleótidos específicos, un fragmento de ADN genómico de Aspergillus

Más detalles

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml)

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml) PCR SIMULADA Ref.PCR Simulada (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

5. MATERIALES Y MÉTODOS

5. MATERIALES Y MÉTODOS 5. MATERIALES Y MÉTODOS 5.1 Equipos Los siguientes termocicladores se emplearon para la amplificación por PCR: - Perkin Elmer, GeneAmp PCR System 2400. - Perkin Elmer, GeneAmp PCR System 9600. - Applied

Más detalles

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now.

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now. Unidad Curricular: Virología y Micología Veterinaria 1 TRABAJO PRÁCTICO No. 3 AMPLIFICACIÓN DE GENES VIRALES Reacción en Cadena de la Polimerasa, conocida como PCR (por sus siglas en inglés: Polimerase

Más detalles

17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico

17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico 17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico Carmen Alicia Padilla Peña, Jesús Diez Dapena, Emilia Martínez Galisteo, José

Más detalles

39. Aislamiento y purificación del DNA de un plásmido recombinante

39. Aislamiento y purificación del DNA de un plásmido recombinante 39. Aislamiento y purificación del DNA de un plásmido recombinante Aurora Galván Cejudo, Manuel Tejada, Antonio Camargo, José Javier Higuera, Vicente Mariscal, Emilio Fernández Reyes Departamento de Bioquímica

Más detalles

CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL

CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL LIBRO DE MEMORIAS 2 CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL Santiago de Cali, 23 al 28 de agosto de 2010 3 Libro de memorias

Más detalles

Protocolos de secuenciación de ADN

Protocolos de secuenciación de ADN 1 Protocolos de secuenciación de ADN Introducción El método de secuenciación utilizado aquí es el desarrollado por Sanger en 1975. Este consiste en la incorporación de didesixinucleótidos marcados fluorescentemente

Más detalles

3/22/2010. Iván Ferrer Rodríguez, PhD Catedrático. En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR.

3/22/2010. Iván Ferrer Rodríguez, PhD Catedrático. En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR. Iván Ferrer Rodríguez, PhD Catedrático En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR. Síntesis "in vitro" de secuencias específicas de ADN son amplificadas.

Más detalles

Reacción en cadena de la polymerasa (PCR)

Reacción en cadena de la polymerasa (PCR) Reacción en cadena de la polymerasa (PCR) 1 PCR Que es? Es una técnica in vitro diseñada para amplificar una región específica de DNA. Es extremadamente sensible, con la capacidad de amplificar millones

Más detalles

MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR)

MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) OBJETIVOS - Definir PCR, conocer los reactivos que

Más detalles

ELECTROFORESIS AVANZADA

ELECTROFORESIS AVANZADA Ref.ELECAVANZADA (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO ELECTROFORESIS AVANZADA El objetivo de este experimento es introducir a los alumnos en el conocimiento de la teoría electroforética y familiarizarse

Más detalles

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles

DETERMINACIÓN DEL FACTOR Rh por PCR

DETERMINACIÓN DEL FACTOR Rh por PCR Ref.PCRRh DETERMINACIÓN DEL FACTOR Rh por PCR 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante BIOTECNOLOGÍA 1.- Ingeniería Genética, ADN recombinante Técnica del ADN recombinante: es la más usada en ingeniería genética, esta basada en el uso de las enzimas de restricción o endonucleasas de restricción

Más detalles

ELECTROFORESIS EN GELES DE AGAROSA. Agustín Garrido. agugarrido@hotmail.com

ELECTROFORESIS EN GELES DE AGAROSA. Agustín Garrido. agugarrido@hotmail.com 1 ELECTROFORESIS EN GELES DE AGAROSA Agustín Garrido agugarrido@hotmail.com Introducción En este trabajo práctico se utilizó la técnica de electroforesis. Este proceso se basa en la migración de las moléculas

Más detalles

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN 5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN Materiales - Eppendorf de 1,5 ml estériles - Eppendorf de pared fina para PCR - Puntas de pipeta estériles desechables - Guantes

Más detalles

P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA"

P.C.R. Técnica de amplificación enzimática de secuencias específicas de DNA P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA" Paso 1: Desnaturalización del DNA Paso 2: Hibridación de los "Primers" Paso 3: Extensión Paso 1: Desnaturalización del DNA

Más detalles

TRABAJO PRÁCTICO Nº 5: ÁCIDOS NUCLEICOS DESCRIPCIÓN DE LOS MÉTODOS A UTILIZAR

TRABAJO PRÁCTICO Nº 5: ÁCIDOS NUCLEICOS DESCRIPCIÓN DE LOS MÉTODOS A UTILIZAR TRABAJO PRÁCTICO Nº 5: ÁCIDOS NUCLEICOS DOCENTES: Andrés Ciocchini, Gabriela Niemirowicz. DESCRIPCIÓN DE LOS MÉTODOS A UTILIZAR Purificación de ácido desoxiribonucleico (ADN) por partición diferencial

Más detalles

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica TÉCNICAS GENÓMICAS Utilidad/Objetivos: 1) Detección de microorganismos directamente en muestras clínicas identificando un fragmento específico del genoma del microorganismo concreto 2) Cuantificación del

Más detalles

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082 Página 1 de 5 1. OBJETIVO Detectar la presencia de Campylobacter jejuni en hamburguesa de pollo mediante técnica de PCR. 2. CAMPO DE APLICACIÓN Y ALCANCE Aplicar este procedimiento a muestras de hamburguesa

Más detalles

FACULTAD REGIONAL ROSARIO

FACULTAD REGIONAL ROSARIO FACULTAD REGIONAL ROSARIO CATEDRA BIOTECNOLOGIA ROFESOR: Ing. Eduardo Santambrosio JTP: Ing. Marta Ortega AUX 1ª : Ing. Pablo Garibaldi PCR (Polymerase chain reaction) Reacción en cadena de la polimerasa

Más detalles

ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA

ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA FACULTAD DE VETERINARIA DEPARTAMENTO DE SANIDAD ANIMAL ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA GUIÓN DE PRÁCTICAS DE LABORATORIO CURSO 2014 2015 MÓDULO: PORCINO Síndrome respiratorio y reproductor

Más detalles

velocidades de movimiento mediante la aplicación de un campo eléctrico a través de una matriz porosa

velocidades de movimiento mediante la aplicación de un campo eléctrico a través de una matriz porosa INTRODUCCIÓN En general, la electroforesis es una técnica que separa las moléculas en base a sus diferentes velocidades de movimiento mediante la aplicación de un campo eléctrico a través de una matriz

Más detalles

ACTIVIDAD PRACTICA No. 8 BIOLOGIA CELULAR EXTRACCIÓN DE ADN

ACTIVIDAD PRACTICA No. 8 BIOLOGIA CELULAR EXTRACCIÓN DE ADN Universidad Centroccidental Lisandro Alvarado Decanato de Ciencias de la Salud ACTIVIDAD PRACTICA No. 8 BIOLOGIA CELULAR EXTRACCIÓN DE ADN Octubre 2009 INTRODUCCION La molécula de ADN (que es la que se

Más detalles

Reacción en cadena de la polimerasa (PCR)

Reacción en cadena de la polimerasa (PCR) Dr. Alejandro Leal Reacción en cadena de la polimerasa (PCR) La reacción en cadena de la polimerasa (PCR, por sus siglas en inglés de "polymerase chain reaction") es un método de amplificación in vitro

Más detalles

ELECTROFORESIS BASICA

ELECTROFORESIS BASICA Ref.ELECBASICA (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO ELECTROFORESIS BASICA El objetivo de este experimento es introducir a los alumnos en el conocimiento de la teoría electroforética y familiarizarse

Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

Tecnologías basadas en la PCR

Tecnologías basadas en la PCR Tecnologías de marcadores moleculares para estudios de diversidad genética de plantas: Módulo de aprendizaje Tecnologías basadas en el ADN Tecnologías basadas en la PCR Fundamentos de la PCR Derechos de

Más detalles

38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa

38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa 38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa José Luis Caballero Repullo, Enriqueta Moyano, Juan Muñoz Blanco Departamento de Bioquímica y Biología Molecular, Campus

Más detalles

Técnicas de Biología Molecular. Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO

Técnicas de Biología Molecular. Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO Técnicas de Biología Molecular Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO 2004 Extracción de ácidos nucleicos o o DNA RNA Tipos de Muestras Sangre total (EDTA) Saliva Líquido Amniótico Bulbo

Más detalles

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA BIOLOGIA MOLECULAR Hemos elaborado un programa en 3 niveles, en función del tipo de estudiante y las posibilidades del centro educativo: 1. NIVEL BASICO 2. NIVEL MEDIO DANAEXTRACTOR KIT Práctica que constituye

Más detalles

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa?

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa? 2º BIOQUÍMICA CUESTIONES 1. Por qué la PCR convencional no es cuantitativa? En la PCR convencional, la cuantificación del ADN de la muestra es complicada debido a que la eficacia de amplificación va disminuyendo

Más detalles

Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez

Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez 1 Objetivos Entender la técnica: Reacción de Polimerasa en Cadena (PCR por sus siglas en inglés)

Más detalles

INGENIERÍA GENÉTICA 5 GAATTC 3 3 CTTAAG 5

INGENIERÍA GENÉTICA 5 GAATTC 3 3 CTTAAG 5 INGENIERÍA GENÉTICA 1. Fundamentos básicos de la ingeniería genética 2. Desnaturalización e hibridación del ADN 3. Reacción en cadena de la polimerasa (PCR) 4. Nuevas disciplinas surgidas de la ingeniería

Más detalles

Laboratorio. Objetivos I N T R O D U C C I Ó N. Al finalizar este laboratorio el estudiante podrá:

Laboratorio. Objetivos I N T R O D U C C I Ó N. Al finalizar este laboratorio el estudiante podrá: Laboratorio 12 Biología molecular Objetivos Al finalizar este laboratorio el estudiante podrá: 1. Conocer los principios básicos de la técnica de electroforesis y su aplicación al análisis del ADN. 2.

Más detalles

TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO

TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO TEST de PATERNIDAD Este experimento introduce a los alumnos en el uso del ADN y la PCR para simular una determinación de paternidad. Los estudiantes

Más detalles

Experimento con reactivos de la vida cotidiana!

Experimento con reactivos de la vida cotidiana! Experimento con reactivos de la vida cotidiana Laura Martínez Martín- 1º Grado Genética - UAB Abril de 2015 1 Índice Introducción 3 Objetivos 3 Material. 3 Procedimiento 4 Explicaciones científicas del

Más detalles

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

Técnicas moleculares.

Técnicas moleculares. Técnicas moleculares. DMTV Carolina Acevedo Curso de Microbiología 2015 SÍNTESIS IN VITRO DE UNA GRAN CANTIDAD DE COPIAS DE UN SEGMENTO DE ADN EXISTENTE EN UNA MUESTRA. O sea. Amplificamos en forma exponencial

Más detalles

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas ELEMENTOS BÁSICOS DE LA INVESTIGACIÓN EN GENES Análisis

Más detalles

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G.

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G. C825T Sistema para la detección de la mutación C825T en el gene de la proteína G. Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. Info@atgen.com.uy www.atgen.com.uy

Más detalles

Clonación molecular. Clonar significa hacer copias idénticas

Clonación molecular. Clonar significa hacer copias idénticas INGENIERÍA GENÉTICA Clonación molecular Clonar significa hacer copias idénticas Este término originalmente fue aplicado al procedimiento de aislar una célula y permitirle reproducirse creando una población

Más detalles

AUTOR: JORGE CONTRERAS PINEDA 1. Titulo:

AUTOR: JORGE CONTRERAS PINEDA 1. Titulo: Página 1 de 1 1. Titulo: Electroforesis de DNA 2. Objetivo Conocer los principios básicos de la electroforesis horizontal en geles de agarosa y aplicarlo para la separación de DNA humano, plasmídico, recombinante

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles

PROBLEMAS MAS FRECUENTES DURANTE LA SECUENCIACIÓN NO SE PRODUCE REACCION O ESTA DECAE POCO DESPUÉS DE COMENZAR

PROBLEMAS MAS FRECUENTES DURANTE LA SECUENCIACIÓN NO SE PRODUCE REACCION O ESTA DECAE POCO DESPUÉS DE COMENZAR PROBLEMAS MAS FRECUENTES DURANTE LA SECUENCIACIÓN NO SE PRODUCE REACCION O ESTA DECAE POCO DESPUÉS DE COMENZAR Las causas pueden ser las siguientes: No hay ADN o se encuentra en muy baja concentración.

Más detalles

Técnicas de ADN recombinante: la manipulación genética

Técnicas de ADN recombinante: la manipulación genética Técnicas de ADN recombinante: la manipulación genética A partir de los años 70 se desarrollaron las herramientas de la biología molecular o la ingeniería genética o lo que se ha llamado técnicas del ADN

Más detalles

PRÁCTICAS DE MICROBIOLOGIA CLINICA

PRÁCTICAS DE MICROBIOLOGIA CLINICA PRÁCTICAS DE MICROBIOLOGIA CLINICA Juan Carlos Rodríguez Hospital General Universitario de Alicante E-mail: rodriguez_juadia@gva.es http://microbiologia-alicante.umh.es CASO CLINICO: Rubéola Evolución

Más detalles

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri OBJETIVO Desarrollar un banco de datos a partir de plantas de origen indudable y del uso

Más detalles

PCR. Técnica inventada por Kary Mullis :1987. Premio Nobel 1993. Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN

PCR. Técnica inventada por Kary Mullis :1987. Premio Nobel 1993. Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN PCR PCR Técnica inventada por Kary Mullis :1987 Premio Nobel 1993 Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN Aprovecha los requerimientos de la replicación Templete ADN Nucleótidos

Más detalles

Tipos de Muestras. Técnicas de Biología Molecular. Extracción de ácidos nucleicos. Extracción de DNA genómico. Muestra de sangre en papel filtro

Tipos de Muestras. Técnicas de Biología Molecular. Extracción de ácidos nucleicos. Extracción de DNA genómico. Muestra de sangre en papel filtro Técnicas de Biología Molecular Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO 2004 Tipos de Muestras Extracción de ácidos nucleicos o DNA o RNA Sangre total (EDTA) Saliva Líquido Amniótico Bulbo

Más detalles

CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015

CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 DEFINICIÓN PCR: Constituye la técnica más importante para amplificar ácidos nucleicos in vitro. Ambas hebras del DNA de interés son replicadas

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. info@atgen.com.uy www.atgen.com.uy

Más detalles

PROCEDIMIENTO PARA LA UTILIZACIÓN DEL POLIMORFISMO DEL GEN COMT (CATECOL-OXI-METILTRANSFERASA) EN EL DIAGNÓSTICO DEL SÍNDROME DE FIBROMIALGIA

PROCEDIMIENTO PARA LA UTILIZACIÓN DEL POLIMORFISMO DEL GEN COMT (CATECOL-OXI-METILTRANSFERASA) EN EL DIAGNÓSTICO DEL SÍNDROME DE FIBROMIALGIA 2 PROCEDIMIENTO PARA LA UTILIZACIÓN DEL POLIMORFISMO DEL GEN COMT (CATECOL-OXI-METILTRANSFERASA) EN EL DIAGNÓSTICO DEL SÍNDROME DE FIBROMIALGIA D E S C R I P C I Ó N OBJETO DE LA INVENCIÓN La presente

Más detalles

PROBLEMAS MÁS FRECUENTES Y POSIBLES SOLUCIONES

PROBLEMAS MÁS FRECUENTES Y POSIBLES SOLUCIONES PROBLEMAS MÁS FRECUENTES Y POSIBLES SOLUCIONES NO SE PRODUCE REACCIÓN O ÉSTA DECAE POCO DESPUÉS DE COMENZAR No hay ADN o hay menos del necesario No hay cebador o la concentración es inferior a la necesaria.

Más detalles

GUÍA PARA LA SECUENCIACIÓN AUTOMÁTICA DE DNA

GUÍA PARA LA SECUENCIACIÓN AUTOMÁTICA DE DNA Página 1 de 16 GUÍA PARA LA SECUENCIACIÓN AUTOMÁTICA DE DNA SERVICIO DE SECUENCIACIÓN-S.C.S.I.E. UNIVERSITAT DE VALÈNCIA Página 2 de 16 CONTENIDOS: 1.- Secuenciación automática de DNA 2.- Tipos de molde

Más detalles

1 MATERIALES Y MÉTODOS

1 MATERIALES Y MÉTODOS 1 MATERIALES Y MÉTODOS El presente protocolo experimental contempla la amplificación del DNA de las bacterias y virus causantes de las ETS Neisseria gonorrhoeae, Chlamydia trachomatis y VPH mediante PCR

Más detalles

CAPÍTULO 10 APÉNDICE A CARACTERIZACIÓN DEL SUELO. A.1. Determinación del ph. (Domínguez et al, 1982)

CAPÍTULO 10 APÉNDICE A CARACTERIZACIÓN DEL SUELO. A.1. Determinación del ph. (Domínguez et al, 1982) CAPÍTULO 10 APÉNDICE A CARACTERIZACIÓN DEL SUELO A.1. Determinación del ph (Domínguez et al, 1982) Pesar 10 gramos de suelo y colocarlos en un vaso de precipitados. Agregar 25 ml de agua destilada y agitar

Más detalles

C A P Í T U L O 3 M A T E R I A L E S Y M É T O D O. Se ejecutaron varias pruebas para la inactivación de Escherichia Coli ATCC 25922 en agua

C A P Í T U L O 3 M A T E R I A L E S Y M É T O D O. Se ejecutaron varias pruebas para la inactivación de Escherichia Coli ATCC 25922 en agua C A P Í T U L O 3 M A T E R I A L E S Y M É T O D O Se ejecutaron varias pruebas para la inactivación de Escherichia Coli ATCC 25922 en agua destilada utilizando Dióxido de Titanio dopado con Nitrógeno,

Más detalles

GUIA DE LABORATORIO PRACTICA 8 EXTRACCIÓN ADN PROGRAMA DE ENFERMERIA CURSO INTEGRADO DE PROCESOS BIOLOGICOS

GUIA DE LABORATORIO PRACTICA 8 EXTRACCIÓN ADN PROGRAMA DE ENFERMERIA CURSO INTEGRADO DE PROCESOS BIOLOGICOS GUIA DE LABORATORIO PRACTICA 8 EXTRACCIÓN ADN PROGRAMA DE ENFERMERIA CURSO INTEGRADO DE PROCESOS BIOLOGICOS Leidy Diana Ardila Leal Docente. INTRODUCCIÓN En esta práctica se va a realizar la extracción

Más detalles

NORMAS DE TRABAJO EN BIOLOGÍA MOLECULAR Y GUÍA DE PROBLEMAS HABITUALES Y SU SOLUCIÓN

NORMAS DE TRABAJO EN BIOLOGÍA MOLECULAR Y GUÍA DE PROBLEMAS HABITUALES Y SU SOLUCIÓN NORMAS DE TRABAJO EN BIOLOGÍA MOLECULAR Y GUÍA DE PROBLEMAS HABITUALES Y SU SOLUCIÓN 1. PROCEDIMIENTOS BÁSICOS: En este apartado pretendemos detallar algunos factores muy importantes a la hora de realizar

Más detalles

Practica la genética Ficha didáctica del profesorado Bachillerato

Practica la genética Ficha didáctica del profesorado Bachillerato Ficha didáctica del profesorado Bachillerato www.eurekamuseoa.es Extracción de ADN Cuál es la función de cada uno de los ingredientes utilizados para realizar la disolución tampón para la visualización

Más detalles

Reacción en cadena de la Polimerasa (PCR)

Reacción en cadena de la Polimerasa (PCR) Explicación de TP Nº 2 Reacción en cadena de la Polimerasa (PCR) Química Biológica Patológica Dra. Mariana L. Ferramola Dra. Gabriela Lacoste 2015 Definición de PCR Es la amplificación enzimática de un

Más detalles

Análisis de la Presencia de Organismos Genéticamente Modificados en Muestras de Alimentos

Análisis de la Presencia de Organismos Genéticamente Modificados en Muestras de Alimentos Análisis de la Presencia de Organismos Genéticamente Modificados en Muestras de Alimentos Sesión nº 5 Electroforesis en gel de agarosa M. Somma, M. Querci WORLD HEALTH ORGANIZATION REGIONAL OFFICE FOR

Más detalles

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras METODOLOGIA DEL PCR Lic. Jorge Mato Luis Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras Desnaturalización del DNA 5 A G G T T A G T G G A C C C T T G A T 3 3 T C C A

Más detalles

CLONAJE DE GENES EN PLÁSMIDOS BACTERIANOS: Construcción del DNA recombinante

CLONAJE DE GENES EN PLÁSMIDOS BACTERIANOS: Construcción del DNA recombinante Construcción DNA recombinante 1 Práctica 1 CLONAJE DE GENES EN PLÁSMIDOS BACTERIANOS: Construcción del DNA recombinante Introducción Los plásmidos bacterianos son moléculas de DNA extracromosómico capaces

Más detalles

AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO

AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO E l estudio del genoma de los seres vivos a sido uno d los principales objetivos de la Biología. Desde los trabajos de Mendel (1866),

Más detalles

III. METODOLOGÍA EXPERIMENTAL

III. METODOLOGÍA EXPERIMENTAL III. METODOLOGÍA EXPERIMENTAL 3.1 Análisis Previos Se utilizaron los filtros con muestra de partículas suspendidas en el aire PM 10 que el Instituto Municipal de Ecología (IME) proporcionó para llevar

Más detalles

DANAGENE SALIVA KIT. Ref.0603.4 50 Extracciones / Ref.0603.41 160 Extracciones

DANAGENE SALIVA KIT. Ref.0603.4 50 Extracciones / Ref.0603.41 160 Extracciones DANAGENE SALIVA KIT Ref.0603.4 50 Extracciones / Ref.0603.41 160 Extracciones 1.INTRODUCCION DANAGENE SALIVA Kit provee un método para la extracción de ADN genómico de alta calidad a partir de muestras

Más detalles

RESOLUCIÓN OENO 5/2007

RESOLUCIÓN OENO 5/2007 RESOLUCIÓN OENO 5/2007 CODEX - GLICOSIDASA LA ASAMBLEA GENERAL Visto el Artículo 2, párrafo 2 iv del acuerdo del 3 de abril de 2001 por el cual se creó la Organización Internacional de la Viña y el Vino,

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

NMX-F-070-1964. MÉTODO DE PRUEBA PARA LA DETERMINACIÓN DE TIAMINA. THIAMINE DETERMINATION. TEST METHOD. NORMAS MEXICANAS. DIRECCIÓN GENERAL DE NORMAS.

NMX-F-070-1964. MÉTODO DE PRUEBA PARA LA DETERMINACIÓN DE TIAMINA. THIAMINE DETERMINATION. TEST METHOD. NORMAS MEXICANAS. DIRECCIÓN GENERAL DE NORMAS. NMX-F-070-1964. MÉTODO DE PRUEBA PARA LA DETERMINACIÓN DE TIAMINA. THIAMINE DETERMINATION. TEST METHOD. NORMAS MEXICANAS. DIRECCIÓN GENERAL DE NORMAS. ASUNTO Con fundamento en lo dispuesto en los Artículos

Más detalles

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a Introducción Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a los investigadores verificar la expresión de una proteína, determinar la cantidad relativa

Más detalles

1. CARACTERÍSTICAS TÉCNICAS DEL EQUIPAMIENTO

1. CARACTERÍSTICAS TÉCNICAS DEL EQUIPAMIENTO PLIEGO DE PRESCRIPCIONES TÉCNICAS QUE HABRÁ DE REGIR LA LICITACIÓN, MEDIANTE PROCEDIMIENTO ABIERTO, PARA LA CONTRATACIÓN DEL SUMINISTRO, INSTALACIÓN Y PUESTA EN MARCHA DEL EQUIPAMIENTO CIENTÍFICO DE LA

Más detalles

UNIVERSIDAD DE PUERTO RICO EN AGUADILLA DEPARTAMENTO DE CIENCIAS NATURALES. Laboratorio de Genética BIOL 3306

UNIVERSIDAD DE PUERTO RICO EN AGUADILLA DEPARTAMENTO DE CIENCIAS NATURALES. Laboratorio de Genética BIOL 3306 UNIVERSIDAD DE PUERTO RICO EN AGUADILLA DEPARTAMENTO DE CIENCIAS NATURALES Laboratorio de Genética BIOL 3306 Liza V. Jiménez Rodríguez, Ph.D. Agosto, 2014 Pre-prueba I. Pareo 1) Geles de agarosa 2) Loading

Más detalles

N 1 Reacción n en Cadena de la Polimerasa

N 1 Reacción n en Cadena de la Polimerasa Trabajo Práctico N 1 Reacción n en Cadena de la Polimerasa Definición n e importancia. Usos y aplicaciones. Optimización. Tipos de PCR. Electroforesis. Fundamentos. Asociado al Programa Teórico: Tema 2.

Más detalles

Técnica de PCR. Beatriz Bellosillo. Servei de Patologia, Hospital del Mar, Barcelona, Spain

Técnica de PCR. Beatriz Bellosillo. Servei de Patologia, Hospital del Mar, Barcelona, Spain Técnica de PCR Beatriz Bellosillo Servei de Patologia, Hospital del Mar, Barcelona, Spain Biología Molecular Estudio de los procesos que se desarrollan en los seres vivos desde un punto de vista molecular

Más detalles

DIAGNÓSTICO GENÉTICO DE LA HIPERCOLESTEROLEMIA FAMILIAR POR RFLP Ref.PCRCOLEST(4 prácticas)

DIAGNÓSTICO GENÉTICO DE LA HIPERCOLESTEROLEMIA FAMILIAR POR RFLP Ref.PCRCOLEST(4 prácticas) DIAGNÓSTICO GENÉTICO DE LA HIPERCOLESTEROLEMIA FAMILIAR POR RFLP Ref.PCRCOLEST(4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios

Más detalles

MATERIALES Y MÉTODOS. Cepas Utilizadas

MATERIALES Y MÉTODOS. Cepas Utilizadas MATERIALES Y MÉTODOS Cepas Utilizadas Para el presente trabajo se utilizaron tres cepas Tipo: Mycobacterium aviumintracellulare (proporcionada al Laboratorio Estatal de Salud Pública por el Instituto Nacional

Más detalles

Curso de biología molecular CIMAT 2010

Curso de biología molecular CIMAT 2010 Curso de biología molecular CIMAT 2010 INTRODUCCIÓN Este curso-taller tiene como propósito mostrar de manera teórica y práctica algunos principios básicos de biología molecular e ingeniería genética. Conocerás

Más detalles

MANUAL DE PRÁCTICAS DE LABORATORIO

MANUAL DE PRÁCTICAS DE LABORATORIO MANUAL DE PRÁCTICAS DE LABORATORIO INGENIERIA ENBIOTECNOLOGÍA INGENIERÍA GENÉTICA FICHA TECNICA FICHA TÉCNICA SEMINARIO DE BIOTECNOLOGÍA MÉDICO-FARMACÉUTICA Fecha: Nombre del catedrático: 10-Julio-2012

Más detalles

versus PCR en Tiempo Real PCR convencional no es cuantitativo

versus PCR en Tiempo Real PCR convencional no es cuantitativo PCR convencional o PCR de punto final versus PCR en Tiempo Real PCR convencional no es cuantitativo S Lobos C - U de Chile 1 PCR clásico La cantidad de producto no está relacionada con la cantidad de DNA

Más detalles

METODOS DE ANALISIS BIOMEDICOS

METODOS DE ANALISIS BIOMEDICOS METODOS DE ANALISIS BIOMEDICOS 2010 Profesora a cargo: Dra. Viviana Lepek PARTE PRÁCTICA Jefe de T.P.: Dra. Mara Roset Ayudantes: Dra. Ines Marchesini Lic. Lucas Bukata Dr. Juan Mucci Dr. Adrián Mutto

Más detalles

ADN y RNA caracterización y métodos de estudio

ADN y RNA caracterización y métodos de estudio ADN y RNA caracterización y métodos de estudio Separación por centrifugación de equilibrio en gradiente de densidad de en CsCl Separación por centrifugación de equilibrio en gradiente de densidad de en

Más detalles

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática.

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Departamento de Bioquímica Médica y Biología Molecular Práctica 3 Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Curso 1 Medicina (Abril) 2012 BIOQUÍMICA

Más detalles

Grado en Química. 4º Curso Bioquímica. Guión de Prácticas

Grado en Química. 4º Curso Bioquímica. Guión de Prácticas Grado en Química 4º Curso Bioquímica Guión de Prácticas UTILES A TRAER POR EL ALUMNO Bata Gafas de Seguridad Cuaderno de Laboratorio NORMAS DE TRABAJO Antes de empezar Antes de empezar cada práctica, el

Más detalles

Investigación en genes. Tecnología del ADN recombinante

Investigación en genes. Tecnología del ADN recombinante Investigación en genes Tecnología del ADN recombinante Tecnología del ADN recombinante 1º parte: Conocimientos básicos que posibilitaron su desarrollo 2º parte: Instrumentos básicos 3º parte Ejemplos Conocimientos

Más detalles

I. 15microlitros de agua esteril, perforar el pozo y diluir. II. Se tomaron 2 microlitros para la primera transformación.

I. 15microlitros de agua esteril, perforar el pozo y diluir. II. Se tomaron 2 microlitros para la primera transformación. 23 de agosto 2007 Se comenzó la elaboración de la bitácora Medio LB Broth, Billar (Luria-Bertani) 25gr/litro Se preparó 500 mililitros agregando 12.5 gramos Se diluyó y esterilizó por autoclave Medio LB

Más detalles

Guía de PCR en tiempo real

Guía de PCR en tiempo real Guía de PCR en tiempo real Michelle C. Chirinos-Arias michelle.christine16@gmail.com Índice Introducción. 2 Algunos conceptos. 2 PCR (reacción en cadena de la polimerasa)... 2 PCR en tiempo real (qpcr)..

Más detalles

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada La PCR La Reacción en Cadena de la Polimerasa es la herramienta más utilizada PCR- Ventajas y Usos Amplificación ilimitada de secuencias de interés. Rápida, Sencilla y Eficaz. Técnica altamente sensible

Más detalles

Int. Cl. 7 : G01N 33/04

Int. Cl. 7 : G01N 33/04 k 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 k Número de publicación: 2 144 36 21 k Número de solicitud: 009800009 1 k Int. Cl. 7 : G01N 33/04 A23C 11/10 k 12 SOLICITUD DE PATENTE A1 22 kfecha

Más detalles

APÉNDICE. Apéndice 1. Espectrofotómetro. (Users Manual 2100 Series Spectrophotometer) 68

APÉNDICE. Apéndice 1. Espectrofotómetro. (Users Manual 2100 Series Spectrophotometer) 68 APÉNDICE Apéndice 1. Espectrofotómetro (Users Manual 2100 Series Spectrophotometer) 68 El espectrofotómetro de la marca UNICO serie 2100 UV posee un rango de longitud de onda de 200-1000 nm. La técnica

Más detalles

CAPÍTULO VI. Expresión de genes relacionados con apoptosis

CAPÍTULO VI. Expresión de genes relacionados con apoptosis CAPÍTULO VI Expresión de genes relacionados con apoptosis 1.- Introducción 2.- Protocolos para análisis genéticos 3.- Resultados en MCF-7 4.- Discusión 1.- Introducción Como se ha descrito anteriormente,

Más detalles

Tema 11. Herramientas de la genética molecular

Tema 11. Herramientas de la genética molecular Tema 11. Herramientas de la genética molecular Genética CC. Mar 2004-05 Objetivos Técnicas de clonación Construcción de genotecas e identificación de secuencias Mapas de restricción Amplificación (PCR)

Más detalles

REACCIÓN EN CADENA DE LA POLIMERASA (PCR)

REACCIÓN EN CADENA DE LA POLIMERASA (PCR) REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Microbiología General Microbiología M de los Alimentos Licenciatura en Bioquímica i Ingeniería en alimentos c Microbiología r 2015 Licenciatura en Biotecnología

Más detalles