APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamaño: px
Comenzar la demostración a partir de la página:

Download "APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS"

Transcripción

1 Prácticas docentes en la COD: APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS FUNDAMENTO TEÓRICO La PCR es una técnica que permite llevar a cabo la síntesis in vitro de fragmentos de ADN. Está basada en una reacción enzimática catalizada por una ADN polimerasa, que produce múltiples copias (amplificación) de un mismo fragmento de ADN. Para la reacción se requiere: El ADN que va a copiarse, que servirá como molde a la ADN polimerasa para hacer las copias. Polimerasa termoestable, habitualmente se utiliza la polimerasa de la bacteria Thermus aquaticus conocida como Taq polimerasa. Cebadores o primers específicos, que se unirán a los extremos del fragmento de ADN que quiere amplificarse. En este caso, se unirán a un fragmento de ADN del genoma del parásito. Se utiliza la especificidad de los cebadores para amplificar una región del genoma del parásito cuando se encuentra presente en una muestra. Desoxirribonucleótidos trifosfato, o dntps (datp, dttp, dctp,dgtp), que son los sustratos para la síntesis de ADN, y un medio de reacción adecuado, que contenga iones magnesio y otras sales necesarias para que se produzca la reacción enzimática, y que se consigue utilizando un tampón de reacción apropiado para la enzima Una PCR típica incluye tres pasos: Etapa de desnaturalización. Se calientan las muestras a una temperatura por encima de 90ºC durante un periodo de 30s-1 minuto. Las moléculas de ADN están compuestas por dos cadenas de nucleótidos (son bicatenarias). Al incubar las reacciones a esta temperatura elevada se rompen los puentes de hidrógeno que unen las dos cadenas de nucleótidos (la molécula de ADN se desnaturaliza), de modo que - 1 -

2 Prácticas docentes en la COD: cada una de las dos cadenas sirve como molde para la copia de un nuevo fragmento de ADN. Etapa de cebado o annealing. las reacciones se enfrían con rapidez a una temperatura que puede variar entre ºC y se incuban a esta temperatura durante un periodo de entre 30s a 1 minuto para que los cebadores se unan a las secuencias complementarias en las cadenas molde. Los cebadores son fragmentos cortos de ADN, entre 15 y 35 nucleótidos, de secuencia inversa y complementaria a los extremos de la región de ADN que va a copiarse. Son además específicos, de modo que se unen exclusivamente a los extremos del fragmento de ADN a amplificar, y no se unen a ninguna otra secuencia de ADN cercana. Etapa de polimerización. Las reacciones se incuban durante un periodo de entre 30s a 1 minuto a 72ºC, temperatura óptima de actuación de la ADN polimerasa, que añadirá los desoxirribonucleótidos trifosfato al extremo de los cebadores e irá sintetizando las cadenas de ADN copia. Al final de esta etapa, se obtienen dos moléculas de ADN por cada molécula de ADN original de la muestra Estas tres etapas forman un ciclo que se repite unas 30 veces. En cada nuevo ciclo, tanto las cadenas de ADN original como las cadenas copiadas sirven como molde para la síntesis de nuevas copias, de modo que el número de moléculas de ADN se duplica en cada ciclo (aumentando la cantidad de moléculas de ADN de forma geométrica)

3 Prácticas docentes en la COD: El resultado final es un gran número de fragmentos de ADN flanqueados por los cebadores, que se obtienen en apenas unas horas (después de 30 ciclos, cada molécula de ADN molde inicial se habrá copiado más de 1000 millones de veces). Como los cebadores que se utilizarán n la reacción son específicos para secuencias de ADN presentes en el genoma de un parásito (cebadores específicos de especie), la PCR puede utilizarse para detectar la presencia de ADN del parásito en cuestión en una muestra que contenga también ADN que no sea del propio parásito (ADN del hospedador). Los resultados de la PCR se analizan habitualmente mediante la técnica de electroforesis en gel de agarosa. En esta técnica, la aplicación de un campo eléctrico permite la separación a través de un soporte sólido (gel de agarosa) de moléculas cargadas en función de su tamaño. Las moléculas más pequeñas avanzarán más en el gel y las moléculas más grandes avanzarán menos. El ADN tiene carga negativa y migrará desde el polo negativo hacia el polo positivo. La separación simultánea, en diferentes pocillos del gel, de los productos de PCR y de un marcador de peso molecular con fragmentos de ADN de tamaño conocido, permite determinar el tamaño de los fragmentos de ADN amplificados mediante PCR. OBJETIVOS DE LA PRÁCTICA Se utilizará la técnica de Reacción en Cadena de Polimerasa, o PCR, para diagnosticar la presencia del protozoo parásito Perkinsus olseni en muestras procedentes de dos de sus hospedadores habituales, la almeja fina (Tapes decussatus) y la almeja japonesa (Tapes philippinarum)

4 Prácticas docentes en la COD: MATERIALES NECESARIOS Agua ultrapura estéril. ADN de almejas (4 muestras), extraído individualmente de dos individuos sanos y dos individuos afectados por el parásito. Controles de la técnica, control positivo (ADN de un animal fuertemente infectado por el parásito), y control negativo (agua estéril). Tampón de PCR, 10x. Mezcla de desoxirribonucleótidos trifosfato (dntps), 10 mm cada uno. Cebadores PK1 y PK2, 200 micromolar cada uno, específicos para amplificar un fragmento del espaciador IGS de los genes ribosómicos del genoma de Perkinsus olseni. Enzima Taq polimerasa, 10U/µL. Microtubos estériles, 0,2 ml. Gradilla para microtubos. Micropipetas automáticas, p2 (0,2-2 µl), p10 (1-10 µl), y p20 (2-20 µl). Puntas de pipeta estériles. Termociclador. Agarosa. Tampón de electroforesis TAE, 1x. Colorante SYBR-Safe, x. Tampón para cargar muestras en gel de agarosa. Marcador de peso molecular. Matraz Erlenmeyer, 250 ml. Balanza. Microondas. Cubeta de electroforesis. Fuente de alimentación. Transiluminador

5 Prácticas docentes en la COD: METODOLOGÍA 1. Preparar las reacciones de PCR, una reacción para cada una de las muestras a amplificar: 4 muestras de almejas, 1 control positivo y 1 control negativo. 2. Colocar los tubos en un termociclador, e incubar las reacciones de PCR utilizando un programa adecuado para los cebadores empleados: 3. Mientras se lleva a cabo la reacción de PCR, preparar el gel de agarosa. 4. Una vez finalizada la reacción de PCR y polimerizado el gel, se lleva a cabo la electroforesis de las muestras amplificadas mediante PCR. DESARROLLO DE LA PRÁCTICA 1. En un microtubo de 0,2 ml se añaden los siguientes reactivos en el orden indicado para cada muestra (muestras de 4 almejas, control positivo y control negativo), y un volumen final de 25 µl: Agua ultrapura estéril 16 µl Tampón de PCR (10x) 2,5 µl dntps (10 mm) 1 µl Cebador PK1 (200 µm) 2 µl Cebador PK2 (200 µm) 2 µl ADN 1 µl Taq polimerasa (10U/µl)0,5 µl 2. Colocar los tubos en un termociclador, e incubar las reacciones según el siguiente programa: Desnaturalización inicial 94ºC 5 minutos Desnaturalización 94ºC 30 seg. Cebado 58ºC 30 seg. x 30 veces Polimerización 72ºC 30 seg. Polimerización final 72ºC 10 minutos 3. Mientras se lleva a cabo la reacción de PCR, se prepara el gel de agarosa: a. En un matraz de 250 ml añadir 40 ml de tampón TAE 1x y 0,4 g de agarosa, para preparar un gel de agarosa al 1%

6 Prácticas docentes en la COD: b. Calentar utilizando un microondas hasta que se funda la agarosa y dejar enfriar la disolución. c. Mientras se deja enfriar la agarosa, preparar el molde en el que se dejará polimerizar el gel, sellando los extremos y colocando un peine que labrará los pocillos en los que se cargarán las muestras. d. Cuando la temperatura de la disolución de agarosa sea inferior a 60ºC, añadir 4 µl del colorante para ADN SYBR Safe (10.000x) y verter en el molde. El gel estará preparado cuando adquiera una apariencia translúcida. e. Retirar el peine y dejar libres los extremos del gel. Colocarlo en la cubeta de electroforesis y cubrirlo con tampón TAE 1x para llevar a cabo una electroforesis en gel horizontal sumergida. 4. Una vez finalizada la reacción de PCR y polimerizado el gel, se lleva a cabo la electroforesis: a. Añadir 5 µl de tampón de carga a cada reacción de PCR, mezclar con ayuda de la micropipeta y cargar cada muestra en un pocillo del gel. Cargar en otro pocillo 4 µl de un marcador de peso molecular. b. Conectar la cubeta de electroforesis a la fuente de alimentación. 5. El resultado de la electroforesis se observa en un transiluminador. El tamaño esperado del fragmento de ADN del parásito amplificado mediante PCR es de unos 500 pb. CUESTIONARIO PARA LOS ALUMNOS 1. Qué criterios deben seguirse a la hora de diseñar cebadores para el diagnóstico de una enfermedad parasitaria a partir de ADN extraído de los hospedadores? 2. Se han utilizado los cebadores PK1 y PK2 para diagnosticar la presencia del parásito Perkinsus olseni en tejidos procedentes de 29 almejas muestreadas en una zona de cultivo de Huelva. Se muestra la fotografía de la electroforesis en gel de agarosa (C+= control positivo y C-= control negativo)

7 Prácticas docentes en la COD: Marcador peso molecular Muestras: pb C+ C- Describir los resultados obtenidos. 3. Al analizar los resultados de una PCR en gel de agarosa se observa un fragmento de ADN del tamaño esperado en todas las muestras ensayadas, incluido el control negativo de la técnica, tal y como puede verse en la fotografía. Qué indicaría este resultado? Marcador peso molecular Muestras: C- C pb 500 pb - 7 -

8 Prácticas docentes en la COD: Sería posible diagnosticar la presencia de dos parásitos distintos en muestras de un animal mediante una única PCR? En caso afirmativo, describe brevemente cómo podría hacerse

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml)

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml) PCR SIMULADA Ref.PCR Simulada (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now.

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now. Unidad Curricular: Virología y Micología Veterinaria 1 TRABAJO PRÁCTICO No. 3 AMPLIFICACIÓN DE GENES VIRALES Reacción en Cadena de la Polimerasa, conocida como PCR (por sus siglas en inglés: Polimerase

Más detalles

MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR)

MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) OBJETIVOS - Definir PCR, conocer los reactivos que

Más detalles

DETERMINACIÓN DEL FACTOR Rh por PCR

DETERMINACIÓN DEL FACTOR Rh por PCR Ref.PCRRh DETERMINACIÓN DEL FACTOR Rh por PCR 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

Materiales para la secuenciación de ADN

Materiales para la secuenciación de ADN Introduccion La Secuenciación Sanger es un método de secuenciación de ADN en el que el ADN diana se desnaturaliza y se hibrida con un cebador de oligonucleótidos, que se extiende entonces gracias a la

Más detalles

Reacción en cadena de la polimerasa (PCR)

Reacción en cadena de la polimerasa (PCR) Dr. Alejandro Leal Reacción en cadena de la polimerasa (PCR) La reacción en cadena de la polimerasa (PCR, por sus siglas en inglés de "polymerase chain reaction") es un método de amplificación in vitro

Más detalles

ELECTROFORESIS AVANZADA

ELECTROFORESIS AVANZADA Ref.ELECAVANZADA (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO ELECTROFORESIS AVANZADA El objetivo de este experimento es introducir a los alumnos en el conocimiento de la teoría electroforética y familiarizarse

Más detalles

ELECTROFORESIS BASICA

ELECTROFORESIS BASICA Ref.ELECBASICA (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO ELECTROFORESIS BASICA El objetivo de este experimento es introducir a los alumnos en el conocimiento de la teoría electroforética y familiarizarse

Más detalles

Práctico: Genética bacteriana 2007.

Práctico: Genética bacteriana 2007. Práctico: Genética bacteriana 2007. Actividad integrada Departamento de Genética Departamento de Bacteriología y Virología. OBJETIVOS Objetivos generales El estudiante al terminar la actividad práctica

Más detalles

3/22/2010. Iván Ferrer Rodríguez, PhD Catedrático. En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR.

3/22/2010. Iván Ferrer Rodríguez, PhD Catedrático. En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR. Iván Ferrer Rodríguez, PhD Catedrático En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR. Síntesis "in vitro" de secuencias específicas de ADN son amplificadas.

Más detalles

TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO

TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO TEST de PATERNIDAD Este experimento introduce a los alumnos en el uso del ADN y la PCR para simular una determinación de paternidad. Los estudiantes

Más detalles

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica TÉCNICAS GENÓMICAS Utilidad/Objetivos: 1) Detección de microorganismos directamente en muestras clínicas identificando un fragmento específico del genoma del microorganismo concreto 2) Cuantificación del

Más detalles

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles

FACULTAD REGIONAL ROSARIO

FACULTAD REGIONAL ROSARIO FACULTAD REGIONAL ROSARIO CATEDRA BIOTECNOLOGIA ROFESOR: Ing. Eduardo Santambrosio JTP: Ing. Marta Ortega AUX 1ª : Ing. Pablo Garibaldi PCR (Polymerase chain reaction) Reacción en cadena de la polimerasa

Más detalles

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR Módulo 1 Amplificación de un fragmento de ADN genómico por PCR En este primer módulo se amplificará por PCR, mediante el uso de oligonucleótidos específicos, un fragmento de ADN genómico de Aspergillus

Más detalles

CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA. Grado en Medicina

CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA. Grado en Medicina DEPARTAMENTO DE BIOQUÍMICA Y BIOLOGÍA MOLECULAR III FACULTAD DE MEDICINA UNIVERSIDAD COMPLUTENSE DE MADRID CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA Grado en Medicina CURSO ACADÉMICO 2014/2015 INDICE

Más detalles

Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez

Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez 1 Objetivos Entender la técnica: Reacción de Polimerasa en Cadena (PCR por sus siglas en inglés)

Más detalles

P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA"

P.C.R. Técnica de amplificación enzimática de secuencias específicas de DNA P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA" Paso 1: Desnaturalización del DNA Paso 2: Hibridación de los "Primers" Paso 3: Extensión Paso 1: Desnaturalización del DNA

Más detalles

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082 Página 1 de 5 1. OBJETIVO Detectar la presencia de Campylobacter jejuni en hamburguesa de pollo mediante técnica de PCR. 2. CAMPO DE APLICACIÓN Y ALCANCE Aplicar este procedimiento a muestras de hamburguesa

Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante BIOTECNOLOGÍA 1.- Ingeniería Genética, ADN recombinante Técnica del ADN recombinante: es la más usada en ingeniería genética, esta basada en el uso de las enzimas de restricción o endonucleasas de restricción

Más detalles

Técnicas moleculares.

Técnicas moleculares. Técnicas moleculares. DMTV Carolina Acevedo Curso de Microbiología 2015 SÍNTESIS IN VITRO DE UNA GRAN CANTIDAD DE COPIAS DE UN SEGMENTO DE ADN EXISTENTE EN UNA MUESTRA. O sea. Amplificamos en forma exponencial

Más detalles

CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL

CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL LIBRO DE MEMORIAS 2 CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL Santiago de Cali, 23 al 28 de agosto de 2010 3 Libro de memorias

Más detalles

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles

Tecnologías basadas en la PCR

Tecnologías basadas en la PCR Tecnologías de marcadores moleculares para estudios de diversidad genética de plantas: Módulo de aprendizaje Tecnologías basadas en el ADN Tecnologías basadas en la PCR Fundamentos de la PCR Derechos de

Más detalles

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR)

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) Centro de de Microscopía Electrónica Facultad de de Ciencias Médicas Universidad Nacional de de Córdoba

Más detalles

Reacción en cadena de la polymerasa (PCR)

Reacción en cadena de la polymerasa (PCR) Reacción en cadena de la polymerasa (PCR) 1 PCR Que es? Es una técnica in vitro diseñada para amplificar una región específica de DNA. Es extremadamente sensible, con la capacidad de amplificar millones

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

DIAGNÓSTICO GENÉTICO DE LA HIPERCOLESTEROLEMIA FAMILIAR POR RFLP Ref.PCRCOLEST(4 prácticas)

DIAGNÓSTICO GENÉTICO DE LA HIPERCOLESTEROLEMIA FAMILIAR POR RFLP Ref.PCRCOLEST(4 prácticas) DIAGNÓSTICO GENÉTICO DE LA HIPERCOLESTEROLEMIA FAMILIAR POR RFLP Ref.PCRCOLEST(4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. info@atgen.com.uy www.atgen.com.uy

Más detalles

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN 5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN Materiales - Eppendorf de 1,5 ml estériles - Eppendorf de pared fina para PCR - Puntas de pipeta estériles desechables - Guantes

Más detalles

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G.

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G. C825T Sistema para la detección de la mutación C825T en el gene de la proteína G. Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. Info@atgen.com.uy www.atgen.com.uy

Más detalles

Practica la genética Ficha didáctica del profesorado Bachillerato

Practica la genética Ficha didáctica del profesorado Bachillerato Ficha didáctica del profesorado Bachillerato www.eurekamuseoa.es Extracción de ADN Cuál es la función de cada uno de los ingredientes utilizados para realizar la disolución tampón para la visualización

Más detalles

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA BIOLOGIA MOLECULAR Hemos elaborado un programa en 3 niveles, en función del tipo de estudiante y las posibilidades del centro educativo: 1. NIVEL BASICO 2. NIVEL MEDIO DANAEXTRACTOR KIT Práctica que constituye

Más detalles

III. METODOLOGÍA EXPERIMENTAL

III. METODOLOGÍA EXPERIMENTAL III. METODOLOGÍA EXPERIMENTAL 3.1 Análisis Previos Se utilizaron los filtros con muestra de partículas suspendidas en el aire PM 10 que el Instituto Municipal de Ecología (IME) proporcionó para llevar

Más detalles

TEMA 14 NUEVAS TECNOLOGÍAS PARA EL ESTUDIO DE LAS ENFERMEDADES INFECCIOSAS: MÉTODOS GENÉTICOS

TEMA 14 NUEVAS TECNOLOGÍAS PARA EL ESTUDIO DE LAS ENFERMEDADES INFECCIOSAS: MÉTODOS GENÉTICOS TEMA 14 NUEVAS TECNOLOGÍAS PARA EL ESTUDIO DE LAS ENFERMEDADES INFECCIOSAS: MÉTODOS GENÉTICOS Tema 14. Nuevas tecnologías para el estudio de enfermedades infecciosas: métodos genéticos Métodos genéticos

Más detalles

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri OBJETIVO Desarrollar un banco de datos a partir de plantas de origen indudable y del uso

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa?

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa? 2º BIOQUÍMICA CUESTIONES 1. Por qué la PCR convencional no es cuantitativa? En la PCR convencional, la cuantificación del ADN de la muestra es complicada debido a que la eficacia de amplificación va disminuyendo

Más detalles

velocidades de movimiento mediante la aplicación de un campo eléctrico a través de una matriz porosa

velocidades de movimiento mediante la aplicación de un campo eléctrico a través de una matriz porosa INTRODUCCIÓN En general, la electroforesis es una técnica que separa las moléculas en base a sus diferentes velocidades de movimiento mediante la aplicación de un campo eléctrico a través de una matriz

Más detalles

PRÁCTICAS DE MICROBIOLOGIA CLINICA

PRÁCTICAS DE MICROBIOLOGIA CLINICA PRÁCTICAS DE MICROBIOLOGIA CLINICA Juan Carlos Rodríguez Hospital General Universitario de Alicante E-mail: rodriguez_juadia@gva.es http://microbiologia-alicante.umh.es CASO CLINICO: Rubéola Evolución

Más detalles

17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico

17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico 17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico Carmen Alicia Padilla Peña, Jesús Diez Dapena, Emilia Martínez Galisteo, José

Más detalles

PCR. Técnica inventada por Kary Mullis :1987. Premio Nobel 1993. Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN

PCR. Técnica inventada por Kary Mullis :1987. Premio Nobel 1993. Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN PCR PCR Técnica inventada por Kary Mullis :1987 Premio Nobel 1993 Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN Aprovecha los requerimientos de la replicación Templete ADN Nucleótidos

Más detalles

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada La PCR La Reacción en Cadena de la Polimerasa es la herramienta más utilizada PCR- Ventajas y Usos Amplificación ilimitada de secuencias de interés. Rápida, Sencilla y Eficaz. Técnica altamente sensible

Más detalles

5. MATERIALES Y MÉTODOS

5. MATERIALES Y MÉTODOS 5. MATERIALES Y MÉTODOS 5.1 Equipos Los siguientes termocicladores se emplearon para la amplificación por PCR: - Perkin Elmer, GeneAmp PCR System 2400. - Perkin Elmer, GeneAmp PCR System 9600. - Applied

Más detalles

AUTOR: JORGE CONTRERAS PINEDA 1. Titulo:

AUTOR: JORGE CONTRERAS PINEDA 1. Titulo: Página 1 de 1 1. Titulo: Electroforesis de DNA 2. Objetivo Conocer los principios básicos de la electroforesis horizontal en geles de agarosa y aplicarlo para la separación de DNA humano, plasmídico, recombinante

Más detalles

DETECCIÓN DEL GENOMA DEL VPPA MEDIANTE REACCIÓN EN CADENA DE LA POLIMERASA (PCR) CONVENCIONAL REV. 2013 1. OBJETO.

DETECCIÓN DEL GENOMA DEL VPPA MEDIANTE REACCIÓN EN CADENA DE LA POLIMERASA (PCR) CONVENCIONAL REV. 2013 1. OBJETO. Página 1 de 7 CONTENIDO CENTRO DE INVESTIGACION EN SANIDAD ANIMAL (CISA-INIA) Laboratorio de Referencia de la UE de PPA (EURL-ASF) Centro de Investigación en Sanidad Animal CISA-INIA, Valdeolmos 28130,

Más detalles

Protocolos de secuenciación de ADN

Protocolos de secuenciación de ADN 1 Protocolos de secuenciación de ADN Introducción El método de secuenciación utilizado aquí es el desarrollado por Sanger en 1975. Este consiste en la incorporación de didesixinucleótidos marcados fluorescentemente

Más detalles

DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino

DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino DIAGNOSTICO VIROLOGICO MOLECULAR Dr. Gerardo Andino DIAGNÓSTICO MOLECULAR La tecnología empleada para la detección de genomas virales mediante la amplificación de secuencias específicas (PCR y reacciones

Más detalles

Reacción en cadena de la Polimerasa (PCR)

Reacción en cadena de la Polimerasa (PCR) Explicación de TP Nº 2 Reacción en cadena de la Polimerasa (PCR) Química Biológica Patológica Dra. Mariana L. Ferramola Dra. Gabriela Lacoste 2015 Definición de PCR Es la amplificación enzimática de un

Más detalles

Investigación en genes. Tecnología del ADN recombinante

Investigación en genes. Tecnología del ADN recombinante Investigación en genes Tecnología del ADN recombinante Tecnología del ADN recombinante 1º parte: Conocimientos básicos que posibilitaron su desarrollo 2º parte: Instrumentos básicos 3º parte Ejemplos Conocimientos

Más detalles

C V C. Instrucciones de uso de Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02. Revisión 2. Julio de 2014

C V C. Instrucciones de uso de Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02. Revisión 2. Julio de 2014 DOT142v1 Instructions for Use Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Página 1 de 7 Instrucciones de uso de Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Revisión 2 Julio de

Más detalles

Biotechnology Explorer. Kit de huella genética (ADN fingerprint) Manual de instrucciones. Número de catálogo 166-0007-EDU. www.explorer.bio-rad.

Biotechnology Explorer. Kit de huella genética (ADN fingerprint) Manual de instrucciones. Número de catálogo 166-0007-EDU. www.explorer.bio-rad. Biotechnology Explorer Kit de huella genética (ADN fingerprint) Manual de instrucciones Número de catálogo 166-0007-EDU www.explorer.bio-rad.com Los reactivos liofilizados se pueden almacenar a temperatura

Más detalles

GUIA DE LABORATORIO PRACTICA 8 EXTRACCIÓN ADN PROGRAMA DE ENFERMERIA CURSO INTEGRADO DE PROCESOS BIOLOGICOS

GUIA DE LABORATORIO PRACTICA 8 EXTRACCIÓN ADN PROGRAMA DE ENFERMERIA CURSO INTEGRADO DE PROCESOS BIOLOGICOS GUIA DE LABORATORIO PRACTICA 8 EXTRACCIÓN ADN PROGRAMA DE ENFERMERIA CURSO INTEGRADO DE PROCESOS BIOLOGICOS Leidy Diana Ardila Leal Docente. INTRODUCCIÓN En esta práctica se va a realizar la extracción

Más detalles

DIAGNÓSTICO GENÉTICO DEL CÁNCER HEREDITARIO Ref.PCRCAN(4 prácticas)

DIAGNÓSTICO GENÉTICO DEL CÁNCER HEREDITARIO Ref.PCRCAN(4 prácticas) DIAGNÓSTICO GENÉTICO DEL CÁNCER HEREDITARIO Ref.PCRCAN(4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción

Más detalles

REACCIÓN EN CADENA DE LA POLIMERASA (PCR)

REACCIÓN EN CADENA DE LA POLIMERASA (PCR) REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Microbiología General Microbiología M de los Alimentos Licenciatura en Bioquímica i Ingeniería en alimentos c Microbiología r 2015 Licenciatura en Biotecnología

Más detalles

REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Microbiología de los Alimentos Ingeniería en alimentos

REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Microbiología de los Alimentos Ingeniería en alimentos REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Microbiología de los Alimentos Ingeniería en alimentos 2015 Desarrollada por Kary Mullis en 1986 Técnica in vitro que permite amplificar enzimáticamente una región

Más detalles

ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA

ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA FACULTAD DE VETERINARIA DEPARTAMENTO DE SANIDAD ANIMAL ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA GUIÓN DE PRÁCTICAS DE LABORATORIO CURSO 2014 2015 MÓDULO: PORCINO Síndrome respiratorio y reproductor

Más detalles

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas ELEMENTOS BÁSICOS DE LA INVESTIGACIÓN EN GENES Análisis

Más detalles

EFECTO DE LA DIGESTIÓN SOBRE PROTEINAS, GRASAS Y GLÚCIDOS

EFECTO DE LA DIGESTIÓN SOBRE PROTEINAS, GRASAS Y GLÚCIDOS EFECTO DE LA DIGESTIÓN SOBRE PROTEINAS, GRASAS Y GLÚCIDOS Objetivos: Mª Jesús González García Mª Amparo Mora Alcácer COLEGIO AVE Mª DE PENYA-ROJA Aprender a trabajar en el laboratorio y apreciar el orden,

Más detalles

PROCEDIMIENTO PARA LA UTILIZACIÓN DEL POLIMORFISMO DEL GEN COMT (CATECOL-OXI-METILTRANSFERASA) EN EL DIAGNÓSTICO DEL SÍNDROME DE FIBROMIALGIA

PROCEDIMIENTO PARA LA UTILIZACIÓN DEL POLIMORFISMO DEL GEN COMT (CATECOL-OXI-METILTRANSFERASA) EN EL DIAGNÓSTICO DEL SÍNDROME DE FIBROMIALGIA 2 PROCEDIMIENTO PARA LA UTILIZACIÓN DEL POLIMORFISMO DEL GEN COMT (CATECOL-OXI-METILTRANSFERASA) EN EL DIAGNÓSTICO DEL SÍNDROME DE FIBROMIALGIA D E S C R I P C I Ó N OBJETO DE LA INVENCIÓN La presente

Más detalles

Técnica de PCR. Beatriz Bellosillo. Servei de Patologia, Hospital del Mar, Barcelona, Spain

Técnica de PCR. Beatriz Bellosillo. Servei de Patologia, Hospital del Mar, Barcelona, Spain Técnica de PCR Beatriz Bellosillo Servei de Patologia, Hospital del Mar, Barcelona, Spain Biología Molecular Estudio de los procesos que se desarrollan en los seres vivos desde un punto de vista molecular

Más detalles

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática.

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Departamento de Bioquímica Médica y Biología Molecular Práctica 3 Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Curso 1 Medicina (Abril) 2012 BIOQUÍMICA

Más detalles

PROBLEMAS MÁS FRECUENTES Y POSIBLES SOLUCIONES

PROBLEMAS MÁS FRECUENTES Y POSIBLES SOLUCIONES PROBLEMAS MÁS FRECUENTES Y POSIBLES SOLUCIONES NO SE PRODUCE REACCIÓN O ÉSTA DECAE POCO DESPUÉS DE COMENZAR No hay ADN o hay menos del necesario No hay cebador o la concentración es inferior a la necesaria.

Más detalles

MATERIALES Y MÉTODOS. Cepas Utilizadas

MATERIALES Y MÉTODOS. Cepas Utilizadas MATERIALES Y MÉTODOS Cepas Utilizadas Para el presente trabajo se utilizaron tres cepas Tipo: Mycobacterium aviumintracellulare (proporcionada al Laboratorio Estatal de Salud Pública por el Instituto Nacional

Más detalles

Análisis de la Presencia de Organismos Genéticamente Modificados en Muestras de Alimentos

Análisis de la Presencia de Organismos Genéticamente Modificados en Muestras de Alimentos Análisis de la Presencia de Organismos Genéticamente Modificados en Muestras de Alimentos Sesión nº 5 Electroforesis en gel de agarosa M. Somma, M. Querci WORLD HEALTH ORGANIZATION REGIONAL OFFICE FOR

Más detalles

PROBLEMAS MAS FRECUENTES DURANTE LA SECUENCIACIÓN NO SE PRODUCE REACCION O ESTA DECAE POCO DESPUÉS DE COMENZAR

PROBLEMAS MAS FRECUENTES DURANTE LA SECUENCIACIÓN NO SE PRODUCE REACCION O ESTA DECAE POCO DESPUÉS DE COMENZAR PROBLEMAS MAS FRECUENTES DURANTE LA SECUENCIACIÓN NO SE PRODUCE REACCION O ESTA DECAE POCO DESPUÉS DE COMENZAR Las causas pueden ser las siguientes: No hay ADN o se encuentra en muy baja concentración.

Más detalles

23. Hidrólisis ácida y enzimática del glucógeno

23. Hidrólisis ácida y enzimática del glucógeno 23. Hidrólisis ácida y enzimática del glucógeno Emilia Martínez Galisteo, Carmen Alicia Padilla Peña, Concepción García Alfonso, José Antonio Bárcena Ruiz, Jesús Diez Dapena. Departamento de Bioquímica

Más detalles

Laboratorio Biología Molecular: EPSH. Universidad de Zaragoza

Laboratorio Biología Molecular: EPSH. Universidad de Zaragoza GEL DE POLIACRILAMIDA A) Preparación del soporte del gel: Para hacer el gel se utilizan dos láminas de vidrio (cristal en "U" y cristal recto) unidas con cinta adhesiva. Estas láminas son diferentes, se

Más detalles

N 1 Reacción n en Cadena de la Polimerasa

N 1 Reacción n en Cadena de la Polimerasa Trabajo Práctico N 1 Reacción n en Cadena de la Polimerasa Definición n e importancia. Usos y aplicaciones. Optimización. Tipos de PCR. Electroforesis. Fundamentos. Asociado al Programa Teórico: Tema 2.

Más detalles

ELECTROFORESIS EN GELES DE POLIACRILAMIDA SDS-PAGE. Presencia de Sodio Dodecil Sulfato bajo condiciones reductoras (SDSPAGE)

ELECTROFORESIS EN GELES DE POLIACRILAMIDA SDS-PAGE. Presencia de Sodio Dodecil Sulfato bajo condiciones reductoras (SDSPAGE) ELECTROFORESIS EN GELES DE POLIACRILAMIDA SDSPAGE Presencia de Sodio Dodecil Sulfato bajo condiciones reductoras (SDSPAGE) Método rápido, reproducible y de bajo costo Utilizado para cuantificar, comparar

Más detalles

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras METODOLOGIA DEL PCR Lic. Jorge Mato Luis Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras Desnaturalización del DNA 5 A G G T T A G T G G A C C C T T G A T 3 3 T C C A

Más detalles

TÉCNICAS MOLECULARES EN LA DETECCIÓN DE ORGANISMOS GENÉTICAMENTE MODIFICADOS

TÉCNICAS MOLECULARES EN LA DETECCIÓN DE ORGANISMOS GENÉTICAMENTE MODIFICADOS TÉCNICAS MOLECULARES EN LA DETECCIÓN DE ORGANISMOS GENÉTICAMENTE MODIFICADOS EN LOS ALIMENTOS. Aplicación de la reacción en cadena de la polimerasa Marta Terrón Cuadrado Junio 2008 Curso de Experto Universitario

Más detalles

1 MATERIALES Y MÉTODOS

1 MATERIALES Y MÉTODOS 1 MATERIALES Y MÉTODOS El presente protocolo experimental contempla la amplificación del DNA de las bacterias y virus causantes de las ETS Neisseria gonorrhoeae, Chlamydia trachomatis y VPH mediante PCR

Más detalles

UNIVERSIDAD NACIONAL DE MISIONES Facultad de Ciencias Exactas Químicas y Naturales TRABAJO PRÁCTICO Nº 4 REACCIÓN EN CADENA DE LA POLIMERASA (PCR)

UNIVERSIDAD NACIONAL DE MISIONES Facultad de Ciencias Exactas Químicas y Naturales TRABAJO PRÁCTICO Nº 4 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) TRABAJO PRÁCTICO Nº 4 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) INTRODUCCIÓN La reacción en cadena de la polimerasa o PCR (del inglés Polymerase Chain Reaction) es una técnica relativamente simple y poderosa

Más detalles

Técnicas de ADN recombinante: la manipulación genética

Técnicas de ADN recombinante: la manipulación genética Técnicas de ADN recombinante: la manipulación genética A partir de los años 70 se desarrollaron las herramientas de la biología molecular o la ingeniería genética o lo que se ha llamado técnicas del ADN

Más detalles

Laboratorio. Objetivos I N T R O D U C C I Ó N. Al finalizar este laboratorio el estudiante podrá:

Laboratorio. Objetivos I N T R O D U C C I Ó N. Al finalizar este laboratorio el estudiante podrá: Laboratorio 12 Biología molecular Objetivos Al finalizar este laboratorio el estudiante podrá: 1. Conocer los principios básicos de la técnica de electroforesis y su aplicación al análisis del ADN. 2.

Más detalles

INGENIERÍA GENÉTICA 5 GAATTC 3 3 CTTAAG 5

INGENIERÍA GENÉTICA 5 GAATTC 3 3 CTTAAG 5 INGENIERÍA GENÉTICA 1. Fundamentos básicos de la ingeniería genética 2. Desnaturalización e hibridación del ADN 3. Reacción en cadena de la polimerasa (PCR) 4. Nuevas disciplinas surgidas de la ingeniería

Más detalles

Química Biológica Patológica Técnicas de Biología Molecular aplicadas a Bioquímica Clínica Tema 2 Dra. Silvia Varas qbpatologica.unsl@gmail.com Tema 2 PCR Historia Bases Optimización de una reacción de

Más detalles

8º CONGRESO IBEROAMERICANO DE INGENIERIA MECANICA Cusco, 23 al 25 de Octubre de 2007

8º CONGRESO IBEROAMERICANO DE INGENIERIA MECANICA Cusco, 23 al 25 de Octubre de 2007 8º CONGRESO IBEROAMERICANO DE INGENIERIA MECANICA Cusco, 23 al 25 de Octubre de 2007 SIMULACIÓN Y ANÁLISIS TÉRMICO DE UN PROTOTIPO DE PORTA MUESTRAS PARA UN TERMOCICLADOR PARA USO EN INGENIERÍA Y BIOLOGÍA

Más detalles

Biotecnología Aplicada

Biotecnología Aplicada Módulo de Diagnóstico Molecular Laboratono de Biotecnologta del PIF Biotecnología Aplicada ARN mensajero (ARNm) Es la copia de un gen. Actúa teniendo una secuencia de nucleótidos complementaria a una cadena

Más detalles

UNIVERSIDAD DE PUERTO RICO EN AGUADILLA DEPARTAMENTO DE CIENCIAS NATURALES. Laboratorio de Genética BIOL 3306

UNIVERSIDAD DE PUERTO RICO EN AGUADILLA DEPARTAMENTO DE CIENCIAS NATURALES. Laboratorio de Genética BIOL 3306 UNIVERSIDAD DE PUERTO RICO EN AGUADILLA DEPARTAMENTO DE CIENCIAS NATURALES Laboratorio de Genética BIOL 3306 Liza V. Jiménez Rodríguez, Ph.D. Agosto, 2014 Pre-prueba I. Pareo 1) Geles de agarosa 2) Loading

Más detalles

Guía de PCR en tiempo real

Guía de PCR en tiempo real Guía de PCR en tiempo real Michelle C. Chirinos-Arias michelle.christine16@gmail.com Índice Introducción. 2 Algunos conceptos. 2 PCR (reacción en cadena de la polimerasa)... 2 PCR en tiempo real (qpcr)..

Más detalles

CAPÍTULO VI. Expresión de genes relacionados con apoptosis

CAPÍTULO VI. Expresión de genes relacionados con apoptosis CAPÍTULO VI Expresión de genes relacionados con apoptosis 1.- Introducción 2.- Protocolos para análisis genéticos 3.- Resultados en MCF-7 4.- Discusión 1.- Introducción Como se ha descrito anteriormente,

Más detalles

SÍNTESIS DEL ÁCIDO ACETIL SALICÍLICO

SÍNTESIS DEL ÁCIDO ACETIL SALICÍLICO PRÁCTICA 10: SÍNTESIS DEL ÁCIDO ACETIL SALICÍLICO 1. INTRODUCCIÓN En esta práctica llevaremos a cabo un proceso sencillo de síntesis de un fármaco: la síntesis del ácido acetilsalicílico. El extracto de

Más detalles

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

PCR SIMULADA. Ref.PCR Simulada (4 prácticas) 1. OBJETIVO DEL EXPERIMENTO

PCR SIMULADA. Ref.PCR Simulada (4 prácticas) 1. OBJETIVO DEL EXPERIMENTO Ref.PCR Simulada (4 prácticas) 1. OBJETIVO DEL EXPERIMENTO PCR SIMULADA El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

TEMA 7. TÉCNICAS EN BIOLOGÍA MOLECULAR: DETECCIÓN E IDENTIFICACIÓN DE MICROORGANISMOS

TEMA 7. TÉCNICAS EN BIOLOGÍA MOLECULAR: DETECCIÓN E IDENTIFICACIÓN DE MICROORGANISMOS TEMA 7. TÉCNICAS EN BIOLOGÍA MOLECULAR: DETECCIÓN E IDENTIFICACIÓN DE MICROORGANISMOS I. TÉCNICAS EN BIOLOGÍA MOLECULAR: ESQUEMA DE TÉCNICAS UTILIZADAS 1. TECNICAS DE HIBRIDACIÓN CON SONDAS DE ACIDOS NUCLEICOS.

Más detalles

REACCIÓN EN CADENA DE LA POLIMERASA (PCR)

REACCIÓN EN CADENA DE LA POLIMERASA (PCR) REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Lic. en Bioquímica Lic. en Biotecnología Microbiología de los Alimentos 2016 Desarrollada por Kary Mullis en 1986 Técnica in vitro que permite amplificar enzimáticamente

Más detalles

ELECTROFORESIS EN GELES DE AGAROSA. Agustín Garrido. agugarrido@hotmail.com

ELECTROFORESIS EN GELES DE AGAROSA. Agustín Garrido. agugarrido@hotmail.com 1 ELECTROFORESIS EN GELES DE AGAROSA Agustín Garrido agugarrido@hotmail.com Introducción En este trabajo práctico se utilizó la técnica de electroforesis. Este proceso se basa en la migración de las moléculas

Más detalles

PCR? PCR en el diagnóstico? Objetivo: Obtener un gran número de copias de un fragmento particular de ADN a partir de una cantidad mínima original.

PCR? PCR en el diagnóstico? Objetivo: Obtener un gran número de copias de un fragmento particular de ADN a partir de una cantidad mínima original. PCR? Objetivo: Obtener un gran número de copias de un fragmento particular de ADN a partir de una cantidad mínima original. PCR en el diagnóstico? A partir de una mezcla compleja de ADN, se puede realizar

Más detalles

Análisis de la Presencia de Organismos Genéticamente Modificados en Muestras de Alimentos

Análisis de la Presencia de Organismos Genéticamente Modificados en Muestras de Alimentos Análisis de la Presencia de Organismos Genéticamente Modificados en Muestras de Alimentos Sesión nº 6 Reacción en Cadena de la Polimerasa (PCR) M. Somma, M. Querci WORLD HEALTH ORGANIZATION REGIONAL OFFICE

Más detalles

ScanGel NEUTRAL 86429 48 Tarjetas 86430 1080 Tarjetas

ScanGel NEUTRAL 86429 48 Tarjetas 86430 1080 Tarjetas ScanGel NEUTRAL 86429 48 Tarjetas 86430 1080 Tarjetas GEL NEUTRO Grupo sérico, screening de Ac irregulares, pruebas cruzadas IVD Todos los productos fabricados y comercializados por la sociedad Bio-Rad

Más detalles

GUÍA PARA LA SECUENCIACIÓN AUTOMÁTICA DE DNA

GUÍA PARA LA SECUENCIACIÓN AUTOMÁTICA DE DNA Página 1 de 16 GUÍA PARA LA SECUENCIACIÓN AUTOMÁTICA DE DNA SERVICIO DE SECUENCIACIÓN-S.C.S.I.E. UNIVERSITAT DE VALÈNCIA Página 2 de 16 CONTENIDOS: 1.- Secuenciación automática de DNA 2.- Tipos de molde

Más detalles

Práctica 5 CINÉTICA ENZIMÁTICA: DETERMINACIÓN ESPECTOFOTOMÉTRICA DE LA CONSTANTE DE MICHAELIS-MENTEN DE LA PAPAÍNA

Práctica 5 CINÉTICA ENZIMÁTICA: DETERMINACIÓN ESPECTOFOTOMÉTRICA DE LA CONSTANTE DE MICHAELIS-MENTEN DE LA PAPAÍNA Práctica 5 CINÉTICA ENZIMÁTICA: DETERMINACIÓN ESPECTOFOTOMÉTRICA DE LA CONSTANTE DE MICHAELIS-MENTEN DE LA PAPAÍNA 1. Objetivo Se pretende calcular la constante de Michaelis-Menten (K M ), la constante

Más detalles

TaqMan GMO Maize Quantification Kit. Part No: 4481972

TaqMan GMO Maize Quantification Kit. Part No: 4481972 TaqMan GMO Maize Quantification Kit Part No: 4481972 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan

Más detalles

Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares. Técnicas Moleculares. Técnicas Moleculares 8/13/13

Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares. Técnicas Moleculares. Técnicas Moleculares 8/13/13 8/13/13 Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares CAF516 O Recursos Genéticos y Biotecnología 14 Agosto 2013 Técnicas Moleculares Aplicaciones en muchas disciplinas Generan

Más detalles

Veamos rápidamente el ciclo celular

Veamos rápidamente el ciclo celular Replicación del adn Veamos rápidamente el ciclo celular Fase G1: Fase de crecimiento celular. Fase G2: la célula ya duplicó su material genético, y se prepara para la mitosis. Fase M: fase de división

Más detalles

7.012 Serie de ejercicios 5

7.012 Serie de ejercicios 5 Nombre Grupo 7.012 Serie de ejercicios 5 Pregunta 1 Al estudiar los problemas de esterilidad, usted intenta aislar un hipotético gen de conejo que explique la prolífica reproducción de estos animales.

Más detalles

RESOLUCIÓN OENO 5/2007

RESOLUCIÓN OENO 5/2007 RESOLUCIÓN OENO 5/2007 CODEX - GLICOSIDASA LA ASAMBLEA GENERAL Visto el Artículo 2, párrafo 2 iv del acuerdo del 3 de abril de 2001 por el cual se creó la Organización Internacional de la Viña y el Vino,

Más detalles