Blga. Gisely Hijar Guerra. Responsable de los Procesos de la Prueba de Genotipificación de VIH Centro Nacional de Salud Publica

Tamaño: px
Comenzar la demostración a partir de la página:

Download "Blga. Gisely Hijar Guerra. Responsable de los Procesos de la Prueba de Genotipificación de VIH Centro Nacional de Salud Publica"

Transcripción

1 Genotipificación de VIH en el INS: técnica local y técnicas convencionales Blga. Gisely Hijar Guerra Coordinación del Laboratorio de Biotecnología y Biología Molecular. lar Responsable de los Procesos de la Prueba de Genotipificación de VIH Centro Nacional de Salud Publica

2 Variantes resistentes Preexistentes Seleccionadas GENERACIÓN DE RESISTENCIA Fármaco en niveles sub-óptimos Potencia o distribución limitada Absorción pobre Activación incompleta Interacciones Falla en Adherencia Falla del Sist. Inmune Función CD4 CTLs Citoquinas Replicación persistente Evolución de resistencia FALLA DEL Tto.

3 COMO MONITOREAR RESISTENCIA? GENOTIPO CODIGO GENETICO ALTERADO DE LA PROTEINA BLANCO DE LA DROGA HIV DNA DEL PACIENTE FENOTIPO SUSCEPTIBILIDAD ALTERADA A LA DROGA PATIENT HIV

4 GENOTIPIFICACIÓN A A A GA A C A G CT Lys Asp Asn Ser

5 Regiones de PR y RT Evaluadas por test de Resistencia Gag Cleavage Sites p7nc p1 p6 RNase H PR RT IN Affymetrix 242 Visible Genetics 310 PE Biosystems 320 ViroLogic, Inc. 305 Virco 483 9

6 Análisis de la Resistencia a Drogas virco TYPE HIV-1

7 OBJETIVOS Evaluar a las personas afectadas con VIH/SIDA con evidencia de resistencia a los medicamentos antiretrovirales. Implementar los criterios y algoritmos para la utilización de la prueba. Promover el uso racional de la prueba de genotipificaciòn en concordancia con la norma técnica del MINSA.

8 ANTECEDENTES R. J. Nº J-OPD/INS: conforma el Comité Técnico Funcional de Genotipificaciòn del INS y declara actividad prioritaria institucional la implementación del sistema R. J. Nº J-OPD-INS: Aprueba la directiva y dispone que el Laboratorio de Biología Molecular y el Laboratorio de VIH son responsables de todos los procesos de laboratorio.

9 Solicitud de la prueba vía Internet Los médicos responsables de TARGA solicitan la prueba utilizando su usuario y código NETLAB: Formato de solicitud en Web INS Datos del paciente Datos del establecimiento Datos del médico Datos clínicos a. Criterios b. Drogas ARV

10 Verificación paciente - médico Paciente usuario del Programa TARGA MINSA Correspondencia de datos del Paciente Establecimiento Médico autorizado NETLAB envía mensaje Automático por correo electrónico Médico solicitante Comité de expertos LAB. de Biología Molecular LAB. de VIH Coordinador de Equipo

11 Evaluación por Comité de Expertos COMITÉ DE EXPERTOS ESN Revisión de casos clínicos recibidos a la fecha, con participación i ió de un representante t del INS SI aprueba? NO Publicación Vía página Web INS de los resultados de evaluación de los casos y fechas para obtención y envío de muestras

12 Muestra / Separación de Plasma Extracción de ARN RT-PCR Electroforesis Reporte Análisis de Datos Análisis de Datos

13 DE LA MUESTRA A LOS RESULTADOS Pre-Analitica Analitica Post-Analitica

14 Colecta de la muestra Pre-Analítica Envío y Almacenamiento Codificación de muestra Extracción de Ac. Nucleico Amplificación de Ac. Analítica Nucleico Edición de Secuencia Ensamblaje de Secuencia Secuenciamiento Automático Alineamiento de Secuencia Post-Analítica Determinación de mutaciones Reporte de resultados

15 MUESTRA : Sangre Total

16 CONSIDERACIONES DE LA MUESTRA PACIENTE : EN AYUNAS TIPO DE MUESTRA: SANGRE TIPO DE TUBO : TUBO AL VACIO CON EDTA DE 5 7 CC. TEMP. TRANSPORTE :AMBIENTE TIEMPO DESDE QUE SE TOMA LA MUESTRA HASTA QUE SE SEPARA EL PLASMA : 24 HORAS.

17 SEPARACIÓN DEL PLASMA Y EXTRACCIÓN DEL MATERIAL GENETICO (ARN ) Controles de la Prueba Controles Mutantes Controles Silvestres

18 TRANSCRIPCIÓN REVERSA (RT) Y REACCIÓN DE LA CADENA DE LA POLIMERASA (PCR)

19 RT-PCR (Reverse Transcription PCR) RNA c DNA

20 ELECTROFORESIS

21 PURIFICACIÓN Y CUANTIFICACIÓN DE PRODUCTOS DE PCR

22 ÁREA SEGUNDA AMPLIFICACIÓN SEGUNDO PCR

23 SECUENCIAMIENTO DE PRODUCTOS DE PCR (Equipo : Analizador Genético)

24 SOFTWARE Sequencing Analysis ANÁLISIS DE SECUENCIAS DE ADN DEL VIH

25 SOFTWARE : SeqScape

26 La secuencia de ADN del virus obtenido es ingresado en la base de datos de la Universidad de Stanford empleando para ello el Programa HIVdb. Este programa analiza las secuencias y determina si están presentes las mutaciones del virus relacionadas a la resistencia antiretroviral.

27

28 Acceso al resultado Los médicos usuarios del NETLAB, utilizarán el mismo USUARIO y CODIGO, con el que ven los resultados de CD4 y carga viral. El Comité de Expertos tendrá acceso a los resultados para elaborar las recomendaciones.

29 PLAZOS DEL PROCESO Solicitud de la prueba Autorización del Comité 15 DIAS (máx.) Resultados NETLAB Obtención de muestras 15 DIAS (*) (*)Si el resultado es indeterminado es necesario repetir la prueba. Recomendaciones del Comité 15 DIAS (máx.)

30 Acceso al informe del Comité Los médicos usuarios del NETLAB Comité de Expertos Estrategia Sanitaria INS PVVS

31 Por qué son útiles y necesarios los ensayos de Resistencia Asiste al médico en la toma de decisiones terapéuticas en distintos escenarios: Clarifica los tratamientos disponibles Selecciona los regímenes mas activos Mejora el resultado clínico Clarifica la etiología de los aumentos de carga viral Reduce el uso de drogas inactivas. Provee beneficios a nivel de salud pública Clarifica la epidemiología de la resistencia al HIV reduce transmisión de virus resistentes Permite mejorar las guías de tratamiento Asiste en el desarrollo de nuevas drogas terapéuticas ti

32 AGRADECIMIENTOS Dr Robert Grant Robert Hance Maribel Acuña Carlos Yabar Equipo del laboratorio de VIH y Biología Molecular

PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH

PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH Blga. Gisely Hijar Guerra Coordinación del Laboratorio de Biotecnología y Biología Molecular. Responsable de los Procesos de la Prueba

Más detalles

Perinatal Transmisión al bebé, durante el embarazo, parto o lactancia.

Perinatal Transmisión al bebé, durante el embarazo, parto o lactancia. Dr. Horacio Salomón Investigador Principal del CONICET Director del INBIRS (Ex-CNRSIDA) UBA-CONICET Contacto sexual Relaciones sexuales sin protección por contacto directo con fluidos corporales como secreciones

Más detalles

APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR. Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina

APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR. Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina BiologÍa Molecular: es una disciplina que se enfoca principalmente en el estudio

Más detalles

FORMATO 1. ASIGNATURA

FORMATO 1. ASIGNATURA FORMATO 1. ASIGNATURA Nombre de la asignatura: MCBA-0707-ITEL Técnicas Biotecnológicas de Diagnóstico Línea de investigación o trabajo: Biotecnología en Ciencia Animal - Horas prácticas - Horas trabajo

Más detalles

EVOLUCIÓN DEL VIRUS DE LA INMUNODEFICIENCIA HUMANA (VIH-1): MUTACIONES REVERTANTES EN EL GEN DE LA TRANSCRIPTASA REVERSA

EVOLUCIÓN DEL VIRUS DE LA INMUNODEFICIENCIA HUMANA (VIH-1): MUTACIONES REVERTANTES EN EL GEN DE LA TRANSCRIPTASA REVERSA EVOLUCIÓN DEL VIRUS DE LA INMUNODEFICIENCIA HUMANA (VIH-1): MUTACIONES REVERTANTES EN EL GEN DE LA TRANSCRIPTASA REVERSA Liliana Gómez Flores Ramos 1, Martha Escoto Delgadillo 2, Eduardo Vázquez Valls

Más detalles

Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio

Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio El VIRUS PRUEBAS PRESUNTIVAS ELISA: es la prueba convencional para la detección

Más detalles

Unidad de Investigación Clínica Ensayos Clínicos Fase I y II. Unidad de Investigació

Unidad de Investigación Clínica Ensayos Clínicos Fase I y II. Unidad de Investigació Unidad de Investigación Clínica Ensayos Clínicos Fase I y II La Unidad de Investigació Investigación Clí Clínica (UIC) es un proyecto adscrito al Subprograma de Dinamizació Dinamización del Entorno Investigador

Más detalles

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico.

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. AQUAGESTION ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. Noviembre 2011 ACTUALIDAD Este año Sernapesca confirma

Más detalles

P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA"

P.C.R. Técnica de amplificación enzimática de secuencias específicas de DNA P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA" Paso 1: Desnaturalización del DNA Paso 2: Hibridación de los "Primers" Paso 3: Extensión Paso 1: Desnaturalización del DNA

Más detalles

DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino

DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino DIAGNOSTICO VIROLOGICO MOLECULAR Dr. Gerardo Andino DIAGNÓSTICO MOLECULAR La tecnología empleada para la detección de genomas virales mediante la amplificación de secuencias específicas (PCR y reacciones

Más detalles

Nuevos ensayos moleculares de la tecnología SUMA para el diagnóstico de las hepatitis B y C

Nuevos ensayos moleculares de la tecnología SUMA para el diagnóstico de las hepatitis B y C Nuevos ensayos moleculares de la tecnología SUMA para el diagnóstico de las hepatitis B y C MSc. Anny Armas Cayarga Laboratorio de Biología Molecular Centro de Inmunoensayo Octubre 16, 2015 Qué es el diagnóstico

Más detalles

SITUACIONES NO REGULADAS EN LA LEGISLACIÓN ESPAÑOLA ACTUAL SOBRE INVESTIGACIÓN EN BIOMEDICINA: A PROPÓSITO DE UN CASO PRÁCTICO

SITUACIONES NO REGULADAS EN LA LEGISLACIÓN ESPAÑOLA ACTUAL SOBRE INVESTIGACIÓN EN BIOMEDICINA: A PROPÓSITO DE UN CASO PRÁCTICO SITUACIONES NO REGULADAS EN LA LEGISLACIÓN ESPAÑOLA ACTUAL SOBRE INVESTIGACIÓN EN BIOMEDICINA: A PROPÓSITO DE UN CASO PRÁCTICO I. Gil-Aldea*, A. Cemborain**, P. Rodríguez-Wilhemi** *Biobanco Navarrabiomed.

Más detalles

Pablo Galindo Orrego. Residente Medicina Interna. Universidad de La Sabana, Bogotá 2012.

Pablo Galindo Orrego. Residente Medicina Interna. Universidad de La Sabana, Bogotá 2012. RESISTENCIAS DEL VIH POR GENOTIPIFICACIÓN Y CARACTERISTICAS ASOCIADAS, EN PACIENTES SIN EXPOSICIÓN PREVIA A TRATAMIENTO ANTIRRETROVIRAL-TAR (NAÏVE o VÍGENES A TRATAMIENTO), BAJO ATENCIÓN INTEGRAL ESPECIALIZADA

Más detalles

Estrategia utilizada

Estrategia utilizada Estrategia utilizada 1) Extracción HIV RNA V3 7114 7218 2) One Step RT-PCR (x triplicado) 3) 2 nd PCR (A1 A2 A3) A1 A2 A3 4) Secuencuiación A1 A2 A3 TGTACAAGACCCAACAACAATACAAGAAAAAGTATACATGTAGGACG AGGGAGATCAATTTATGCAACAGAAAAAATAATAGGAGATACAAAAC

Más detalles

Facultad de Ciencias Bioquímicas y Farmacéuticas Área de Integración n Disciplinar y Estudio de la Problemática Profesional TPP I Unidad 2 Aspectos biológicos del VIH Algunos datos importantes 1959 Se

Más detalles

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR)

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) Centro de de Microscopía Electrónica Facultad de de Ciencias Médicas Universidad Nacional de de Córdoba

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

PERFIL DE LOS NUEVOS CABA 2010-2011

PERFIL DE LOS NUEVOS CABA 2010-2011 PERFIL DE LOS NUEVOS DIAGNÓSTICOS CABA 2010-2011 Distribución de las notificaciones según sexo y estadio clínico al momento del diagnóstico CABA 2010-2011 Estadio % mujeres % hombres SRA 1,9 1,8 Asintomático

Más detalles

CONVENIO 036 de 2012

CONVENIO 036 de 2012 CONVENIO 036 de 2012 Guía de Práctica Clínica basada en la evidencia científica para la atención integral del VIH/Sida en niñas y niños. Guía de práctica clínica basada en la evidencia científica para

Más detalles

Elementos genéticos móviles

Elementos genéticos móviles Elementos genéticos móviles Elementos genéticos móviles Se pueden mover de un lado a otro del genoma Diferentes nombres: Elementos controladores Genes saltarines Genes móviles Transposones Elementos transponibles

Más detalles

Diagnóstico microbiológico de la infección por HIV

Diagnóstico microbiológico de la infección por HIV Diagnóstico microbiológico de la infección por HIV Juan Carlos Rodríguez Díaz S. Microbiología Hospital General Universitario de Alicante E-mail: rodriguez_juadia@gva.es http://microbiología-alicante.umh.es

Más detalles

ESTRATEGIAS PARA LA DETECCÍON Y DIAGNOSIS DE VIRUS EN PLATANOS Y BANANOS EN LA COMUNIDAD ANDINA DE NACIONES

ESTRATEGIAS PARA LA DETECCÍON Y DIAGNOSIS DE VIRUS EN PLATANOS Y BANANOS EN LA COMUNIDAD ANDINA DE NACIONES ESTRATEGIAS PARA LA DETECCÍON Y DIAGNOSIS DE VIRUS EN PLATANOS Y BANANOS EN LA COMUNIDAD ANDINA DE NACIONES CIRO BARRERA Instituto Nacional de Innovación Agraria (INIA) PERÚ Piura, Junio 2011 INTRODUCCION

Más detalles

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now.

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now. Unidad Curricular: Virología y Micología Veterinaria 1 TRABAJO PRÁCTICO No. 3 AMPLIFICACIÓN DE GENES VIRALES Reacción en Cadena de la Polimerasa, conocida como PCR (por sus siglas en inglés: Polimerase

Más detalles

NOCIONES DE EPIDEMIOLOGÍA Y DIAGNOSTICO DE HIV. Dra G Carballal Laboratorio de Virología Clínica CEMIC, 2009

NOCIONES DE EPIDEMIOLOGÍA Y DIAGNOSTICO DE HIV. Dra G Carballal Laboratorio de Virología Clínica CEMIC, 2009 NOCIONES DE EPIDEMIOLOGÍA Y DIAGNOSTICO DE HIV Dra G Carballal Laboratorio de Virología Clínica CEMIC, 2009 La Pandemia de SIDA Personas que viven con el HIV/SIDA Total 40 millones Adultos 38 Niños 2 Nuevas

Más detalles

Informe de vigilancia basada en laboratorio del dengue

Informe de vigilancia basada en laboratorio del dengue Centro Nacional de Referencia de Virología Informe de vigilancia basada en laboratorio del dengue Período: enero a diciembre, 2012 Volumen 1, Número 1, 2013 Fecha: 29-01-13 1. Introducción Contenidos 2.

Más detalles

Técnicas moleculares.

Técnicas moleculares. Técnicas moleculares. DMTV Carolina Acevedo Curso de Microbiología 2015 SÍNTESIS IN VITRO DE UNA GRAN CANTIDAD DE COPIAS DE UN SEGMENTO DE ADN EXISTENTE EN UNA MUESTRA. O sea. Amplificamos en forma exponencial

Más detalles

ALBERTO JIMÉNEZ BENÍTEZ 1º BACH

ALBERTO JIMÉNEZ BENÍTEZ 1º BACH ALBERTO JIMÉNEZ BENÍTEZ 1º BACH 1.) Las características principales del virus (estructura, genoma ) A pesar de su pequeño tamaño, el genoma es muy complejo. El ARN del VIH contiene instrucciones genéticas

Más detalles

CURSO ACADÉMICO 2012-2013

CURSO ACADÉMICO 2012-2013 TITULACIÓN: BIOLOGÍA CURSO ACADÉMICO 2012-2013 GENÉTICA APLICADA CÓDIGO: 200810419 Departamento de adscripción: Parasitología, ecología y Genética Área de conocimiento: Genética Ciclo:2º Curso: 4º Tipo:

Más detalles

8 Congreso Argentino de Salud Integral del Adolescente. Dr. Eduardo Rubinstein. Hospital Francisco J. Muñiz Adolescencia

8 Congreso Argentino de Salud Integral del Adolescente. Dr. Eduardo Rubinstein. Hospital Francisco J. Muñiz Adolescencia 8 Congreso Argentino de Salud Integral del Adolescente Dr. Eduardo Rubinstein Hospital Francisco J. Muñiz Adolescencia VIH EN ADOLESCENTES: QUE HAY DE NUEVO? En diagnóstico de infección por VIH En seguimiento

Más detalles

Coinfección VIH / VHC /VHB. Aspectos relevantes de su seguimiento.

Coinfección VIH / VHC /VHB. Aspectos relevantes de su seguimiento. Coinfección VIH / VHC /VHB. Aspectos relevantes de su seguimiento. VIH VHC VHB Porque es importante tener en cuenta la coinfección por VHC y por VHB en el paciente VIH? Importancia epidemiológica 1ª) Alta

Más detalles

co 2012 2013 la Asignatura VETERINARIA SEGUNDO Nombre de de la asignatura GENÉTICA Créditos Teóricos Periodo Grupos de conocimiento to Genética

co 2012 2013 la Asignatura VETERINARIA SEGUNDO Nombre de de la asignatura GENÉTICA Créditos Teóricos Periodo Grupos de conocimiento to Genética Curso Académic co 2012 2013 VETERINARIA SEGUNDO GENÉTICA GUÍA DOCENTE 1.- Características de la asignatura Nombre de la Asignatura GENÉTICA Totales Créditos Teóricos Prácticos Grupos Teoría Práctica Troncal

Más detalles

REGISTRO SANITARIO DE PRODUCTOS BIOLÓGICOS/ BIOTECNOLÓGICOS

REGISTRO SANITARIO DE PRODUCTOS BIOLÓGICOS/ BIOTECNOLÓGICOS REGISTRO SANITARIO DE PRODUCTOS BIOLÓGICOS/ BIOTECNOLÓGICOS REPÚBLICA DE PANAMÁ PRESENTADO POR: LICDA. KYRHIAM CASTILLO CHIAL MINISTERIO DE SALUD DIRECCIÓN N NACIONAL DE FARMACIAS Y DROGAS Registro Sanitario

Más detalles

GenomeLab GeXP Sistema de Análisis Genético

GenomeLab GeXP Sistema de Análisis Genético GenomeLab GeXP Sistema de Análisis Genético PLATAFORMA CON MULTIPLES APLICACIONES DETECCIÓN DE VIRUS, BACTERIAS, LEVADURAS, HONGOS, APLICACIONES ESPECIALES, ETC. GenomeLab GeXP GenomeLab GeXP Qué es? Es

Más detalles

Administración Nacional de Medicamentos Alimentos y Tecnología Medica y,

Administración Nacional de Medicamentos Alimentos y Tecnología Medica y, Ministerio de Salud "2011 - Año del Trabajo Decente, la Salud y Seguridad de los Trabajadores" Secretaría de Políticas, Regulación... e Institutos DI8POStOlul'f "",6 2 2 3 A.N. M. A. T. BUENOS AIRES,'

Más detalles

Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional

Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional BIOQ. LILIANA DI TULLIO BUDASSI FAC. CS.BIOQUÍMICAS Y FARMACÉUTICAS UNIVERSIDAD NACIONAL DE ROSARIO lilianadt2003@yahoo.com.ar

Más detalles

ACTUALIZACIÓN EN DENGUE Y CHIKUNGUNYA

ACTUALIZACIÓN EN DENGUE Y CHIKUNGUNYA ACTUALIZACIÓN EN DENGUE Y CHIKUNGUNYA Diagnóstico de las infecciones por DENV y CHIKV María Gabriela Barbás Bioq. Esp.en Virología Jefa del Servicio Bioquímico Laboratorio Central de la Provincia de Córdoba

Más detalles

versus PCR en Tiempo Real PCR convencional no es cuantitativo

versus PCR en Tiempo Real PCR convencional no es cuantitativo PCR convencional o PCR de punto final versus PCR en Tiempo Real PCR convencional no es cuantitativo S Lobos C - U de Chile 1 PCR clásico La cantidad de producto no está relacionada con la cantidad de DNA

Más detalles

EVALUACION EXTERNA DEL DESEMPEÑO PARA LA DETECCION DEL VIRUS DE INFLUENZA TIPO A MEDIANTE LA TÉCNICA DE RT- PCR PANEL x (20xx)

EVALUACION EXTERNA DEL DESEMPEÑO PARA LA DETECCION DEL VIRUS DE INFLUENZA TIPO A MEDIANTE LA TÉCNICA DE RT- PCR PANEL x (20xx) 1. OBJETIVO Evaluar el desempeño de los Laboratorios de Salud Pública participantes en cuanto a la detección del virus de la Influenza A mediante la técnica de RT PCR. 2. ALCANCE Este documento se tomo

Más detalles

TM CLAUDIO MIRANDA Sección SIDA. BQ. EUGENIO RAMIREZ Sección Virus Oncogénicos. TM LILIAN VERA D. Sección Virus Hepáticos y Emergentes

TM CLAUDIO MIRANDA Sección SIDA. BQ. EUGENIO RAMIREZ Sección Virus Oncogénicos. TM LILIAN VERA D. Sección Virus Hepáticos y Emergentes TALLER PARA EL ANALISIS DE RESULTADOS PEEC HBsAg, VHC, Ac- anti VIH y HTLV I/II TM CLAUDIO MIRANDA Sección SIDA BQ. EUGENIO RAMIREZ Sección Virus Oncogénicos TM LILIAN VERA D. Sección Virus Hepáticos y

Más detalles

Algoritmos diagnósticos para VIH

Algoritmos diagnósticos para VIH Algoritmos diagnósticos para VIH ALGORITMOS DIAGNÓSTICOS PARA VIH Los avances tecnológicos de los distintos ensayos para el tamizaje y diagnóstico de la infección por VIH, conjuntamente con la necesidad

Más detalles

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA BIOLOGIA MOLECULAR Hemos elaborado un programa en 3 niveles, en función del tipo de estudiante y las posibilidades del centro educativo: 1. NIVEL BASICO 2. NIVEL MEDIO DANAEXTRACTOR KIT Práctica que constituye

Más detalles

Vigilancia epidemiológica en salud pública de la transmisión madre - niño del VIH

Vigilancia epidemiológica en salud pública de la transmisión madre - niño del VIH NTS para la Vigilancia Epidemiológica en Salud Pública de la Infección por el VIH y de las ITS en el Perú Vigilancia epidemiológica en salud pública de la transmisión madre - niño del VIH Dra. Mary Reyes

Más detalles

Técnicas de Biología Molecular. Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO

Técnicas de Biología Molecular. Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO Técnicas de Biología Molecular Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO 2004 Extracción de ácidos nucleicos o o DNA RNA Tipos de Muestras Sangre total (EDTA) Saliva Líquido Amniótico Bulbo

Más detalles

Entendiendo la resistencia a los

Entendiendo la resistencia a los Competencias Esenciales: VIH/SIDA: -los Efectos Secundarios & la Resistencia Entendiendo la resistencia a los medicamentos* sobre esta actividad Tiempo: 65 minutos Objectivos: Al finalizar esta sesión,

Más detalles

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G.

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G. C825T Sistema para la detección de la mutación C825T en el gene de la proteína G. Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. Info@atgen.com.uy www.atgen.com.uy

Más detalles

SIDA EN AFRICA. África Holguín 5 Abril 2016

SIDA EN AFRICA. África Holguín 5 Abril 2016 SIDA EN AFRICA África Holguín 5 Abril 2016 DESDE ABRIL 2008. SUBPROGRAMA DE INMIGRACIÓN Y SALUD. GRUPO 33 TRABAJAMOS EN VARIABILIDAD GENÉTICA DEL VIH (desde 1994) DIFICULTA CONTROL VIH: resistencias, escape

Más detalles

NORMA TÉCNICA DE SALUD PARA LA PROFILAXIS DE LA TRANSMISIÓN MADRE-NIÑO DEL VIH Y LA SÍFILIS CONGÉNITA

NORMA TÉCNICA DE SALUD PARA LA PROFILAXIS DE LA TRANSMISIÓN MADRE-NIÑO DEL VIH Y LA SÍFILIS CONGÉNITA NORMA TÉCNICA DE SALUD PARA LA PROFILAXIS DE LA TRANSMISIÓN MADRE-NIÑO DEL VIH Y LA SÍFILIS CONGÉNITA NTS N 064 - MINSA/DGSP - V. 01 MINISTERIO DE SALUD NTS Nº 064 - MINSA/DGSP - V. 01 NORMA TÉCNICA DE

Más detalles

III CONGRESO NACIONAL DE ATENCIÓN FARMACÉUTICA

III CONGRESO NACIONAL DE ATENCIÓN FARMACÉUTICA Adherencia a la terapia antirretroviral en pacientes infectados con el virus de la inmunodeficiencia humana que asisten a una clínica universitaria de enfermedades infecciosas en Venezuela. III CONGRESO

Más detalles

Boletín de Tratamiento Adherencia al Tratamiento: Estrategias para el Éxito

Boletín de Tratamiento Adherencia al Tratamiento: Estrategias para el Éxito La Fundación Toronto People With AIDS Boletín de Tratamiento Adherencia al Tratamiento: Estrategias para el Éxito Noviembre 2010 Descargo de responsabilidad El Programa de Recursos sobre Tratamientos en

Más detalles

BOLETIN INSTITUTO NACIONAL DE SALUD

BOLETIN INSTITUTO NACIONAL DE SALUD BOLETIN INSTITUTO NACIONAL DE SALUD Reporte de Resultados de Laboratorio Enfermedades de Notificación Obligatoria SE -/24 Resistencia antimicrobiana Año - Nº 6 MARZO 24 BROTE DE TOS FERINA EN CAJAMARCA

Más detalles

Recomendaciones para la implementación de tests rápidos en el diagnóstico de VIH

Recomendaciones para la implementación de tests rápidos en el diagnóstico de VIH Recomendaciones para la implementación de tests rápidos en el diagnóstico de VIH Presidenta de la Nación Dra. Cristina Fernández de Kirchner Ministro de Salud Dr. Juan Luis Manzur Secretario de Promoción

Más detalles

Enfermería en laboratorios de bioquímica, hematología, hemoterapia y hemodonación

Enfermería en laboratorios de bioquímica, hematología, hemoterapia y hemodonación Enfermería en laboratorios de bioquímica, hematología, hemoterapia y hemodonación Curso de 80 h de duración, acreditado con 12,4 Créditos CFC Programa 1. INTRODUCCIÓN A LA BIOQUÍMICA EN EL LABORATORIO:

Más detalles

del VIH a los medicamentos

del VIH a los medicamentos Información, Inspiración y Defensa de la Gente con HIV/AIDS Un buen número de medicamentos se encuentran ahora disponibles Pruebas de para el tratamiento de la infección del VIH. Con más medicamentos para

Más detalles

INTERPRETACION DE LOS RESULTADOS DE LA HEPATITIS VIRALES EN ADULTOS

INTERPRETACION DE LOS RESULTADOS DE LA HEPATITIS VIRALES EN ADULTOS INTERPRETACION DE LOS RESULTADOS DE LA HEPATITIS VIRALES EN ADULTOS S. Microbiología Hospital General Universitario de Elche Abril 2009 HEPATITIS A INTRODUCCION La principal característica diferencial

Más detalles

Detección de Mutaciones. y diagnóstico prenatal. Curso de Genética Molecular. Ciencias Biológicas. Universidad de Jaén

Detección de Mutaciones. y diagnóstico prenatal. Curso de Genética Molecular. Ciencias Biológicas. Universidad de Jaén Detección de Mutaciones y diagnóstico prenatal Curso de Genética Molecular Ciencias Biológicas Universidad de Jaén Detección de mutaciones: Objetivos Detección de enfermedades hereditarias Detección de

Más detalles

QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA. Julio A. Carrasco Vallejo Julio 2014

QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA. Julio A. Carrasco Vallejo Julio 2014 QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA Julio A. Carrasco Vallejo Julio 2014 Definiciones Biología Molecular: Estudio de los flujos de información genética en una célula Biotecnología: Uso de sistemas

Más detalles

Nadia Isabel Hornquist Hurtarte Química Bióloga Clínica de Enfermedades Infecciosas Hospital Roosevelt

Nadia Isabel Hornquist Hurtarte Química Bióloga Clínica de Enfermedades Infecciosas Hospital Roosevelt Nadia Isabel Hornquist Hurtarte Química Bióloga Clínica de Enfermedades Infecciosas Hospital Roosevelt Fase aguda: Entre el 40% a 90% sintomáticos (similar mononucleosis) Fase crónica: asintomaticos El

Más detalles

Herramientas de laboratorio aplicadas al diagnóstico y el monitoreo del tratamiento de la infección por VIH (Virus

Herramientas de laboratorio aplicadas al diagnóstico y el monitoreo del tratamiento de la infección por VIH (Virus Herramientas de laboratorio aplicadas al diagnóstico y el monitoreo del tratamiento de la infección por VIH (Virus Inmunodeficiencia Humana) Fabián Fay CIBIC. Rosario. Argentina Test de laboratorio para

Más detalles

Situación del VIH/SIDA en el Perú

Situación del VIH/SIDA en el Perú Situación del VIH/SIDA en el Perú Dr. José Luís Sebastian Mesones Coordinador Nacional Estrategia Sanitaria Nacional P y C ITS, VIH y SIDA Ministerio de Salud del Perú CASOS ACUMULADOS DE VIH Y SIDA, PERU

Más detalles

Herramienta para Diagnosticar el Grado de Preparación de los Establecimientos del Programa para Iniciar Terapias de Anti-retrovirales

Herramienta para Diagnosticar el Grado de Preparación de los Establecimientos del Programa para Iniciar Terapias de Anti-retrovirales Herramienta para Diagnosticar el Grado de Preparación de los Establecimientos del Programa para Iniciar Terapias de Anti-retrovirales Versión. Septiembre 00 JSI Fundado en 978, JSI ha manejado exitosamente

Más detalles

Diagnóstico Prenatal No invasivo (NIPD)

Diagnóstico Prenatal No invasivo (NIPD) Dra. Derly Liseth Castro Rojas, MD Especialista en Genética Clínica - IGH PUJ / UNAB Directora Dto. Genética Clínica FOSCAL- Lab. Higuera Escalante Docente Asociado Facultad de Medicina UNAB Medicina fetal

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles

DIAGNÓSTICO DE SITUACIÓN EN RELACIÓN A LA ASISTENCIA Y EL TRATAMIENTO

DIAGNÓSTICO DE SITUACIÓN EN RELACIÓN A LA ASISTENCIA Y EL TRATAMIENTO Informe de la Red Argentina de Personas Viviendo con VIH/SIDA, Comisión de Tratamientos y Medicamentos. Julio 2003 Buenos Aires, julio de 2003 DIAGNÓSTICO DE SITUACIÓN EN RELACIÓN A LA ASISTENCIA Y EL

Más detalles

INDICE DE MATERIAS I- LISTA DE FIGURAS, 8. II- LISTA DE CUADROS, 10. III- RESUMEN, 11. IV- SUMMARY, 12. 1- INTRODUCCIÓN, 13.

INDICE DE MATERIAS I- LISTA DE FIGURAS, 8. II- LISTA DE CUADROS, 10. III- RESUMEN, 11. IV- SUMMARY, 12. 1- INTRODUCCIÓN, 13. INDICE DE MATERIAS I- LISTA DE FIGURAS, 8. II- LISTA DE CUADROS, 10. III- RESUMEN, 11. IV- SUMMARY, 12. 1- INTRODUCCIÓN, 13. 1.1 Presentación de la especie Fragaria chiloensis, 14. 1.1.1 Clasificación

Más detalles

TÉCNICAS MOLECULARES DE DETECCIÓN DE PATÓGENOS Y DE SUS FACTORES DE VIRULENCIA

TÉCNICAS MOLECULARES DE DETECCIÓN DE PATÓGENOS Y DE SUS FACTORES DE VIRULENCIA TÉCNICAS MOLECULARES DE DETECCIÓN DE PATÓGENOS Y DE SUS FACTORES DE VIRULENCIA TÉCNICAS MOLECULARES:VENTAJAS 1- RAPIDEZ 2- SENSIBILIDAD 3- NO NECESITAN MICROORGANISMO VIABLE 4- DETECTAN MICRORGANISMOS

Más detalles

PAREJAS SERODISCORDANTE

PAREJAS SERODISCORDANTE PAREJAS SERODISCORDANTE Las parejas serodiscordantes son aquellas en las que uno de los dos miembros es seropositivo al virus de la inmunodeficiencia humana (VIH). La elevada incidencia del VIH en pacientes

Más detalles

Dra. MERCEDES CARRILLO

Dra. MERCEDES CARRILLO Fiebre Amarilla Importancia y Uso Racional del Laboratorio en la Vigilancia y Atención de los pacientes con cuadro clínico icterohemorrágicos agudos Dra. MERCEDES CARRILLO Directora General Laboratorio

Más detalles

Genómica aplicada al diagnóstico de patologías periodontales

Genómica aplicada al diagnóstico de patologías periodontales Genómica aplicada al diagnóstico de patologías periodontales Dra. Blanca Bermejo Barrera, Directora Desarrollo Área Molecular FACTORES AMBIENTALES: - Enfermedades sistémicas: Diabetes Enfermedad Cardiovascular

Más detalles

Bioq. María Elina Acevedo Biología Molecular Fundación Hemocentro Buenos Aires

Bioq. María Elina Acevedo Biología Molecular Fundación Hemocentro Buenos Aires Bioq. María Elina Acevedo Biología Molecular Fundación Hemocentro Buenos Aires OBJETIVO DETECTAR Y DESCARTAR PRECOZMENTE UNIDADES DE SANGRE DE DONANTES CON VIREMIA PARA HIV, HBV Y HCV, CON PRUEBAS SEROLÓGICAS

Más detalles

Resumen de la clase teórica sobre Infección persistente crónica II: HIV Dictada el día 30 de junio de 2008. Prof. Dra. Liliana Martínez Peralta

Resumen de la clase teórica sobre Infección persistente crónica II: HIV Dictada el día 30 de junio de 2008. Prof. Dra. Liliana Martínez Peralta Resumen de la clase teórica sobre Infección persistente crónica II: HIV Dictada el día 30 de junio de 2008. Prof. Dra. Liliana Martínez Peralta El HIV es un retrovirus que pertenece al género de los Lentivirus.

Más detalles

DEPARTAMENTO LABORATORIO BIOMÉDICO NACIONAL Y DE REFERENCIA

DEPARTAMENTO LABORATORIO BIOMÉDICO NACIONAL Y DE REFERENCIA FLUJOGRAMA PARA LA SEROLOGÍA Y CONFIRMACIÓN DE VIRUS HANTA DEPARTAMENTO LABORATORIO BIOMÉDICO NACIONAL Y DE REFERENCIA SUBDEPARTAMENTO DE ENFERMEDADES VIRALES SECCIÓN VIRUS HEPÁTICOS/EMERGENTES ALERTA

Más detalles

Problemas en el Diagnostico de la Infección VIH. Diplomado de Atención Integral del VIH-SIDA. 2007

Problemas en el Diagnostico de la Infección VIH. Diplomado de Atención Integral del VIH-SIDA. 2007 Problemas en el Diagnostico de la Infección VIH Diplomado de Atención Integral del VIH-SIDA. 2007 Algunas Generalidades Sub - tipos del VIH y pruebas de laboratorio Analogía del VIH 1 y 2 es de: 40-60%

Más detalles

AMPLICHIP CYP450 GENOTIPAJE DEL CYP450 EN PACIENTES PSIQUÁTRICOS

AMPLICHIP CYP450 GENOTIPAJE DEL CYP450 EN PACIENTES PSIQUÁTRICOS AMPLICHIP CYP450 GENOTIPAJE DEL CYP450 EN PACIENTES PSIQUÁTRICOS MARTA CUADROS CELORRIO Y ROMÁN VILLEGAS AGENCIA DE EVALUACIÓN DE TECNOLOGÍAS SANITARIAS DE ANDALUCÍA Este trabajo se ha realizado bajo la

Más detalles

Los objetivos de las terapias contra VIH se centran en:

Los objetivos de las terapias contra VIH se centran en: I N T R O D U C C I Ó N Una vez que se identificó al VIH como causante del Síndrome de Inmunodeficiencia Adquirida (SIDA), el principal objetivo científico se convirtió en la búsqueda de algún medio para

Más detalles

IiSGM 2015. Objetivo del Curso. III Curso de Técnicas Experimentales

IiSGM 2015. Objetivo del Curso. III Curso de Técnicas Experimentales página 2 Objetivo del Curso El objetivo del «Curso de Técnicas Experimentales en Investigación Biomédica» es proporcionar a los asistentes unas nociones básicas sobre las metodologías y tecnología habitualmente

Más detalles

Técnicas de Biología Molecular

Técnicas de Biología Molecular Técnicas de Biología Molecular DNA I. Enzimas de restricción Análisis Las enzimas de restricción fueron aisladas de bacterias; su función natural es proteger contra DNA extraño II. Separación electroforética

Más detalles

Aproximación práctica al estudio del KRAS y otros biomarcadores. Javier Hernández Losa. 23-Mayo-2013

Aproximación práctica al estudio del KRAS y otros biomarcadores. Javier Hernández Losa. 23-Mayo-2013 Aproximación práctica al estudio del KRAS y otros biomarcadores Javier Hernández Losa. 23-Mayo-2013 Fase Pre-analítica: Selección del material Evaluación, gestión y rentabiliad de la muestra S09-23447

Más detalles

Centro Nacional de Alerta y Respuesta Rápida. Dirección de Epidemiología CORONAVIRUS

Centro Nacional de Alerta y Respuesta Rápida. Dirección de Epidemiología CORONAVIRUS CORONAVIRUS Introducción Los coronavirus constituyen una gran familia de virus que en el ser humano pueden causar diversas enfermedades que van desde el resfriado común hasta el SRAS (síndrome respiratorio

Más detalles

1) a) En la figura señale, englobando con un trazo continuo, lo siguiente:

1) a) En la figura señale, englobando con un trazo continuo, lo siguiente: CÁTEDRA: BIOQUÍMICA Carreras: Farmacia Profesorado en Química Licenciatura en Química Licenciatura en Alimentos ÁCIDOS NUCLEICOS 1) a) En la figura señale, englobando con un trazo continuo, lo siguiente:

Más detalles

5-MARCO DE REFERENCIA

5-MARCO DE REFERENCIA 5-MARCO DE REFERENCIA Para hablar de pruebas diagnosticas es necesario el conocimiento de ciertos términos que a continuación se describen. Sensibilidad: Es la probabilidad de obtener una prueba positiva

Más detalles

Actualización en nuevas técnicas de diagnóstico genético molecular disponibles en Chile

Actualización en nuevas técnicas de diagnóstico genético molecular disponibles en Chile Actualización en nuevas técnicas de diagnóstico genético molecular disponibles en Chile Dra. Teresa Aravena Clínica INDISA Hospital Clínico de la Universidad de Chile Hospital Dr. Sótero del Río Exámenes

Más detalles

LA INFECCION POR VIH Y EL LABORATORIO

LA INFECCION POR VIH Y EL LABORATORIO LA INFECCION POR VIH Y EL LABORATORIO Instituto Nacional de Salud - Peru Centro Nacional de Salud Publica Laboratorio de Referencia Nacional de ETS y VIH/SIDA Lic. T.M Ada Valverde Rojas ANTECEDENTES Noviembre

Más detalles

Diversidad Genética del VIH: Importancia para la Salud Pública Global

Diversidad Genética del VIH: Importancia para la Salud Pública Global Diversidad Genética del VIH: Importancia para la Salud Pública Global Alvaro Carrascal, MD, MPH Director, División de Atención de Salud Instituto del SIDA Departamento de Salud del Estado de Nueva York

Más detalles

PRÁCTICAS DE MICROBIOLOGIA CLINICA

PRÁCTICAS DE MICROBIOLOGIA CLINICA PRÁCTICAS DE MICROBIOLOGIA CLINICA Juan Carlos Rodríguez Hospital General Universitario de Alicante E-mail: rodriguez_juadia@gva.es http://microbiologia-alicante.umh.es CASO CLINICO: Rubéola Evolución

Más detalles

Dra. Natàlia Casamitjana

Dra. Natàlia Casamitjana VALIDACIÓN DE LA DETERMINACIÓN DEL RNA DEL VIRUS DE LA HEPATITIS C, RNA DEL VIH-1 Y DNA DEL VIRUS DE LA HEPATITIS B EN LECHE HUMANA MEDIANTE UN SISTEMA AUTOMÁTICO DE AMPLIFICACIÓN DE ÁCIDOS NUCLEICOS Dra.

Más detalles

USOS DE LA BIOLOGÍA MOLECULAR EN EL DIAGNÓSTICO DE ENFERMEDADES INFECCIOSAS Y METABÓLICAS. Dra. María Lilia Cedillo Ramírez

USOS DE LA BIOLOGÍA MOLECULAR EN EL DIAGNÓSTICO DE ENFERMEDADES INFECCIOSAS Y METABÓLICAS. Dra. María Lilia Cedillo Ramírez USOS DE LA BIOLOGÍA MOLECULAR EN EL DIAGNÓSTICO DE ENFERMEDADES INFECCIOSAS Y METABÓLICAS Dra. María Lilia Cedillo Ramírez Época de Oro de la Microbiología Robert Koch DIAGNÓSTICO MOLECULAR

Más detalles

PORQUE BUSCAMOS LA HEPATITIS C?

PORQUE BUSCAMOS LA HEPATITIS C? PORQUE BUSCAMOS LA HEPATITIS C? ESTE INDIVIDUO TIENE HCV? ESTA PERSONA (POTENCIAL DONANTE DE SANGRE) PUEDE ESTAR EXPUESTO A HCV? QUE EFECTOS TIENE LA INFECCION POR HCV EN EL HIGADO? CUAL ES LA PROBABILIDAD

Más detalles

Pruebas de bajo costo para el seguimiento al tratamiento de VIH

Pruebas de bajo costo para el seguimiento al tratamiento de VIH Pruebas de bajo costo para el seguimiento al tratamiento de VIH (Economical assays for monitoring HIV-1 treatment) Lisa Frenkel Profesora de Pediatria y Medicina del Laboratorio Marzo 2010 Uso de pruebas

Más detalles

EL INSTITUTO DE SALUD CARLOS III Y GILEAD ANUNCIAN LA PUESTA EN MARCHA DE LA CUARTA EDICIÓN DEL FELLOWSHIP PROGRAM

EL INSTITUTO DE SALUD CARLOS III Y GILEAD ANUNCIAN LA PUESTA EN MARCHA DE LA CUARTA EDICIÓN DEL FELLOWSHIP PROGRAM EL INSTITUTO DE SALUD CARLOS III Y GILEAD ANUNCIAN LA PUESTA EN MARCHA DE LA CUARTA EDICIÓN DEL FELLOWSHIP PROGRAM Este programa está orientado a apoyar la I+D biomédica en centros asistenciales sanitarios,

Más detalles

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa?

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa? 2º BIOQUÍMICA CUESTIONES 1. Por qué la PCR convencional no es cuantitativa? En la PCR convencional, la cuantificación del ADN de la muestra es complicada debido a que la eficacia de amplificación va disminuyendo

Más detalles

AVANCES EN EL PLAN NACIONAL DE CONTROL DE LAS HEPATITIS VIRALES 2014 2017

AVANCES EN EL PLAN NACIONAL DE CONTROL DE LAS HEPATITIS VIRALES 2014 2017 AVANCES EN EL PLAN NACIONAL DE CONTROL DE LAS HEPATITIS VIRALES 2014 2017 Antecedentes Resolución WHA 63.18 de 2010 Hepatitis Virales. Resolución WHA 67.6 de 2014 - Hepatitis Prevención y control de las

Más detalles

El desarrollo de la Virología

El desarrollo de la Virología LOS VIRUS El desarrollo de la Virología Literatura china del siglo X a.j.c.: Se describe una enfermedad similar a la viruela. Desde el siglo XVIII se vacuna contra la viruela vacuna (Jenner). En 1884 Pasteur

Más detalles

Más allá de las técnicas analíticas en los Laboratorios Clínicos: la dimensión científica y académica

Más allá de las técnicas analíticas en los Laboratorios Clínicos: la dimensión científica y académica Más allá de las técnicas analíticas en los Laboratorios Clínicos: la dimensión científica y académica Alberto Gómez Gutiérrez, PhD Profesor Titular Instituto de Genética Humana Facultad de Medicina Pontificia

Más detalles

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082 Página 1 de 5 1. OBJETIVO Detectar la presencia de Campylobacter jejuni en hamburguesa de pollo mediante técnica de PCR. 2. CAMPO DE APLICACIÓN Y ALCANCE Aplicar este procedimiento a muestras de hamburguesa

Más detalles

La Biotecnología como Tema de Integración Curricular y su Relevancia en el Desarrollo de las Destrezas del Pensamiento

La Biotecnología como Tema de Integración Curricular y su Relevancia en el Desarrollo de las Destrezas del Pensamiento La Biotecnología como Tema de Integración Curricular y su Relevancia en el Desarrollo de las Destrezas del Pensamiento Gerardo Arroyo Cruzado, Ph.D. Departamento de Ciencias Biológicas, Facultad de Ciencias

Más detalles

EL MATERIAL GENÉTICO:

EL MATERIAL GENÉTICO: LA HUELLA GENÉTICA: PRUEBAS DE PATERNIDAD E IDENTIFICACIÓN INTRODUCCIÓN: En éstos últimos años, se ha popularizado a través de los medios de comunicación la expresión: identificación través de pruebas

Más detalles

Actividad anti-vih-1 de factores solubles: su papel protector en esta infección. Maria Teresa Rugeles

Actividad anti-vih-1 de factores solubles: su papel protector en esta infección. Maria Teresa Rugeles Actividad anti-vih-1 de factores solubles: su papel protector en esta infección. Maria Teresa Rugeles Grupo Inmunovirología Universidad de Antioquia Infección No infección Progresor rápido Progresor típico

Más detalles

Hepatitis viral tipo C (HCV) RT-PCR

Hepatitis viral tipo C (HCV) RT-PCR Hepatitis viral tipo C (HCV) RT-PCR Celía, Alejandro Fabián Taborda, Florencia Ines Características Generales del HCV Agente etiológico de las HNANB transmitidas por transfusiones Flia: Flaviviridae Género:

Más detalles

OBTENCIÓN, PREPARACIÓN Y ENVÍO DE BIOPSIAS HEPÁTICAS

OBTENCIÓN, PREPARACIÓN Y ENVÍO DE BIOPSIAS HEPÁTICAS 1 de 7 MANUAL DE PROCEDIMIENTOS OBTENCIÓN, PREPARACIÓN Y ENVÍO DE BIOPSIAS HEPÁTICAS CONTROLADA Nº DESTINATARIO FECHA ENTREGA ENTREGADO POR Nombre Firma NO CONTROLADA ENTRADA EN REVISIÓN REALIZADO FECHA

Más detalles

GENÉTICA: Herencia, Expresión génica, Replicación, biotecnología Selectividad: herencia

GENÉTICA: Herencia, Expresión génica, Replicación, biotecnología Selectividad: herencia GENÉTICA: Herencia, Expresión génica, Replicación, biotecnología Selectividad: herencia 5 JUN9.- Existen caracteres que no se comportan típicamente como los Mendelianos y sus patrones de herencia muestran

Más detalles