Save this PDF as:

Tamaño: px
Comenzar la demostración a partir de la página:



1 REAL CLEAN SPIN KIT Ref. RBMCS01 50 Preps. Ref. RBMCS Preps 1. INTRODUCCIÓN 1. INTRODUCTION Sistema de producción certificado bajo norma ISO Real Clean Spin Kit es un método versátil y efectivo para una rápida y eficiente purificación y concentración de ADN a partir de soluciones, o de geles de agarosa de TAE o TBE. Está especialmente diseñado para un rápido cleanup de productos de PCR. Este método permite la purificación de hasta 15 µg de DNA. Con el kit se suministran 2 tampones de unión diferentes: Tampón de Solubilización y Unión 1: Para purificaciones rutinarias fragmentos de PCR de 300pb-10 Kb dsdna en mezclas de mer primers, dntps, enzimas y sales. Para la solubilización de trozos de agarosa para la extracción de fragmentos de ADN. Tampón de Unión 2: Para purificaciones rutinarias fragmentos de PCR de 100pb- 10 Kb dsdna en mezclas de mer primers, dntps, enzimas y sales. La purificación se basa en la absorción selectiva de los ácidos nucleicos en membranas de sílica que se encuentran en mini-columnas spin en presencia de sales caotrópicas. El ADN purificado es eluido en un pequeño volumen de tampón (5 mm Tris HCl ph 8.5) y se puede utilizar en manipulaciones enzimáticas incluyendo, secuenciación, clonaje, análisis de restricción, ligaciones, marcaje y transcripción in vitro. Real Clean Spin Kit permite una recuperación de ADN de Kb con una eficiencia que varía entre el 75-90% dependiendo del tamaño del fragmento. Real Clean Spin Kit is a versatile and effective method for a fast and efficient purification and concentration of DNA from solutions, agarose gels, either TAE or TBE. It is specially designed for a quick PCR products clean up. This method allows the purification of DNA up to 15 µg. The Real Clean Spin kit is supplied with two binding buffers: Solubilization and Binding Solution 1: For routine purifications of 300 bp-10 Kb dsdna PCR fragments from mer primers, dntps, enzymes and salts mixtures.. And for the solubilisation of the agarose gel slice for extraction of DNA fragments. Binding Solution 2: For routine purifications of 100 bp- 10 Kb dsdna PCR fragments from mer primers, dntps, enzymes and salts mixtures. The purification is based on the selective absorption of nucleic acids in spin mini-columns with silica membranes with chaotropic agents presence. The purified DNA is eluted in a small buffer volume (5 mm Tris-HCl ph 8.5) and can be used in enzymatic manipulations, including sequencing, cloning, restriction analysis, ligations, labelling and in vitro transcription. Real Clean Spin Kit allows a DNA recovering of Kb with an efficiency that varies between 75-90% depending on the fragment size. Production system certified under ISO 1/5

2 2. COMPONENTES DEL KIT KIT COMPONENTS Solución de Solubilización y Unión 1 Solubilization and Binding Solution 1 Solución de Unión 2 Binding Solution 2 Solución de Lavado Wash Solution Tampón de Elución Elution Buffer Spin Columnas Spin Columns Tubos de Recogida Collection Tubes Ref. Ref. RBMCS01 50 preps Ref. RBMCS preps Tª CM01 30 ml 150 ml 4ºC CM02 15 ml 72 ml RT EP08 10 ml 50 ml RT E13 2 ml 10 ml RT RSC03 50 unid. 250 unid. RT R unid. 500 unid. RT Equipos y reactivos necesarios no incluidos en el kit: * Etanol 100 %. * Isopropanol * Microtubos de 1.5 ml * Micocentrifuga. * Baño de agua Equipment and additional reagents required * 100 % Ethanol * Isopropanol * 1.5 ml. microtubes * Microcentrifuge. * Water Bath 3. PROTOCOLO GENERAL GENERAL PROCEDURE 3.1 Consideraciones preliminares 1. El protocolo implica los siguientes pasos: Solubilización del gel: el Ioduro de Sodio solubiliza la agarosa y además promueve la unión del ADN a la membrana de sílica. Unión del ADN: el paso a través de la Spin columna de la muestra a purificar promueve la unión del ADN a la sílica. Purificación del ADN: lavado con una solución de lavado que contiene etanol y elimina los contaminantes, oligos, proteínas, etc. Recuperación del ADN: el ADN es eluido con 5 mm Tris-HCl ph 8.5 o agua estéril ph La capacidad máxima de la spin columna es de 700 µl. 3. Coloración del Ioduro de Sodio: Cuando se expone al aire por un largo tiempo se volverá de color amarillo. La solución de Solubilización y Unión 1 contiene sulfito de sodio para minimizar este proceso. A pesar de ello, el cambio de color no inhibe la función del Ioduro de sodio, siempre y cuando el ph, normalmente entre , no exceda de 7.5, lo cual produce un descenso en la eficiencia de unión. El ph puede ser ajustado a con 1/ 200 volúmenes de Acido acético 10% respecto el volumen de Solución de Solubilización y Unión. 3.1 Preliminary conditions 1. The protocol implies the following steps: Gel solubilization: Sodium iodide solubilizes the agarose and promove the DNA binding to the silica membrane. DNA binding: the sample that has to be purified goes through the Spin column and this promove the DNA binding to the silica membrane. DNA purification: washing with the use of a washing solution that contains ethanol and removes contaminants, oligos, proteins, etc. DNA recovering: the DNA is eluted with 5 mm Tris-HCl ph 8.5 or sterile water ph The maximum capacity of the spin column is 700 µl. 3. Sodium iodide staining. When it is exposed to the air for a long time, it will turn yellow. The Solubilization and Binding solution contains Sodium sulphide to minimize this process. Even though, the change in colour does not inhibit the sodium sulphide function, as long as the ph, usually adjusted at , is not higher than 7.5, which produces a decrease in the binding efficiency. PH can be adjusted at with 1/200 volumes of 10% acetic acid according to the Solubilization and Binding solution. 2/5

3 3.2 Preparaciones preliminares Añadir 40 ml (ref. RBMCS01, 50 test) o 200 ml (ref. RBMCS02, 250 test) de Etanol 100% a la Solución de Lavado (ref. EP08).Marcar el envase y mantenerlo bien cerrado para evitar la evaporación del etanol. Añadir 10 ml (ref. RBMCS01, 50 test) o 48 ml (ref. RBMCS02, 250 test) de Isopropanol 100% al tampón de Unión 2 (ref.cm02). Marcar el envase y mantenerlo bien cerrado para evitar la evaporación del isopropanol. Pre-calentar el Tampón de Elución a 70ºC. 3.2 Preliminary Preparations Add 40 ml (ref. RBMCS01, 50 test) or 200 ml (ref. RBMCS02, 250 test) of 100% Ethanol to the wash solution (ref EP08).Label the container and keep it closed to avoid ethanol evaporation. Add 10 ml (ref. RBMCS01, 50 test) or 48 ml (ref. RBMCS02, 250 test) of 100% Isopropanol to the binding solution 2 (ref.cm02). Label the container and keep it closed to avoid Isopropanol evaporation. Pre-heat the Elution Buffer at 70ºC. 3.3 Protocolo 1: para purificaciones rutinarias de fragmentos de PCR de 100pb - 10 Kb dsdna en mezclas de mer primers, dntps, enzimas y sales. 1. Añadir 4 volúmenes del Tampón de Unión 2 (ref. CM02) con isopropanol a 1 volumen de mezcla de PCR ( µl). Mezclar bien. 2. Transferir la muestra a una spin columna. Colocar la spin columna en un tubo de recogida. 3. Centrifugar 1 minuto a rpm. 4. Eliminar el filtrado y añadir 600 µl de Tampón de Lavado (ref. EP08). Centrifugar 1 5. Eliminar el filtrado y añadir 200 µl de Tampón de Lavado (ref. EP08). Centrifugar 1 6. Eliminar el etanol residual por centrifugación durante 3 minutos a rpm. 7. Colocar la spin columna en un nuevo tubo de recogida y añadir por lo menos 25 µl de Tampón de Elución (ref. E13) pre-calentado a 70ºC. 8. Incubar durante 2 minutos y centrifugar durante Protocol 1: for routine purifications of 100 bp - 10 Kb dsdna PCR fragments from mer primers, dntps, enzymes and salts mixtures. 1. Add 4 volumes of Binding Solution 2 (ref. CM02) with isopropanol to 1 volume of PCR ( µl). Mix well. 2. Transfer the sample to a spin column. Put the spin column in collecting tube. 3. Centrifuge for 1 minute at rpm. 4. Remove the filtrate and use 600 µl of the Washing solution (ref. EP08). Centrifuge for 1 5. Remove the filtrate and apply 200 µl of washing solution. Centrifuge for 1 minute at rpm. 6. Remove the residual ethanol by centrifugation for 3 minutes at rpm. 7. Transfer the spin column into a new receiver tube and add at least 25 µl of pre-warmed Elution Buffer (ref. E13) at 70ºC. 8. Incubate for 2 minutes and centrifuge for 1 3/5

4 3.4 Protocolo 2: para purificaciones rutinarias de fragmentos de PCR de 300pb - 10 Kb dsdna en mezclas de mer primers, dntps, enzimas y sales. para la solubilización de cortes de agarosa para la extracción de fragmentos de ADN 1. Medir el volumen / peso del ADN Si el ADN se encuentra en solución medir el volumen con una pipeta Para purificaciones de geles de agarosa, cortar la banda e intentar minimizar el tamaño del fragmento eliminando el exceso de agarosa. Para la conversión asumir que 100 mg de gel equivale a 400µl de Solución de Solubilización y Unión. 2. Añadir 4 volúmenes de Solución de Solubilización y Unión (ref. CM01). Para volúmenes menores a 50 µl ajustar el volumen a 50 µl con TE o agua. 3. En el caso de geles de agarosa, incubar 5-10 minutos a 55ºC para disolver la agarosa. Agitar mediante vortex cada 2-3 minutos. 4. Transferir la solución a una spin columna. Colocar la spin columna en un tubo de recogida. 5. Centrifugar durante 1 minuto a rpm. 6. Descartar el filtrado y aplicar 600 µl de la Solución de Lavado (ref. EP08). Centrifugar durante 1 7. Descartar el filtrado y aplicar 200 µl de la Solución de Lavado. Centrifugar durante 1 8. Eliminar el etanol residual por centrifugación durante 3 minutos a rpm. 9. Colocar la spin columna en un nuevo tubo de recogida y añadir por lo menos 25 µl de Tampón de Elución (ref. E13) pre-calentado a 70ºC. 10. Incubar durante 2 minutos y centrifugar durante Protocol 2: for routine purifications of 300bp - 10 Kb dsdna PCR fragments from mer primers, dntps, enzymes and salts mixtures for solubilization of the agarose gel slice for extractions of DNA fragments 1. Measure volume / weight of DNA If the DNA is in solution, measure the volume with a pipette To purify agarose gels, cut the band and try to minimize the fragment size removing the excess of agarose. For the conversion assume that 100 mg of gel are equivalent to 400µl of Solubilization and Binding Solution. 2. Add 4 volumes of Solubilization and Binding Solution 1 (ref. CM01). For samples volumes lower than 50 µl adjust the sample volume at 50 µl with TE or water. 3. If you have agarose gels, incubate for 5-10 minutes at 55ºC to dissolve the agarose. Shake with a vortex every 2-3 minutes. 4. Transfer the solution to a spin column. Put the spin column in collecting tube. 5. Centrifuge for 1 minute at rpm. 6. Remove the filtrate and use 600 µl of the Washing solution (ref. EP08). Centrifuge for 1 7. Remove the filtrate and apply 200 µl of washing solution. Centrifuge for 1 minute at rpm. 8. Remove the residual ethanol by centrifugation for 3 minutes at rpm. 9. Transfer the spin column into a new receiver tube and add at least 25 µl of pre-warmed Elution Buffer (ref. E13) at 70ºC. 10. Incubate for 2 minutes and centrifuge for 1 4/5

5 4. GUIA DE PROBLEMAS Y POSIBLES SOLUCIONES TROUBLESHOOTING 1. Baja recuperación de ADN El etanol 100 % no se añadió a la solución de lavado o su concentración es inadecuada. Asegurarse de añadirlo y marcar el envase. Evitar también la evaporación Los fragmentos de agarosa no fueron disueltos completamente con la Solución de Solubilización y Unión. Esto puede ocurrir si se añade demasiada agarosa y no se mezcla cada 1-2 minutos durante el periodo de incubación a 55ºC Tampón de elución inadecuado. Utilizar 5 mm Tris-HCl ph 8.5 o agua estéril ph 8.5 Chequear el ph del tampón de elución Volumen de elución demasiado bajo. El volumen de elución debería ser por lo menos de 25 µl. Incrementos en el volumen produce mejores recuperaciones. Mayores volúmenes de elución incrementan el porcentaje de recuperación Para fragmentos mayores de 5 Kb es imprescindible pre-calentar la solución de elución a 70 ºC. 2. El ADN eluido no es funcional en las siguientes manipulaciones enzimáticas En el paso de lavado y con la Solución de lavado no se elimina todo el etanol, la presencia de etanol residual inhibe las posteriores manipulaciones enzimáticas Centrifugar el tiempo que se indica. 3. Para purificación de productos de PCR No es necesario la eliminación del aceite mineral, aunque se recomienda recoger la muestra minimizando lo mayor posible la recogida de aceite mineral Alternativamente, recomendamos colocar las muestras de PCR a -20ºC durante 30 minutos. La fase acuosa se congelará, pudiendo eliminar la fase orgánica por medio de una pipeta. 1. Low DNA recovering The 100 % ethanol was not added to the washing solution or its concentration is wrong The agarose fragments were not completely dissolved in the Solubilization and Binding solution. This may happen when too much agarose is added and it is not mixed every 1-2 minutes during the incubation period at 55ºC Wrong elution buffer. Use 5 mm Tris- HCl ph 8.5 or sterile water ph 8.5 Check the elution buffer ph Elution buffer too low. The elution volume should be at least 25 µl. A volume increase produces better recovering. Bigger elution volume increases the recovering percentage You must always pre-heat the elution solution at 70ºC with fragments bigger than 5Kb. 2. The eluted DNA is not functional in following enzymatic manipulations The washing step and washing solution do not remove all the ethanol, the presence of residual ethanol inhibits later enzymatic manipulations Centrifuge just for the indicated time. 3. For PCR products recovering The removal of the mineral oil is not necessary, although we recommend picking up the sample minimizing mineral oil collection as much as possible 3.2. Alternatively, we recommend to place PCR samples at -20ºC for 30 minutes. The aqueous phase will be frozen, being able to remove the organic phase with a pipette. 5/5


REAL TOTAL RNA FROM BACTERIA AND YEAST KIT REAL TOTAL RNA FROM BACTERIA AND YEAST KIT Ref. 1. INTRODUCCIÓN 1. INTRODUCTION Este kit permite la obtención de ARN total a partir de diferentes cultivos de bacterias y levaduras, sin la utilización de

Más detalles


REAL TOTAL RNA SPIN BLOOD KIT REAL TOTAL RNA SPIN BLOOD KIT Ref. 50 Preps. 1. INTRODUCCIÓN 1. INTRODUCTION Sistema de producción certificado bajo norma ISO Este kit permite la obtención de ARN total libre de ADN directamente de sangre

Más detalles


DANAGENE RNA PURIFICATION KIT DANAGENE RNA PURIFICATION KIT REF.0801.1 100 EXTRACCIONES REF.0801.2 500 EXTRACCIONES 1.INTRODUCCION Este kit permite la permite la obtención de ARN total a partir de cultivos celulares, tejidos animales,

Más detalles


REAL MINIPREP TURBO KIT REAL MINIPREP TURBO KIT Ref. 500 Preps. 1. INTRODUCCIÓN 1. INTRODUCTION Este kit provee un método para una rápida, sencilla y eficiente extracción de DNA plasmídico a partir de cultivos de E.coli de 1.5-3.0

Más detalles

RapidFinder STEC Detection Workflow

RapidFinder STEC Detection Workflow QUICK REFERENCE RapidFinder STEC Detection Workflow Aislamiento automático de ADN y detección de la PCR en tiempo real de E. coli O157:H7 y cepas "Big 6" de STEC no O157 Número de catálogo 4480466, 4428176,

Más detalles

TIPS: Understanding Overspray

TIPS: Understanding Overspray TIPS: Understanding Overspray In any pneumatic spray application, overspray is an area of concern that should be addressed early on. Fortunately if it does occur, it s easily remedied through the use of

Más detalles


SEPARACIÓN DE PROTEÍNAS POR CROMATOGRAFÍA DE EXCLUSIÓN MOLECULAR SEPARACIÓN DE PROTEÍNAS POR CROMATOGRAFÍA DE EXCLUSIÓN MOLECULAR INTRODUCCION La cromatografía es una técnica que permite la separación de moléculas diferentes presentes en una misma muestra. El método

Más detalles

New! Solvent-free The new MiniSystem is here... New cap design for easier sample collection!! New! New! 1. Ready to Use 2. One Step 3. Disposable 4. Closed Process 5. Save space and reagents 6. Fast Protocol

Más detalles

DANAGENE SALIVA KIT. Ref.0603.4 50 Extracciones / Ref.0603.41 160 Extracciones

DANAGENE SALIVA KIT. Ref.0603.4 50 Extracciones / Ref.0603.41 160 Extracciones DANAGENE SALIVA KIT Ref.0603.4 50 Extracciones / Ref.0603.41 160 Extracciones 1.INTRODUCCION DANAGENE SALIVA Kit provee un método para la extracción de ADN genómico de alta calidad a partir de muestras

Más detalles

Sistemas de impresión y tamaños mínimos Printing Systems and minimum sizes

Sistemas de impresión y tamaños mínimos Printing Systems and minimum sizes Sistemas de impresión y tamaños mínimos Printing Systems and minimum sizes Para la reproducción del Logotipo, deberán seguirse los lineamientos que se presentan a continuación y que servirán como guía

Más detalles

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Para la purificación de ADN genómico de todos los kits de colección Oragene y ORAcollect. Visite nuestro sitio

Más detalles



Más detalles

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR Módulo 1 Amplificación de un fragmento de ADN genómico por PCR En este primer módulo se amplificará por PCR, mediante el uso de oligonucleótidos específicos, un fragmento de ADN genómico de Aspergillus

Más detalles

Protocolos de secuenciación de ADN

Protocolos de secuenciación de ADN 1 Protocolos de secuenciación de ADN Introducción El método de secuenciación utilizado aquí es el desarrollado por Sanger en 1975. Este consiste en la incorporación de didesixinucleótidos marcados fluorescentemente

Más detalles


DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082 Página 1 de 5 1. OBJETIVO Detectar la presencia de Campylobacter jejuni en hamburguesa de pollo mediante técnica de PCR. 2. CAMPO DE APLICACIÓN Y ALCANCE Aplicar este procedimiento a muestras de hamburguesa

Más detalles


5. MATERIALES Y MÉTODOS 5. MATERIALES Y MÉTODOS 5.1 Equipos Los siguientes termocicladores se emplearon para la amplificación por PCR: - Perkin Elmer, GeneAmp PCR System 2400. - Perkin Elmer, GeneAmp PCR System 9600. - Applied

Más detalles


IRS DATA RETRIEVAL NOTIFICATION DEPENDENT STUDENT ESTIMATOR IRS DATA RETRIEVAL NOTIFICATION DEPENDENT STUDENT ESTIMATOR Subject: Important Updates Needed for Your FAFSA Dear [Applicant], When you completed your 2012-2013 Free Application for Federal Student Aid

Más detalles

Creating your Single Sign-On Account for the PowerSchool Parent Portal

Creating your Single Sign-On Account for the PowerSchool Parent Portal Creating your Single Sign-On Account for the PowerSchool Parent Portal Welcome to the Parent Single Sign-On. What does that mean? Parent Single Sign-On offers a number of benefits, including access to

Más detalles


1 MATERIALES Y MÉTODOS 1 MATERIALES Y MÉTODOS El presente protocolo experimental contempla la amplificación del DNA de las bacterias y virus causantes de las ETS Neisseria gonorrhoeae, Chlamydia trachomatis y VPH mediante PCR

Más detalles

Materiales para la secuenciación de ADN

Materiales para la secuenciación de ADN Introduccion La Secuenciación Sanger es un método de secuenciación de ADN en el que el ADN diana se desnaturaliza y se hibrida con un cebador de oligonucleótidos, que se extiende entonces gracias a la

Más detalles



Más detalles


2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA BIOLOGIA MOLECULAR Hemos elaborado un programa en 3 niveles, en función del tipo de estudiante y las posibilidades del centro educativo: 1. NIVEL BASICO 2. NIVEL MEDIO DANAEXTRACTOR KIT Práctica que constituye

Más detalles


5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN 5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN Materiales - Eppendorf de 1,5 ml estériles - Eppendorf de pared fina para PCR - Puntas de pipeta estériles desechables - Guantes

Más detalles


1. OBJETO. 3.1. DOCUMENTOS UTILIZADOS EN LA ELABORACIÓN. 3.2. DOCUMENTOS (PNTs) A UTILIZAR CONJUNTAMENTE. 5.1. MATERIALES Y REACTIVOS. Página 1 de 5 CENTRO DE INVESTIGACION EN SANIDAD ANIMAL (CISA-INIA) Laboratorio de Referencia de la UE de PPA (EURL-ASF) Centro de Investigación en Sanidad Animal CISA-INIA, Valdeolmos 28130, Madrid, Spain.

Más detalles

Los ensayos que se van a desarrollar son los siguientes:

Los ensayos que se van a desarrollar son los siguientes: I Resumen El objetivo principal del proyecto es desarrollar un software que permita analizar unos datos correspondientes a una serie de ensayos militares. Con este objetivo en mente, se ha decidido desarrollar

Más detalles

Nueva confirmación de pedido de compra con cambios: proveedor ES

Nueva confirmación de pedido de compra con cambios: proveedor ES Ayuda de trabajo Nueva confirmación de pedido de compra con cambios: proveedor ES Step 1. This Supplier portal activity lists the steps necessary for confirming a new purchase order with changes on price,

Más detalles

Cualificación de Sistemas de Gases Comprimidos

Cualificación de Sistemas de Gases Comprimidos Servicios de Calibración y Cualificación en instalaciones i y equipamientos i en centros de Cultivo Celular Gases comprimidos más habituales Aire comprimido Nitrógeno Dióxido de Carbono Sistema de generación

Más detalles

38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa

38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa 38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa José Luis Caballero Repullo, Enriqueta Moyano, Juan Muñoz Blanco Departamento de Bioquímica y Biología Molecular, Campus

Más detalles

Guía Práctica 9. Producción de micelio en medio líquido para extracción de ADN. Micelio de hongos. Contenido

Guía Práctica 9. Producción de micelio en medio líquido para extracción de ADN. Micelio de hongos. Contenido Guía Práctica 9 Micelio de hongos Producción de micelio en medio líquido para extracción de ADN Guillermo Castellanos, Experto en Investigación 2 Carlos Jara, Ing. Agr. M.Sc., Asociado en Investigación

Más detalles

Bioquímica III- 2009

Bioquímica III- 2009 Facultad de Ciencias Exactas, Universidad Nacional de La Plata Bioquímica III- 2009 Trabajo Práctico Nro 4 Extracción de RNA y DNA bacteriano INTRODUCCIÓN El RNA es el ácido nucleico más abundante en la

Más detalles


DETERMINACIÓN DEL FACTOR Rh por PCR Ref.PCRRh DETERMINACIÓN DEL FACTOR Rh por PCR 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60.

Más detalles


EQUIPO: PLATAFORMA DE CLONAJE ROBOTIZADA DE 2000mm EQUIPO: PLATAFORMA DE CLONAJE ROBOTIZADA DE 2000mm Ficha técnica: Robot con una mesa de trabajo útil de al menos 2000 mm. El sistema robótico deberá incluir dentro de la mesa de trabajo, 3 brazos (1 brazo

Más detalles

PEMEX E&P South Region OMC 2015

PEMEX E&P South Region OMC 2015 PEMEX E&P South Region OMC 2015 Austin, TX. USA Por: Mario Alejandro Mosqueda Thompson (PEMEX) Juan D. Osorio Monsalve (OVS GROUP MEXICO) The system is based on integrating databases and capture of different

Más detalles

It doesn t take long for spills to become stains...permanently. For precision spill-removal on high-finish concrete floors when every second counts.

It doesn t take long for spills to become stains...permanently. For precision spill-removal on high-finish concrete floors when every second counts. It doesn t take long for spills to become stains...permanently. For concrete floors For precision spill-removal on high-finish concrete floors when every second counts. 6 Steps for spill clean-up Preparation

Más detalles



Más detalles

GUÍA DE USUARIO PC-331117. Bienvenidos al mundo Perfect Choice. Antes de comenzar a usar el producto es importante que leas esta guía.

GUÍA DE USUARIO PC-331117. Bienvenidos al mundo Perfect Choice. Antes de comenzar a usar el producto es importante que leas esta guía. GUÍA DE USUARIO PC-331117 Bienvenidos al mundo Perfect Choice Antes de comenzar a usar el producto es importante que leas esta guía. Conexión 1. Inserta el transmisor en el conector para encendedor de

Más detalles

Obtención de ADN de cactáceas: comparación de dos métodos de extracción en Ferocactus histrix

Obtención de ADN de cactáceas: comparación de dos métodos de extracción en Ferocactus histrix Obtención de ADN de cactáceas: comparación de dos métodos de extracción en Ferocactus histrix Brenda Díaz Cárdenas 1, Liliana Gómez Flores Ramos 1, Verónica Carolina Rosas-Espinoza 2, Laura Izascum Pérez

Más detalles

Extracción de DNA por el Método Adaptado de Drábek.

Extracción de DNA por el Método Adaptado de Drábek. Extracción de DNA por el Método Adaptado de Drábek. El aislamiento de DNA constituye un paso esencial para la realización de estudios de tamizaje genético, análisis de polimorfismos genéticos, estudios

Más detalles

iclef-2002 at Universities of Alicante and Jaen University of Alicante (Spain)

iclef-2002 at Universities of Alicante and Jaen University of Alicante (Spain) iclef-2002 at Universities of Alicante and Jaen University of Alicante (Spain) ! Introduction! Passage Retrieval Systems! IR-n system! IR-n system at iclef-2002! Conclusions and Future works ! Introduction!

Más detalles

Sesión 3: PL 2b: Sistema para la adquisición de señales analógicas.

Sesión 3: PL 2b: Sistema para la adquisición de señales analógicas. Sesión 3: PL 2b: Sistema para la adquisición de señales analógicas. 1 Objetivo... 3 Signal Logging Basics... 3 Configure File Scope (xpc) Blocks... 3 File Scope Usage... 4 Create File Scopes Using xpc

Más detalles



Más detalles

Real Time Systems. Part 2: Cyclic schedulers. Real Time Systems. Francisco Martín Rico. URJC. 2011

Real Time Systems. Part 2: Cyclic schedulers. Real Time Systems. Francisco Martín Rico. URJC. 2011 Real Time Systems Part 2: Cyclic schedulers Scheduling To organise the use resources to guarantee the temporal requirements A scheduling method is composed by: An scheduling algorithm that calculates the

Más detalles

FCC Information : Warning: RF warning statement:

FCC Information : Warning: RF warning statement: FCC Information : This device complies with Part 15 of the FCC Rules. Operation is subject to the following two conditions: (1) This device may not cause harmful interference, and (2) This device must

Más detalles



Más detalles

velocidades de movimiento mediante la aplicación de un campo eléctrico a través de una matriz porosa

velocidades de movimiento mediante la aplicación de un campo eléctrico a través de una matriz porosa INTRODUCCIÓN En general, la electroforesis es una técnica que separa las moléculas en base a sus diferentes velocidades de movimiento mediante la aplicación de un campo eléctrico a través de una matriz

Más detalles

Cómo comprar en la tienda en línea de UDP y cómo inscribirse a los módulos UDP

Cómo comprar en la tienda en línea de UDP y cómo inscribirse a los módulos UDP Cómo comprar en la tienda en línea de UDP y cómo inscribirse a los módulos UDP Sistema de registro y pago Este sistema está dividido en dos etapas diferentes*. Por favor, haga clic en la liga de la etapa

Más detalles


ASSEMBLY DRAWING / SPARE PARTS ASSEMBLY DRAWING / SPARE PARTS Flush button with Lock Nut C7715-6.4 N7714TL Toilet Lid Flush Valve C7715-6 BSB Kit - C7715-1 Fluidmaster Seal Seal - C7715-2 Fill Valve C7715-7 Ceramic tank Air Tube - C7715-3

Más detalles

Some examples. I wash my clothes, I wash the dishes, I wash the car, I wash the windows. I wash my hands, I wash my hair, I wash my face.

Some examples. I wash my clothes, I wash the dishes, I wash the car, I wash the windows. I wash my hands, I wash my hair, I wash my face. Reflexive verbs In this presentation, we are going to look at a special group of verbs called reflexives. Let s start out by thinking of the English verb wash. List several things that you can wash. Some

Más detalles


REAL TOTAL RNA FROM TISSUES AND CELLS STAR KIT 10/10 RBMER02 REAL TOTAL RNA FROM TISSUES AND CELLS STAR KIT Ref. RBMER02 1. INTRODUCCIÓN 1. INTRODUCTION Este kit permite la obtención de ARN total a partir de muestras de tejidos y células, sin la utilización

Más detalles


IX CONGRESO DE CIENCIA DE LOS ALIMENTOS y V FORO DE CIENCIA Y TECNOLOGÍA DE ALIMENTOS Determinación de Fosfatos y Sólidos en Disolución en Bebidas Bajas en Carbohidratos Ramírez Cossío Miriam Alejandra, Witrago Durán Raquel Nallhely y Rubén Salcedo Hernández. Instituto de Ciencias Agrícolas

Más detalles


EXTRACCIÓN DE ADN (2) EXTRACCIÓN DE ADN (2) PROCEDIMIENTO BÁSICO Muchos estudios de Biología Molecular comienzan con la extracción de ácidos nucleicos. La lisis celular libera las moléculas en una fase acuosa que es separada

Más detalles

P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA"

P.C.R. Técnica de amplificación enzimática de secuencias específicas de DNA P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA" Paso 1: Desnaturalización del DNA Paso 2: Hibridación de los "Primers" Paso 3: Extensión Paso 1: Desnaturalización del DNA

Más detalles


PRINTING INSTRUCTIONS PRINTING INSTRUCTIONS 1. Print the Petition form on 8½ X 11inch paper. 2. The second page (instructions for circulator) must be copied on the reverse side of the petition Instructions to print the PDF

Más detalles



Más detalles

Speak Up! In Spanish. Young s Language Consulting. Young's Language Consulting. Lesson 1 Meeting and Greeting People.

Speak Up! In Spanish. Young s Language Consulting. Young's Language Consulting. Lesson 1 Meeting and Greeting People. Buenos días Good morning Buenos días Good afternoon Buenas tardes Good evening Buenas tardes Good night Buenas noches Sir Señor Ma am/mrs. Señora Miss Señorita Buenas tardes Culture Note: When greeting

Más detalles


CONTROLADORA PARA PIXELS CONPIX The LedEdit Software Instructions 1, Install the software to PC and open English version: When we installed The LedEdit Software, on the desktop we can see following icon: Please Double-click it, then

Más detalles

An explanation by Sr. Jordan

An explanation by Sr. Jordan & An explanation by Sr. Jdan direct object pronouns We usually use Direct Object Pronouns to substitute f it them in a sentence when the it them follows the verb. Because of gender, him and her could also

Más detalles

Adjectives. By Lic. Hector Chacon

Adjectives. By Lic. Hector Chacon Adjectives By Lic. Hector Chacon Use The adjectives are words that describe nouns. Examples Big Far Expensive Cheap Beautiful Comparatives & Superlatives Comparative Adjectives Comparative adjectives are

Más detalles


TALLER 1 FORMAS DE REPRESENTACIÓN TALLER 1 FORMAS DE REPRESENTACIÓN Ejemplos 1.- Representar 421 10 en base 2 Resultado: 110100101b 2.- Representar 11010111 2 en base 10 Resultado: 215 3.- Representar 1101,1012 en base 10 Resultado: 13,625

Más detalles

ICP FOREST / FUTMON 3rd Meeting of the Heads of the Laboratories

ICP FOREST / FUTMON 3rd Meeting of the Heads of the Laboratories mg/l Water Ring Test 2011 Range Na K Mg Ca 0 20 0 10 0 10 0-20 Spain Lab Range 1-20 1-40 1-20 1-40 INIA Lab Only measured ICP Forest samples During more than 15 years Knowledge of the ranges Water samples

Más detalles


PROBLEMAS PARA LA CLASE DEL 20 DE FEBRERO DEL 2008 PROBLEMAS PARA LA CLASE DEL 20 DE FEBRERO DEL 2008 Problema 1 Marketing estimates that a new instrument for the analysis of soil samples will be very successful, moderately successful, or unsuccessful,

Más detalles



Más detalles

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G.

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G. C825T Sistema para la detección de la mutación C825T en el gene de la proteína G. Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60.

Más detalles

Guía de referencia rápida / Quick reference guide Visor de Noticias Slider / NCS News Slider for SharePoint

Guía de referencia rápida / Quick reference guide Visor de Noticias Slider / NCS News Slider for SharePoint Guía de referencia rápida / Quick reference guide Visor de Noticias Slider / NCS News Slider for SharePoint Contenido ESPAÑOL... 3 Términos de Uso... 3 Soporte... 3 Look de la Aplicación... 3 Requisitos

Más detalles


ADAPTACIÓN DE REAL TIME WORKSHOP AL SISTEMA OPERATIVO LINUX ADAPTACIÓN DE REAL TIME WORKSHOP AL SISTEMA OPERATIVO LINUX Autor: Tomás Murillo, Fernando. Director: Muñoz Frías, José Daniel. Coordinador: Contreras Bárcena, David Entidad Colaboradora: ICAI Universidad

Más detalles

Laboratorio de Marcadores Moleculares del Programa de Cereales y Granos Nativos

Laboratorio de Marcadores Moleculares del Programa de Cereales y Granos Nativos Laboratorio de Marcadores Moleculares del Programa de Cereales y Granos Nativos GUÍA PRÁCTICA: INTRODUCCIÓN AL USO DE MARCADORES MOLECULARES EN EL ANÁLISIS DE DIVERSIDAD GENÉTICA Bloque Práctico (Chirinos

Más detalles



Más detalles

Agustiniano Ciudad Salitre School Computer Science Support Guide - 2015 Second grade First term

Agustiniano Ciudad Salitre School Computer Science Support Guide - 2015 Second grade First term Agustiniano Ciudad Salitre School Computer Science Support Guide - 2015 Second grade First term UNIDAD TEMATICA: INTERFAZ DE WINDOWS LOGRO: Reconoce la interfaz de Windows para ubicar y acceder a los programas,

Más detalles

1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de Quant- it PicoGreen dsaadnssay Kit (Invitrogen ).

1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de Quant- it PicoGreen dsaadnssay Kit (Invitrogen ). 1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de QuantiT PicoGreen dsaadnssay Kit (Invitrogen ). 2. Finalidad. El presente documento describe el Procedimiento Normalizado de

Más detalles

Extracción de bromelina a partir de residuos de piña

Extracción de bromelina a partir de residuos de piña Extracción de bromelina a partir de residuos de piña Linda I. S. Gallardo Castillo 1, Alfredo Sánchez Solano 1,2, Claudia Montalvo Paquini 1 Alejandro I. A. Alonso Calderón 1,2 y 1 Universidad Politécnica

Más detalles

Universidad Autónoma Metropolitana Unidad Xochimilco.

Universidad Autónoma Metropolitana Unidad Xochimilco. Universidad Autónoma Metropolitana Unidad ochimilco. Calzada del Hueso No. 1100. Colonia Villa Quietud. México, 04960, D.F. Departamento El Hombre y su Ambiente. Laboratorio: Producción de Alimento Vivo

Más detalles

TEACHER TOOLS: Teaching Kids Spanish Vocabulary. An Activity in 4 Steps

TEACHER TOOLS: Teaching Kids Spanish Vocabulary. An Activity in 4 Steps TEACHER TOOLS: Teaching Kids Spanish Vocabulary An Activity in 4 Steps Teaching Kids Spanish Vocabulary Lesson for Spanish Teachers Learning new vocabulary words in Spanish is an important element in the

Más detalles


APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS Prácticas docentes en la COD: 10-71 APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS FUNDAMENTO TEÓRICO La PCR es una técnica que permite llevar a cabo la síntesis in vitro de fragmentos de ADN. Está basada

Más detalles


ELECTROFORESIS AVANZADA Ref.ELECAVANZADA (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO ELECTROFORESIS AVANZADA El objetivo de este experimento es introducir a los alumnos en el conocimiento de la teoría electroforética y familiarizarse

Más detalles

Universidad de Guadalajara

Universidad de Guadalajara Universidad de Guadalajara Centro Universitario de Ciencias Económico-Administrativas Maestría en Tecnologías de Información Ante-proyecto de Tésis Selection of a lightweight virtualization framework to

Más detalles

FAQs preguntasfrecuentes

FAQs preguntasfrecuentes FAQs preguntasfrecuentes 1.- Diferencias entre el MethylDetector y el MethylCollector. ir a respuesta 2.- Se puede hacer ChipIT a partir de muestras de tejidos? ir a respuesta 3.- A veces se producen incidencias

Más detalles

ADN y RNA caracterización y métodos de estudio

ADN y RNA caracterización y métodos de estudio ADN y RNA caracterización y métodos de estudio Separación por centrifugación de equilibrio en gradiente de densidad de en CsCl Separación por centrifugación de equilibrio en gradiente de densidad de en

Más detalles

Hard Disk Drive Duplicator Dock USB 3.0 to SATA HDD Duplicator. StarTech ID: SATDOCK22RU3

Hard Disk Drive Duplicator Dock USB 3.0 to SATA HDD Duplicator. StarTech ID: SATDOCK22RU3 Hard Disk Drive Duplicator Dock USB 3.0 to SATA HDD Duplicator StarTech ID: SATDOCK22RU3 The SATDOCK22RU3 USB 3.0 to SATA Hard Drive Duplicator Dock can be used as a standalone SATA hard drive duplicator,

Más detalles


FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles


DETERMINACIÓN DE GLUTEN EN ALIMENTOS PARA CELÍACOS INDICE DETERMINACIÓN DE GLUTEN EN ALIMENTOS PARA CELÍACOS INDICE 1 Objetivo 2 2 Alcance 2 3 Desarrollo 2 4 Anexo 8 1.0. Objetivo Determinación de gluten en alimentos para celíacos. 2.0. Alcance Este método analítico

Más detalles

Diseño de un directorio Web de diseñadores gráficos, ilustradores y fotógrafos.

Diseño de un directorio Web de diseñadores gráficos, ilustradores y fotógrafos. Universidad Nueva Esparta Facultad de Ciencias Administrativas Escuela de Administración de Diseño de un directorio Web de diseñadores gráficos, ilustradores y fotógrafos. Tutor: Lic. Beaujon, María Beatriz

Más detalles

17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico

17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico 17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico Carmen Alicia Padilla Peña, Jesús Diez Dapena, Emilia Martínez Galisteo, José

Más detalles


Más detalles

Brief Introduction to Docking and Virtual Screening with Autodock4 and Autodock Tools

Brief Introduction to Docking and Virtual Screening with Autodock4 and Autodock Tools Brief Introduction to Docking and Virtual Screening with Autodock4 and Autodock Tools Environment set up Launch AutoDock Tools Gui. Aplicaciones --> MGLTools-1.5.4 --> AutoDockTools-1.5.4 You should see

Más detalles

DIAMOND Gear Company, LTD. an ERIKS Company. Installation, Maintenance, & Operation Manual DECLUTCHABLE WORM GEAR

DIAMOND Gear Company, LTD. an ERIKS Company. Installation, Maintenance, & Operation Manual DECLUTCHABLE WORM GEAR DIAMOND Gear Company, LTD. an ERIKS Company Installation, Maintenance, & Operation Manual 2013 INSTRUCTIONS This is an instructional manual which provides general installation, operation, and maintenance

Más detalles

MANUAL EASYCHAIR. A) Ingresar su nombre de usuario y password, si ya tiene una cuenta registrada Ó

MANUAL EASYCHAIR. A) Ingresar su nombre de usuario y password, si ya tiene una cuenta registrada Ó MANUAL EASYCHAIR La URL para enviar su propuesta a la convocatoria es: Donde aparece la siguiente pantalla: Se encuentran dos opciones: A) Ingresar

Más detalles

Compraventa de acciones en la cuenta de su plan accionario (Stock Plan Account)

Compraventa de acciones en la cuenta de su plan accionario (Stock Plan Account) ESPAÑOL - SPANISH Compraventa de acciones en la cuenta de su plan accionario (Stock Plan Account) Siga los pasos que se indican a continuación para poner una orden de venta de las acciones de su empresa.*

Más detalles



Más detalles

Instrucciones de uso. Wipe test. Control de Contaminación. Kit de pruebas para la detección de contaminaciones basado en genética molecular REF 7091

Instrucciones de uso. Wipe test. Control de Contaminación. Kit de pruebas para la detección de contaminaciones basado en genética molecular REF 7091 Instrucciones de uso Wipe test Control de Contaminación Kit de pruebas para la detección de contaminaciones basado en genética molecular REF 7091 40 Reacciones 1. Descripción del Producto El uso de la

Más detalles


THE RACING RULES OF SAILING FOR 2009 2012 THE RACING RULES OF SAILING FOR 2009 2012 Changes effective from 1 January 2010 Cambios con efecto desde el 1 de Enero de 2010 As a result of actions taken by the ISAF Racing Rules Committee and the ISAF

Más detalles



Más detalles


SEPARACIÓN DE LOS IONES Fe 3+, Cu 2+, Co 2+, Ni 2+ POR CROMATOGRAFÍA DE PAPEL CIRCULAR 64 Rev. Soc. Quím. Perú, 2005, 71, Nº 1, (64-68) SEPARACIÓN DE LOS IONES Fe 3+, Cu 2+, Co 2+, Ni 2+ POR CROMATOGRAFÍA DE PAPEL CIRCULAR Alma Rosa Vargas Castañeda* RESUMEN En este trabajo se desarrolló

Más detalles


ACTIVIDAD PRACTICA No. 8 BIOLOGIA CELULAR EXTRACCIÓN DE ADN Universidad Centroccidental Lisandro Alvarado Decanato de Ciencias de la Salud ACTIVIDAD PRACTICA No. 8 BIOLOGIA CELULAR EXTRACCIÓN DE ADN Octubre 2009 INTRODUCCION La molécula de ADN (que es la que se

Más detalles


METODOS DE ANALISIS BIOMEDICOS METODOS DE ANALISIS BIOMEDICOS 2010 Profesora a cargo: Dra. Viviana Lepek PARTE PRÁCTICA Jefe de T.P.: Dra. Mara Roset Ayudantes: Dra. Ines Marchesini Lic. Lucas Bukata Dr. Juan Mucci Dr. Adrián Mutto

Más detalles

Laboratorio. Objetivos I N T R O D U C C I Ó N. Al finalizar este laboratorio el estudiante podrá:

Laboratorio. Objetivos I N T R O D U C C I Ó N. Al finalizar este laboratorio el estudiante podrá: Laboratorio 12 Biología molecular Objetivos Al finalizar este laboratorio el estudiante podrá: 1. Conocer los principios básicos de la técnica de electroforesis y su aplicación al análisis del ADN. 2.

Más detalles

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml)

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml) PCR SIMULADA Ref.PCR Simulada (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

Digitally Certifying Using Autodesk Design Review

Digitally Certifying Using Autodesk Design Review Desarrollado por: DNE Labs LLC Developed by: DNE Labs LLC Revisado en: 01 de mayo de 2014. Ver. 4.102.0501 Revision date: May 01, 2014. Este manual es para aquellos que quieran utilizar

Más detalles

Qué viva la Gráfica de Cien!

Qué viva la Gráfica de Cien! Qué viva la Gráfica de Cien! La gráfica de cien consiste en números del 1 al 100 ordenados en cuadrilones de diez números en hileras. El resultado es que los estudiantes que utilizan estás gráficas pueden

Más detalles

ARTICULO: 5810 Sistema de Posicionador Digital para Actuador Eléctrico Digital Positioning System for Electric Actuator

ARTICULO: 5810 Sistema de Posicionador Digital para Actuador Eléctrico Digital Positioning System for Electric Actuator ARTICULO: 5810 Sistema de Posicionador Digital para Actuador Eléctrico Digital Positioning System for Electric Actuator Características El DPS es un accesorio para los actuadores eléctricos que convierte

Más detalles