Save this PDF as:

Tamaño: px
Comenzar la demostración a partir de la página:



1 Página 1 de 5 1. OBJETIVO Detectar la presencia de Campylobacter jejuni en hamburguesa de pollo mediante técnica de PCR. 2. CAMPO DE APLICACIÓN Y ALCANCE Aplicar este procedimiento a muestras de hamburguesa de pollo sospechosa de estar contaminadas con Campylobacter. 3. FUNDAMENTO Los métodos de cultivo tradicionales para identificación de C. jejuni son lentos y tediosos, ya que requieren de aproximadamente 5 días para el aislamiento y caracterización del microorganismo. Por otra parte la diferenciación de C. jejuni de otros microorganismos del mismo género basada en la prueba de hidrólisis del hipurato no siempre permite definir con precisión la identificación, ya que se ha descrito la existencia de cepas de C. jejuni con ausencia de la enzima hipuricasa. A partir de la dificultad de los test fenotípicos para la caracterización a nivel de especie de Campylobacter y el bajo espectro de pruebas bioquímicas, se han desarrollado varios ensayos basados en biología molecular para la identificación específica de este microorganismo La reacción especifica de PCR para amplificación específica de C. jejuni fue desarrollada con el uso de primers según la secuencia nucleotídica de sondas monoespecíficas basadas en el gen altamente conservado gly A (que codifica una serinahidroximetiltransferasa). 4. REFERENCIAS 4.1 Manual de Procedimientos para el Diagnóstico y Caracterización de Campylobacter spp. Difundido a través del IV Curso Avanzado de WHO Global Salmonella Survillance 2006, realizado en el Instituto Nacional de Enfermedades Infecciosas ANLIS Dr. Carlos Malbrán Servicio de Bacteriología Sanitaria Departamento de Bacteriología.

2 Página 2 de 5 5. TERMINOLOGÍA 5.1 ATCC = American Type Culture Collection 5.2 dntps = Desoxirribonucleótidos (adenina, timina, citosina, guanina) 5.3 MgCl 2 = Cloruro de magnesio 5.4 PCR = Reacción en cadena de la polimerasa 5.5 BSA = Serum Albumina Bovine 5.6 pb = pares de base 5.7 TAE= Tris-Acetato-EDTA 6. MATERIALES, INSUMOS Y EQUIPOS 6.1 Materiales Materiales de uso común en microbiología (pipetas de vidrio, placas de Petri, asa de inoculación, etc.) 6.2 Reactivos y medios Suero fisiológico en porciones de 250 ml Cepa de Campylobacyter jejuni ATCC Set de partidores específicos Jun F : 5 CAT CTT CCC TAG TCA AGC CT 3 Jun R : 5 AAG ATA TGG CAC TAG CAA GAC Reactivos de uso común en PCR tradicional (dntps, Mg Cl2, Taq DNA polimerasa, agua calidad biología molecular, micropuntas, microtubos, micropipetas) Caldo Bolton sin sangre, con suplemento FBP y antibióticos Suplemento FBP (Oxoid SR0232E) Suplemento Skirrow (Oxoid SR0069E) Suplemento Bolton (Oxoid SR 0183E) Suplemento Preston (Oxoid)

3 Página 3 de Caldo Preston sin sangre, con suplemento FBP y antibióticos BSA 0,02% Estándar de peso molecular de100 pares de base (pb) Agarosa calidad biología molecular Buffer TAE 1X Agua calidad biología molecular Solución de bromuro de etidio (1µ/mL) 6.3 EQUIPOS Incubadora regulada a 42ºC ± 1ºC Termociclador Cámara de electroforesis Fuente e poder Microcentrífuga ( x g.) Digitalizador de imágenes Congelador -20ºC 7. DESARROLLO 7.1 Preparación de la muestra, PCR en hamburguesa de pollo Pesar 25 gramos de muestra de hamburguesa de pollo y agregar 250 ml de suero fisiológico estéril. Agitar por 1 minuto y luego dejar en reposo por 15 a 20 minutos Tomar 2 ml del sobrenadante de la solución de lavado del alimento y agregar a 18 ml de caldo Bolton con suplemento FBP y antibióticos Incubar a 42 ± 1 ºC por 18 ± 2 horas en microaerofilia Después de la incubación se toma 1mL del cultivo y se centrifuga a x g durante 10 minutos Luego descartar el sobrenadante Resuspender el pellet en 1 ml de suero fisiológico y centrifugar nuevamente a x g durante 10 minutos.

4 Página 4 de Descartar el sobrenadante Resuspender el pellet en 100 ul de agua calidad molecular Llevar la suspensión por 10 minutos a 100ºC, y luego mantenerla a 4ºC para utilizarla como templado Realizar la mezcla de PCR, según el siguiente esquema: Reactivos Volumen (µl) Concentración Templado 5 Agua PCR 5,75 Buffer 10 X 2,5 1X MgCl 2 50 mm 1 2,0 mm BSA 1% 0,5 0,02g% dntp(mezcla) 2 0,2 mm Jun F 2,5 1 µm Jun R 2,5 1 µm Taq polimerasa 0,25 1,25 U Volumen final Llevar los tubos al termociclador y someter al siguiente programa: Una etapa inicial de desnaturalización de 5 minutos a 94ºC, 2 ciclos de 1 minto a 94ºC, 1 minuto a 64 ºC, 1 minuto a 72ºC, 2 ciclos de 1 minto a 94ºC, 1 minuto a 62 ºC, 1 minuto a 72ºC, 2 ciclos de 1 minto a 94ºC, 1 minuto a 60 ºC, 1 minuto a 72ºC, 2 ciclos de 1 minto a 94ºC, 1 minuto a 58 ºC, 1 minuto a 72ºC, 2 ciclos de 1 minto a 94ºC, 1 minuto a 56 ºC, 1 minuto a 72ºC, Seguido de 30 ciclos de 1 minuto a 94ºC, 1 minuto a 54ºC, 1 minuto a 72ºC, y una extensión final de 10 minutos a 72ºC. Al final mantener a 4ºC Observar los productos de la reacción de PCR en un gel de agarosa al 2%, corrido a 100 V durante 40 minutos, usando como buffer de corrida TAE 1X y marcador de peso molecular de 100 pares de base. El tamaño de fragmento esperado es de 773 pb C. jejuni. La tinción del gel se realiza con bromuro de etidio (1ug/mL), durante 30 minutos y luego se visualiza bajo una fuente de luz U.V.

5 Página 5 de PCR desde cepa aislada Tomar una asada de cepa desarrollada en agar sangre a 42ºC durante 24 horas en condiciones de microaerofilia y colocarla en un tubo que contenga 1 ml de suero fisiológico, agitar en Vortex Centrifugar a x g durante 5 a 8 minutos. Descartar el sobrenadante y resuspender. El pellet en 200 ul de agua calidad molecular Colocar la suspensión a 100 ºC por 10 minutos, luego colocarla a -20ºC hasta su utilización como templado Realizar la reacción de PCR y la visualización de productos de amplificación de la misma forma descrita en a REGISTROS Identificación del registro Almacenamiento Protección Recuperación Tiempo retención y disposición Registro de Archivador Azul, Libre acceso papel 5 años y disponer identificación de C. Registro de lectura de personal de en la basura jejuni RG informe de resultado microbiología picado en trozos 105 Laboratorio 348 de alimentos 9. TABLA DE MODIFICACIONES Revisión Nº Pág. Modificada Motivo del cambio Fecha Aprobación 10. ANEXOS 10.1 Registro de identificación de C. jejuni, RG

IV Curso Avanzado WHO GSS 2006 Buenos Aires 15 al 24 de mayo de 2006

IV Curso Avanzado WHO GSS 2006 Buenos Aires 15 al 24 de mayo de 2006 IV Curso Avanzado WHO GSS 2006 Buenos Aires 15 al 24 de mayo de 2006 REACCION EN CADENA DE LA POLIMERASA (PCR) EN EL DIAGNOSTICO DE Campylobacter jejuni/coli Viernes 19 de mayo María Rosa Viñas Servicio

Más detalles



Más detalles


5. MATERIALES Y MÉTODOS 5. MATERIALES Y MÉTODOS 5.1 Equipos Los siguientes termocicladores se emplearon para la amplificación por PCR: - Perkin Elmer, GeneAmp PCR System 2400. - Perkin Elmer, GeneAmp PCR System 9600. - Applied

Más detalles

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR Módulo 1 Amplificación de un fragmento de ADN genómico por PCR En este primer módulo se amplificará por PCR, mediante el uso de oligonucleótidos específicos, un fragmento de ADN genómico de Aspergillus

Más detalles


APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS Prácticas docentes en la COD: 10-71 APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS FUNDAMENTO TEÓRICO La PCR es una técnica que permite llevar a cabo la síntesis in vitro de fragmentos de ADN. Está basada

Más detalles



Más detalles

Materiales para la secuenciación de ADN

Materiales para la secuenciación de ADN Introduccion La Secuenciación Sanger es un método de secuenciación de ADN en el que el ADN diana se desnaturaliza y se hibrida con un cebador de oligonucleótidos, que se extiende entonces gracias a la

Más detalles

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G.

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G. C825T Sistema para la detección de la mutación C825T en el gene de la proteína G. Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60.

Más detalles

Protocolos de secuenciación de ADN

Protocolos de secuenciación de ADN 1 Protocolos de secuenciación de ADN Introducción El método de secuenciación utilizado aquí es el desarrollado por Sanger en 1975. Este consiste en la incorporación de didesixinucleótidos marcados fluorescentemente

Más detalles



Más detalles


PRÁCTICAS DE MICROBIOLOGIA CLINICA PRÁCTICAS DE MICROBIOLOGIA CLINICA Juan Carlos Rodríguez Hospital General Universitario de Alicante E-mail: CASO CLINICO: Rubéola Evolución

Más detalles


MATERIALES Y MÉTODOS. Cepas Utilizadas MATERIALES Y MÉTODOS Cepas Utilizadas Para el presente trabajo se utilizaron tres cepas Tipo: Mycobacterium aviumintracellulare (proporcionada al Laboratorio Estatal de Salud Pública por el Instituto Nacional

Más detalles

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now.

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now. Unidad Curricular: Virología y Micología Veterinaria 1 TRABAJO PRÁCTICO No. 3 AMPLIFICACIÓN DE GENES VIRALES Reacción en Cadena de la Polimerasa, conocida como PCR (por sus siglas en inglés: Polimerase

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60.

Más detalles

Práctico: Genética bacteriana 2007.

Práctico: Genética bacteriana 2007. Práctico: Genética bacteriana 2007. Actividad integrada Departamento de Genética Departamento de Bacteriología y Virología. OBJETIVOS Objetivos generales El estudiante al terminar la actividad práctica

Más detalles


2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA BIOLOGIA MOLECULAR Hemos elaborado un programa en 3 niveles, en función del tipo de estudiante y las posibilidades del centro educativo: 1. NIVEL BASICO 2. NIVEL MEDIO DANAEXTRACTOR KIT Práctica que constituye

Más detalles

Técnicas de Biología Molecular. Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO

Técnicas de Biología Molecular. Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO Técnicas de Biología Molecular Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO 2004 Extracción de ácidos nucleicos o o DNA RNA Tipos de Muestras Sangre total (EDTA) Saliva Líquido Amniótico Bulbo

Más detalles

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml)

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml) PCR SIMULADA Ref.PCR Simulada (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles



Más detalles

Curso de biología molecular CIMAT 2010

Curso de biología molecular CIMAT 2010 Curso de biología molecular CIMAT 2010 INTRODUCCIÓN Este curso-taller tiene como propósito mostrar de manera teórica y práctica algunos principios básicos de biología molecular e ingeniería genética. Conocerás

Más detalles

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles


III. METODOLOGÍA EXPERIMENTAL III. METODOLOGÍA EXPERIMENTAL 3.1 Análisis Previos Se utilizaron los filtros con muestra de partículas suspendidas en el aire PM 10 que el Instituto Municipal de Ecología (IME) proporcionó para llevar

Más detalles


DETERMINACIÓN DEL FACTOR Rh por PCR Ref.PCRRh DETERMINACIÓN DEL FACTOR Rh por PCR 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles


PROCEDIMIENTO NMP PARA LA DETERMINACION DE COLIFORMES FECALES EN AGUAS POR METODO A-1 PRT-712.02-006 Página 1 de 6 1. OBJETIVO Este análisis se realiza para estimar la densidad de coliformes fecales en agua, con una incubación de 24 hrs. por lo cual se obtienen resultados en menor tiempo que el método

Más detalles

Técnicas moleculares.

Técnicas moleculares. Técnicas moleculares. DMTV Carolina Acevedo Curso de Microbiología 2015 SÍNTESIS IN VITRO DE UNA GRAN CANTIDAD DE COPIAS DE UN SEGMENTO DE ADN EXISTENTE EN UNA MUESTRA. O sea. Amplificamos en forma exponencial

Más detalles


ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles

ANEXO I. Inmunofenotipificación Celular por Citometría de Flujo

ANEXO I. Inmunofenotipificación Celular por Citometría de Flujo ANEXO I Inmunofenotipificación Celular por Citometría de Flujo Reactivos Anticuerpos monoclonales fluoromarcados (BD Bioscience Pharmingen) Medio DMEM con 0.02% de azida de sodio Paraformaldehido (PFA)

Más detalles

3/22/2010. Iván Ferrer Rodríguez, PhD Catedrático. En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR.

3/22/2010. Iván Ferrer Rodríguez, PhD Catedrático. En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR. Iván Ferrer Rodríguez, PhD Catedrático En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR. Síntesis "in vitro" de secuencias específicas de ADN son amplificadas.

Más detalles

Reacción en cadena de la polymerasa (PCR)

Reacción en cadena de la polymerasa (PCR) Reacción en cadena de la polymerasa (PCR) 1 PCR Que es? Es una técnica in vitro diseñada para amplificar una región específica de DNA. Es extremadamente sensible, con la capacidad de amplificar millones

Más detalles



Más detalles

velocidades de movimiento mediante la aplicación de un campo eléctrico a través de una matriz porosa

velocidades de movimiento mediante la aplicación de un campo eléctrico a través de una matriz porosa INTRODUCCIÓN En general, la electroforesis es una técnica que separa las moléculas en base a sus diferentes velocidades de movimiento mediante la aplicación de un campo eléctrico a través de una matriz

Más detalles

Tipos de Muestras. Técnicas de Biología Molecular. Extracción de ácidos nucleicos. Extracción de DNA genómico. Muestra de sangre en papel filtro

Tipos de Muestras. Técnicas de Biología Molecular. Extracción de ácidos nucleicos. Extracción de DNA genómico. Muestra de sangre en papel filtro Técnicas de Biología Molecular Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO 2004 Tipos de Muestras Extracción de ácidos nucleicos o DNA o RNA Sangre total (EDTA) Saliva Líquido Amniótico Bulbo

Más detalles


ELECTROFORESIS AVANZADA Ref.ELECAVANZADA (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO ELECTROFORESIS AVANZADA El objetivo de este experimento es introducir a los alumnos en el conocimiento de la teoría electroforética y familiarizarse

Más detalles



Más detalles


PROTOCOLO REGISTRO DE SEMILLA PRE-INOCULADA Dirección General de Servicios Agrícolas Ministerio de Ganadería, Agricultura y Pesca República Oriental del Uruguay Av. Millán 4703, Montevideo. CP 12.900. Teléfono: (598) -2304 3992 Web:

Más detalles


AUTOR: JORGE CONTRERAS PINEDA 1. Titulo: Página 1 de 1 1. Titulo: Electroforesis de DNA 2. Objetivo Conocer los principios básicos de la electroforesis horizontal en geles de agarosa y aplicarlo para la separación de DNA humano, plasmídico, recombinante

Más detalles

DANAGENE SALIVA KIT. Ref.0603.4 50 Extracciones / Ref.0603.41 160 Extracciones

DANAGENE SALIVA KIT. Ref.0603.4 50 Extracciones / Ref.0603.41 160 Extracciones DANAGENE SALIVA KIT Ref.0603.4 50 Extracciones / Ref.0603.41 160 Extracciones 1.INTRODUCCION DANAGENE SALIVA Kit provee un método para la extracción de ADN genómico de alta calidad a partir de muestras

Más detalles



Más detalles

C V C. Instrucciones de uso de Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02. Revisión 2. Julio de 2014

C V C. Instrucciones de uso de Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02. Revisión 2. Julio de 2014 DOT142v1 Instructions for Use Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Página 1 de 7 Instrucciones de uso de Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Revisión 2 Julio de

Más detalles

39. Aislamiento y purificación del DNA de un plásmido recombinante

39. Aislamiento y purificación del DNA de un plásmido recombinante 39. Aislamiento y purificación del DNA de un plásmido recombinante Aurora Galván Cejudo, Manuel Tejada, Antonio Camargo, José Javier Higuera, Vicente Mariscal, Emilio Fernández Reyes Departamento de Bioquímica

Más detalles

P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA"

P.C.R. Técnica de amplificación enzimática de secuencias específicas de DNA P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA" Paso 1: Desnaturalización del DNA Paso 2: Hibridación de los "Primers" Paso 3: Extensión Paso 1: Desnaturalización del DNA

Más detalles


DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino DIAGNOSTICO VIROLOGICO MOLECULAR Dr. Gerardo Andino DIAGNÓSTICO MOLECULAR La tecnología empleada para la detección de genomas virales mediante la amplificación de secuencias específicas (PCR y reacciones

Más detalles



Más detalles


PROCEDIMIENTO DETECCION NOROVIRUS RT-qPCR EN EXTRACTO VIRAL PROVENIENTE DE MOLUSCOS BIVALVOS. PRT-712.07.01-097 Página 1 de 7 PRT-712.07.01-097 Página 1 de 7 1. OBJETIVO Realizar la detección molecular de genes de Norovirus en muestras de moluscos bivalvos. 2. CAMPO DE APLICACIÓN Y ALCANCE Aplicar este procedimiento a concentrados

Más detalles


1 MATERIALES Y MÉTODOS 1 MATERIALES Y MÉTODOS El presente protocolo experimental contempla la amplificación del DNA de las bacterias y virus causantes de las ETS Neisseria gonorrhoeae, Chlamydia trachomatis y VPH mediante PCR

Más detalles

CAPÍTULO VI. Expresión de genes relacionados con apoptosis

CAPÍTULO VI. Expresión de genes relacionados con apoptosis CAPÍTULO VI Expresión de genes relacionados con apoptosis 1.- Introducción 2.- Protocolos para análisis genéticos 3.- Resultados en MCF-7 4.- Discusión 1.- Introducción Como se ha descrito anteriormente,

Más detalles



Más detalles



Más detalles

Tecnologías basadas en la PCR

Tecnologías basadas en la PCR Tecnologías de marcadores moleculares para estudios de diversidad genética de plantas: Módulo de aprendizaje Tecnologías basadas en el ADN Tecnologías basadas en la PCR Fundamentos de la PCR Derechos de

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

N 1 Reacción n en Cadena de la Polimerasa

N 1 Reacción n en Cadena de la Polimerasa Trabajo Práctico N 1 Reacción n en Cadena de la Polimerasa Definición n e importancia. Usos y aplicaciones. Optimización. Tipos de PCR. Electroforesis. Fundamentos. Asociado al Programa Teórico: Tema 2.

Más detalles


METODO DE FILTRACIÓN POR MEMBRANA PARA DETERMINACION DE COLIFORMES Y E. coli EN AGUA PRT-712.03-009 Página 1 de 7 1. OBJETIVO Este método se utiliza para medir la calidad sanitaria del agua potable. 2. CAMPO DE APLICACIÓN Y ALCANCE Se aplica a agua clorada o agua naturales de muy baja

Más detalles

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica TÉCNICAS GENÓMICAS Utilidad/Objetivos: 1) Detección de microorganismos directamente en muestras clínicas identificando un fragmento específico del genoma del microorganismo concreto 2) Cuantificación del

Más detalles

17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico

17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico 17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico Carmen Alicia Padilla Peña, Jesús Diez Dapena, Emilia Martínez Galisteo, José

Más detalles


ACTIVIDAD PRACTICA No. 8 BIOLOGIA CELULAR EXTRACCIÓN DE ADN Universidad Centroccidental Lisandro Alvarado Decanato de Ciencias de la Salud ACTIVIDAD PRACTICA No. 8 BIOLOGIA CELULAR EXTRACCIÓN DE ADN Octubre 2009 INTRODUCCION La molécula de ADN (que es la que se

Más detalles


5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN 5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN Materiales - Eppendorf de 1,5 ml estériles - Eppendorf de pared fina para PCR - Puntas de pipeta estériles desechables - Guantes

Más detalles


REACCIÓN EN CADENA DE LA POLIMERASA (PCR) REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Microbiología General Microbiología M de los Alimentos Licenciatura en Bioquímica i Ingeniería en alimentos c Microbiología r 2015 Licenciatura en Biotecnología

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

Reacción en cadena de la polimerasa (PCR)

Reacción en cadena de la polimerasa (PCR) Dr. Alejandro Leal Reacción en cadena de la polimerasa (PCR) La reacción en cadena de la polimerasa (PCR, por sus siglas en inglés de "polymerase chain reaction") es un método de amplificación in vitro

Más detalles


DETERMINACIÓN DE PATULINA EN JUGOS DE MANZANA Extracción líquido-líquido Página 1 de 9 1. OBJETIVO Detectar y cuantificar la presencia de la micotoxina patulina en jugos de manzana. 2. CAMPO DE APLICACIÓN Y ALCANCE El método es aplicable a los jugos y concentrados de manzana.

Más detalles

Laboratorio. Objetivos I N T R O D U C C I Ó N. Al finalizar este laboratorio el estudiante podrá:

Laboratorio. Objetivos I N T R O D U C C I Ó N. Al finalizar este laboratorio el estudiante podrá: Laboratorio 12 Biología molecular Objetivos Al finalizar este laboratorio el estudiante podrá: 1. Conocer los principios básicos de la técnica de electroforesis y su aplicación al análisis del ADN. 2.

Más detalles


METODOS DE ANALISIS BIOMEDICOS METODOS DE ANALISIS BIOMEDICOS 2010 Profesora a cargo: Dra. Viviana Lepek PARTE PRÁCTICA Jefe de T.P.: Dra. Mara Roset Ayudantes: Dra. Ines Marchesini Lic. Lucas Bukata Dr. Juan Mucci Dr. Adrián Mutto

Más detalles


UNIVERSIDAD DE PUERTO RICO EN AGUADILLA DEPARTAMENTO DE CIENCIAS NATURALES. Laboratorio de Genética BIOL 3306 UNIVERSIDAD DE PUERTO RICO EN AGUADILLA DEPARTAMENTO DE CIENCIAS NATURALES Laboratorio de Genética BIOL 3306 Liza V. Jiménez Rodríguez, Ph.D. Agosto, 2014 Pre-prueba I. Pareo 1) Geles de agarosa 2) Loading

Más detalles



Más detalles

Instrucciones de uso. Wipe test. Control de Contaminación. Kit de pruebas para la detección de contaminaciones basado en genética molecular REF 7091

Instrucciones de uso. Wipe test. Control de Contaminación. Kit de pruebas para la detección de contaminaciones basado en genética molecular REF 7091 Instrucciones de uso Wipe test Control de Contaminación Kit de pruebas para la detección de contaminaciones basado en genética molecular REF 7091 40 Reacciones 1. Descripción del Producto El uso de la

Más detalles

REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Microbiología de los Alimentos Ingeniería en alimentos

REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Microbiología de los Alimentos Ingeniería en alimentos REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Microbiología de los Alimentos Ingeniería en alimentos 2015 Desarrollada por Kary Mullis en 1986 Técnica in vitro que permite amplificar enzimáticamente una región

Más detalles


AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO E l estudio del genoma de los seres vivos a sido uno d los principales objetivos de la Biología. Desde los trabajos de Mendel (1866),

Más detalles

Resumen Bioluminiscencia

Resumen Bioluminiscencia Curso de biología molecular CIMAT 2007 Resumen Este curso-taller tiene como propósito mostrar de manera teórica y práctica algunos principios básicos de biología molecular e ingeniería genética. Conocerás

Más detalles



Más detalles

Guía de PCR en tiempo real

Guía de PCR en tiempo real Guía de PCR en tiempo real Michelle C. Chirinos-Arias Índice Introducción. 2 Algunos conceptos. 2 PCR (reacción en cadena de la polimerasa)... 2 PCR en tiempo real (qpcr)..

Más detalles

Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares. Técnicas Moleculares. Técnicas Moleculares 8/13/13

Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares. Técnicas Moleculares. Técnicas Moleculares 8/13/13 8/13/13 Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares CAF516 O Recursos Genéticos y Biotecnología 14 Agosto 2013 Técnicas Moleculares Aplicaciones en muchas disciplinas Generan

Más detalles


MOLECULAR DIAGNOSTIC KITS CATALOGUE MOLECULAR DIAGNOSTIC KITS CATALOGUE KITS DE DIAGNÓSTICO MOLECULAR IELAB le presenta, enmarcada dentro de su línea de productos de diagnóstico molecular, una nueva gama de kits de diagnóstico, que han sido

Más detalles

Guía Práctica 9. Producción de micelio en medio líquido para extracción de ADN. Micelio de hongos. Contenido

Guía Práctica 9. Producción de micelio en medio líquido para extracción de ADN. Micelio de hongos. Contenido Guía Práctica 9 Micelio de hongos Producción de micelio en medio líquido para extracción de ADN Guillermo Castellanos, Experto en Investigación 2 Carlos Jara, Ing. Agr. M.Sc., Asociado en Investigación

Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

Método de extracción de adn en nematodos para su aplicación en el diagnóstico por técnicas moleculares.

Método de extracción de adn en nematodos para su aplicación en el diagnóstico por técnicas moleculares. Método de extracción de adn en nematodos para su aplicación en el diagnóstico por técnicas moleculares. INTRODUCCIÓN La determinación morfológica y morfométrica de nematodos fitopatógenos en los laboratorios

Más detalles

Biotechnology Explorer. Kit de huella genética (ADN fingerprint) Manual de instrucciones. Número de catálogo 166-0007-EDU.

Biotechnology Explorer. Kit de huella genética (ADN fingerprint) Manual de instrucciones. Número de catálogo 166-0007-EDU. Biotechnology Explorer Kit de huella genética (ADN fingerprint) Manual de instrucciones Número de catálogo 166-0007-EDU Los reactivos liofilizados se pueden almacenar a temperatura

Más detalles

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada La PCR La Reacción en Cadena de la Polimerasa es la herramienta más utilizada PCR- Ventajas y Usos Amplificación ilimitada de secuencias de interés. Rápida, Sencilla y Eficaz. Técnica altamente sensible

Más detalles


PROCEDIMIENTO EVALUACION DE MEDIOS DE CULTIVO PRT-712.00-105 PRT712.00105 28102008 10012012 Página 1 de 25 1. OBJETIVO Asegurar la calidad de los medios de cultivos preparados en la Sección Microbiología de utilizados en los análisis microbiológicos de alimentos

Más detalles


DETECCIÓN, CARACTERIZACIÓN Y TITULACIÓN DE ISOHEMAGLUTININAS Área de Inmunología. Prácticas de Inmunología Clínica Autor: Gonzalo Rubio Pedraza DETECCIÓN, CARACTERIZACIÓN Y TITULACIÓN DE ISOHEMAGLUTININAS Al finalizar la práctica, el alumno debe ser

Más detalles

Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala

Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala IICA/Red SICTA-CIAT INFORME DE AVANCE Gerardo Gallego - Harold

Más detalles


ELECTROFORESIS BASICA Ref.ELECBASICA (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO ELECTROFORESIS BASICA El objetivo de este experimento es introducir a los alumnos en el conocimiento de la teoría electroforética y familiarizarse

Más detalles

Prácticas integradas de Ecología molecular microbiana

Prácticas integradas de Ecología molecular microbiana Prácticas integradas de Ecología molecular microbiana Indice. Página 1. Introducción 1 2. Cronograma 1 3. Esquema de trabajo 2 4. Reactivos utilizados 3 5. Preparación de las Muestras 3 6. Hibridación

Más detalles


FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles


COMPLEJO MAYOR DE HISTOCOMPATIBILIDAD. Molecular COMPLEJO MAYOR DE HISTOCOMPATIBILIDAD Dra.. Flora Calzadilla Lugo Laboratorio de Genética Molecular POLIMORFISMO GENETICO Presencia en una población de múltiples un gen y que debe estar presente en el

Más detalles


ELECTROFORESIS EN GELES DE AGAROSA. Agustín Garrido. 1 ELECTROFORESIS EN GELES DE AGAROSA Agustín Garrido Introducción En este trabajo práctico se utilizó la técnica de electroforesis. Este proceso se basa en la migración de las moléculas

Más detalles

ELECTROFORESIS Cubas, fuentes de poder, transiluminadores y termocicladores

ELECTROFORESIS Cubas, fuentes de poder, transiluminadores y termocicladores 1 ELECTROFORESIS Cubas, fuentes de poder, transiluminadores y termocicladores CUBA HORIZONTAL LABNET ENDURO - MADE IN USA Diseñadas para maximizar su durabilidad, tiempo de uso y seguridad, las cubas horizontales

Más detalles


FACULTAD REGIONAL ROSARIO FACULTAD REGIONAL ROSARIO CATEDRA BIOTECNOLOGIA ROFESOR: Ing. Eduardo Santambrosio JTP: Ing. Marta Ortega AUX 1ª : Ing. Pablo Garibaldi PCR (Polymerase chain reaction) Reacción en cadena de la polimerasa

Más detalles

Técnica de PCR. Beatriz Bellosillo. Servei de Patologia, Hospital del Mar, Barcelona, Spain

Técnica de PCR. Beatriz Bellosillo. Servei de Patologia, Hospital del Mar, Barcelona, Spain Técnica de PCR Beatriz Bellosillo Servei de Patologia, Hospital del Mar, Barcelona, Spain Biología Molecular Estudio de los procesos que se desarrollan en los seres vivos desde un punto de vista molecular

Más detalles

Bioquímica III- 2009

Bioquímica III- 2009 Facultad de Ciencias Exactas, Universidad Nacional de La Plata Bioquímica III- 2009 Trabajo Práctico Nro 4 Extracción de RNA y DNA bacteriano INTRODUCCIÓN El RNA es el ácido nucleico más abundante en la

Más detalles

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri OBJETIVO Desarrollar un banco de datos a partir de plantas de origen indudable y del uso

Más detalles


TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO TEST de PATERNIDAD Este experimento introduce a los alumnos en el uso del ADN y la PCR para simular una determinación de paternidad. Los estudiantes

Más detalles

PCR. Técnica inventada por Kary Mullis :1987. Premio Nobel 1993. Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN

PCR. Técnica inventada por Kary Mullis :1987. Premio Nobel 1993. Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN PCR PCR Técnica inventada por Kary Mullis :1987 Premio Nobel 1993 Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN Aprovecha los requerimientos de la replicación Templete ADN Nucleótidos

Más detalles

D.- La investigación ha sido presentada en otros eventos (ferias o muestras) científicos?

D.- La investigación ha sido presentada en otros eventos (ferias o muestras) científicos? C. Dónde han investigado? Mencione si se ha desarrollado parte, o toda la investigación en otras instituciones distintas a su Establecimiento Educacional. La fase práctica del proyecto fue desarrollada

Más detalles


ECOLOGÍA MICROBIANA Y COMPORTAMIENTO BACTERIANO COMUNITARIO 5 TRABAJO PRÁCTICO ECOLOGÍA MICROBIANA Y COMPORTAMIENTO BACTERIANO COMUNITARIO OBJETIVOS: 1 Observar y comprender la diversidad bacteriana que coexiste en un mismo nicho en un dado ecosistema y las interrelaciones

Más detalles


MEMORIA DE PRÁCTICAS MEMORIA DE PRÁCTICAS Empresa: Centro Nacional de Tecnología y Seguridad Alimentaria (CNTA)- Laboratorio del Ebro. San Adrián (Navarra). Alumna: Laura Sánchez Vicente Período de prácticas: 01-07-08 hasta

Más detalles

TIPIFICACION HLA. Bioq. Eliana Palomino Lab. De Histocompatibilidad Hospital Privado

TIPIFICACION HLA. Bioq. Eliana Palomino Lab. De Histocompatibilidad Hospital Privado TIPIFICACION HLA Bioq. Eliana Palomino Lab. De Histocompatibilidad Hospital Privado Tipificación HLA: Estudio mediante el cual se determina cuales de todas las variantes conocidas del locus HLA están presentes

Más detalles


TRABAJO PRÁCTICO N 2: TÉCNICAS DE ESTERILIZACIÓN Y CULTIVO DE MICROORGANISMOS Objetivos: TRABAJO PRÁCTICO N 2: TÉCNICAS DE ESTERILIZACIÓN Y CULTIVO DE MICROORGANISMOS Objetivos: -Conocer las metodologías actuales de control y eliminación de microorganismos. -Obtener dominio de los métodos

Más detalles

CAPÍTULO III MATERIALES Y MÉTODOS. El propósito de este capitulo es describir a detalle cada uno de los procedimientos y

CAPÍTULO III MATERIALES Y MÉTODOS. El propósito de este capitulo es describir a detalle cada uno de los procedimientos y CAPÍTULO III MATERIALES Y MÉTODOS El propósito de este capitulo es describir a detalle cada uno de los procedimientos y técnicas de laboratorio utilizadas en este proyecto para evaluar la eficiencia de

Más detalles


PROCEDIMIENTO PARA DETERMINAR RIBOFLAVINA EN ALIMENTOS. Método Fluorométrico-HPLC PRT-711.02-046 Página 1 de 8 1. OBJETIVO Determinar la concentración de riboflavina por cromatografía liquida de alta resolución en alimentos. 2. CAMPO DE APLICACIÓN Y ALCANCE El método es aplicable a

Más detalles

Tipos de Muestras. Técnicas de Biología Molecular. Extracción de ácidos nucleicos. Extracción de DNA genómico. Muestra de sangre en papel filtro

Tipos de Muestras. Técnicas de Biología Molecular. Extracción de ácidos nucleicos. Extracción de DNA genómico. Muestra de sangre en papel filtro Técnicas de Biología Molecular Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO 2004 Tipos de Muestras Extracción de ácidos nucleicos o DNA o RNA Sangre total (EDTA) Saliva Líquido Amniótico Bulbo

Más detalles