NUEVO MÉTODO DE PCR ANIDADA EN TIEMPO REAL CON EVAGREEN PARA DETERMINAR LA CARGA DE PAPILOMAVIRUS

Tamaño: px
Comenzar la demostración a partir de la página:

Download "NUEVO MÉTODO DE PCR ANIDADA EN TIEMPO REAL CON EVAGREEN PARA DETERMINAR LA CARGA DE PAPILOMAVIRUS"

Transcripción

1 NUEVO MÉTODO DE PCR ANIDADA EN TIEMPO REAL CON EVAGREEN PARA DETERMINAR LA CARGA DE PAPILOMAVIRUS Socorro Hernández-Arteaga, Mireya Sánchez-Garza, Rubén López-Revilla División de Biología Molecular, IPICYT, San Luis Potosí, SLP. Correo electrónico: RESUMEN El cáncer cervicouterino (CaCu) es la primera causa de muerte por cáncer en las mujeres mexicanas. Su desarrollo requiere infección por virus del papiloma humano (VPH). Los virus asociados al CaCu son de alto riesgo, como los tipos 16 y 18. La amplificación de DNA viral mediante la reacción de polimerización en cadena (PCR) permite diagnosticar la infección por VPH y tiene valor predictivo del riesgo de desarrollar CaCu. La PCR en tiempo real (PCR-TR) permite determinar la carga viral (i.e., cuantificar el número de copias de los genes blanco). La PCR-TR con SYBRGreen es la técnica más usada para la investigación y el diagnóstico rutinario. El propósito de este trabajo fue desarrollar un método de PCR-TR más sensible para determinar la carga viral de VPH16 empleando EvaGreen como fluorocromo. SiHa, línea celular derivada de un CaCu invasor, contiene una copia del genoma de VPH16 por célula, pone a prueba la sensibilidad de los métodos de detección. Para aumentar la sensibilidad desarrollamos un método de PCR anidada en el cual preamplificamos un producto de la región E6/E7 de VPH16 de 645 pb por PCR convencional y en la segunda reacción anidada (en tiempo real) amplificamos un producto de 249 pb empleando EvaGreen. Cuantificamos la carga viral de muestras problema por interpolación con los valores del ciclo umbral (Ct) de mezclas con copias de phv101 (plásmido con un inserto E6/E7-VPH16 de 645 pb). Detectamos las dos copias esperadas de VPH16 por célula SiHa y determinamos el número de copias en las muestras cervicales con grado conocido de displasia. Nuestro método, más sensible y barato que el de SYBRGreen, disminuiría los costos para determinar la carga viral y contribuiría al estudio de la epidemiología molecular de la infección del cérvix por VPH. Palabras clave: Cáncer cervicouterino, PCR en tiempo real, Virus del papiloma humano INTRODUCCIÓN El cáncer cervicouterino (CaCu) es la segunda causa de muerte por cáncer entre las mujeres de todo el mundo y la primera en los países en desarrollo incluyendo a México. La falta de acceso oportuno al diagnóstico y tratamiento es la razón de su alta prevalencia principalmente en mujeres pobres, de baja escolaridad, que habitan en las áreas rurales y en las zonas marginadas de las ciudades. En México hubo alrededor de 13,400 muertes por cáncer cervicouterino en el año 2002 por lo cual cada hora y media murió una mujer mexicana por este mal. El desarrollo de las lesiones precancerosas y cancerosas está asociado a la infección por virus del papiloma humano (VPH), trasmitidos a las mujeres por contacto sexual genital con hombres infectados. Algunos virus causan verrugas o condilomas (lesiones benignas que no progresan al cáncer, usualmente causadas por los tipos 6 y

2 11), mientras que otros provocan la transformación neoplásica de las células del epitelio del cuello uterino y por eso son llamados oncogénicos o de alto riesgo. Se ha demostrado la presencia de genes de VPH de alto riesgo en el 99.7% de los casos de CaCu invasor, por lo cual se acepta que los VPH de alto riesgo son el principal factor necesario para el desarrollo del CaCu. Los virus de alto riesgo más frecuentes son los tipos 16, 18 y 31. El diagnóstico citológico de la infección por papilomavirus se realiza con el método de Papanicolaou, que puede tener fallas por deficiencias en la calidad de las muestras, baja sensibilidad (44-88%), y una alta proporción de falsos negativos (10-54%). Actualmente hay diversos métodos moleculares más sensibles y específicos que complementan al Papanicolaou para diagnosticar la infección por papilomavirus. La PCR en tiempo real (PCR-TR) permite la cuantificación de secuencias nucleotídicas definidas. La intensidad creciente de la fluorescencia del producto de amplificación en función del número de ciclos de polimerización permite extrapolar el valor del ciclo umbral (Ct), el cual es inversamente proporcional al número de las secuencias blanco presentes en las muestras control (i.e., con un número conocido de copias de la secuencia blanco) y problema. La PCR-TR que emplea al SYBRGreen como flurorocromo es la técnica más empleada actualmente para la investigación y el diagnóstico rutinario. En este trabajo hemos desarrollado un método alternativo de PCR-TR más sensible y barato para la cuantificación de la carga viral de VPH16 en muestras de raspados cervicales con un nuevo fluorocromo llamado EvaGreen. MÉTODOS Oligonucleótidos. Utilizamos dos parejas de oligonucleótidos para la detección de VPH de alto riesgo (Fujinaga et al. 1991). La primera (LCR/E7AS) genera un producto E6/E7 de 645 pb que abarca del del nucleótido (nt) 26 al 671 en el genoma de HPV16. La segunda pareja (pu1m/pu2r) genera un producto de 249 pb incluido en la secuencia del primero que abarca del nt 419 al 668. Control con número de copias conocido. Amplificamos el producto E6/E7 de 645 pb a partir de un plásmido con la misma secuencia clonada en el vector phv101 derivado de pgem, para contar con un control con un número conocido de copias. Considerando el tamaño de la construcción calculamos que en 10 ng de phv101 hay copias del fragmento clonado. Fluorocromos. EvaGreen y SYBRGreen a concentración final 1. El volumen total de las mezclas de PCR fue de 50 µl con el kit de Invitrogen (No. Cat ). Las concentraciones finales de cada componente fueron MgCl 2 3 mm; oligonucleótidos 0.15 µm; dntps 0.05 mm; Taq DNA polimerasa 30 mu/ml. Como DNA molde utilizamos copias de phv101. El programa de amplificación en el Icycler (BioRad) fue de 50 ciclos, con desnaturalización a 95 C por 15 seg, annealing a 58 C por 1 min y extensión a 72 C por 1 min. Preamplificación. Usamos cinco tipos de mezclas: 1) con copias de phv101, 2) control negativo sin DNA (blanco), 3) control positivo con 50 ng de DNA de células SiHa, 4) control negativo con 50 ng de DNA de sangre humana normal y 5)

3 muestras problema de raspados cervicales con displasia por VPH16, las cuales fueron sometidas a 10 ciclos de PCR convencional utilizando la pareja de oligonucleótidos E6/E7 de 645 pb y el programa descrito. PCR anidada en tiempo real con EvaGreen usando como molde el producto preamplificado. Preparamos las mezclas de PCR agregando 1 µl de la mezcla preamplificada, EvaGreen y la pareja de oligonucleótidos interna de 249 pb. Para obtener la familia de curvas control con un número de copias conocido empleamos diluciones logarítmicas a partir de la mezcla de phv101 preamplificada para contar con estándares de a copias. Los controles y las muestras problema preamplificadas también sirvieron de molde para la PCR en tiempo real. Incluimos como control negativo una muestra del DNA de SiHa preamplificada que contenía sólo el oligonucleótido F de la pareja de 249 pb. RESULTADOS Sensibilidad. En mezclas para la amplificación de E6/E7 645 pb con copias iniciales de phv101 obtuvimos dos familias de curvas consistentes y proporcionales con EvaGreen y SYBRGreen. Para la curva con copias iniciales, el valor de Ct (ciclo umbral) con EvaGreen fue mientras que para SYBRGreen fue Para mezclas con copias la curva no permitió obtener el valor de Ct con SYBRGreen mientras que con EvaGreen el valor de Ct fue y fue conservada la proporcionalidad y la consistencia con el resto de los los valores de la familia de curvas (Tabla1). Copias de phv101 Valores de Ct SYBRGreen EvaGreen Amplificación nula Tabla 1. EvaGreen es 10 veces más sensible que SYBRGreen PCR anidada en tiempo real con EvaGreen. Los valores de Ct y Ct (diferencia entre los valores de Ct vecinos que para diluciones logarítmicas teóricamente debe ser 3.3) obtenidos en tiempo real fueron consistentes en cada una de las curvas obtenidas con diferente número de copias iniciales de phv101 y de muestras problema. El coeficiente de correlación lineal obtenido con los valores del logaritmo del número de copias vs el valor de Ct fue de y el valor de la pendiente de la recta construida con los valores de Ct de la familia de curvas de phv101 fue La interpolación de los valores de Ct obtenidos con el control positivo con DNA de células SiHa permitió detectar 1 copia de genoma viral por célula; en este experimento también calculamos por interpolación la carga viral de las muestras problema. Especificidad. Para analizar la especificidad de los productos de amplificación analizamos la extinción térmica de la fluorescencia en las mezclas con diferentes números de copias de phv101 y de cada muestra problema. Encontramos patrón con un pico con extinción máxima de la fluorescencia a 85.5 C en todas las muestras con phv101, en el control positivo con DNA de SiHa y en todas las muestras problema, pero no en la

4 muestra con un solo oligonucleótido (Fig. 1). Fig. 1. El patrón de extinción de fluorescencia coincide para el producto principal de phv101, SiHa y las muestras problema. Valor máximo de extinción = 85.5 C. Correlación de la carga viral con el grado de displasia. Hicimos un análisis preliminar de 10 muestras con infección única por VPH16 tipificadas previamente en nuestro laboratorio que mostró una correlación directa de la carga viral con el grado de displasia (Fig. 2). Figura 2. Correlación de la carga viral con el grado de displasia del cérvix. Clave de las muestras con lesiones displásicas: 1, NIC1; 2, NIC2; 3, NIC3; 4, CaCu invasor. CONCLUSIONES 1. El uso de EvaGreen hace a nuestro método de PCR en tiempo real más sensible y barato e igualmente específico y reproducible que el de SYBRGreen. 2. Hasta donde sabemos, nuestro método de PCR anidada en tiempo real con EvaGreen es el primero que se ha desarrollado. 3. Con este método logramos detectar una copia del genoma de VPH16 por célula y confirmamos que la carga viral correlaciona con el grado de displasia cervical. REFERENCIAS 1. Fujinaga Y, Shimada M, Okasawa K, Fukushima M, Kato I, Fujinaga K. Simultaneous detection and typing of genital human papillomavirus using the polymerase chain reaction. J Gen Virol 72: , Lewis, MJ. Análisis de la situación del cáncer cervicouterino en América Latina y el Caribe. Organización Panamericana de la Salud. Washington

5 3. Muñoz N, Bosch X, De Sanjosé S, Vergara A, del Moral A, Munoz MT, Tafur L, Gili M,Izarzugaza I, Viladiu P. Risk factor for cervical intraepithelial neoplasia grade III/ carcinoma in situ in Spain and Colombia. Cancer Epidemiol Biomarkers Prev 2: , Walboomers J, Jacobs M, Manos MM, Bosch FX, Kummer JA, Shah KV. Human papillomavirus is a necessary cause of invasive cervical cancer worldwide. J Pathol 189:12-19, Zur Hausen H. Papillomavirus in human cancers. Mol Carcinog 1: , 1

versus PCR en Tiempo Real PCR convencional no es cuantitativo

versus PCR en Tiempo Real PCR convencional no es cuantitativo PCR convencional o PCR de punto final versus PCR en Tiempo Real PCR convencional no es cuantitativo S Lobos C - U de Chile 1 PCR clásico La cantidad de producto no está relacionada con la cantidad de DNA

Más detalles

Virus del papiloma humano

Virus del papiloma humano Vista creada el 29/05/2016 a las 03:43 h Publicado en Comité Asesor de Vacunas (http://vacunasaep.org) Virus del papiloma humano Diciembre 2014 1. INTRODUCCIÓN La infección por el virus del papiloma humano

Más detalles

Virus del Papiloma Humano

Virus del Papiloma Humano Virus del Papiloma Humano Es el término científico correcto, pero muchos, por no decir la mayoría, hablan de papiloma virus. Cualquiera de las dos formas la consideraremos con fines prácticos como correcta

Más detalles

Guía de PCR en tiempo real

Guía de PCR en tiempo real Guía de PCR en tiempo real Michelle C. Chirinos-Arias michelle.christine16@gmail.com Índice Introducción. 2 Algunos conceptos. 2 PCR (reacción en cadena de la polimerasa)... 2 PCR en tiempo real (qpcr)..

Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

Guía educativa acerca del VPH y el cáncer cervicouterino

Guía educativa acerca del VPH y el cáncer cervicouterino Guía educativa acerca del VPH y el cáncer cervicouterino Qué es el cáncer cervicouterino o cáncer de matriz? Es el cáncer de cérvix, que es la parte del útero que conecta la parte superior de éste (la

Más detalles

Diagnóstico precoz del cáncer de cérvix uterino TIRSO PÉREZ MEDINA

Diagnóstico precoz del cáncer de cérvix uterino TIRSO PÉREZ MEDINA Diagnóstico precoz del cáncer de cérvix uterino TIRSO PÉREZ MEDINA Squamous Intraepithelial Lesion SIL Bethesda, 1998 SIL de bajo grado (L-SIL) SIL de alto grado (H-SIL) Colposcopia Epitelio aceto-blanco

Más detalles

DETERMINACIÓN DEL FACTOR Rh por PCR

DETERMINACIÓN DEL FACTOR Rh por PCR Ref.PCRRh DETERMINACIÓN DEL FACTOR Rh por PCR 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

Guía educativa acerca del VPH y el cáncer cervicouterino

Guía educativa acerca del VPH y el cáncer cervicouterino UNIVERSIDAD DE SAN MARTIN DE PORRES CENTRO MÉDICO Guía educativa acerca del VPH y el cáncer cervicouterino Dr. Antonio Velasco Figallo. Qué es el cáncer cervicouterino o cáncer de matriz? Es el cáncer

Más detalles

Prevención del cáncer de cuello uterino Una nueva visión. Dr. F. Javier García Pérez-Llantada

Prevención del cáncer de cuello uterino Una nueva visión. Dr. F. Javier García Pérez-Llantada Prevención del cáncer de cuello uterino Una nueva visión Dr. F. Javier García Pérez-Llantada Vacuna para el HPV un avance contra el cáncer Dr. F. Javier García Pérez-Llantada Especialista en Obstetricia

Más detalles

Gaceta Parlamentaria de la ALDF 03 de agosto de 2011. Núm. 157. Año 02 DIPUTADO LEOBARDO URBINA MOSQUEDA

Gaceta Parlamentaria de la ALDF 03 de agosto de 2011. Núm. 157. Año 02 DIPUTADO LEOBARDO URBINA MOSQUEDA PROPOSICIÓN CON PUNTO DE ACUERDO POR EL QUE SE EXHORTA AL SECRETARIO DE SALUD DEL DISTRITO FEDERAL, A QUE RINDA UN INFORME DETALLADO DEL PRESUPUESTO ASIGNADO Y EVALUACIÓN DE LA APLICACIÓN DE LA VACUNA

Más detalles

Ministerio de Salud y Protección Social República de Colombia

Ministerio de Salud y Protección Social República de Colombia Los Virus del Papiloma Humano y el Cáncer Cartilla de Preguntas y Respuestas (página Web) Qué es el cáncer de cuello uterino? Es una desorganización de las células que componen el cuello del útero, formando

Más detalles

Principales aspectos de la biología del virus papiloma humano (HPV) que justifican la prevención primaria y secundaria

Principales aspectos de la biología del virus papiloma humano (HPV) que justifican la prevención primaria y secundaria Principales aspectos de la biología del virus papiloma humano (HPV) que justifican la prevención primaria y secundaria María Alejandra Picconi, PhD Laboratorio Nacional de Referencia de HPV Laboratorio

Más detalles

EL CANCER DE CUELLO UTERINO ES LA PRIMERA CAUSA DE MUERTE POR CANCER EN NUESTRO PAIS, EN MUJERES ENTRE LOS 30 Y 59 AÑOS Y LA SEGUNDA EN EL MUNDO

EL CANCER DE CUELLO UTERINO ES LA PRIMERA CAUSA DE MUERTE POR CANCER EN NUESTRO PAIS, EN MUJERES ENTRE LOS 30 Y 59 AÑOS Y LA SEGUNDA EN EL MUNDO EL CANCER DE CUELLO UTERINO ES LA PRIMERA CAUSA DE MUERTE POR CANCER EN NUESTRO PAIS, EN MUJERES ENTRE LOS 30 Y 59 AÑOS Y LA SEGUNDA EN EL MUNDO ESTA AMPLIAMENTE DEMOSTRADO QUE EL VIRUS DEL PAPILOMA HUMANO

Más detalles

Técnicas moleculares.

Técnicas moleculares. Técnicas moleculares. DMTV Carolina Acevedo Curso de Microbiología 2015 SÍNTESIS IN VITRO DE UNA GRAN CANTIDAD DE COPIAS DE UN SEGMENTO DE ADN EXISTENTE EN UNA MUESTRA. O sea. Amplificamos en forma exponencial

Más detalles

CLASIFICACION HISTOPATOLOGICA DE UN GRUPO DE BIOPSIAS DE CERVIX

CLASIFICACION HISTOPATOLOGICA DE UN GRUPO DE BIOPSIAS DE CERVIX CLASIFICACION HISTOPATOLOGICA DE UN GRUPO DE BIOPSIAS DE CERVIX Paola Briseño Díaz 1,2, Marisa Hernández Barrales 1,2, Francisco Javier García Vázquez 3, José Eduardo Farfán Morales 3, Raúl Martínez Orozco

Más detalles

Guía educativa acerca del VPH y el cáncer cervicouterino

Guía educativa acerca del VPH y el cáncer cervicouterino Guía educativa acerca del VPH y el cáncer cervicouterino Qué es el cáncer de cuello uterino o cáncer cervical? de cuello uterino no l cáncer de cuello uterino es una enfermedad grave y potencialmente mortal

Más detalles

CÁNCER DE CÉRVIX Y ANTICONCEPCIÓN: NUEVAS EVIDENCIAS EPIDEMIOLÓGICAS

CÁNCER DE CÉRVIX Y ANTICONCEPCIÓN: NUEVAS EVIDENCIAS EPIDEMIOLÓGICAS CÁNCER DE CÉRVIX Y ANTICONCEPCIÓN: NUEVAS EVIDENCIAS EPIDEMIOLÓGICAS Xavier Castellsagué Institut Català d'oncologia Barcelona Barcelona, Junio 2006 Uno de los descubrimientos más importantes en la investigación

Más detalles

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS Prácticas docentes en la COD: 10-71 APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS FUNDAMENTO TEÓRICO La PCR es una técnica que permite llevar a cabo la síntesis in vitro de fragmentos de ADN. Está basada

Más detalles

COLEGIO NACIONAL DE DOCENCIA E INVESTIGACIÓN EN COLPOSCOPÍA, A.C. ESTADO ACTUAL DE LAS VACUNAS VS EL VPH. www.conadico.org.mx

COLEGIO NACIONAL DE DOCENCIA E INVESTIGACIÓN EN COLPOSCOPÍA, A.C. ESTADO ACTUAL DE LAS VACUNAS VS EL VPH. www.conadico.org.mx COLEGIO NACIONAL DE DOCENCIA E INVESTIGACIÓN EN COLPOSCOPÍA, A.C. ESTADO ACTUAL DE LAS VACUNAS VS EL VPH El Cáncer cérvico uterino sigue siendo la segunda causa de muerte por neoplasia maligna en la mujer

Más detalles

VIRUS PAPILOMA HUMANO (HPV)

VIRUS PAPILOMA HUMANO (HPV) VIRUS PAPILOMA HUMANO (HPV) INTRODUCCIÓN Los primeros estudios realizados para determinar la causa que origina el cáncer cervicouterino se remontan hasta 1842, cuando Regioni Stern demostró que el probable

Más detalles

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now.

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now. Unidad Curricular: Virología y Micología Veterinaria 1 TRABAJO PRÁCTICO No. 3 AMPLIFICACIÓN DE GENES VIRALES Reacción en Cadena de la Polimerasa, conocida como PCR (por sus siglas en inglés: Polimerase

Más detalles

Métodos de determinación del virus del papiloma humano (HPV) en cribado de cáncer de cérvix

Métodos de determinación del virus del papiloma humano (HPV) en cribado de cáncer de cérvix Métodos de determinación del virus del papiloma humano (HPV) en cribado de cáncer de cérvix Beatriz Bellosillo Servicio de Anatomía Patológica Hospital del Mar, Barcelona Virus del Papiloma Humano- HPV

Más detalles

Práctico: Genética bacteriana 2007.

Práctico: Genética bacteriana 2007. Práctico: Genética bacteriana 2007. Actividad integrada Departamento de Genética Departamento de Bacteriología y Virología. OBJETIVOS Objetivos generales El estudiante al terminar la actividad práctica

Más detalles

PCR? PCR en el diagnóstico? Objetivo: Obtener un gran número de copias de un fragmento particular de ADN a partir de una cantidad mínima original.

PCR? PCR en el diagnóstico? Objetivo: Obtener un gran número de copias de un fragmento particular de ADN a partir de una cantidad mínima original. PCR? Objetivo: Obtener un gran número de copias de un fragmento particular de ADN a partir de una cantidad mínima original. PCR en el diagnóstico? A partir de una mezcla compleja de ADN, se puede realizar

Más detalles

Diagnostico del Virus de Papiloma Humano por papanicolau y PCR en un grupo de adolescentes y mujeres jóvenes.

Diagnostico del Virus de Papiloma Humano por papanicolau y PCR en un grupo de adolescentes y mujeres jóvenes. Diagnostico del Virus de Papiloma Humano por papanicolau y PCR en un grupo de adolescentes y mujeres jóvenes. Instituto Conmemorativo Gorgas de Estudios de la Salud, Centro de Investigación en Reproducción

Más detalles

PCR A TIEMPO REAL. María Maiques R4-Bioquímica Clínica 25-Abril-07

PCR A TIEMPO REAL. María Maiques R4-Bioquímica Clínica 25-Abril-07 PCR A TIEMPO REAL María Maiques R4-Bioquímica Clínica 25-Abril-07 VEAMOS Herramientas para detectar mutaciones Moléculas fluorescentes y tecnología FRET PCR a tiempo real: equipos y métodos de detección

Más detalles

EXAMEN DE PAPANICOLAOU

EXAMEN DE PAPANICOLAOU 20121 2 El cáncer cervicouterino, una clase común de cáncer en la mujer, es una enfermedad en la cual se encuentra células cancerosas (malignas) en los tejidos del cuello uterino. EXAMEN DE PAPANICOLAOU

Más detalles

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante BIOTECNOLOGÍA 1.- Ingeniería Genética, ADN recombinante Técnica del ADN recombinante: es la más usada en ingeniería genética, esta basada en el uso de las enzimas de restricción o endonucleasas de restricción

Más detalles

RESOLUCIÓN 563/2011. VISTO el expediente Nº 2002-7536/11-0 del registro del MINISTERIO DE SALUD, y

RESOLUCIÓN 563/2011. VISTO el expediente Nº 2002-7536/11-0 del registro del MINISTERIO DE SALUD, y RESOLUCIÓN 563/2011 MINISTERIO DE SALUD - SALUD PUBLICA Bs. As., 10/05/2011 Fecha de publicación: B.O. 13/05/2011 VISTO el expediente Nº 2002-7536/11-0 del registro del MINISTERIO DE SALUD, y CONSIDERANDO:

Más detalles

Control prenatal como herramienta para la detección de cáncer de cuello uterino

Control prenatal como herramienta para la detección de cáncer de cuello uterino Control prenatal como herramienta para la detección de cáncer de cuello uterino Autores: Lic. Obstétricas: Alonso, María E.; Arias, Carla; Bava, Ivana; Deza, Andrea; Pelizza, Laura; Salazar, Lucía; Taddei,

Más detalles

Tipos de papilomavirus humanos más frecuentes en muestras cubanas de cáncer cervical

Tipos de papilomavirus humanos más frecuentes en muestras cubanas de cáncer cervical GINECOLOGÍA Y SALUD REPRODUCTIVA Tipos de papilomavirus humanos más frecuentes en muestras cubanas de cáncer cervical The more frequent types of human papillomavirus in Cuban samples of cervix cancer María

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles

Cómo encaja la vacunación en las nuevas guías de cribado? Juan J. Hernández Aguado Servicio Obstetricia y Ginecología

Cómo encaja la vacunación en las nuevas guías de cribado? Juan J. Hernández Aguado Servicio Obstetricia y Ginecología Cómo encaja la vacunación en las nuevas guías de cribado? Juan J. Hernández Aguado Servicio Obstetricia y Ginecología Prevención primaria Cómo encaja la vacunación en las nuevas guías de cribado? Cambio

Más detalles

VACUNA VPH: NUESTRA EXPERIENCIA

VACUNA VPH: NUESTRA EXPERIENCIA VACUNA VPH: NUESTRA EXPERIENCIA Mª Elena Varo, Irene Oteiza, Mª Teresa Cruz, Mª Teresa López y Mª José Ramírez. INTRODUCCIÓN Dado que uno de los pilares del trabajo enfermero en atención primaria es el

Más detalles

Previniendo el cáncer CARLOS LÓPEZ 22 en áreas indígenas marginadas de Chiapas CERVICOUTERINO 23 Héctor Ochoa Díaz-López, Esmeralda García Parra y Rosario García Miranda E l cáncer cervicouterino, CaCU,

Más detalles

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

HACIA UN PROGRAMA NACIONAL INTEGRAL DE PREVENCIÓN DEL CÁNCER DE CUELLO UTERINO 2012-2015

HACIA UN PROGRAMA NACIONAL INTEGRAL DE PREVENCIÓN DEL CÁNCER DE CUELLO UTERINO 2012-2015 HACIA UN PROGRAMA NACIONAL INTEGRAL DE PREVENCIÓN DEL CÁNCER DE CUELLO UTERINO 2012-2015 Cáncer de cuello uterino Enfermedad de transmisión sexual Agente: Virus Papiloma humano (16, 18, 31 y 33) Huésped

Más detalles

Un centro de biotecnología al servicio de la salud

Un centro de biotecnología al servicio de la salud Tecnologías para la Vida S. de R.L. de C.V. En búsqueda del bienestar humano Un centro de biotecnología al servicio de la salud Mexicali, Baja California, México Septiembre de 2012 Tecnologías para la

Más detalles

Revista Salud Pública y Nutrición Edición Especial 3-2012 23 y 24 de Agosto 2011; Monterrey, N.L., México

Revista Salud Pública y Nutrición Edición Especial 3-2012 23 y 24 de Agosto 2011; Monterrey, N.L., México RESPYN Revista Salud Pública y Nutrición Edición Especial 3-2012 23 y 24 de Agosto 2011; Monterrey, N.L., México INSTITUTO MEXICANO DEL SEGURO SOCIAL Diagnóstico Molecular del VPH en Cáncer Cervicouterino

Más detalles

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa?

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa? 2º BIOQUÍMICA CUESTIONES 1. Por qué la PCR convencional no es cuantitativa? En la PCR convencional, la cuantificación del ADN de la muestra es complicada debido a que la eficacia de amplificación va disminuyendo

Más detalles

GUÍA DE PRÁCTICA CLÍNICA. Vacunas contra HPV. Dra. Laura Fleider

GUÍA DE PRÁCTICA CLÍNICA. Vacunas contra HPV. Dra. Laura Fleider Dra. Laura Fleider Año 2011 - Revisión: 0 Página 1 de 6 Introducción Entre las afecciones atribuidas al virus del papiloma humano (HPV) que pueden prevenirse por medio de la vacunación se destacan: cáncer

Más detalles

El Virus del Papiloma Humano y la vacuna para prevenir el cáncer cérvico uterino: descripción y prevención de la enfermedad

El Virus del Papiloma Humano y la vacuna para prevenir el cáncer cérvico uterino: descripción y prevención de la enfermedad El Virus del Papiloma Humano y la vacuna para prevenir el cáncer cérvico uterino: descripción y prevención de la enfermedad No. DE AUTORIZACION: 093300201B1730 SSA El cáncer cérvico uterino P1 Dónde se

Más detalles

UNIVERSIDAD NACIONAL AUTÓNOMA DE MÉXICO FACULTAD DE MEDICINA VETERINARIA Y ZOOTECNIA

UNIVERSIDAD NACIONAL AUTÓNOMA DE MÉXICO FACULTAD DE MEDICINA VETERINARIA Y ZOOTECNIA UNIVERSIDAD NACIONAL AUTÓNOMA DE MÉXICO FACULTAD DE MEDICINA VETERINARIA Y ZOOTECNIA. Estudio comparativo del diagnóstico del virus del PRRS por RT-PCR, PCR anidada y RT-PCR en tiempo real. Zoalli Angélica

Más detalles

CAPÍTULO VI. Expresión de genes relacionados con apoptosis

CAPÍTULO VI. Expresión de genes relacionados con apoptosis CAPÍTULO VI Expresión de genes relacionados con apoptosis 1.- Introducción 2.- Protocolos para análisis genéticos 3.- Resultados en MCF-7 4.- Discusión 1.- Introducción Como se ha descrito anteriormente,

Más detalles

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico.

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. AQUAGESTION ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. Noviembre 2011 ACTUALIDAD Este año Sernapesca confirma

Más detalles

SIPMPOSIO MATUTINO 13. VPH Y CÁNCER CÉRVICOUTERINO: IMPACTO EN LA SALUD DE LA MUJER

SIPMPOSIO MATUTINO 13. VPH Y CÁNCER CÉRVICOUTERINO: IMPACTO EN LA SALUD DE LA MUJER Mérida, Yuc. 01 de noviembre de 2013 SIPMPOSIO MATUTINO 13. VPH Y CÁNCER CÉRVICOUTERINO: IMPACTO EN LA SALUD DE LA MUJER CONTENIDO 1. PESO DE LA ENFERMEDAD 2. LA RELACIÓN DEL VPH CON EL CaCu 3. POSIBILIDADES

Más detalles

LO QUE TODA MUJER NECESITA SABER SOBRE LA. Prevención del cáncer de cuello de útero

LO QUE TODA MUJER NECESITA SABER SOBRE LA. Prevención del cáncer de cuello de útero LO QUE TODA MUJER NECESITA SABER SOBRE LA Prevención del cáncer de cuello de útero Qué es el cáncer de cuello de útero? ES EL CÁNCER QUE AFECTA A UNA ZONA GENITAL FEMENINA: el cuello del útero, es decir,

Más detalles

predisponen a adultos jóvenes a tener relaciones sexuales sin protección, y evaluar el nivel de conocimiento que tienen sobre el VPH.

predisponen a adultos jóvenes a tener relaciones sexuales sin protección, y evaluar el nivel de conocimiento que tienen sobre el VPH. Identificar los factores que predisponen a adultos jóvenes a tener relaciones sexuales sin protección, y evaluar el nivel de conocimiento que tienen sobre el VPH. Se realizó un estudio retrospectivo transversal,

Más detalles

Epidemiología del Virus del Papiloma Humano

Epidemiología del Virus del Papiloma Humano Epidemiología del Virus del Papiloma Humano Hector Figueroa, Francisco Valtierra Asesor- Biol Guillermina Ríos CUAM Morelos El virus del papiloma humano es un grupo grande de virus de los cuales se han

Más detalles

FICHA PÚBLICA DEL PROYECTO

FICHA PÚBLICA DEL PROYECTO NUMERO DE PROYECTO: 210730 EMPRESA BENEFICIADA: ARX TECH S DE RL DE CV TÍTULO DEL PROYECTO: DETECTOR DE VPH Y CANCER CERVICO UTERINO CON AUTO COLECTOR DE CELULAS EPITELIALES DEL CERVIX OBJETIVO DEL PROYECTO:

Más detalles

5. MATERIALES Y MÉTODOS

5. MATERIALES Y MÉTODOS 5. MATERIALES Y MÉTODOS 5.1 Equipos Los siguientes termocicladores se emplearon para la amplificación por PCR: - Perkin Elmer, GeneAmp PCR System 2400. - Perkin Elmer, GeneAmp PCR System 9600. - Applied

Más detalles

El cáncer cérvico-uterino: Implicaciones de la edad de inicio de vida sexual y el Papilomavirus humano

El cáncer cérvico-uterino: Implicaciones de la edad de inicio de vida sexual y el Papilomavirus humano El cáncer cérvico-uterino: Implicaciones de la edad de inicio de vida sexual y el Papilomavirus humano Bertha Alicia Olmedo Buenrostro 1, Víctor Ángel Zepeda Pamplona 2, Irma Gabriela Enríquez Maldonado

Más detalles

MANEJO IVPH PRODUCTIVA Y NIC EN LA ADOLESCENCIA

MANEJO IVPH PRODUCTIVA Y NIC EN LA ADOLESCENCIA MANEJO IVPH PRODUCTIVA Y NIC EN LA ADOLESCENCIA Dra. Mayra Ortuño López Médico Especialista en Ginecología y Obstetricia Médico Colposcopista 2º Secretario Mesa Directiva 2011-2012 Colegio Nacional de

Más detalles

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml)

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml) PCR SIMULADA Ref.PCR Simulada (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

VPH y Cáncer Cervical

VPH y Cáncer Cervical UICC VPH y Cáncer Cervical CURRICULUM 01 Capitulo 3. Rol del VPH Ahti Anttila PhD Director de Investigación, Registro de Cáncer Finlandés Helsinki, Finlandia Harri Vertio MD, PhD Secretaria general, Sociedad

Más detalles

CAPTURA DE HÍBRIDOS, INMUNOHISTOQUÍMICA p16 Y Ki-67, HERRAMIENTAS COMPLEMENTARIAS EN EL DIAGNÓSTICO DE INFECCIONES POR VPH

CAPTURA DE HÍBRIDOS, INMUNOHISTOQUÍMICA p16 Y Ki-67, HERRAMIENTAS COMPLEMENTARIAS EN EL DIAGNÓSTICO DE INFECCIONES POR VPH CAPTURA DE HÍBRIDOS, INMUNOHISTOQUÍMICA p16 Y Ki-67, HERRAMIENTAS COMPLEMENTARIAS EN EL DIAGNÓSTICO DE INFECCIONES POR VPH Casas Sánchez Nancy Janette 1, Que Chan Sandro Saúl 2,3, Alvarez Arquieta María

Más detalles

PROGRAMA DE CÁNCER DE CÉRVIX CON ENFOQUE PREVENTIVO COMFAMA OPERADOR EPS SAVIA SALUD

PROGRAMA DE CÁNCER DE CÉRVIX CON ENFOQUE PREVENTIVO COMFAMA OPERADOR EPS SAVIA SALUD PROGRAMA DE CÁNCER DE CÉRVIX CON ENFOQUE PREVENTIVO COMFAMA OPERADOR EPS SAVIA SALUD DENGUE DENGUE DENGUE Distribución porcentual de las diez primeras localizaciones de cáncer en mujeres. Departamento

Más detalles

Pruebas moleculares para la detección del virus papiloma humano. Desafíos y posibilidades.

Pruebas moleculares para la detección del virus papiloma humano. Desafíos y posibilidades. Pruebas moleculares para la detección del virus papiloma humano. Desafíos y posibilidades. María Eugenia Cavazza, María Correnti. Instituto de Biomedicina. Instituto de Oncología y Hematología. Ministerio

Más detalles

Reacción en cadena de la polymerasa (PCR)

Reacción en cadena de la polymerasa (PCR) Reacción en cadena de la polymerasa (PCR) 1 PCR Que es? Es una técnica in vitro diseñada para amplificar una región específica de DNA. Es extremadamente sensible, con la capacidad de amplificar millones

Más detalles

Papiloma Virus Humano (PVH) El cáncer de cuello uterino sí se puede evitar.

Papiloma Virus Humano (PVH) El cáncer de cuello uterino sí se puede evitar. Papiloma Virus Humano (PVH) El cáncer de cuello uterino sí se puede evitar. Qué es la infección por PVH El Papiloma Virus Humano (PVH) es la enfermedad de transmisión sexual más común en la mayoría de

Más detalles

8.1- Características Sociodemográficos de la población en estudio:

8.1- Características Sociodemográficos de la población en estudio: IX.- ANÁLISIS DE LOS RESULTADOS 8.1- Características Sociodemográficos de la población en estudio: En el presente estudio se encontró que la edad más frecuente de pacientes que fueron atendidos en el período

Más detalles

ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA

ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA FACULTAD DE VETERINARIA DEPARTAMENTO DE SANIDAD ANIMAL ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA GUIÓN DE PRÁCTICAS DE LABORATORIO CURSO 2014 2015 MÓDULO: PORCINO Síndrome respiratorio y reproductor

Más detalles

Lo que las mujeres deben saber sobre el cáncer de cuello uterino

Lo que las mujeres deben saber sobre el cáncer de cuello uterino Lo que las mujeres deben saber sobre el cáncer de cuello uterino y el virus del papiloma humano Guías de la Sociedad Americana Contra El Cáncer para la detección temprana de cáncer del cuello uterino Yo

Más detalles

Las lesiones precancerosas constituyen un todo continuo de cambios morfológicos cuyas fronteras están bastante mal delimitadas.

Las lesiones precancerosas constituyen un todo continuo de cambios morfológicos cuyas fronteras están bastante mal delimitadas. VI) MARCO DE REFERENCIA Anatomía del útero: El útero es un órgano hueco con forma de pera, de pared fibromuscular situada entre la vejiga y el recto. El tamaño del útero varía dependiendo de la edad y

Más detalles

METODOS DE ANALISIS BIOMEDICOS

METODOS DE ANALISIS BIOMEDICOS METODOS DE ANALISIS BIOMEDICOS 2010 Profesora a cargo: Dra. Viviana Lepek PARTE PRÁCTICA Jefe de T.P.: Dra. Mara Roset Ayudantes: Dra. Ines Marchesini Lic. Lucas Bukata Dr. Juan Mucci Dr. Adrián Mutto

Más detalles

Aunque estos cambios no son cáncer, pueden llevar a que se presente cáncer del cuello uterino si no se tratan.

Aunque estos cambios no son cáncer, pueden llevar a que se presente cáncer del cuello uterino si no se tratan. La displasia cervical se refiere a cambios anormales en las células de la superficie del cuello uterino que se observan bajo un microscopio. El cuello uterino es la parte inferior del útero (matriz) que

Más detalles

INTRODUCCIÓN DE LA VACUNA CONTRA EL VIRUS DEL PAPILOMA HUMANO (VPH) Figura N 1. Esquema genómico del virus del papiloma humano

INTRODUCCIÓN DE LA VACUNA CONTRA EL VIRUS DEL PAPILOMA HUMANO (VPH) Figura N 1. Esquema genómico del virus del papiloma humano INTRODUCCIÓN DE LA VACUNA CONTRA EL VIRUS DEL PAPILOMA HUMANO (VPH) ASPECTOS TÉCNICOS VIRUS DEL PAPILOMA HUMANO Estructura y clasificación El virus del papiloma humano (VPH) es un virus de tamaño pequeño,

Más detalles

Los estudios hechos en el área de Biología Molecular han impulsado el desarrollo de

Los estudios hechos en el área de Biología Molecular han impulsado el desarrollo de 1. INTRODUCCIÓN Los estudios hechos en el área de Biología Molecular han impulsado el desarrollo de técnicas cuya aplicación no se ha limitado a la investigación, sino que también han sido usadas en el

Más detalles

La prueba de Papanicolaou: preguntas y respuestas. Puntos clave

La prueba de Papanicolaou: preguntas y respuestas. Puntos clave CANCER FACTS N a t i o n a l C a n c e r I n s t i t u t e N a t i o n a l I n s t i t u t e s o f H e a l t h D e p a r t m e n t o f H e a l t h a n d H u m a n S e r v i c e s La prueba de Papanicolaou:

Más detalles

Vacunas contra los virus del papiloma humano Para destacar:

Vacunas contra los virus del papiloma humano Para destacar: Vacunas contra los virus del papiloma humano Para destacar: Los virus del papiloma humano (VPH) son un grupo de más de 100 virus relacionados. Ciertos tipos de VPH son la causa principal de cáncer de cuello

Más detalles

Prevención y detección del cáncer de cuello uterino

Prevención y detección del cáncer de cuello uterino Prevención y detección del cáncer de cuello uterino Trompas de Falopio Ovarios Qué es el cáncer de cuello uterino? Útero Cuello uterino Vagina El cáncer es una enfermedad que se origina por causa del crecimiento

Más detalles

GPC. Guía de referencia Rápida. Prevención y Detección Oportuna del Cáncer Cérvico Uterino en el Primer Nivel de Atención

GPC. Guía de referencia Rápida. Prevención y Detección Oportuna del Cáncer Cérvico Uterino en el Primer Nivel de Atención Guía de referencia Rápida Prevención y Detección Oportuna del Cáncer Cérvico Uterino en el Primer Nivel de Atención GPC Guía de Práctica Clínica Catalogo Maestro de Guías de Práctica Clínica: SS-146-08

Más detalles

I. NOMBRE Y CÓDIGO: DISPLASIAS CERVICALES CIE 10: N.87

I. NOMBRE Y CÓDIGO: DISPLASIAS CERVICALES CIE 10: N.87 DISPLASIAS CERVICALES I. NOMBRE Y CÓDIGO: DISPLASIAS CERVICALES CIE 10: N.87 NOMBRES ALTERNATIVOS: - Cambios precancerosos del cuello uterino - Neoplasia intraepitelial cervical (NIC) II. DEFINICIÓN Es

Más detalles

Gobierno de Canarias Consejería de Sanidad Servicio Canario de la Salud Dirección General de Programas Asistenciales

Gobierno de Canarias Consejería de Sanidad Servicio Canario de la Salud Dirección General de Programas Asistenciales EDICIÓN: Gobierno de Canarias Consejería de Sanidad Servicio Canario de la Salud Dirección General de Programas Asistenciales Cáncer de Cérvix El cáncer de cérvix ocupa el segundo lugar en incidencia y

Más detalles

Morbimortalidad del Cáncer Cérvico Uterino en el Estado de Guanajuato

Morbimortalidad del Cáncer Cérvico Uterino en el Estado de Guanajuato Morbimortalidad del Cáncer Cérvico Uterino en el Estado de Guanajuato Dr. Martín Milán López Jefe del Departamento de Epidemiología Secretaría de Salud de Guanajuato EL Cáncer Cérvico Uterino es una enfermedad

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

UNA ACTUALIZACION ACERCA DEL VIRUS DEL PAPILOMA HUMANO Y LA CARCINOGENESIS CERVICAL Pruebas de Diagnostico del Cáncer Cervicouterino Hoy en Día

UNA ACTUALIZACION ACERCA DEL VIRUS DEL PAPILOMA HUMANO Y LA CARCINOGENESIS CERVICAL Pruebas de Diagnostico del Cáncer Cervicouterino Hoy en Día DEL VIRUS DEL PAPILOMA HUMANO (VPH) AL CANCER CERVICO UTERINO Dr. Mark Schiffman (Máster en Salud Publica) y Dr. Nicolas Wentzensen (Máster en Salud Publica) El Cáncer Cervicouterino es una de las enfermedades

Más detalles

Cáncer de cuello uterino PREVENCIÓN. Dra Alicia Aleman Prof Ag. Departamento de Medicina Preventiva y Social Facultad de Medicina- UdelaR

Cáncer de cuello uterino PREVENCIÓN. Dra Alicia Aleman Prof Ag. Departamento de Medicina Preventiva y Social Facultad de Medicina- UdelaR Cáncer de cuello uterino PREVENCIÓN Dra Alicia Aleman Prof Ag. Departamento de Medicina Preventiva y Social Facultad de Medicina- UdelaR Montevideo, julio 2012 De que hablaremos Algunos aspectos anatómicos

Más detalles

DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino

DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino DIAGNOSTICO VIROLOGICO MOLECULAR Dr. Gerardo Andino DIAGNÓSTICO MOLECULAR La tecnología empleada para la detección de genomas virales mediante la amplificación de secuencias específicas (PCR y reacciones

Más detalles

Prevención del cáncer de cuello de útero

Prevención del cáncer de cuello de útero GINECOLOGÍA Prevención del cáncer de cuello de útero Prevención del cáncer de cuello de útero Vacúnate y protégete Salud de la mujer Dexeus ATENCIÓN INTEGRAL EN OBSTETRICIA, GINECOLOGÍA Y MEDICINA DE LA

Más detalles

A principios de los años ochentas el desarrollo de nuevas tecnologías para la

A principios de los años ochentas el desarrollo de nuevas tecnologías para la Nuevos marcadores para la detección temprana y predicción de sobrevida en blancos terapéuticos. A principios de los años ochentas el desarrollo de nuevas tecnologías para la identificación del ADN del

Más detalles

estrategia de Screening

estrategia de Screening estrategia de Screening en Cáncer Cérvico- uterino Dra. Adriana Cas,blanco G. Servicio de Anatomía Patológica Clinica Alemana estrategia Mortalidad de Cáncer cérvico- uterino de Screening Globocan 2012

Más detalles

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082 Página 1 de 5 1. OBJETIVO Detectar la presencia de Campylobacter jejuni en hamburguesa de pollo mediante técnica de PCR. 2. CAMPO DE APLICACIÓN Y ALCANCE Aplicar este procedimiento a muestras de hamburguesa

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

El cáncer cervical uterino es el 2º cáncer en frecuencia a nivel mundial tras el cáncer de mama

El cáncer cervical uterino es el 2º cáncer en frecuencia a nivel mundial tras el cáncer de mama El cáncer cervical uterino es el 2º cáncer en frecuencia a nivel mundial tras el cáncer de mama También en España entre las mujeres de 15-44 años (en el global de edades es el 15º ). Relativamente infrecuente

Más detalles

Cáncer de Cuello Uterino

Cáncer de Cuello Uterino I Curso Videoconferencia Atención Médica Integral Ambulatoria Universidad Central de Venezuela Facultad de Medicina Escuela de Enfermería Cáncer de Cuello Uterino Es posible prevenirlo? Mgsc. Maribel Osorio

Más detalles

Significancia de los micronúcleos en lesiones cervicales intraepiteliales y carcinoma

Significancia de los micronúcleos en lesiones cervicales intraepiteliales y carcinoma Significancia de los micronúcleos en lesiones cervicales intraepiteliales y carcinoma María E. Gonsebatt Universidad Nacional Autónoma de México margen@unam.mx > 90 % de los cánceres se originan en tejidos

Más detalles

Actualización en nuevas técnicas de diagnóstico genético molecular disponibles en Chile

Actualización en nuevas técnicas de diagnóstico genético molecular disponibles en Chile Actualización en nuevas técnicas de diagnóstico genético molecular disponibles en Chile Dra. Teresa Aravena Clínica INDISA Hospital Clínico de la Universidad de Chile Hospital Dr. Sótero del Río Exámenes

Más detalles

P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA"

P.C.R. Técnica de amplificación enzimática de secuencias específicas de DNA P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA" Paso 1: Desnaturalización del DNA Paso 2: Hibridación de los "Primers" Paso 3: Extensión Paso 1: Desnaturalización del DNA

Más detalles

Otros son de bajo riesgo y pueden causar verrugas genitales y alteraciones del cuello uterino (es decir, anormales, pero no cancerosas).

Otros son de bajo riesgo y pueden causar verrugas genitales y alteraciones del cuello uterino (es decir, anormales, pero no cancerosas). Cuadernillo Virus del Papiloma Humano El virus del papiloma humano, papilomavirus o VPH es una infección de transmisión sexual, por lo que es considerada dentro del grupo de enfermedades venéreas. El VPH

Más detalles

Detección Marcadores Moleculares por PCR. Dr. Carlos G. Gonzalez Becuar

Detección Marcadores Moleculares por PCR. Dr. Carlos G. Gonzalez Becuar Detección Marcadores Moleculares por PCR Dr. Carlos G. Gonzalez Becuar Virus de Papiloma Humano (VPH) - El CaCu ocupa los primeros lugares por muertes por Cancer en Mexico - Factor principal: VPH tipos

Más detalles

-Usar el preservativo, que evita el contagio de otras enfermedades de transmisión sexual.

-Usar el preservativo, que evita el contagio de otras enfermedades de transmisión sexual. Virus del Papiloma Humano (VPH) - Preguntas y respuestas 1. Qué es el virus del Papiloma Humano (VPH)? El virus papiloma humano (VPH) es un virus que se transmite por contacto entre personas infectadas,

Más detalles

Programa de cribado de cáncer de cérvix en Osakidetza.

Programa de cribado de cáncer de cérvix en Osakidetza. Programa de cribado de cáncer de cérvix en Osakidetza. Irune Ruiz Hospital Universitario Donostia. XVIII REUNIÓN ANUAL DE LA RED DE PROGRAMAS DE CRIBADO DE CÁNCER DONOSTIA 27 29 DE MAYO DE 2015 Enfermedad

Más detalles

Cáncer. Cáncer Cervical de Útero. Siempre hay tiempo realice un papanicolau y colposcopia.

Cáncer. Cáncer Cervical de Útero. Siempre hay tiempo realice un papanicolau y colposcopia. Siempre hay tiempo realice un papanicolau y colposcopia. Cáncer Cáncer Cervical de Útero El cáncer de cuello uterino es un grave problema en países en vías de desarrollo. Es el cáncer femenino más frecuente

Más detalles

POTOSINA DEL VIRUS DEL PAPILOMA HUMANO TIPO

POTOSINA DEL VIRUS DEL PAPILOMA HUMANO TIPO INSTITUTO POTOSINO DE INVESTIGACIÓN CIENTÍFICA Y TECNOLÓGICA, A.C. DIVISIÓN DE BIOLOGÍA MOLECULAR CLONACIÓN DEL Título GENOMA de la tesis DE LA VARIANTE POTOSINA DEL VIRUS DEL PAPILOMA HUMANO TIPO (Tratar

Más detalles

INFECCION POR VIRUS DEL PAPILOMA HUMANO:

INFECCION POR VIRUS DEL PAPILOMA HUMANO: INFECCION POR VIRUS DEL PAPILOMA HUMANO: UNA VISIÓN N DIFERENTE COMO ARMAR EL ROMPECABEZAS DR. JOSÉ DE J. CURIEL VALDÉS ANATOMOPATÓLOGO COLPOSCOPISTA Quien suponga que todo está dicho en materia científica

Más detalles

Ficha descriptiva del cáncer cervicouterino. Qué es el cáncer cervicouterino?

Ficha descriptiva del cáncer cervicouterino. Qué es el cáncer cervicouterino? Ficha descriptiva del cáncer cervicouterino Qué es el cáncer cervicouterino? ENGAGe está publicando una serie de fichas descriptivas a modo de campaña de concienciación en torno a los cánceres ginecológicos

Más detalles

Determinación del estado físico y carga viral de vph-16 en cáncer cervicouterino y lecciones precursoras en mujeres guerrerenses.

Determinación del estado físico y carga viral de vph-16 en cáncer cervicouterino y lecciones precursoras en mujeres guerrerenses. Tlamati Sabiduría Volumen 7 Número Especial 1, Septiembre 2016 3 er. Encuentro de Jóvenes en la Investigación de Bachillerato-CONACYT Acapulco, Guerrero 22-24 de Septiembre 2016 Memorias Determinación

Más detalles