HAMA-ELISA medac. Castellano

Tamaño: px
Comenzar la demostración a partir de la página:

Download "HAMA-ELISA medac. Castellano"


1 HAMAELISA medac Castellano

2 FABRICANTE medac Gesellschaft für klinische Spezialpräparate mbh Fehlandtstraße 3 D20354 Hamburg DISTRIBUCIÓN medac Gesellschaft für klinische Spezialpräparate mbh Geschäftseinheit Diagnostika Theaterstraße 6 D22880 Wedel Tel.: ++49/ 4103/ Fax: ++49/ 4103/ DIRECCIÓN DE PEDIDOS Tel.: ++49/ 4103/ Fax: ++49/ 4103/ AVPS/031108

3 HAMAELISA medac Inmunoensayo enzimático para la detección cuantitativa de los anticuerpos humanos antiratón (HAMA, Human AntiMouse Antibodies) Cat. No.: 10018A PARA USO EXCLUSIVO DE DIAGNOSTICO IN VITRO INTRODUCCIÓN Los anticuerpos monoclonales de ratón se utilizan in vivo para la inmunosupresión después de un trasplante con el objetivo de evitar cuadros de rechazo, para suprimir fases agudas de autoinmunopatías y para la inmunogammagrafía o la inmunoterapia in vivo en pacientes con tumores. La administración de anticuerpos monoclonales de ratón puede inducir la aparición de HAMA en estos pacientes. Un uso reiterado de anticuerpos monoclonales de ratón suele provocar un aumento significativo de la concentración de HAMA en el suero del paciente. Los HAMA desarrollados son en su mayor parte antiisotípicos, y rara vez antiidiotípicos. Los HAMA pueden influir en la eficacia de la inmunoterapia o dela inmunogammagrafía: los HAMA se unen a los anticuerpos monoclonales administrados y la formación de inmunocomplejos (HAMAmAb) reduce la eficacia terapéutica y el valor diagnóstico de los anticuerpos monoclonales. En los pacientes HAMApositivos existe un mayor riesgo de reacciones anafilácticas tras la administración repetida de anticuerpos monoclonales de ratón. Los inmunoensayos para el diagnóstico in vitro suelen basarse en el uso de anticuerpos monoclonales de ratón. Los HAMA pueden generar resultados falsamente positivos y negativos en estos ensayos. La incorporación de anticuerpos de ratón en los diluyentes de los inmunoensayos no siempre logra eliminar por completo los efectos indeseables producidos por los HAMA. El HAMAELISA medac es un inmunoensayo enzimático simple y rápido en un solo paso para la determinación cuantitativa de los HAMA en el suero. La determinación está calibrada frente a anticuerpos antiratón IgG. El rango de medida del HAMA ELISA medac es de 40 a 2000 ng/ml AVPS/

4 PRINCIPIO DE LA DETERMINACIÓN La placa está recubierta de IgG de ratón (antígeno). Se añaden las muestras y las IgG de ratón marcadas con peroxidasa (conjugado)(p = peroxidasa). Los anticuerpos humanos antiratón (HAMA) se ligan a la fase sólida y a los IgG de ratón marcados con peroxidasa. Incubación con el sustrato TMB (*). La reacción se detiene mediante la adicción de ácido sulfúrico. La absorción se lee con un fotómetro. Ventajas del ensayo Ensayo en un solo paso con una incubación corta. Las tiras de micropozos permiten un uso óptimo de la prueba. Los reactivos de colores permiten controlar visualmentecada etapa de pipeteo. Compatible con la automatización en equipos ELISA abiertos AVPS/

5 CONTENIDO DEL EQUIPO Ref.: 10018A 1. MTP Microplaca: 12 x 8 pozos (con soporte y desecante, en una bolsa de aluminio al vacío), divisibles, en forma de U, recubiertos de IgG de ratón y SAB, lista para su usar. 2. CONTROL 1 + Control positivo 1: 1 vial con 0,75 ml de anticuerpos IgG de cabra antiratón, listo para usar, de color azul, que contiene SAB, FSC, fenol, ProClin TM 300 y sulfato de gentamicina. 3. CONTROL 2 + Control positivo 2: 1 vial con 0,75 ml de anticuerpos IgG de cabra antiratón, listo para usar, de color azul, que contiene SAB, FSC, fenol, ProClin TM 300 y sulfato de gentamicina. 4. CAL Estándares: 1 vial cada uno de 0,75 ml de anticuerpos de cabra antiratón IgG, listo para usar, de color azul, que contiene SAB, FSC, fenol, ProClin TM 300 y sulfato de gentamicina. 4a. CAL 1 Estándar 1: 2000 ng/ml 4b. CAL 2 Estándar 2: 1000 ng/ml 4c. CAL 3 Estándar 3: 500 ng/ml 4d. CAL 4 Estándar 4: 200 ng/ml 4e. CAL 5 Estándar 5: 40 ng/ml 5. WB Solución de lavado: 1 vial de 100 ml, PBS/Tween (10x), ph 7,2 7,4, que contiene ProClin TM AVPS/

6 6. VIRDIL Diluyente de la muestra: 1 vial de 110 ml, PBS/Tween/SAB, Ph 7,2 7,4, listo para usar, de color azul, que contiene ProClin TM CON Conjugado: 2 viales cada uno con 5,0 ml de IgG de ratón, HRPconjugado, listo para usar, de color naranja, que contienen SAB, fenol, ProClin TM 300 y sulfato de gentamicina. 8. TMB TMBsubstrato: 2 viales de 10 ml cada uno, listo para usar. 9. STOP Solución de parada: 1 vial de 11 ml de ácido sulfúrico 0,5 M (H2SO4), listo para usar. 1. ALMACENAMIENTO Y ESTABILIDAD Material/Reactivos Estado Almacenamiento Estabilidad Equipo sin abrir C Hasta la fecha de caducidad Microplaca abierto C en la 4 semanas bolsa con desecante Controles abierto C 4 semanas Estándares abierto C 4 semanas Solución de lavado diluida C 4 semanas Diluyente de la abierto C 4 semanas muestra Conjugado abierto C 4 semanas TMBsubstrato abierto C 4 semanas Solución de parada abierto C Hasta la fecha de caducidad No se deben utilizar los reactivos tras la fecha de caducidad. 2. REACTIVOS Y MATERIAL NECESARIOS QUE NO SE PROPORCIONAN 2.1. Agua bidestilada. La utilización de agua desionizada puede alterar el procedimiento de la técnica AVPS/

7 2.2. Micropipetas adjustables Contenedores de cristal o de de plástico limpios para la dilución de la solución de lavado y de las muestras Sistemas apropiados para el lavado de la microplaca (e.j. pipeta multicanal o lavador de ELISA) Incubador de 37 C Lector de microplaca con filtros para 450 nm y nm. 3. PREPARACION DE LOS REACTIVOS Antes de comenzar con el procedimiento de la técnica, todos los componentes del kit deben alcanzar la temperatura ambiente. Calcular el número de pocillos que se necesiten Microplaca La bolsa de aluminio debe cerrarse herméticamente junto con el desecante cada vez que se separen pocillos. El almacenamiento y la estabilidad de los pocillos se indican en punto Solución de lavado Mezclar un volumen de solución de lavado (10x) con 9 volúmenes de agua bidestilada (p. ej., 50 ml de solución de lavado (10x) con 450 ml de agua). Para 8 pocillos, se requieren 5 ml de solución de lavado diluída. Si se observan cristales en la solución de lavado (10x), deberan de disolverse por calentamiento (max. a 37 C), y/o agitación a temperatura ambiente. No mezcle reactivos de diferentes lotes o fabricantes. Sólo obtendrá resultados válidos y reproducibles si sigue de forma rigurosa el procedimiento de la prueba y utiliza los reactivos específicos del kit. 4. MUESTRAS 4.1. El ensayo es apropriado para suero AVPS/

8 4.2. No es necesario un tratamiento previo del suero (por ejemplo, inactivación). No obstante, no debe contaminarse con microorganismos ni contener glóbulos rojos Las muestras séricas deben diluirse a 1:10 con el diluyente de muestra (por ejemplo 20 μl de suero μl de diluyente). Las muestras fuera del rango de medida pueden diluirse más. (Véase 6.A.) 5.A. PROCEDIMIENTO DE LA TECNICA 5.1. Corte la bolsa de aluminio por encima del cierre zip y extraiga el número de pozos necesario (véase 3.1.). Los pocillos de la microplaca están listos para usar y no necesitan prelavado Añadir 100 μl de diluyente de la muestra en el pozo A1 para la determinación del blanco. Añadir 50 μl de cada estándar, control y muestra diluida, por duplicado, en los pozos respectivos. Después pipetee 50 μl de conjugado en todos los pozos, salvo A1. El pipeteo de los estándares, controles, muestras y conjugado debe realizarse en menos de 10 minutos. Más allá de este plazo, la placa debe incubarse inmediatamente (véase 5.3.). Atención: Si el procedimiento se realiza con un equipo automatizado, debe añadir en cada pozo 60 μl de estándar, control, muestra y conjugado en cada pozo debido a una mayor evaporación en la cámara de incubación del equipo. El uso de la prueba con equipos automátizados ha sido validado durante la evaluación de la prueba. Sin embargo, recomendamos comprobar la compatibilidad de la prueba con los equipos utilizados en el laboratorio Incubar la microplaca durante 30 min (± 1 min) a 37 C (±1 C) en una cámara húmeda o recubierta con film para incubación Tras la incubación, lavar la microplaca tres veces con 200 μl de solución de lavado por pozo. Comprobar que se hayan rellenado todos los pozos. Tras el lavado, golpear suavemente la microplaca sobre papel absorbente. No dejar secar los pocillos! Proceder inmediatamente! 10018AVPS/

9 5.5. Añadir 100 μl de sustrato TMB en cada pozo (también al A1) e incubar durante 15 min (± 1 min) a 37 C (± 1 C) en una cámara húmeda o recubierta con film para incubación, en la oscuridad. Las muestras positivas se vuelven azules Detener la reacción añadiendo 50 μl de solución de parada en cada pozo (también el A1). Las muestras positivas se vuelven amarillas. Mezclar bien el contenido de los pozos mediante una agitación suave, limpiar la parte inferior de los pozos antes de la lectura fotométrica y procure que no haya burbujas de aire en los pozos. La lectura debe realizarse en un plazo de 10 minutos después de añadir la solución de parada. 5.B. TABLA PARA EL PROCEDIMIENTO DE LA TECNICA Blanco Estándares Controles Muestras (A1) Diluyente de la 100 μl muestras Estándares Controles Muestras 50/60 μl*) 50/60 μl*) 50/60 μl*) Conjugado 50/60 μl*) 50/60 μl*) 50/60 μl*) Incubar durante 30 min a 37 C, lavar x 3 con 200 μl de solución de lavado TMBsubstrato 100 μl 100 μl 100 μl 100 μl Incubar durante 15 min a 37 C en la oscuridad Solución de 50 μl 50 μl 50 μl 50 μl parada Lectura fotométrica a 450 nm (ref nm) Procedimiento manual/automático (véase 5.2.) 10018AVPS/

10 6.A CÁLCULO DE LOS RESULTADOS (VALIDACION) Leer los valores de DO a 450 nm (longitud de onda de referencia nm). Restar el valor de DO del blanco (pozo A1) a todos los demás valores de DO. El rango de concentración nominal de los controles aparece impreso en las etiquetas de los viales. Criterios de validez El valor de DO del blanco tiene que ser < 0,050. El valor medio de DO del estándar 5 tiene que ser < 0,200. El valor medio de DO del estándar 1 tiene que ser > 1,500. Las concentraciones de los controles tienen que estar dentro de los rangos de las concentraciones nominales (consultar las etiquetas de los viales). Repetir el ensayo si los resultados no cumplen con las especificaciones. Curva de calibración y cuantificación de los resultados Los valores de DO de los estándares se expresan gráficamente en función de las concentraciones. Para la curva de calibración, se recomienda utilizar una curva de tipo Cubic Spline. Las concentraciones de HAMA correspondientes a las DO medias de las muestras, pueden leerse a partir de la curva de calibración. El rango de medida va de 40 a 2000 ng/ml. Las muestras con concentraciones inferiores deben interpretarse como < 40 ng/ml. Las muestras superiores al rango de medida deben interpretarse como > 2000 ng/ml. Estos valores no deben extrapolarse. Estas muestras deben repetirse con una dilución más alta. Si se ha medido una muestra con una dilución superior a 1:10, la concentración leída a partir de la curva de calibración debe multiplicarse por el factor adicional de dilución (p.ej.: dilución en la prueba 1:40, concentración leída = 1500 ng/ml concentración real = 1500 ng/ml x 4 = 6000 ng/ml) AVPS/

11 Ejemplo de curva de calibración: 2,5 OD (450/630 nm) 2,0 1,5 1,0 0,5 0, HAMA conc. [ng/ml] 6.B. INTERPRETACIÓN DE LOS RESULTADOS/LÍMITACIONES DEL MÉTODO El HAMAELISA medac puede utilizarse para medir únicamente la concentración de anticuerpos antiisotípicos. Las concentraciones de HAMA > 40 ng/ml se consideran positivas. Esto puede influir en la eficacia terapéutica de los anticuerpos monoclonales de ratón y la interpretación de los métodos de diagnóstico basados en estos anticuerpos. Para la interpretación individual, se recomienda medir muestras de seguimiento. En algunos casos, no pueden excluirse reacciones falsamente positivas, provocadas por anticuerpos heterofílicos. Los sueros que contienen factores reumatoides pueden presentar niveles elevados de HAMA. Se han medido concentraciones > 40 ng/ml en el 63 % de los 43 sueros estudiados. El 5 % de estos sueros eran > 320 ng/ml. No se han hallado valores de HAMA > 1000 ng/ml en el grupo estudiado. Las concentraciones muy altas de lípidos o de hemoglobina y bilirrubina no influyen en los resultados. La linealidad de dilución se ha establecido sobre la base de muestras seleccionadas (véase el capítulo 7.D.). Cabe señalar que algunas muestras de pacientes muestran una mala linealidad de dilución AVPS/

12 7. CARACTERÍSTICAS ESPECÍFICAS DEL ENSAYO Las características específicas de la determinación obtenidas durante la evaluación diagnóstica son las siguientes. 7.A. PREVALENCIA Se han medido 101 muestras de donantes de sangre durante la evaluación diagnóstica. 98 muestras fueron negativas (concentración HAMA < 40 ng/ml). 7.B. PRECISIÓN Muestra Variación intraensayo Muestra Variación interensayo DO media SD CV (%) n Media ng/ml SD CV (%) n Est.1 2,460 0,204 8,3 21 C ,6 11 Est.5 0,070 0,008 11,4 21 C ,8 11 C1 1,013 0,053 5,2 21 No ,1 11 C2 2,205 0,121 5,5 21 No ,4 11 No 1 0,128 0,011 8,6 22 No ,8 11 No 3 2,341 0,129 5,5 22 Est. = Estándar ; C= control ; No = muestra 7.C. RECUPERACIÓN Se ha calculado una recuperación media del 99% (SD = 12 %) añadiendo ocho concentraciones de HAMA definidas, cada una a tres sueros diferentes AVPS/

13 7.D. LINEALIDAD DE DILUCIÓN Se ha comprobadola linealidad de dilución utilizando 10 sueros altamente reactivos, que se han probado con 5 diluciones diferentes (diluciones sucesivas de 1:2). Dil. 1 Dil. 2 Dil. 3 Dil. 4 Dil. 5 Media SD CV ng/ml ng/ml ng/ml ng/ml ng/ml ng/ml ng/ml No % No % No % No % No % No % No % No % No % No % 7.E. LÍMITE DE CUANTIFICACIÓN (LC) El límite de cuantificación es de 40 ng/ml. Esta concentración es significativamente superior al valor cero. INDICACIONES GENERALES No intercambiar los tapones de los viales para evitar contaminaciones cruzadas. Los viales de los reactivos deben cerrarse inmediatamente después de su uso para evitar la evaporación y la contaminación microbiana. Después de su empleo, los reactivos deben conservarse como se indica para garantizar su vida útil. Tras su utilización, conservar todos los componentes del equipo en su embalaje original para evitar que se mezclen reactivos utilizados en otras técnicas de determinación o de otros lotes (véase también 3.). PRECAUCIONES DE EMPLEO Debe aplicarse la normativa local en vigor en materia de seguridad y salud AVPS/

14 Se recomienda firmemente manipular los reactivos de origen animal (véase el contenido del equipo) como sustancias potencialmente infecciosas y utilizarlos con todas las precauciones necesarias. CONSEJOS DE ELIMINACIÓN En general, los residuos de los productos químicos y de las preparaciones se consideran residuos peligrosos. La eliminación de este tipo de residuos está regulada por las leyes y las normativas nacionales y regionales. Contacte con sus autoridades locales o con empresas de gestión de residuos, que le aconsejarán cómo tratar los residuos peligrosos. Fecha de revisión: AVPS/

15 LITERATURA Baum, R.P., et al.: Clinical Course of Ovarian Cancer Patients Under Repeated Stimulation of HAMA Using MAb OC 125 and B HYBRIDOMA 12 (5), (1993) Baum, R.P. et al.: Activating AntiIdiotypic Human AntiMouse Antibodies for Immunotherapy of Ovarian Carcinoma. CANCER 73 (3), (1994) Bock, J.L., J. Forgiuele, B. Wenz: False positive immunometric assays caused by antiimmunoglobulin antibodies: a case report. CLIN. CHIM. ACTA. 147, (1985) Boscato, L.M., G. Egan, M.C. Stuart: Covert cross reactants in a twosite immunoassay studied with monoclonal antibodies. ANAL. BIOCHEM. 146, (1985) Boscato, L.M. and M.C. Stuart: Incidence and specificity of interference in twosite immunoassays. CLIN. CHEM. 32, (1986) Boscato, L.M. and M.C. Stuart: Heterophilic Antibodies: A Problem for all immunoassays. CLIN. CHEM. 34/1, 2733 (1988) CourtenayLuck, N.S., et al.: Development of Primary and Secondary Immune Responses to Mouse Monoclonal Antibodies Used in the Diagnosis and Therapy of Malignant Neoplasms. CANCER RESEARCH 46, (1986) CourtenayLuck, N.S., A.A. Epenetos, C.G. Winearls, M.A. Ritter: Preexisting Human AntiMurine Immunoglobulin Reactivity Due to Polyclonal Rheumatoid Factors. CANCER RESEARCH 47, (1987) Cusick, C.F., K. Mistry, G.M. Addision: Interference in a TwoSite Immunoradiometric Assay for Thyrotropin in a Child. CLIN. CHEM. 31, (1985) Davies, A.G., et al.: Preexisting Antimouse Immunoglobulin in a Patient Receiving 131Imurine Monoclonal Antibody for Radioimmunolocalization. BR. J. CANCER 53, (1986) Hansen, H.J., E. Newman, G. LaFontaine: Human AntiMurine Antibody (HAMA) Can Cause FalsePositive and FalseNegative Carcinoembryonic Antigen (CEA) Assay Results. Presented at the Third International Conference of Monoclonal Antibody Immunoconjugates for Cancer, February 46 (1988) Hertel, A., et al.: Antiidiotypic HAMA Triggered by OC 125 Radioimmunoscintigraphy: Beneficial to the Patient? in R. Klapdor (ed.): Tumor Associated Antigens, Oncogenes, Receptors, Cytokines in Tumor 10018AVPS/

16 Diagnosis and Therapy at the Beginning of the Nineties. Cancer of the BreastState and Trends in Diagnosis and Therapy. Zuckerschwerdt Verlag München, Bern, Wien, New York, (1992) Hertel, A. and R. Baum: Influence of Human AntiMurine Antibodies on in vitro Assays in Ovarian Cancer Patients. HYBRIDOMA 12 (5), (1993) Klein, J.L., et al.: Detection of specific antiantibodies in patients treated with radiolabelled antibody. INT. J. RAD. ONCOL. BIOL. PHYS. 12, (1986) Kricka, L.J. and D. SchmerfeldPruss: Interlaboratory Survey of Methods for Measuring Human AntiMouse Antibodies. CLINICAL CHEMISTRY 38 (1), (1992) LaFontaine, G.S., H.J. Hansen, B.F. Weiss and D.M.Goldenberg: Enzyme Immunoassay for the Detection of Circulating Immunoglobulins in Humans to Mouse Monoclonal Antibody (HAMA). Presented at the Third International Conference of Monoclonal Antibody Immunoconjugates for Cancer, February 46 (1988) McCarthy, R.C., F.J. Ryan: Interference in immunoenzymometric assays (IEMA) using mouse monoclonal antibodies (MCAB) caused by human IgM antibody to mouse IgG (Abstract). CLIN. CHEM. 33, 918 (1987) Pimm, M.V., et al.: The Characteristics of Blood Borne Radiolabels and the Effect of AntiMouse IgG Antibodies on Localization of Radiolabelled Monoclonal Antibody in Cancer Patients. J. NUCL. MED. 26, (1985) Porstmann, T. (Hrsg.): Human antimausantikörper immer häufiger Ursache fehlerhafter Immunoassayergebnisse. INVITRO DIAGNOSTICA ACHRICHTEN 2 + 3, 15 (1993) Porstmann, T. (Hrsg.): Interferenzen durch humane AntiMausAntikörper (HAMA). INVITRO DIAGNOSTICA NACHRICHTEN 10, 8 (1993) 10018AVPS/

medac Asparaginase-Aktivitäts-Test MAAT Castellano 550-VPS/010512

medac Asparaginase-Aktivitäts-Test MAAT Castellano 550-VPS/010512 medac Asparaginase-Aktivitäts-Test MAAT Castellano 550-VPS/010512 FABRICANTE medac Gesellschaft für klinische Spezialpräparate mbh Fehlandtstraße 3 D-20354 Hamburg DISTRIBUIDOR medac Gesellschaft für klinische

Más detalles

CMV-IgM-ELA Test PKS medac

CMV-IgM-ELA Test PKS medac CMVIgMELA Test PKS medac Castellano 0123 110PKSVPS/010708 FABRICANTE medac Gesellschaft für klinische Spezialpräparate mbh Fehlandtstraße 3 D20354 Hamburg DISTRIBUCION medac Gesellschaft für klinische

Más detalles

ELISA PeliClass human IgG subclass kit REF M1551

ELISA PeliClass human IgG subclass kit REF M1551 Sanquin Reagents Plesmanlaan 5 0 CX Amsterdam The Netherlands Phone: +.0.5.599 Fax: +.0.5.570 Email: reagents@sanquin.nl Website: www.sanquinreagents.com M55/ November 007 ELISA PeliClass human IgG subclass

Más detalles

Componentes 1. MCPL MICROPLACA: 12 x 8 pocillos recubiertos con antígenos recombinantes de HCV (E. coli). Pocillos separables individualmente.

Componentes 1. MCPL MICROPLACA: 12 x 8 pocillos recubiertos con antígenos recombinantes de HCV (E. coli). Pocillos separables individualmente. bioelisa HCV 4.0 3000-1115 LEER CAMBIOS SOMBREADOS 96 tests 3000-1116 480 tests Test de ELISA para la detección de anticuerpos contra el virus de la hepatitis C (HCV) en suero o plasma humano para ser

Más detalles

Mercodia Ultrasensitive C-peptide ELISA

Mercodia Ultrasensitive C-peptide ELISA Mercodia Ultrasensitive C-peptide ELISA Instrucciones para el uso 10-1141-01 REACTIVOS PARA 96 DETERMINACIONES Para uso diagnóstico in vitro ATENCIÓN! Protocolo de actualización Fabricado por Mercodia

Más detalles

4. DIL SAMP DILUYENTE DE LAS MUESTRAS: Tampón fosfato con proteínas estabilizadoras y conservantes. Listo para usar.

4. DIL SAMP DILUYENTE DE LAS MUESTRAS: Tampón fosfato con proteínas estabilizadoras y conservantes. Listo para usar. bioelisa HIV-1+2 (rec) 3000-1143 LEER CAMBIOS SOMBREADOS 96 tests 3000-1144 480 tests Test de ELISA para la detección de anticuerpos contra HIV-1 y HIV-2 en suero o plasma humano. Sumario Como es conocido

Más detalles

Mycoplasma pneumoniae-iga-elisa medac. Castellano 361-VPS/110305

Mycoplasma pneumoniae-iga-elisa medac. Castellano 361-VPS/110305 Mycoplasma pneumoniaeigaelisa medac Castellano 361VPS/110305 FABRICANTE medac Gesellschaft für klinische Spezialpräparate mbh Fehlandtstraße 3 D20354 Hamburg DISTRIBUCION medac Gesellschaft für klinische

Más detalles

RIDASCREEN. Leishmania Ab. Art. n.: K7121

RIDASCREEN. Leishmania Ab. Art. n.: K7121 RIDASCREEN Leishmania Ab Art. n.: K7121 R-Biopharm AG, An der neuen Bergstraße 17, D-64297 Darmstadt, Alemania Telf.: +49 (0) 6151 8102-0 / Fax: +49 (0) 6151 8102-20 1. Área de aplicación Para el diagnóstico

Más detalles


DETERMINACIÓN DE GLUTEN EN ALIMENTOS PARA CELÍACOS INDICE DETERMINACIÓN DE GLUTEN EN ALIMENTOS PARA CELÍACOS INDICE 1 Objetivo 2 2 Alcance 2 3 Desarrollo 2 4 Anexo 8 1.0. Objetivo Determinación de gluten en alimentos para celíacos. 2.0. Alcance Este método analítico

Más detalles

RIDASCREEN. HSV 2 IgG, IgM. Nº de artículo: K5221 (IgG) K5231 (IgM)

RIDASCREEN. HSV 2 IgG, IgM. Nº de artículo: K5221 (IgG) K5231 (IgM) RIDASCREEN HSV 2 IgG, IgM Nº de artículo: K5221 (IgG) K5231 (IgM) R-Biopharm AG, An der neuen Bergstraße 17, D-64297 Darmstadt, Alemania Teléfono: +49 61 51 81 02-0/Fax: +49 61 51 81 02-20 1. Uso previsto

Más detalles

C-peptide. N de código K6220. Inmunoensayo enzimático para la medición cuantitativa del péptido C en muestras clínicas humanas.

C-peptide. N de código K6220. Inmunoensayo enzimático para la medición cuantitativa del péptido C en muestras clínicas humanas. C-peptide N de código K6220 Inmunoensayo enzimático para la medición cuantitativa del péptido C en muestras clínicas humanas. Este kit contiene reactivos para 96 pocillos de prueba. (111838-002) K6220/ES/CKJ/2009.06.17

Más detalles

Quantikine IVD ELISA. Inmunoensayo Epo Humano Manual de Instrucciones suplementario. Referencia DEP00

Quantikine IVD ELISA. Inmunoensayo Epo Humano Manual de Instrucciones suplementario. Referencia DEP00 Quantikine IVD ELISA Inmunoensayo Epo Humano Manual de Instrucciones suplementario Referencia DEP00 Este manual de instrucciones incluye el protocolo del ensayo y debe leerse en su totalidad antes de comenzar

Más detalles

NycoCard CRP Single Test

NycoCard CRP Single Test NycoCard CRP Single Test ES DESCRIPCION DEL PRODUCTO Aplicaciones NycoCard CRP Single Test es un test de diagnóstico in vitro para medir de una forma rápida la proteína C reactiva (CRP) en la sangre humana.

Más detalles


ELISA IgM PARA DIAGNOSTICO DE LEPTOSPIRA Página 1 de 9 ELISA IgM PARA DIAGNOSTICO DE LEPTOSPIRA Elaborado por: CNSP Blgo. Manuel Céspedes Zambrano Revisado por: CNSP TM. Julia I. Espinoza Soto CNSP MV Gladys Malásquez Mendoza Aprobado por: RD

Más detalles

ScanGel NEUTRAL 86429 48 Tarjetas 86430 1080 Tarjetas

ScanGel NEUTRAL 86429 48 Tarjetas 86430 1080 Tarjetas ScanGel NEUTRAL 86429 48 Tarjetas 86430 1080 Tarjetas GEL NEUTRO Grupo sérico, screening de Ac irregulares, pruebas cruzadas IVD Todos los productos fabricados y comercializados por la sociedad Bio-Rad

Más detalles

RIDASCREEN. Chlamydia IgG/IgM. Art. n.: KGM3101

RIDASCREEN. Chlamydia IgG/IgM. Art. n.: KGM3101 RIDASCREEN Chlamydia IgG/IgM Art. n.: KGM3101 R-Biopharm AG, An der neuen Bergstraße 17, D-64297 Darmstadt, Alemania Telf.: +49 61 51 81 02-0 / Fax: +49 61 51 81 02-20 1. Área de aplicación Para el diagnóstico

Más detalles

Murex anti-hbc (total)

Murex anti-hbc (total) es 8G21-01/-02 GE65/66 Primera edición 10/2009 Murex anti-hbc (total) Enzimoinmunoanálisis para la detección de anticuerpos frente al antígeno core del virus de la hepatitis B (anti-hbc) en suero o plasma

Más detalles

Control de Calidad en la Técnica de ELISA. Lic. Valentina Bastidas D.

Control de Calidad en la Técnica de ELISA. Lic. Valentina Bastidas D. Control de Calidad en la Técnica de ELISA Lic. Valentina Bastidas D. TÉCNICA DE ELISA DEFINICIÓN E L I S A Ensayo Inmunoabsorbente Ligado a Enzimas Enzime-Linked ImmunoSorbent Assay TIPOS DE ELISA: ELISA

Más detalles


SC5b-9 Plus RESUMEN Y EXPLICACIÓN SC5b-9 Plus Enzimoinmunoensayo para la cuantificación del complejo SC5b-9 presente en plasma o suero humanos MicroVue SC5b-9 Plus EIA Preparación del Reactivo y de la Muestra Diluya el Concentrado de Solución

Más detalles


CALIBRATEURS Hb A1c CAPILLAIRE Hb A1c CAPILLARY CALIBRATORS CALIBRATEURS Hb A1c CAPILLAIRE Hb A1c CAPILLARY CALIBRATORS Ref. 4755 2014/04 CALIBRADORES Hb A1c CAPILAR Aplicación Los Calibradores Hb A1c CAPILAR están destinados a la calibración y al control de migración

Más detalles

Prolactina Código: 9001004 Ensayo inmunoenzimático por Quimioluminiscencia para la medición cuantitativa de Prolactina (PRL) en suero humano.

Prolactina Código: 9001004 Ensayo inmunoenzimático por Quimioluminiscencia para la medición cuantitativa de Prolactina (PRL) en suero humano. Prolactina Código: 9001004 Ensayo inmunoenzimático por Quimioluminiscencia para la medición cuantitativa de Prolactina (PRL) en suero humano. 96 PRUEBAS USO El equipo de Prolactina CLIA se destina para

Más detalles

Mercodia Proinsulin ELISA

Mercodia Proinsulin ELISA Mercodia Proinsulin ELISA Instrucciones para el uso 10-1118-01 REACTIVOS PARA 96 DETERMINACIONES Para uso diagnóstico in vitro Fabricado por Mercodia AB, Sylveniusgatan 8A, SE-754 50 Uppsala, Suecia EXPLICACIÓN

Más detalles

Mycoplasma pneumoniae-igm-elisa medac. Castellano 362-VPS/010905

Mycoplasma pneumoniae-igm-elisa medac. Castellano 362-VPS/010905 Mycoplasma pneumoniaeigmelisa medac Castellano 362VPS/010905 FABRICANTE medac Gesellschaft für klinische Spezialpräparate mbh Fehlandtstraße 3 D20354 Hamburg DISTRIBUCION medac Gesellschaft für klinische

Más detalles

DiaSorin S.p.A. Via Crescentino snc - 13040 Saluggia (VC) - Italy www.diasorin.com. Modificaciones: Supresiones:

DiaSorin S.p.A. Via Crescentino snc - 13040 Saluggia (VC) - Italy www.diasorin.com. Modificaciones: Supresiones: DiaSorin S.p.A. Via Crescentino snc - 13040 Saluggia (VC) - Italy www.diasorin.com Modificaciones: Supresiones: 1. FINALIDAD DEL ENSAYO Ensayo in vitro para la determinación de tiroglobulina humana (htg)

Más detalles

RIDASCREEN Chlamydia trachomatis

RIDASCREEN Chlamydia trachomatis RIDASCREEN Chlamydia trachomatis Art. n.: KGM2901 K2911 (IgG/IgM) (IgA) R-Biopharm AG, An der neuen Bergstraße 17, D-64297 Darmstadt, Alemania Telf.: +49 61 51 81 02-0 / Fax: +49 61 51 81 02-20 1. Área

Más detalles

DiaSorin S.p.A. Via Crescentino snc - 13040 Saluggia (VC) - ITALY www.diasorin.com. Modificaciones: 11 Supresiones:

DiaSorin S.p.A. Via Crescentino snc - 13040 Saluggia (VC) - ITALY www.diasorin.com. Modificaciones: 11 Supresiones: DiaSorin S.p.A. Via Crescentino snc - 13040 Saluggia (VC) - ITALY www.diasorin.com Modificaciones: 11 Supresiones: 1. FINALIDAD DEL ENSAYO Ensayo in vitro para determinación cuantitativa de alfafetoproteína

Más detalles

Murex HIV Ag/Ab Combination

Murex HIV Ag/Ab Combination es 7G79-09/-11 GE41/42 Primera edición 08/2009 Murex HIV Ag/Ab Combination Enzimoinmunoanálisis para la detección mejorada de la seroconversión frente a los virus de la inmunodeficiencia humana tipo 1

Más detalles

Mercodia Iso-Insulin ELISA

Mercodia Iso-Insulin ELISA Mercodia Iso-Insulin ELISA Instrucciones para el uso 10-1128-01 REACTIVOS PARA 96 DETERMINACIONES Para uso diagnóstico in vitro Fabricado por Mercodia AB, Sylveniusgatan 8A, SE-754 50 Uppsala, Suecia EXPLICACIÓN

Más detalles

C1q CIC ELISA 704620

C1q CIC ELISA 704620 QUANTA Lite Para Diagnóstico In Vitro Complejidad de CLIA: Alto C1q CIC ELISA 704620 Aplicación El propósito de este kit es la determinación in-vitro de los inmunocomplejos circulantes (CIC) ligantes de

Más detalles

Diagnóstico del Dengue

Diagnóstico del Dengue Solución Total: Todo lo que usted necesita saber acerca del Diagnóstico del Dengue Prueba Rápida Dengue Duo ( + Ab Combo) Dengue IgG/IgM ELISA Dengue IgM capture ELISA Dengue IgG capture ELISA ELISA 2

Más detalles

Inmunoensayo enzimático para cuantificar in vitro la 25-hidroxivitamina D 2 y D 3 (25OH-D 2 y 25OH-D 3 ) en suero. RESUMEN

Inmunoensayo enzimático para cuantificar in vitro la 25-hidroxivitamina D 2 y D 3 (25OH-D 2 y 25OH-D 3 ) en suero. RESUMEN Inmunoensayo enzimático para cuantificar in vitro la 25-hidroxivitamina D 2 y D 3 (25OH-D 2 y 25OH-D 3 ) en suero. RESUMEN EIA (inmunoensayo enzimático) de la 25-OH vitamina D de MicroVue Página 1 de 17

Más detalles



Más detalles



Más detalles

PROCEDIMIENTO PARA DETERMINACIÓN DE SODIO, POTASIO y CALCIO EN ALIMENTOS. Método Espectrofotometría de Absorción Atómica de llama. Método AOAC 985.

PROCEDIMIENTO PARA DETERMINACIÓN DE SODIO, POTASIO y CALCIO EN ALIMENTOS. Método Espectrofotometría de Absorción Atómica de llama. Método AOAC 985. Página 1 de 8 1. OBJETIVO Determinar la concentración de sodio, potasio y calcio en muestras de alimentos con bajo contenido de grasa. 2. CAMPO DE APLICACIÓN Y ALCANCE El método es aplicable a alimentos

Más detalles


PRINCIPIO DE LA PRUEBA: USO PREVISTO: ESPECIFICACIONES DEL KIT: Cat. No Cantidad Reactivo Almacenamiento ADRT0011 1 x 20 PRUEBAS 1 x 3 ml Diluente USO PREVISTO: HIV 2-30 C El HIV-1/2 Plus Combo Rapid Test es un inmunoensayo de flujo lateral

Más detalles

TaqMan GMO Maize Quantification Kit. Part No: 4481972

TaqMan GMO Maize Quantification Kit. Part No: 4481972 TaqMan GMO Maize Quantification Kit Part No: 4481972 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan

Más detalles

QUANTA Lite TM Sm 708560 Para Diagnóstico In Vitro Complejidad de CLIA: Alto

QUANTA Lite TM Sm 708560 Para Diagnóstico In Vitro Complejidad de CLIA: Alto QUANTA Lite TM Sm 708560 Para Diagnóstico In Vitro Complejidad de CLIA: Alto Aplicación QUANTA Lite TM Sm es un ensayo basado en la técnica ELISA (Enzyme-Linked Immunosorbent Assay) para la detección semi

Más detalles

PROSPECTO. Para uso diagnóstico in vitro. Para uso en la preparación y aislamiento de linfocitos purificados directamente de sangre entera.

PROSPECTO. Para uso diagnóstico in vitro. Para uso en la preparación y aislamiento de linfocitos purificados directamente de sangre entera. Para uso en la preparación y aislamiento de linfocitos purificados directamente de sangre entera. PROSPECTO Para uso diagnóstico in vitro PI-TT.610-ES-V5 Información e instrucciones Uso previsto El reactivo

Más detalles

El tipo de alteración observada también proporciona gran información:

El tipo de alteración observada también proporciona gran información: TEMA 5: ENZIMOLOGÍA CLÍNICA 1. Valor diagnóstico de las enzimas en el plasma. 2. Principios del análisis de enzimas 3. Análisis de isoenzimas. 4. Determinación enzimática de sustratos. 1. Valor diagnóstico

Más detalles



Más detalles


INSTRUCCIONES DE USO. TEST RÁPIDO DETECCIÓN ENFERMEDAD CELIACA. Test Rápido para la detección de anticuerpos IgA/IgG/IgM contra la transglutaminasa tisular humana en sangre humana. Para diagnostico in vitro. Almacenar entre

Más detalles

QUANTA Lite dsdna ELISA 708510 doble cadena DNA ELISA Para Diagnóstico In Vitro Complejidad CLIA : Alta

QUANTA Lite dsdna ELISA 708510 doble cadena DNA ELISA Para Diagnóstico In Vitro Complejidad CLIA : Alta QUANTA Lite dsdna ELISA 708510 doble cadena DNA ELISA Para Diagnóstico In Vitro Complejidad CLIA : Alta Aplicación QUANTA Lite dsdna es un ensayo basado en la técnica ELISA (Enzyme-Linked Immunosorbent

Más detalles

TaqMan GMO Screening Kit. Part No: 4466334

TaqMan GMO Screening Kit. Part No: 4466334 TaqMan GMO Screening Kit Part No: 4466334 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan mayor

Más detalles

HBsAg CONFIRMATORY TEST Para la confirmación de muestras positivas con el UMELISA HBsAg PLUS

HBsAg CONFIRMATORY TEST Para la confirmación de muestras positivas con el UMELISA HBsAg PLUS HBsAg CONFIRMATORY TEST Para la confirmación de muestras positivas con el UMELISA HBsAg PLUS INTERES CLÍNICO Con el descubrimiento del antígeno de superficie del virus de la Hepatitis B (1) se crearon

Más detalles

Diagnóstico Serológico de Sífilis Técnicas treponémicas

Diagnóstico Serológico de Sífilis Técnicas treponémicas Diagnóstico Serológico de Sífilis Técnicas treponémicas T.M. Rodrigo Colina Morales Laboratorio de Infecciones de Transmisión Sexual Sección Bacteriología Mayo 2014 FTA-ABS (Fluorescent Treponemal Antibody

Más detalles


PET-RPLA KIT para DETECCIÓN de TOXINAS. Código: TD0930 PET-RPLA KIT para DETECCIÓN de TOXINAS Código: TD0930 Kit para detección de enterotoxina tipo A de Clostridium perfringens en muestras fecales o en filtrados de cultivos por aglutinación pasiva de látex

Más detalles

Universidad Tecnológica de Panamá Centro de Investigaciones Hidráulicas e Hidrotécnicas Laboratorio de Sistemas Ambientales

Universidad Tecnológica de Panamá Centro de Investigaciones Hidráulicas e Hidrotécnicas Laboratorio de Sistemas Ambientales Página: 1 de 5 1. Introducción: La prueba de Demanda Química de Oxígeno (DQO) se basa en la oxidación química de la materia orgánica e inorgánica, presente en las muestras de agua, con dicromato de potasio

Más detalles

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Para la purificación de ADN genómico de todos los kits de colección Oragene y ORAcollect. Visite nuestro sitio

Más detalles

ELISA. Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes

ELISA. Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes ELISA Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes ELISA Enzyme Linked Immuno Sorbent Assay Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. info@atgen.com.uy www.atgen.com.uy

Más detalles

Departamento de Bioquímica y Biología Molecular,

Departamento de Bioquímica y Biología Molecular, 18. Inmunoanálisis Aurora Galván Cejudo 1, Isaac Túnez Fiñana 2 Departamento de Bioquímica y Biología Molecular, 1 Campus Universitario de Rabanales, Edificio Severo Ochoa, 14071-Córdoba, 2 Facultad de

Más detalles


LEER CAMBIOS SOMBREADOS BIO-FLASH Rubella IgM 3000-8560 50 tests BIO-FLASH Rubella IgM es un inmunoensayo quimioluminiscente de dos pasos totalmente automatizado para la determinación cualitativa de anticuerpos IgM frente al

Más detalles

TP1: Diluciones. Objetivos. Introducción. Introducción a la Biología Celular y Molecular

TP1: Diluciones. Objetivos. Introducción. Introducción a la Biología Celular y Molecular TP1: Diluciones Objetivos Familiarizarse con las unidades mas utilizadas en biología molecular y ser capaces de intercambiar ágilmente las distintas unidades. Familiarizarse con el material de uso corriente

Más detalles

Prospecto de QuantiFERON -TB Gold (QFT ) ELISA 2 x 96 (n.º de referencia 0594-0201)

Prospecto de QuantiFERON -TB Gold (QFT ) ELISA 2 x 96 (n.º de referencia 0594-0201) Prospecto de QuantiFERON -TB Gold (QFT ) ELISA 2 x 96 (n.º de referencia 0594-0201) 20 x 96 (n.º de referencia 0594-0501) Ensayo de IFN-γ en sangre total que mide la reacción a los antígenos peptídicos

Más detalles


10-1176-01 REACTIVOS PARA 96 ANÁLISIS Mercodia MPO ELISA Instrucciones de uso 10-1176-01 REACTIVOS PARA 96 ANÁLISIS Fabricado por Mercodia AB, Sylveniusgatan 8A, SE-754 50 Uppsala Suecia EXPLICACIÓN DE LOS SÍMBOLOS EMPLEADOS EN LAS ETIQUETAS

Más detalles

Detección de IgE específica.

Detección de IgE específica. Detección de IgE específica. Una forma de identificar los alérgenos responsables de los síntomas alérgicos es la detección de anticuerpos IgE específicos frente a dichos alérgenos. Estos anticuerpos están

Más detalles

APÉNDICE. Apéndice 1. Espectrofotómetro. (Users Manual 2100 Series Spectrophotometer) 68

APÉNDICE. Apéndice 1. Espectrofotómetro. (Users Manual 2100 Series Spectrophotometer) 68 APÉNDICE Apéndice 1. Espectrofotómetro (Users Manual 2100 Series Spectrophotometer) 68 El espectrofotómetro de la marca UNICO serie 2100 UV posee un rango de longitud de onda de 200-1000 nm. La técnica

Más detalles



Más detalles


DENV Detect TM IgM CAPTURE ELISA Detect TM IgM CAPTURE ELISA USO PREVISTO La prueba Detect IgM Capture ELISA está diseñada para la detección cualitativa de anticuerpos IgM contra antígenos recombinantes DEN (DENRA) en suero para diagnóstico

Más detalles



Más detalles

Chagatest ELISA lisado

Chagatest ELISA lisado C Chagatest ELISA lisado Ensayo inmunoenzimático (ELISA) para la detección de anticuerpos anti-trypanosoma cruzi SIGNIFICACION CLINICA La enfermedad de Chagas es una infección parasitaria producida por

Más detalles

ELISA. Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes

ELISA. Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes ELISA Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes ELISA Enzyme Linked Immuno Sorbent Assay Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes

Más detalles

Manual de ensayo de ADVIA Centaur Prolactina 1 / 10

Manual de ensayo de ADVIA Centaur Prolactina 1 / 10 Manual de ensayo de ADVIA Centaur Prolactina 1 / 10 Prolactina (PRL) Resumen del ensayo Contenido Uso previsto Tipo de muestra Suero Volumen de la muestra 25 µl Calibrador B Sensibilidad y rango del ensayo

Más detalles



Más detalles

HIV 1+2 ELISA 3ª Generación

HIV 1+2 ELISA 3ª Generación HIV 1+2 ELISA 3ª Generación Ensayo inmunoenzimático (ELISA) para la detección de anticuerpos anti- HIV-1 y anti HIV-2 en suero o plasma SIGNIFICACION CLINICA Los virus de la inmunodeficiencia humana (HIV-1

Más detalles

Prospecto de QuantiFERON -CMV ELISA 2 96

Prospecto de QuantiFERON -CMV ELISA 2 96 Prospecto de QuantiFERON -CMV ELISA 2 96 Prueba de IFN-γ en sangre total para medir las respuestas a los antígenos peptídicos del citomegalovirus humano Para uso de diagnóstico in vitro 0350-0201 Cellestis,

Más detalles


LEER CAMBIOS SOMBREADOS BIO-FLASH Chagas 3000-8599 100 tests BIO-FLASH Chagas es un inmunoensayo quimioluminiscente de dos pasos totalmente automatizado para la determinación cualitativa de anticuerpos IgG e IgM frente a Trypanosoma

Más detalles

QUANTA Lite TM ssdna ELISA 708525 Cadena simple DNA ELISA Para Diagnóstico In Vitro Complejidad de CLIA: Alto

QUANTA Lite TM ssdna ELISA 708525 Cadena simple DNA ELISA Para Diagnóstico In Vitro Complejidad de CLIA: Alto QUANTA Lite TM ssdna ELISA 708525 Cadena simple DNA ELISA Para Diagnóstico In Vitro Complejidad de CLIA: Alto Aplicación QUANTA Lite TM ssdna es un ensayo basado en la técnica ELISA (Enzyme-Linked Immunosorbent

Más detalles

Acido Urico Uricasa - POD

Acido Urico Uricasa - POD Acido Urico Uricasa - POD Usar un suero de calibración valorado por este método. Programar en el ordenador los siguientes parámetros: Nombre de la prueba : AC. URICO Prueba : URIC Código de barras de la

Más detalles


CUANTIFICACIÓN DE ADENOSIN DESAMINASA (ADA) CUANTIFICACIÓN DE ADENOSIN DESAMINASA (ADA) PROTOCOLO ADA FUNDAMENTO DEL METODO: La adenosindesaminasa (ADA) es una enzima del catabolismo de las purinas que cataliza la conversión de la adenosina en inosina

Más detalles

Chlamydia trachomatis-iga-pelisa medac. Castellano 498-TMB-VPS/010708

Chlamydia trachomatis-iga-pelisa medac. Castellano 498-TMB-VPS/010708 Chlamydia trachomatisigapelisa medac Castellano 0123 498TMBVPS/010708 FABRICANTE medac Gesellschaft für klinische Spezialpräparate mbh Fehlandtstraße 3 D20354 Hamburg DISTRIBUCIÓN medac Gesellschaft für

Más detalles


USO PRACTICO E INTERPRETACIÓN DE LA SEROLOGÍA EN CAMPO. Joaquín Girón, MSD AH USO PRACTICO E INTERPRETACIÓN DE LA SEROLOGÍA EN CAMPO. Joaquín Girón, MSD AH El objetivo final de las empresas es tener lotes con muy buenas producciones y económicamente rentables, lógicamente un lote

Más detalles


PTH RESUMEN Y EXPLICACIÓN USO UTILIZACIÓN PTH Un inmunoensayo enzimático para la determinación cuantitativa de la PTH (hormona paratiroidea) intacta en el suero humano RESUMEN Y EXPLICACIÓN USO UTILIZACIÓN El kit de inmunoensayo enzimático de

Más detalles

QUANTA Lite RNP ELISA 708565 Para Diagnóstico In Vitro Complejidad de CLIA: Alto

QUANTA Lite RNP ELISA 708565 Para Diagnóstico In Vitro Complejidad de CLIA: Alto QUANTA Lite RNP ELISA 708565 Para Diagnóstico In Vitro Complejidad de CLIA: Alto Aplicación QUANTA-Lite RNP es un ensayo basado en la técnica ELISA (Enzyme-Linked Immunosorbent Assay) para la detección

Más detalles



Más detalles

Código: I-CIRB-AADC-03 Revisión: 02 Página: 1 de 5. Fecha de emisión: 12-Octubre-2012

Código: I-CIRB-AADC-03 Revisión: 02 Página: 1 de 5. Fecha de emisión: 12-Octubre-2012 Código: I-CIRB-AADC-03 Revisión: 02 Página: 1 de 5 1.- OBJETIVO Establecer los procedimientos necesarios para realizar correctamente la Citometría Hemática Completa que ayude a una buena orientación diagnóstica.

Más detalles


DEFINICIÓN Y CARACTERÍSTICAS DE LA TÉCNICA: EQUIPO AUTOMÁTICO PARA LA DETECCIÓN DE PATÓGENOS minividas-vidas DEFINICIÓN Y CARACTERÍSTICAS DE LA TÉCNICA: Sistema automático de inmunodetección rápida de patógenos basado en la técnica ELFA (Enzyme

Más detalles


5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN 5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN Materiales - Eppendorf de 1,5 ml estériles - Eppendorf de pared fina para PCR - Puntas de pipeta estériles desechables - Guantes

Más detalles

RESULTADOS Y DISCUSIÓN. Estimación de la Concentración Proteica del Filtrado de Cultivo de Mycobacterium tuberculosis H37Rv

RESULTADOS Y DISCUSIÓN. Estimación de la Concentración Proteica del Filtrado de Cultivo de Mycobacterium tuberculosis H37Rv RESULTADOS Y DISCUSIÓN Estimación de la Concentración Proteica del Filtrado de Cultivo de Mycobacterium tuberculosis H37Rv La curva estándar con la que se estimó la concentración proteica del filtrado

Más detalles

INSULINA. Cat. DA-2425300 VER.1. Solo para diagnóstico In Vitro Para uso exclusivo de laboratorios clínicos o de gabinete Conservar entre 2 C a 8 C

INSULINA. Cat. DA-2425300 VER.1. Solo para diagnóstico In Vitro Para uso exclusivo de laboratorios clínicos o de gabinete Conservar entre 2 C a 8 C INSULINA Cat. DA-2425300 VER.1 Inmunoensayo de la ima para la Determinación Cuantitativa de la Concentración de Insulina en Suero Humano. + Ag Ins + Btn k a - Btn Solo para diagnóstico In Vitro Para uso

Más detalles

QUANTA Lite TM RNA Pol III 704555 Para Diagnóstico In Vitro Complejidad de CLIA: Alto

QUANTA Lite TM RNA Pol III 704555 Para Diagnóstico In Vitro Complejidad de CLIA: Alto QUANTA Lite TM RNA Pol III 704555 Para Diagnóstico In Vitro Complejidad de CLIA: Alto Aplicación El ELISA QUANTA Lite TM RNA Pol III es un análisis inmunoenzimático por adsorción semicuantitativo para

Más detalles

Ficha de Datos de Seguridad

Ficha de Datos de Seguridad Ficha de Datos de Seguridad Fecha de emisión: 10.02.2003 1. Identificación de la sustancia o del preparado y de la sociedad o empresa Identificación de la sustancia o del preparado Rekonstitutionspuffer

Más detalles



Más detalles

MATERLAB S.L. Pº PONTONES 7 28005 MADRID TLF. 91/4745799 4745623 FAX.


Más detalles

Pruebas serológicas para dengue

Pruebas serológicas para dengue Pruebas serológicas para dengue El 40% de la población mundial corre riesgo de infección por dengue Durante más de 25 años, Focus Diagnostics ha sido un líder en el desarrollo de ensayos inmunológicos

Más detalles


CROMATOGRAFÍA DE GASES ACOPLADO A UN DETECTOR DE MASAS GC/MS CROMATOGRAFÍA DE GASES ACOPLADO A UN DETECTOR DE MASAS GC/MS La cromatografía es una técnica para separar las sustancias químicas que se basa en las diferencias en conductas partitivas de una fase móvil

Más detalles

Introducción a los Inmunoensayos. GDS_0418723_McClelland_v4 1

Introducción a los Inmunoensayos. GDS_0418723_McClelland_v4 1 Introducción a los Inmunoensayos GDS_0418723_McClelland_v4 1 Introducción a los Inmunoensayos Objetivos del Entrenamiento Una vez finalizado este capítulo, usted podrá: Definir inmunoensayo Describir la

Más detalles

C V C. Instrucciones de uso de Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02. Revisión 2. Julio de 2014

C V C. Instrucciones de uso de Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02. Revisión 2. Julio de 2014 DOT142v1 Instructions for Use Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Página 1 de 7 Instrucciones de uso de Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Revisión 2 Julio de

Más detalles

Plasma Renin Activity Kit Elisa

Plasma Renin Activity Kit Elisa Plasma Renin Activity Kit Elisa KAPDB4600 DIAsource ImmunoAssays S.A. - Rue du Bosquet, 2 - B-1348 Louvain-la-Neuve - Belgium : 120515/1 Plasma Renin Activity Elisa Kit Para la detección cuantitativa de

Más detalles

QUANTA Lite TM MPO 708700 Para Diagnóstico In Vitro Complejidad de CLIA: Alto

QUANTA Lite TM MPO 708700 Para Diagnóstico In Vitro Complejidad de CLIA: Alto QUANTA Lite TM MPO 708700 Para Diagnóstico In Vitro Complejidad de CLIA: Alto Aplicación QUANTA Lite TM MPO es un ensayo basado en la técnica ELISA (Enzyme-Linked Immunosorbent Assay) para la detección

Más detalles

Ficha de Datos de Seguridad Conforme a la Directiva 91/155/CEE de la Comisión Fecha de emisión: 03.02.2005 Reemplaza la emisión del 19.07.

Ficha de Datos de Seguridad Conforme a la Directiva 91/155/CEE de la Comisión Fecha de emisión: 03.02.2005 Reemplaza la emisión del 19.07. Ficha de Datos de Seguridad Fecha de emisión: 03.02.2005 Reemplaza la emisión del 19.07.2001 1. Identificación de la sustancia o del preparado y de la sociedad o empresa Identificación de la sustancia

Más detalles

6.4.5. Esterilización por gas plasma (Sterrad )

6.4.5. Esterilización por gas plasma (Sterrad ) 6.4.5. Esterilización por gas plasma (Sterrad ) Indicaciones Esterilización de material termosensible (resistente a temperaturas < 60ºC) e instrumental de superficies lisas. No puede esterilizarse instrumental

Más detalles



Más detalles

Bioquímica Médica I. Jorge Contreras Pineda. Práctica: Espectrofotometría GENERALIDADES:

Bioquímica Médica I. Jorge Contreras Pineda. Práctica: Espectrofotometría GENERALIDADES: Bioquímica Médica I Jorge Contreras Pineda Práctica: Espectrofotometría GENERALIDADES: Un espectrofotómetro o colorímetro hace uso de la transmisión de la luz a través de una solución para determinar la

Más detalles

ACCESS Immunoassay System. HIV combo QC4 & QC5. Para la supervisión del rendimiento de sistema del ensayo Access HIV combo. B71123A - [ES] - 2015/01

ACCESS Immunoassay System. HIV combo QC4 & QC5. Para la supervisión del rendimiento de sistema del ensayo Access HIV combo. B71123A - [ES] - 2015/01 ACCESS Immunoassay System HIV combo QC4 & QC5 B22822 Para la supervisión del rendimiento de sistema del ensayo Access HIV combo. - [ES] - 2015/01 Índice Access HIV combo QC4 & QC5 1 Uso previsto... 3 2

Más detalles

Validación y verificación de métodos de examen cuantitativos

Validación y verificación de métodos de examen cuantitativos Temas selectos de Calidad en Serología (aplicación en el banco de sangre) Validación y verificación de métodos de examen cuantitativos Ignacio Reyes Ramírez entidad mexicana de acreditación, a.c. Introducción

Más detalles

Manual del GPHF-Minilab

Manual del GPHF-Minilab Una Guía Concisa de Control de Calidad de Drogas Esenciales y otros Medicamentos Manual del GPHF-Minilab Tercer Suplemento del Volumen II Cromatografía de Capa Fina Extensión 2003 Antiretrovirales Una

Más detalles

Cómo funciona la prueba de ELISA SYSTEMS de residuos de alergenos alimentarios:

Cómo funciona la prueba de ELISA SYSTEMS de residuos de alergenos alimentarios: En muchos países, entre ellos Australia, Canadá, la Unión Europea, Corea, Japón, Nueva Zelanda, EEUU, existen leyes y sistemas de control para regular el etiquetado relativo a alergenos alimentarios. Las

Más detalles



Más detalles


FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles