Los polimorfismos de los genes que codifican. en la aparición o severidad de la enfermedad coronaria

Tamaño: px
Comenzar la demostración a partir de la página:

Download "Los polimorfismos de los genes que codifican. en la aparición o severidad de la enfermedad coronaria"


1 Los polimorfismos de los genes que codifican para Interferon-γ e Interleucina 18 no tienen influencia en la aparición o severidad de la enfermedad coronaria Polymorphism in Interferon-gamma and Interleukin-18 genes exert no influence upon the occurrence or severity of coronary artery disease Sierra Alique, M. 1, Segura Laborda, I. 2, Gayà i Puig, A. 1, Merino Otermin, A. 2, Calvo Benito, J. 1 1 Fundació Banc de Sang i Teixits de les Illes Balears. 2 Institut Cardiològic de la Clínica Rotger. Palma de Mallorca. España. RESUMEN Introducción: La patogénesis de la aterosclerosis es compleja siendo la inflamación crónica un componente determinante. Las citocinas, mediadores clave de la respuesta inmunológica, actúan de forma muy diversa en el desarrollo del proceso aterogénico, ya sea a favor o en contra, modulando las características de la placa y su evolución clínica. Las concentraciones sanguíneas de Interleucina-18 (IL-18) e interferón gamma (IFN-γ) están relacionadas con el desarrollo, extensión y complicaciones de la enfermedad coronaria arterial (ECA). Además, la elevación de los niveles de IL-18 puede aumentar la producción de IFN-γ. Por otra parte, los factores genéticos tienen una clara influencia en el desarrollo de la enfermedad coronaria. Entre estos factores se han identificado los polimorfismos en genes de algunas citocinas (IL-1B, IL-6). Estos polimorfismos influyen en el nivel de secreción y por tanto en el tipo de respuesta inmunológica e inflamatoria, determinando la aparición y/o evolución de la enfermedad coronaria. Objetivo: Determinar si los polimorfismos genéticos de los genes que codifican para IL-18 e IFN-γ y afectan su expresión están relacionados con la ECA, ya sea de forma individual o combinada. Métodos: Se analizaron 90 donantes de Banco de Sangre y 215 pacientes sometidos a un procedimiento de cateterización, determinándose la presencia de ECA angiográfica y su extensión a 1, 2 ó 3 vasos, así como los factores de riesgo cardiológicos y la presentación clínica. Los polimorfismos genéticos IL- 18 (-137 G/C) e IFNG (repetición CA del intrón 1), fueron realizados por PCR- RFLP y PCR y análisis de fragmentos, respectivamente. Resultados: La presencia de factores de riesgo coronarios (incluyendo la proteína C reactiva elevada) resultó mayor en pacientes con ECA angiográfica. Aunque los genotipos de IL-18 GG, GC y CC, no estaban distribuidos de forma idéntica entre pacientes con (51%, 42% y 7%) y sin (56%, 39% y 5%) ECA angiográfica, las diferencias no alcanzaban la significación estadística. Tampoco existía relación con la severidad de la enfermedad o la presentación clínica. De forma similar, la distribución de alelos del gen IFNG era parecida en ambos grupos. Cuando ambos genotipos se analizaron en combinación los resultados tampoco mostraron significación estadística en relación con la ECA. Conclusiones: Los polimorfismos genéticos de IL-18 e IFNG o la combinación de sus genotipos no esta relacionada con la aparición, severidad o complicaciones clínicas de la ECA de forma estadísticamente significativa. Palabras clave: Enfermedad coronaria arterial, Interleucina 18, Interferon gamma, Polimorfismos genéticos. Los polimorfismos de los genes que codifican para Interferon-γ e Interleucina 18 no tienen influencia en la aparición o severidad de la enfermedad coronaria Sierra Alique M, Segura Laborda I, Gayà i Puig A, Merino Otermin A, Calvo Benito J Investigación Cardiovascular, 2005; 8: ABSTRACT Introduction: The pathogenesis of atherosclerosis is complex, and involves chronic inflammation as a dominant factor. Cytokines are key mediators in immune response, and intervene in very diverse ways in atherogenesis either favoring or countering atheroma plaque development, and modulating plaque characteristics and clinical evolution. The blood concentrations of interleukin-18 (IL-18) and interferon-gamma (IFN-γ) are related to the development, extent and complications of coronary artery disease (CAD). In addition, elevations in IL-18 concentration can increase IFN-γ production. On the other hand, genetic factors exert a clear influence on the development of CAD. These factors include polymorphisms in genes encoding for certain cytokines (IL-1B, IL-6). Such polymorphisms influence secretion levels and therefore the type of immune and inflammatory response elicited thus determining the occurrence and/or evolution of CAD. Aim: The present study investigates whether polymorphisms in IL-18 and IFN-γ genes which affect their expression are related to CAD either individually or combined. Methods: Ninety blood bank donors and 215 patients subjected to cardiac catheterization were analyzed, with determination of the presence of angiographic CAD and its extent (single- double- or triple-vessel disease), cardiological risk factors, and clinical presentation. The gene polymorphisms IL-18 (-137 G/C) and IFNG (repetition CA of intron 1) were assessed by PCR- RFLP and PCR and fragments analysis, respectively. Results: The presence of coronary risk factors (including elevated C-reactive protein) was found to be greater among patients with angiographic CAD. Although IL-18 genotypes GG, GC and CC were not identically distributed among patients with (51%, 42% and 7%) and without (56%, 39% and 5%) angiographic CAD, the differences were not statistically significant. Likewise, no relation to the severity of the disease or its clinical presentation was observed. In turn, IFNG gene allele distribution was similar in both groups. On jointly analyzing both genotypes, the results showed no statistically significant association to CAD. Conclusions: Gene polymorphisms of IL-18 and IFNG or the combination of their genotypes show no statistically significant association to the occurrence, severity or clinical complications of CAD. Key words: Coronary artery disease, Interleukin 18, Interferon gamma, Genetic polymorphisms. Polymorphism in Interferon-gamma and Interleukin-18 genes exert no influence upon the occurrence or severity of coronary artery disease Sierra Alique M, Segura Laborda I, Gayà i Puig A, Merino Otermin A, Calvo Benito J Investigación Cardiovascular, 2005; 8: Correspondencia / correspondence: Dr. Javier Calvo Benito Banc de Teixits Fundacio Banc de Sang i Teixits de les Illes Balears C/ Rossello i Caçador 20, Palma de Mallorca INVESTIGACIÓN CARDIOVASCULAR, 2005; vol. 8, n.º 2

2 Los polimorfismos de los genes que codifican Polymorphism in Interferon-gamma and INTRODUCCIÓN INTRODUCTION La ateroesclerosis, remodelación patológica de las arterias, es la causa principal de morbimortalidad en países desarrollados y es la base subyacente del infarto de miocardio, la angina de pecho y de la enfermedad de arterias periféricas. Se puede considerar a la aterosclerosis como un proceso crónico inflamatorio que aparece en la pared arterial (1). La patogénesis de la aterosclerosis es compleja siendo la inflamación crónica un componente determinante. En ella, las células monocito-macrofágicas intervienen en diferentes puntos cruciales de la enfermedad de las arterias coronarias (2). Los macrófagos fagocitan lípidos convirtiéndose en células espumosas ( foam cells ), participando en el depósito subendotelial de lípidos y en la formación de la placa. Además, los macrófagos son un componente del infiltrado celular en la rotura de placas que precipitan la trombosis aguda coronaria y que pueden mediar la lesión tisular en placas inestables mediante la producción de metaloproteinasas. Los monocitos circulantes, por su parte, se encuentra activados, particularmente en pacientes con síndromes agudos coronarios, si bien se desconocen los mecanismos que provocan dicha activación. Debido a que estas células activadas participan de manera directa en el proceso patológico, la identificación de las señales estimuladoras aportaría claves al conocimiento de la relación entre la inflamación y las complicaciones trombóticas de la enfermedad coronaria (3). Los monocitos pueden ser activados por diferentes estímulos, siendo su activador más potente el interferón-γ (IFN-γ). Teniendo en cuenta que las fuentes principales de IFN-γ son las células natural killer (NK) activadas y los linfocitos T, más concretamente los linfocitos Th1 (4), podría considerarse que la inflamación en la enfermedad coronaria puede ser un efecto colateral de una respuesta inmunológica establecida. La función efectora principal de las células Th1 se da en la defensa contra las infecciones, especialmente en la respuesta mediada por los fagocitos (5). Así, las células Th1 actúan como colaboradoras en el desarrollo de los linfocitos T citotóxicos, favoreciendo la inmunidad frente a gérmenes intracelulares. En la primera fase del proceso, estos gérmenes estimulan la producción de IFN-γ por las células NK. Esta produc- Atherosclerosis, the pathological remodeling of arteries, is the main source of morbidity-mortality in the industrialized world and the basis of myocardial infarction, chest pain and peripheral arterial disease. Atherosclerosis may be regarded as a chronic inflammatory process that develops in the arterial wall (1). The pathogenesis of atherosclerosis is complex, and involves chronic inflammation as a dominant factor. In this context, monocyte-macrophage cells intervene at different crucial points in coronary artery disease (CAD)(2). Macrophages phagocyte lipids and transform into foam cells, which in turn participate in the subendothelial accumulation of lipids and in the development of the atheroma plaque. In addition, macrophages form part of the cellular infiltrate in atheroma plaque rupture, which precipitates acute coronary thrombosis, and may mediate in tissue damage in unstable plaques via the production of metalloproteinases. Circulating monocytes are in turn activated, particularly in patients with acute coronary syndrome (ACS) though the mechanisms underlying such activation remain unclear. Since these activated cells directly participate in the pathological process, identification of the stimulatory signals would provide key insight to the relationship between inflammation and the thrombotic complications of CAD (3). Monocytes can be activated by different stimuli the most potent activator being interferon-gamma (IFN-γ). Taking into account that the principal sources of IFN-γ are activated natural killer (NK) cells and T lymphocytes (specifically Th1 lymphocytes)(4), inflammation in CAD could be regarded as a potential collateral effect of an established immune response. The principal effector function of Th1 cells comprises defense against infection, particularly in those responses mediated by phagocytes (5). Thus, Th1 cells act as collaborators in the development of cytotoxic T lymphocytes, favoring immunity against intracellular germs. In the first phase of the process, these germs stimulate IFN-γ production by NK cells. Such IFN-γ INVESTIGACIÓN CARDIOVASCULAR, 2005; vol. 8, n.º 2 113

3 MSierra Alique, M.1, Segura Laborda, I.2, Gayà i Puig, et al. ción de IFN-γ potencia la secreción de IL-12 por parte de los macrófagos (6). La IL-12 se une a los receptores de las células T CD4+ estimuladas por el antígeno y favorecen su diferenciación hacia células Th1, productoras de IFN-γ. Además, la IL-12 también estimula directamente la transcripción de los genes de las citocinas Th1, especialmente de IFN-γ, posiblemente a través de la activación de la proteína STAT4 (7). Las diferentes citocinas actúan de forma muy diversa en desarrollo del proceso aterogénico, ya sea a favor o en contra, modulando las características de la placa y su evolución clínica. Las citocinas pro-inflamatorias clásicas, IL-1, IL-6 y TNF-α, se encuentran implicadas en procesos pro-aterogénicos, mientras que las consideradas citocinas anti-inflamatorias, IL-4 e IL-10, activan mecanismos anti-aterogénicos (1). Por otra parte, el IFN-γ puede realizar funciones pro- y anti-aterogénicas (1, 3). Sin embargo, basándonos en la reducción de la severidad de la aterosclerosis en los ratones deficientes en receptor de IFN-γ, las funciones pro-aterogénicas deben dominar in vivo (8, 9, 10). Otras citocinas pro-aterogénicas incluyen IL-12 y IL-18, probablemente debido a la capacidad que poseen de estimular la producción de IFN-γ en diferentes tipos celulares (11, 12, 13, 14). Recientemente, se han descrito varios polimorfismos en genes de interleucinas que condicionan diferentes niveles de secreción y por consiguiente podrían favorecen diferentes tipos de respuesta inmunitaria frente a un determinado antígeno (15, 16). A partir de estos datos se ha establecido la hipótesis que factores genéticos individuales influirían en la diferenciación de células Th1 y Th2 (17). Así pues, las diferencias funcionales derivadas de la presencia de estos polimorfismos, ofrecen una excelente explicación respecto a la variabilidad observada en la susceptibilidad a padecer una determinada enfermedad y los diferentes patrones de evolución (18, 19). Por otra parte, los factores genéticos tienen una clara influencia en el desarrollo de la enfermedad coronaria tal como ha quedado establecido en estudios de concordancia de enfermedad en gemelos y estudios prospectivos de casos-controles de polimorfismos genéticos (20, 21). En consecuencia, la determinación de los polimorfismos que controlan los niveles de producción de diferentes citocinas en diferentes grupos de pacientes nos permite investigar el papel de estas moléculas inmunoreguladoras en el riesgo relativo de padecer una enfermedad production in turn enhances IL-12 secretion by the macrophages (6). IL-12 binds to the receptors of antigen-stimulated T CD4+ and favors their differentiation towards IFN-γ producing Th1 cells. In addition, IL-12 directly stimulates transcription of the Th1 cytokine genes, particularly IFN-γ, possibly through activation of the STAT4 protein (7). The different cytokines intervene in very diverse ways in atherogenesis either favoring or countering atheroma plaque development, and modulating plaque characteristics and clinical evolution. The classical proinflammatory cytokines (IL-1, IL-6 and TNF-α) are implicated in proatherogenic processes, while the purported antiinflammatory cytokines (IL-4 and IL-10) activate antiatherogenic mechanisms (1). On the other hand, IFN-γ may exert pro- and anti-atherogenic effects (1,3). However, based on the observed reduction in the severity of atherosclerosis in mice with IFN-γ receptor deficiency, the proatherogenic functions must dominate in vivo (8-10). Other proatherogenic cytokines include IL-12 and IL-18, probably due to their capacity to stimulate IFN-γ production in different cell types (11-14). There have been recent reports of various polymorphisms in interleukin genes, conditioning different levels of secretion and thus possibly favoring different types of immune response to a given antigen (15,16). On the basis of these data, it has been hypothesized that individual genetic factors influence the differentiation of Th1 and Th2 cells (17). Thus, the functional differences derived from the presence of such polymorphisms afford an excellent explanation for the observed variability in patient susceptibility towards a given disease and its different evolutive patterns (18,19). On the other hand, genetic factors exert a clear influence upon the development of CAD, as has been established by studies correlating the disease in twins, and by prospective case-control studies of gene polymorphisms (20,21). Consequently, determination of the polymorphisms that control the levels of production of different cytokines in different groups of patients allows us to explore the role of these immune regulating molecules in relation to the relative risk of suffering an inflammatory 114 INVESTIGACIÓN CARDIOVASCULAR, 2005; vol. 8, n.º 2

4 Los polimorfismos de los genes que codifican Polymorphism in Interferon-gamma and inflamatoria como es la enfermedad coronaria. A este respecto, se ha estudiado la relación entre los polimorfismos que afectan a la producción de IL-1, IL-6, IL-10 y TNF-α, y la enfermedad coronaria (22, 23). Tan sólo en el caso de IL-1 y IL- 6 se ha podido establecer una posible influencia en la aparición de a enfermedad (23). En relación al IFN-γ se ha identificado la existencia de un microsatélite polimórfico (repetición de un dinucleótido CA de longitud variable) que se halla situado en el primer intrón del gen, entre las posiciones 1349 y 1373 (24). Se han descritos seis alelos de este microsatélite en población caucasoide que difieren en el número de repeticiones CA, observándose una clara correlación entre la presencia del alelo #2 y una mayor producción de IFN-γ (25). Existe, además, un nuevo polimorfismo de un único nucleótido, descrito recientemente, que se haya situado en el extremo 5 de la región repetitiva CA y que se correlaciona con la presencia o ausencia del alelo #2 del microsatélite (26). Este punto polimórfico puede afectar la expresión del gen IFNG pues coincide con un sitio putativo de unión del factor de transcripción NF-κB. Se han llevado a cabo diversos estudios que demuestran la existencia de una asociación de alelos de este polimorfismo con diferentes enfermedades como diabetes mellitus insulino dependiente (27, 28), artritis reumatoide (29), aparición de enfermedad del injerto contra huésped en transplante de médula ósea (30) y rechazo en transplante de riñón (31). La IL-18 es una citocina pro-inflamatoria producida principalmente por macrófagos activados y al igual que la IL-12 tiene la capacidad de inducir la producción de IFN-γ (32). De hecho, IL-12 y IL-18 actúan sinergísticamente en la inducción de IFN-γ. La IL-18 también estimula la expresión del factor estimulador de colonias de granulocitos y macrófagos (GM-CSF) y del ligando de Fas y disminuye la producción de IL- 10. Sus principales dianas son los linfocitos T y células NK. Al estar incluida en el grupo de citocinas pro-inflamatorias, IL-18 podría tener un papel importante en el desarrollo de enfermedades inflamatorias, habiéndose observado aumentos de IL-18 en Enfermedad de Chron (33) y esclerosis múltiple (34). Recientemente se han descrito tres polimorfismos en la región promotora del gen que codifica para la IL-18 (35). Uno de ellos, localizado en la posición -137, presenta diferencias en la transcripción del gen según el alelo que contenga. La presencia de diferentes disorder such as CAD. In this context, studies have been made of the relationship between polymorphisms that affect the production of IL-1, IL-6, IL-10 and TNF-α, and CAD (22, 23). However, only in the case of IL-1 and IL-6 has it been possible to establish a possible influence upon the occurrence of the disease (23). As regards IFN-γ, the existence of a polymorphic microsatellite (repetition of a CA dinucleotide of variable length) has been identified, located in the first intron of the gene, between positions 1349 and 1373 (24). Six alleles of this microsatellite have been reported in Caucasians, differing in the number of CA repetitions with a clear correlation between the presence allele #2 and increased IFN-γ production (25). In addition, there have been reports of a new single-nucleotide polymorphism located at the 5 extreme of the repetitive CA region, which correlates to the presence or absence of allele #2 of the microsatellite (26). This polymorphic point may affect expression of the IFNG gene, since it coincides with a putative binding site of transcription factor NF-κB. Different studies have shown the existence of an association of alleles of this polymorphism with different diseases such as insulin-dependent diabetes mellitus (27,28), rheumatoid arthritis (29), graftversus-host disease in bone marrow transplants (30), and kidney transplant rejection (31). IL-18 is a proinflammatory cytokine mainly produced by activated macrophages, and in the same way as IL-12 it is able to induce the production of IFN-γ (32). In fact, IL-12 and IL-18 act synergistically in the induction of IFN-γ. IL-18 also stimulates the expression of granulocyte and macrophage colony-stimulating factor (GM-CSF), and of the Fas ligand, and reduces the production of IL-10. Its main targets are the T lymphocytes and NK cells. As a proinflammatory cytokine, IL-18 could play an important role in the development of inflammatory disorders; in this sense, IL-18 increments have been reported in Crohn s disease (33) and in multiple sclerosis (34). Recently, three polymorphisms have been described in the promoter region of the IL-18 gene (35). One of them, located in position -137, presents differences in transcription of the gene according to the allele it contains. INVESTIGACIÓN CARDIOVASCULAR, 2005; vol. 8, n.º 2 115

5 MSierra Alique, M.1, Segura Laborda, I.2, Gayà i Puig, et al. alelos en esta posición justificaría las diferencias observadas en los niveles de IL-18 entre diferentes individuos. En el presente proyecto de investigación nos proponemos estudiar la distribución alélica de los polimorfismos genéticos de los genes que codifican para IFN-γ e IL-18 en individuos con enfermedad coronaria comparándolas con pacientes sometidos a cateterismo cardiaco por otras patologías (enfermedad reumática valvular) y con población control sana (donantes de banco de sangre). The presence of different alleles in this position accounts for the differences observed in the levels of IL-18 among different individuals. The present research project investigates the allelic distribution of the polymorphisms in IFN-γ and IL-18 genes in individuals with CAD, comparing them with patients subjected to cardiac catheterization for other diseases (rheumatic valve disease), and with a health control population (blood bank donors). MATERIAL Y MÉTODOS MATERIAL AND METHODS Pacientes Se dividieron en dos grupos: 1. Casos: Se analizaron 215 pacientes sometidos a un procedimiento de cateterización, determinándose la presencia de ECA angiográfica y su extensión a 1, 2 ó 3 vasos, así como los factores de riesgo cardiológicos y la presentación clínica. 2. El grupo control de población sana lo formaron 90 donantes sanos voluntarios del Banco de Sangre de la Fundació Banc de Sang i Teixits de les Illes Balears. Diseño del estudio Variables comunes: Se recogieron los siguientes grupos de variables: Datos demográficos: Edad, sexo, lugar de nacimiento y de residencia. Factores de riesgo cardiovascular: tabaco, HTA, diabetes, colesterol Sintomatología clínica. Analítica general: hemograma, ionograma, glucemia, urea/creatinina, colesterol, HDL, LDL, triglicéridos, homocisteína, fibrinógeno, proteína C reactiva Sangre periférica para extracción de DNA. Patients The patients were divided into two groups: 1. Cases: 215 patients subjected to cardiac catheterization, determining the presence of angiographic CAD and its extent (singledouble- or triple-vessel disease), cardiological risk factors, and clinical presentation. 2. The control group comprised 90 healthy blood donors of the Fundació Banc de Sang i Teixits de les Illes Balears (Spain). Study design The following variables were recorded: Demographic data: Age, sex, place of birth and residency. Cardiovascular risk factors: smoking, arterial hypertension, diabetes, elevated blood cholesterol. Clinical symptoms General laboratory parameters: complete blood count, ionogram, blood glucose, urea/creatinine, cholesterol, HDL, LDL, triglycerides, homocysteine, fibrinogen, C-reactive protein. Peripheral blood collection for DNA extraction. Pruebas de biología molecular El ADN genómico se obtuvo a partir de sangre periférica utilizando kits comerciales. Las muestras de ADN fueron alicuotadas a una con- Molecular biology tests Genomic DNA was obtained from peripheral blood using commercial kits. The DNA samples were divided into aliquots at a 116 INVESTIGACIÓN CARDIOVASCULAR, 2005; vol. 8, n.º 2

6 Los polimorfismos de los genes que codifican Polymorphism in Interferon-gamma and centración de 50 ng/µl y se almacenaron congeladas a -80ºC hasta su utilización. Determinación del polimorfismo del microsatélite situado en el primer intrón del gen del IFN-γ: El análisis se realizó como ha sido descrito previamente (36). 100 ng de ADN genómico se amplificaron mediante la técnica de la reacción en cadena de la polimerasa (PCR) utilizando los oligonucleótidos, IFNg-Fw: 5 - Cy5-AATTGATTTTATTCTTAC -3 y IFNg-Rv: 5 - CCTTCCTGTAGGGTATTATT -3 que flanquean una región de 116 pares de bases del gen IFNG conteniendo la repetición del dinucleótido CA. El primer 5 está marcado con el fluorescente Cy5 en el extremo 5. Ocho µl de la reacción de PCR se sometieron a electroforesis en gel de secuencia de poliacrilamida al 6% (Figura 1). Los resultados se analizaron utilizando el secuenciador automático ALFXpress y el software Fragment Analyzer (Amersham Biosciences). concentration of 50 ng/?l and were frozen at - 80ºC until use. Determination of polymorphism of the microsatellite located in the first intron of the IFN-γ gene: The analysis was carried out as described elsewhere (36). One hundred nanograms of genomic DNA were amplified by the polymerase chain reaction (PCR) technique using the oligonucleotides IFNg-Fw: 5 - Cy5-AATTGATTTTATTCTTAC -3 and IFNg- Rv: 5 - CCTTCCTGTAGGGTATTATT -3 which flank a region of 116 base pairs of the IFNG gene containing the repetition of the CA dinucleotide. The 5 primer is Cy5 fluorescent marked at the 5 extreme. Eight _l of the PCR reaction were subjected to 6% polyacrylamide sequence gel electrophoresis (Figure 1). The results were analyzed using the ALFXpress automatic sequencer and Fragment Analyzer software (Amersham Biosciences). Figura 1. Determinación del polimorfismo del gen IFNG: A) Imagen de la electroforesis en gel de acrilamida de productos de amplificación del gen IFNG en formato curva. En el primer carril figuran dos picos del estándar de pesos moleculares correspondientes a 100 y 150 bp. El resto de carriles corresponden a muestras del estudio donde cada pico corresponde a un alelo. Los individuos tienen dos alelos o uno en caso de ser homocigotos. B) Imagen en gel de las mismas muestras que la imagen anterior donde se ven bandas correspondientes a los alelos amplificados. Standard 26 G G GCDG 29 G G G G G G G LGV 39 H Bases Figure 1. Determination of IFNG gene polymorphism: A) Acrylamide gel electrophoresis of amplification products of the IFNG gene in curve format. The first lane presents two peaks of the standard, of molecular weights 100 and 150 bp. The remaining lanes represent study samples where each peak corresponds to an allele. Individuals present two alleles, versus one in the case of homozygous subjects. B) Gel electrophoresis of the same samples as before, showing the bands corresponding to the amplified alleles. INVESTIGACIÓN CARDIOVASCULAR, 2005; vol. 8, n.º 2 117

7 MSierra Alique, M.1, Segura Laborda, I.2, Gayà i Puig, et al. Análisis del polimorfismo -137 G/C en la región promotora del gen de IL-18: Se realizó como ha sido descrito con anterioridad (35). Brevemente, consiste en una PCR con oligonucleótido específico de secuencia (PCR-SSP), utilizando un primer antisense común IL-18 RV: 5 - AGGAGGGCAAAATGCACTGG-3 y dos primers sense específicos de secuencia, IL18 FwG: 5 -CCCCAACTTTTACGGAAGAAAAG-3 y IL18 FwC: 5 - CCCCAACTTTTACGGAAGAAAAC-3. Se obtuvo un producto amplificado de 261 pares de bases. Las amplificaciones por PCR se realizaron en un termociclador GeneAmp PCR system 9600 (Perkin Elmer). Los productos de PCR fueron directamente analizados por electroforesis en geles de agarosa al 2% teñidos con bromuro de etidio (10 ng/ml) (Figura 2). Analysis of polymorphism -137 G/C in the promoter region of the IL-18 gene: This was carried out as previously described (35). Briefly, the procedure involves sequence specific oligonucleotide PCR (PCR-SSP), using a common antisense primer, IL-18 RV: 5 - AGGAGGGCAAAATGCACTGG-3 and two sequence specific sense primers, IL-18 FwG: 5 -CCCCAACTTTTACGGAAGAAAAG-3 and IL- 18 FwC: 5 - CCCCAACTTTTACGGAAGAAAAC- 3. A 261 base pair amplified product was obtained. The PCR amplifications were carried out using a GeneAmp PCR system 9600 thermocycler (Perkin Elmer). The PCR products were directly analyzed by 2% agarose gel electrophoresis stained with ethidium bromide (10 ng/ml) (Figure 2). Figura 2. Determinación del polimorfismo -137 G/C del promotor del gen de IL-18: En la parte superior de la figura se muestra un esquema de la técnica empleada. Las flechas representas oligonucleótidos. En la parte inferior se muestra una imagen de un gel de agarosa al 2% donde se aprecian los resultados correspondientes a 5 muestras diferentes. El primer carril (St) corresponde a un marcador de pesos moleculares donde cada banda se diferencia de la anterior en 100 bp. La banda de más intensidad corresponde a 600 bp. Cada dos carriles del resto de la imagen corresponden a una muestra diferente. El primer carril de cada pareja corresponde al alelo -137 G y el segundo al alelo -137 C. El tamaño de la banda de amplificación es de 261 bp. Si aparece amplificación en el primer carril y no en el segundo la muestra se considera homocigoto para el alelo -137G, por el contrario si aparece sólo en el segundo se considera homocigoto -137C y si aparece en los dos se considera heterocigoto G/C. Así, la muestra 1 sería homocigoto para el alelo -137C, las muestras 2, 3 y 4 serían homocigotos para el alelo -137G y la muestra 5 sería heterocigoto G/C. I L-18 PROMOTER -137 G/C 5 3 G IL18-G Fw IL18-C Fw C I L18 Rv 261 bp S GCGCGCGCGC 261 Figure 2. Determination of polymorphism -137 G/C in the IL-18 gene promoter. A schematic representation of the technique employed is show at the top of the figure. The arrows represent oligonucleotides. The bottom of the figure corresponds to 2% agarose gel electrophoresis, showing the results corresponding to 5 different samples. The first lane (St) corresponds to a molecular weights marker where each band differs from the preceding band by 100 bp. The maximum intensity band corresponds to 600 bp. Every two lanes of the rest of the gel correspond to a different sample. The first lane of each pair corresponds to allele -137 G, and the second to allele -137 C. The amplification band size is 261 bp. Amplification in the first lane but not in the second is considered to define homozygous status for allele -137G, while amplification only in the second lane is considered to represent homozygosis for -137C. Amplification in both lanes is indicative of heterozygosis G/C. Accordingly, sample 1 would be homozygous for allele -137C, samples 2, 3 and 4 would be homozygous for allele -137G, and sample 5 would be heterozygous G/C. 118 INVESTIGACIÓN CARDIOVASCULAR, 2005; vol. 8, n.º 2

8 Los polimorfismos de los genes que codifican Polymorphism in Interferon-gamma and Pacientes RESULTADOS Fueron incluidos en el estudio 215 pacientes consecutivos sometidos a un procedimiento de cateterización. De ellos 38 (19.5%) no presentaban enfermedad coronaria arterial (ECA), 22 (11.3%) presentaban ECA no obstructiva y 135 (69.2%) ECA obstructiva. En cuanto a la presentación clínica, 23 (11.67%) tenían cardiopatía no isquémica, 22 (11.16%) isquemia silente, 56 (29%) angina estable, 58 (30%) síndromes coronarios agudos sin elevación del segmento ST (SCASEST), 28 (14.5%) infarto agudo de miocardio y 6 (3.5%) insuficiencia cardiaca congestiva. El rango de edad era de 34 a 91 años, 135 (69%) eran varones y 61 (31%) mujeres. Patients RESULTS The study included 215 consecutive patients subjected to cardiac catheterization. Of these, 38 (19.5%) did not present coronary artery disease (CAD), 22 (11.3%) presented nonobstructive CAD, and 135 (69.2%) obstructive CAD. As regards the clinical presentation, 23 (11.67%) had non-ischemic heart disease, 22 (11.16%) silent ischemia, 56 (29%) stable angina, 58 (30%) acute coronary syndrome (ACS) without ST-segment elevation (ACSWSTE), 28 (14.5%) acute myocardial infarction, and 6 (3.5%) congestive heart failure. The age range was years; there were 135 (69%) males and 61 (31%) females. Análisis del microsatélite del primer intrón del gen IFNG El interferón gamma (IFN-γ) es un homodímero de 34 kd secretado por los linfocitos T, natural killer (4) y por células presentadoras de antígeno (APCs) (6). Promueve la diferenciación de células B y células T, induciendo la progresión de células T CD4 Th0 al fenotipo Th1, la maduración de células T CD8 y el cambio de clase de inmunoglobulina en células B. Está codificado por un único gen localizado en humanos en el cromosoma 12q24.1. El gen está formado por cuatro exones y tres intrones. Entre las posiciones 1349 y 1373 de primer intrón del gen ha sido descrito un polimorfismo tipo microsatélite con seis alelos diferentes en población caucásicas que difieren en el número de repeticiones CA (24). De ellos, el alelo #2, con 11 repeticiones CA, es el que se asocia con el mayor nivel de producción de IFN-γ (25). Recientemente se ha descrito un nuevo polimorfismo de nucleótido único presente en el extremo 5 del microsatélite que se correlaciona con la presencia o ausencia del alelo #2 (26). Este polimorfismo afectaría a expresión del gen IFNG pues coincide con un sitio potencial de unión del factor de transcripción NF-κB (26). En la Tabla I se muestra la distribución alélica del microsatélite IFNG (CA) n en nuestra población. No existían diferencias significativas en la distribución alélica entre nuestra población control sana y la de otras poblaciones caucasoides Analysis of the microsatellite of the first intron of the IFNG gene Interferon-gamma (IFN-γ) is a 34-kDa homodimer secreted by T lymphocytes, NK cells (4) and antigen presenting cells (APCs)(6). It promotes B and T cell differentiation, inducing the progression of CD4+ Th0 cells to the Th1 phenotype, the maturation of CD8+ T cells, and immunoglobulin class change in B cells. IFN-γ is encoded for by a single gene located in chromosome 12q24.1 in humans. The gene is composed of four exons and three introns. Between positions 1349 and 1373 of the first intron of the gene, microsatellite-type polymorphism has been described, with 6 different alleles in Caucasians that differ in the number of CA repetitions (24). Of these, allele #2, with 11 CA repetitions, is the allele associated with the greatest level of IFN-γ production (25). Recently, a new singlenucleotide polymorphism has been reported, located in the 5 extreme of the microsatellite, that correlates to the presence or absence of allele #2 (26). This polymorphism would affect expression of the IFNG gene, since it coincides with a potential binding site for transcription factor NF-κB (26). Table I shows the allelic distribution of the microsatellite IFNG (CA) n in our population. There were no significant differences in the allelic distribution between our healthy controls and other Caucasian populations INVESTIGACIÓN CARDIOVASCULAR, 2005; vol. 8, n.º 2 119

9 MSierra Alique, M.1, Segura Laborda, I.2, Gayà i Puig, et al. de Manchester (UK) (37) o Canadá (29). Como otros estudios realizados en población caucasoide, no encontramos ningún individuo con alelo 1, aunque sí encontramos una muestra con un alelo 6, siendo ambos alelos muy poco frecuentes. Los alelos #2 y #3, y el genotipo 2/3 fueron los más frecuentes, aunque las diferencias entre grupos no fueron estadísticamente significativas. En la tabla I mostramos las frecuencias alélicas, separando las muestras de pacientes cardiológicos según la presencia de enfermedad coronaria arterial (ECA) en tres grupos, 1) no ECA por coronariografía, 2) ECA obstructiva, y 3) ECA no obstructiva. Las diferencias en las frecuencias alélicas no fueron estadísticamente significativas pero mostraban una tendencia a una menor frecuencia del alelo alto productor en pacientes con ECA. from Manchester (UK) (37) or Canada (29). In the same way as other studies involving Caucasians, we observed no individual with allele #1, though one sample presenting allele #6 was identified. Both alleles are very infrequent. Alleles #2 and #3, and genotype 2/3 were the most frequent findings, though the intergroup differences were not statistically significant. Table I shows the allele frequencies, dividing the cardiological patients according to the presence of CAD into three subgroups: 1) no CAD as evidenced by coronariography, 2) obstructive CAD, and 3) non-obstructive CAD. The differences in allelic frequencies were not statistically significant, though the highproduction allele tended to be less common in patients with CAD. TABLA I. Distribución y frecuencia alélica del polimorfismo de microsatélite del primer intrón del gen IFNG. TABLE I. Distribution and allelic frequency of the microsatellite polymorphism of the first intron of the IFNG gene. Controles B Sangre NO ECA ECA obstructiva ECA no obstr Controls No CAD Obstructive CAD Non-obstructive CAD Alelos/ Alleles n % n % n % n % 1 0 0,00% 0 0,00% 0 0,00% 0 0,00% ,56% 40 54,05% ,56% 21 47,73% ,82% 28 37,84% ,81% 16 36,36% 4 8 4,49% 4 5,41% 13 4,81% 3 6,82% 5 2 1,12% 2 2,70% 13 4,81% 3 6,82% 6 0 0,00% 0 0,00% 0 0,00% 1 2,27% Total= % % % % Genotipos/ Genotypes n % n % n % n % 1/2 0 0,00% 0 0,00% 0 0,00% 0 0,00% 2/ ,60% 9 23,68% 28 20,74% 4 18,18% 2/ ,31% 17 44,74% 59 43,70% 9 40,91% 2/4 3 3,37% 3 7,89% 3 2,22% 2 9,09% 2/5 2 2,25% 2 5,26% 5 3,70% 1 4,55% 2/6 0 0,00% 0 0,00% 0 0,00% 1 4,55% 3/ ,98% 5 13,16% 23 17,04% 2 9,09% 3/4 3 3,37% 1 2,63% 9 6,67% 1 4,55% 3/5 0 0,00% 0 0,00% 7 5,19% 2 9,09% 4/4 1 1,12% 0 0,00% 0 0,00% 0 0,00% 4/5 0 0,00% 1 2,63% 1 0,74% 0 0,00% Total= % % % % 120 INVESTIGACIÓN CARDIOVASCULAR, 2005; vol. 8, n.º 2

10 Los polimorfismos de los genes que codifican Polymorphism in Interferon-gamma and Análisis de la distribución alélica del polimorfismo -137 G/C del gen IL-18 La interleucina-18 (IL-18) es una potente citocina pro-inflamatoria con potenciales propiedades pro-aterogénicas cuyo papel último en la aterosclerosis no es bien conocido todavía (38). Está producida mayoritariamente por monocitos/macrófagos y tiene una potente actividad sobre macrófagos y células T, dos tipos celulares involucrados en el desarrollo y en las complicaciones de las placas de ateroma. La IL-18 muestra el sinergismo más potente con la IL-12 en la inducción de IFN-γ. Estas últimas citocinas se expresan en la placa de ateroma y han sido implicadas en la respuesta inmunoinflamatoria que determina tanto el tamaño como la composición de la lesión aterosclerótica en modelos animales (1). Se han descrito aumentos de la IL- 18 sérica como factor predictor de complicaciones cardiovasculares (39) y un aumento de la expresión de IL-18 y del ARN mensajero de IL-18 en lesiones ateroscleróticas (38, 40). Simultáneamente se describió un polimorfismo genético en la región promotora del gen que codifica para IL-18 que tiene influencia en la expresión del gen (35). Por todo lo anterior decidimos estudiar la influencia del polimorfismo -137 G/C del gen IL-18 en la aparición o severidad de la enfermedad coronaria. Como se muestra en la Tabla II no había diferencias significativas en la Analysis of the allelic distribution of polymorphism -137 G/C of the IL-18 gene Interleukin-18 (IL-18) is a potent proinflammatory cytokine with potential proatherogenic properties though its ultimate role in atherosclerosis remains uncertain (38). IL-18 is mainly produced by monocytes/macrophages, and exerts a potent effect upon macrophages and T cells both of which are implicated in the development and complications of atheroma plaques. In turn, IL- 18 and IL-12 act synergistically in the induction of IFN-γ. These latter cytokines are both expressed in the atheroma plaque and have been implicated in the immuneinflammatory response that determines both the size and composition of atherosclerotic lesions in animals models (1). Increases in serum IL-18 have been described as being predictive of cardiovascular complications (38), and increased IL-18 and IL-18 messenger RNA expression has been documented in atherosclerotic lesions (38,40). At the same time, gene polymorphism has been reported in the promoter region of the IL-18 gene, exerting an influence upon expression of the gene (35). Based on the above considerations, we decided to study the influence of polymorphism -137 G/C of the IL-18 gene upon the occurrence or severity of CAD. As can be TABLA II. Distribución y frecuencia alélica del polimorfismo -137 G/C del gen IL-18. ECA: enfermedad coronaria arterial. TABLE II. Distribution and allelic frequency of polymorphism -137 G/C of the IL-18 gene. CAD: coronary artery disease. Controles B Sangre NO ECA ECA obstructiva ECA no obstr Controls No CAD Obstructive CAD Non-obstructive CAD Alelos/ Alleles n % n % n % n % -137 G ,61% 57 75,00% ,09% 32 72,73% -137 C 57 32,39% 19 25,00% 72 27,91% 12 27,27% Total= ,00% ,00% ,00% ,00% Genotipos/ Genotypes n % n % n % n % -137 G/G 43 48,86% 21 55,26% 66 51,16% 13 59,09% -137 G/C 33 37,50% 15 39,47% 54 41,86% 6 27,27% -137 C/C 12 13,64% 2 5,26% 9 6,98% 3 13,64% Total= % % % % INVESTIGACIÓN CARDIOVASCULAR, 2005; vol. 8, n.º 2 121

11 MSierra Alique, M.1, Segura Laborda, I.2, Gayà i Puig, et al. distribución de los alelos entre los diferentes grupos estudiados, controles sanos de donantes de sangre, pacientes cateterizados sin ECA, pacientes con ECA obstructiva y pacientes con ECA no obstructiva. Entre los donantes de banco de sangre, que se podría considerar la población general de referencia y los diferentes pacientes con ECA o sin ella, existen diferencias, con una mayor frecuencia del alelo -137 G asociado a una mayor producción de IL-18 entre los pacientes sometidos a cateterismo pero esas diferencias no alcanzaban la significación estadística. El análisis estadístico combinando de las frecuencias de ambos genotipos (IL-18 e IFNG) en los diferentes grupos tampoco mostró diferencias estadísticamente significativas. CONCLUSIONES La IL-18 actúa como un importante regulador tanto de la respuesta inmune innata como de la adquirida. Existen importantes datos experimentales que apoyan la hipótesis de una nueva vía de señalización en la aterosclerosis y en la vulnerabilidad de la placa que implica la asociación de IL-18 y su ligando. La IL-18 ha sido identificada en lesiones ateroscleróticas humanas con niveles significativamente más elevados de ARN mensajero en placas inestables (38, 40). También se ha descrito que los niveles séricos de IL-18 podrían servir de marcadores de evolución en la enfermedad coronaria (39). Además, la estimulación in vitro de receptores de IL-18 en células endoteliales o en células de músculo liso, activa procesos asociados a ateroma como la estimulación de IL-6 o IL-8 y la expresión de moléculas de adhesión y metaloproteinasas de la matriz (11). La administración de IL-18 conlleva un aumento en el tamaño de la lesión y promueve una elevación en el número de linfocitos T asociados a la lesión en modelos animales. Ambos efectos fueron eliminados en ratones deficientes en IFN-γ, sugiriendo la importancia de la vía mediada por interferón (14). El IFN-γ influye de forma significativa en el contenido de colágeno de las placas de ateroma, en parte a través de la inhibición de la síntesis de colágeno por las células de músculo liso. Por ello, se cree que el IFN-γ participa en la desestabilización de la placa evitando la formación de un tope fibroso grueso (38, 40). seen in Table II, there were no significant differences in allelic distribution among the different groups studied: health controls (blood donors), catheterized patients without CAD, patients with obstructive CAD, and patients with non-obstructive CAD. Differences were observed between the blood donors, which may be regarded as the reference general population, and the different patients with or without CAD with a greater frequency of the allele -137 G associated to a greater production of IL-18 among the patients subjected to catheterization. These differences did not reach statistical significance, however. The combined statistical analysis of the frequencies of both genotypes (IL-18 and IFNG) in the different groups likewise showed no statistically significant differences. CONCLUSIONS IL-18 is an important regulator of both innate and acquired immune response. There is important experimental evidence pointing to a new signaling pathway in atherosclerosis and in atheroma plaque vulnerability involving the association of IL-18 and its ligand. IL-18 has been identified in human atherosclerotic lesions with significantly higher levels of encoding messenger RNA in unstable plaques (38,40). It has also been suggested that serum IL-18 levels may serve as markers for the evolution of coronary artery disease (39). Furthermore, the in vitro stimulation of IL- 18 receptors in endothelial or smooth muscle cells activates atheroma-associated processes such as the stimulation of IL-6 or IL-8, and the expression of adhesion molecules and metalloproteinases at matrix level (11). The administration of IL-18 produces an increase in lesion size and promotes a rise in the number of T lymphocytes associated to the lesion in animal models. Both effects were eliminated in mice with IFN-γ deficiency thus supporting the importance of the interferon-mediated pathway (14). IFN-γ significantly influences the collagen content of the atheroma plaque, in part via the inhibition of collagen synthesis by the smooth muscle cells. It is therefore believed that IFN-γ participates in plaque destabilization, preventing the formation of a thick fibrous covering (38,40). 122 INVESTIGACIÓN CARDIOVASCULAR, 2005; vol. 8, n.º 2

12 Los polimorfismos de los genes que codifican Polymorphism in Interferon-gamma and Debido a todo lo expuesto hasta ahora, y a la influencia de factores genéticos no descubiertos hasta ahora en la enfermedad coronaria y a la existencia de polimorfismos en los genes que codifican para las dos interleucinas antes citadas y que afectan a la expresión de sus genes, nos parecía que el análisis de la distribución alélica de esos polimorfismos en poblaciones de enfermos afectados de ECA era indispensable. Nuestro estudio revela que, al menos en nuestra población, no hay diferencias significativas en la distribución de los diferentes alelos en diferentes grupos de pacientes y controles. El análisis combinado de ambos polimorfismos tampoco demostró diferencias significativas. En conclusión, los polimorfismos genéticos de IL-18 e IFNG o la combinación de sus genotipos no esta relacionada con la aparición, severidad o complicaciones clínicas de la ECA de forma estadísticamente significativa. In view of all the above considerations, and considering the influence of genetic factors not identified to date in coronary artery disease and the existence of polymorphisms in the genes encoding for the two aforementioned interleukins, which affect expression of the encoding genes, we considered it essential to analyze the allelic distribution of these polymorphisms in patients with CAD. The findings of the present study show that, at least in our population, no significant differences are seen in the distribution of the different alleles in different groups of patients and controls. The combined analysis of both polymorphisms likewise revealed no significant differences. In conclusion, the polymorphisms in IL-18 and IFNG genes, or the combination of their genotypes, are not related in any statistically significant way to the occurrence, severity or clinical complications of coronary artery disease. BIBLIOGRAFÍA/REFERENCES 1. Young JL, Libby P, Scjhönbeck U. Cytokines in the Pathogenesis of Atherosclerosis. Thromb Haemost : Lucas AD, and Greaves DR. Atherosclerosis: Role of chemokines and macrophages. Expeert Reviews in Molecular Genetics Liuzzo G, Vallejo AN, Kopecky SL, Frye RL, Holmes DR, Goronzy JJ, Weyand CM. Molecular fingerprint of interferon-gamma signaling in unstable angina. Circulation 2001 Mar 20;103(11): Boehm U., Klamp T., Groot M. and Howard J.C. Cellular responses to interferon-gamma. Annu Rev Immunol : Jankovic D., Liu Z. and Gause W. Th1- and Th2-cell commitment during infectious disease: asymmetry in divergent pathways. Trends Immunol : Frucht D.M., Fukao T., Bogdan C., Schnler H., O Shea J.J. and Koyasu S. IFN-gamma production by antigen-presenting cells: mechanisms emerge. Trends Immunol : Kourilsky P. and Truffa-Bachi P. Cytokine fields and the polarization of the immune response. Trends Immunol : Gupta S, Pablo AM, Jiang X, Wang N, Tall AR, Schnler C. IFN-gamma potentiates atherosclerosis in ApoE knock-out mice. J Clin Invest 1997 Jun 1;99(11): Nagano H, Mitchell RN, Taylor MK, Hasegawa S, Tilney NL, Libby P. Interferon-gamma deficiency prevents coronary arteriosclerosis but not myocardial rejection in transplanted mouse hearts. J Clin Invest 1997 Aug 1;100(3): Tellides G, Tereb DA, Kirkiles-Smith NC, Kim RW, Wilson JH, Schechner JS, Lorber MI, Pober JS. Interferon-gamma elicits arteriosclerosis in the absence of leukocytes. Nature 2000 Jan 13; 403(6766): Gerdes N, Sukhova GK, Libby P, Reynolds RS, Young JL, Schonbeck U. Expression of interleukin (IL)-18 and functional IL-18 receptor on human vascular endothelial cells, smooth muscle cells, and macrophages: implications for atherogenesis. J Exp Med 2002 Jan 21;195(2): Mallat Z, Henry P, Fressonnet R, Alouani S, Scoazec A, Beaufils P, Chvatchko Y, Tedgui A. Increased plasma concentrations of interleukin-18 in acute coronary syndromes. Heart Nov;88(5): Wang H, DeVries ME, Deng S, Khandaker MH, Pickering JG, Chow LH, Garcia B, Kelvin DJ, Zhong R. The axis of interleukin 12 and gamma interferon regulates acute vascular xenogeneic rejection. Nat Med 2000 May;6(5): Whitman SC, Ravisankar P, Daugherty A. Interleukin-18 enhances atherosclerosis in apolipoprotein E(-/-) mice through release of interferon-gamma. Circ Res 2002 Feb 8;90(2):E Bidwell J., Keen L., Gallagher G., Kimberly R., Huizinga T., McDermott M.F., Cytokine gene polymorphism in human disease: on-line databases. Genes Immun : Bidwell J., Keen L., Gallagher G., Kimberly R., Huizinga T., McDermott M.F., Cytokine gene polymor- INVESTIGACIÓN CARDIOVASCULAR, 2005; vol. 8, n.º 2 123

13 MSierra Alique, M.1, Segura Laborda, I.2, Gayà i Puig, et al. phism in human disease: on-line databases, supplement 1. Genes Immun : Bunnapradist S. and Jordan S.C. The role of cytokines and cytokine gene polymorphism in T-cell activation and allograft rejection. Ann Acad Med Singapore : Akalin E. and Murphy B. Gene polymorphisms and transplantation. Curr Opin Immunol : van Deventer S. Cytokine and cytokine receptor polymorphisms in infectious disease. Intensive Care Med Suppl 1: S Marenberg ME, Risch N, Berkman LF, Floderus B, de Faire U. Genetic susceptibility to death from coronary heart disease in a study of twins. N Engl J Med : Lane DA, Grat PJ. Role of hemostatic gene polymorphisms in venous and arterial thrombotic disease. Blood : Allen RA, Lee EM, Roberts DH, Park BK, and Pirmohamed M. Polymorphisms in the TNF-α and TNF-receptor genes in patients with coronary artery disease. Eur J Clin Invest : Shields DC, Fitzgerald AP, O Neill PA, Muckian C, Kenny D, Moran B, Cannon CP, Byrne CE, Fitzgerald DJ. The contribution of genetic factors to thrombotic and bleeding outcomes in coronary patients randomised to Iib/IIIa antagonist. The Pharmacogenomics Journal : Ruiz-Linares A. Dinucleotide repeat polymorphism in the interferon-gamma (IFNG) gene. Hum Mol Genet : Pravica V., Asderakis A., Perrey C., Hajeer A., Sinnott P.J. and Hutchinson I.V. In vitro production of IFNgamma correlates with CA repeat polymorphism in the human IFN-gamma gene. Eur J Immunogenet : Pravica V., Perrey C., Stevens A., Lee J.H. and Hutchinson I.V. A single nucleotide polymorphism in the first intron of the human IFN-gamma gene: absolute correlation with a polymorphic CA microsatellite marker of high IFN-gamma production. Hum Immunol : Awata T., Matsumoto C., Urakami T., Hagura R., Amemiya S. and Kanazawa Y. Association of polymorphism in the interferon gamma gene with IDDM. Diabetologia : Jahromi M., Millward A. and Demaine A. A CA repeat polymorphism of the IFN-gamma gene is associated with susceptibility to type 1 diabetes. J Interferon Cytokine Res : Khani_Hanjani A., Lacaille D., Hoar D., Chalmers A., Horsman D., Anderson M., Association between dinucleotide repeat in non-coding region of interferon-gamma gene and susceptibility to, and severity of, rheumatoid arthritis. Lancet : Cavet J., Dickinson A.M., Norden J., Taylor P.R., Jackson G.H. and Middleton P.G. Interferon-gamma and interleukin-6 gene polymorphisms associate with graft-versus-host disease in HLA-matched sibling bone marrow transplantation. Blood : Asderakis A., Sankaran D., Dyer P., Johnson R.W., Pravica V., Sinnott P.J., Association of polymorphisms in the human interferon-gamma and interleukin-10 gene with acute and chronic kidney transplant outcome: the cytokine effect on transplantation. Transplantation : García VE, Uyemura K, Sieling PA, Ochoa MT, Morita CT, Okamura H, Kurimoto M, Rea TH, Modlin RL. IL-18 promotes type 1 cytokine production from NK cells and T cells in human intracellular infection. J Immunol : Monteleone G,Trapasso F, Parello T, Biancone L, Stella A, Iuliano R, Luzza F, Fusco A, Pallone F. Bioactive IL-18 expression is up-regulated in Chron s disease. J Immunol : Balashov KE, Rottman JB, Weiner HL, Hancock WW. CCR5 (+) and CXCR3 (+) T cells are increased in multiple sclerosis and teir ligands MIP-1alpha and IP-10 are expressed in demyelinating brain lesions. Proc Natl Acad Sci USA : Giedraitis V, He B, Huang WX, Hillert J. Cloning and mutation analysis of the human IL-18 promoter: a possible role of polymorphisms in expression regulation. J Neuroimmunol 2001 Jan 1;112(1-2): Calvo J, Martínez N, Etxagibel A, Calleja S, Sáez-Torres C, Sedeño M, Julià R, Muncunill J, Matamoros N, Gayà A. Allelic frequencies of polymorphic variants of cytokine genes (IL-1A, IL-1B, IL-1RN, IL-6, IL- 10, IL-12P40, and IFNG) in a spanish population. Inmunología (2): Perrey C, Pravica V, Sinnott PJ, Hutchinson IV. Genotyping for polymorphism in interferon-gamma,interleukin-10, transforming growth factor-beta 1 and tumot necrosis factor-alpha genes: a technical report. Transpl Immunol : Mallat Z, Corbaz A, Scoazec A, Graber P, Alouani S, Esposito B, Humbert Y, Chvatchko Y, Tedgui A. Interleukin-18/interleukin-18 binding protein signaling modulates atherosclerotic lesion development and stability. Circ Res 2001 Sep 28;89(7):E Blankenberg S, Tiret L, Bickel C, Peetz D, Cambien F, Meyer J, Rupprecht HJ; AtheroGene Investigators. Interleukin-18 is a strong predictor of cardiovascular death in stable and unstable angina. Circulation Jul 2;106(1): Mallat Z, Corbaz A, Scoazec A, Besnard S, Leseche G, Chvatchko Y, Tedgui A. Expression of interleukin-18 in human atherosclerotic plaques and relation to plaque instability. Circulation 2001 Oct 2;104(14): INVESTIGACIÓN CARDIOVASCULAR, 2005; vol. 8, n.º 2

Análisis de la coestimulación vía CD28 en células linfoides de pacientes infectados. con el virus de la Hepatitis C RESUMEN

Análisis de la coestimulación vía CD28 en células linfoides de pacientes infectados. con el virus de la Hepatitis C RESUMEN Análisis de la coestimulación vía CD28 en células linfoides de pacientes infectados con el virus de la Hepatitis C RESUMEN La infección por el virus de la hepatitis C (VHC) afecta a más de 170 millones

Más detalles



Más detalles



Más detalles

Linfocitos T con receptores antigénicos quiméricos en la inmunoterapia del cáncer: el amanecer de una nueva era?

Linfocitos T con receptores antigénicos quiméricos en la inmunoterapia del cáncer: el amanecer de una nueva era? Linfocitos T con receptores antigénicos quiméricos en la inmunoterapia del cáncer: el amanecer de una nueva era? Dr. Miguel Lozano Molero Jefe de Sección de Hemoterapia Servicio de Hemoterapia y Hemostasia

Más detalles

Inmunología de la aterosclerosis

Inmunología de la aterosclerosis UNIVERSIDAD DE CONCEPCIÓN DEPTO. DE ESPECIALIDADES MEDICAS FACULTAD DE MEDICINA Inmunología de la aterosclerosis Expositor : Efraín Mora Aguayo INTRODUCCION Tradicionalmente, esta era entendida como un

Más detalles

Simposio Sindrome Metabólico. Metabólico

Simposio Sindrome Metabólico. Metabólico 2ºCurso Internacional Factores de Riesgo de Enfermedad Cardiovascular 3ª Jornadas Regionales de Cardiología Simposio Sindrome Metabólico Dislipidemia y Sindrome Metabólico T.M. MSc Elba Leiva M Prof Asistente

Más detalles

* Residente de Postgrado de Medicina Interna. Decanato de Medicina. UCLA. **Médico Internista. Profesor titular del Decanato de Medicina. UCLA.

* Residente de Postgrado de Medicina Interna. Decanato de Medicina. UCLA. **Médico Internista. Profesor titular del Decanato de Medicina. UCLA. EVOLUCION DE LA DIABETES MELLITUS TIPO I Y II Y REPERCUSIONES SISTEMICAS SEGUN CUMPLIMIENTO DEL TRATAMIENTO * Carlos Ernesto Medina Santander ** Kepler Orellana PALABRAS CLAVES: Diabetes Mellitus. Tratamiento.

Más detalles


TEMA 3. ESTRUCTURA Y EVOLUCIÓN DEL GENOMA EUCARIOTA TEMA 3. ESTRUCTURA Y EVOLUCIÓN DEL GENOMA EUCARIOTA Genes y genomas. Estructura del genoma eucariota. Genómica comparada. Evolución del tamaño, del número y de la complejidad de los genes. Origen y evolución

Más detalles



Más detalles


BIBLIOGRAFÍA COMENTADA BIBLIOGRAFÍA COMENTADA GUT HCV substitutions and IL-28B polymorphisms on outcome of peg-interferon plus ribavirin combination therapy Efecto de las variantes del VHC y los polimorfismos del gen IL-28B

Más detalles

Regeneración in vitro

Regeneración in vitro Regeneración in vitro A. K. Neelakandan K. Wang (2012) Recent progress in the understanding of @ssue culture- induced genome level changes in plants and poten@al applica@ons.plant Cell Rep 31:597 620 Variación

Más detalles

Influencia de las dislipemias y de su tratamiento sobre el metabolismo de la glucosa, la función renal y miocárdica

Influencia de las dislipemias y de su tratamiento sobre el metabolismo de la glucosa, la función renal y miocárdica Influencia de las dislipemias y de su tratamiento sobre el metabolismo de la glucosa, la función renal y miocárdica Dr. Carlos Guijarro Unidad de Medicina Interna Universidad Rey Juan Carlos Dislipemias,

Más detalles

Los ensayos que se van a desarrollar son los siguientes:

Los ensayos que se van a desarrollar son los siguientes: I Resumen El objetivo principal del proyecto es desarrollar un software que permita analizar unos datos correspondientes a una serie de ensayos militares. Con este objetivo en mente, se ha decidido desarrollar

Más detalles

Diseño de un directorio Web de diseñadores gráficos, ilustradores y fotógrafos.

Diseño de un directorio Web de diseñadores gráficos, ilustradores y fotógrafos. Universidad Nueva Esparta Facultad de Ciencias Administrativas Escuela de Administración de Diseño de un directorio Web de diseñadores gráficos, ilustradores y fotógrafos. Tutor: Lic. Beaujon, María Beatriz

Más detalles

Hígado bioartificial Revisión sistemática

Hígado bioartificial Revisión sistemática CONSEJERÍA DE IGUALDAD, SALUD Y POLÍTICAS SOCIALES AGENCIA DE EVALUACIÓN DE TECNOLOGÍAS SANITARIAS DE ANDALUCÍA (AETSA) Hígado bioartificial Revisión sistemática Informe de evaluación de tecnologías emergentes

Más detalles



Más detalles

Diseño ergonómico o diseño centrado en el usuario?

Diseño ergonómico o diseño centrado en el usuario? Diseño ergonómico o diseño centrado en el usuario? Mercado Colin, Lucila Maestra en Diseño Industrial Posgrado en Diseño Industrial, UNAM lucila_mercadocolin@yahoo.com.mx RESUMEN En los últimos años el

Más detalles

Este proyecto tiene como finalidad la creación de una aplicación para la gestión y explotación de los teléfonos de los empleados de una gran compañía.

Este proyecto tiene como finalidad la creación de una aplicación para la gestión y explotación de los teléfonos de los empleados de una gran compañía. SISTEMA DE GESTIÓN DE MÓVILES Autor: Holgado Oca, Luis Miguel. Director: Mañueco, MªLuisa. Entidad Colaboradora: Eli & Lilly Company. RESUMEN DEL PROYECTO Este proyecto tiene como finalidad la creación

Más detalles



Más detalles

Volatilidad: Noviembre 2010 Futuros Frijol de Soya

Volatilidad: Noviembre 2010 Futuros Frijol de Soya Observaciones Junio 09, 2010 1. La volatilidad tiene una tendencia a aumentar de Junio a Julio. 2. Este reporte sugiere que se debería considerar la implementación de estrategias largas con opciones en

Más detalles

Ignacio Ferreira González. Unidad de Epidemiología. Servicio de Cardiología. Hospital Vall d Hebron. Barcelona.

Ignacio Ferreira González. Unidad de Epidemiología. Servicio de Cardiología. Hospital Vall d Hebron. Barcelona. Ignacio Ferreira González. Unidad de Epidemiología. Servicio de Cardiología. Hospital Vall d Hebron. Barcelona. Variables de resultado combinadas en los ensayos clínicos (Composite Endpoint / Composite

Más detalles

Células con múltiples micronücleos, asociadas a enfermedad viral, detectadas durante el estudio de niños relacionados con el accidente de Chernobil.

Células con múltiples micronücleos, asociadas a enfermedad viral, detectadas durante el estudio de niños relacionados con el accidente de Chernobil. Células con múltiples micronücleos, asociadas a enfermedad viral, detectadas durante el estudio de niños relacionados con el accidente de Chernobil. Resumen. Garcia O., Lamadrid A.I.,anzano J. Centro de

Más detalles


PERIODONTITIS, ATEROSCLEROSIS Y LES PERIODONTITIS, ATEROSCLEROSIS Y LES Mónica Zamora Pasadas Hospital Universitario Virgen de las Nieves Unidad de Enfermedades Autoinmunes Sistémicas Granada INTRODUCCIÓN El lupus eritematoso sistémico es

Más detalles

Dispositivos Lab-on-a-chip y ópticos para mediciones distribuidas con aplicaciones en biomedicina.

Dispositivos Lab-on-a-chip y ópticos para mediciones distribuidas con aplicaciones en biomedicina. UNIVERSIDAD NACIONAL DE INGENIERÍA FACULTAD DE CIENCIAS Sección de Posgrado y Segunda Especialización Profesional Dispositivos Lab-on-a-chip y ópticos para mediciones distribuidas con aplicaciones en biomedicina.

Más detalles

Alcohol, microarn e inflamación

Alcohol, microarn e inflamación III Jornada sobre Alcohol y Alcoholismo Alcohol, microarn e inflamación Miguel Marcos Martín Servicio de Medicina Interna Hospital Universitario de Salamanca Madrid, 26 de abril de 2014 Consumo de alcohol

Más detalles

Itziar Astigarraga/Mª Dolores Boyano Servicio de Pediatría. HU Cruces. UPV/EHU Departamento Biología Celular. UPV/EHU

Itziar Astigarraga/Mª Dolores Boyano Servicio de Pediatría. HU Cruces. UPV/EHU Departamento Biología Celular. UPV/EHU Estudio de las alteraciones inmunes en las histiocitosis y su aplicación en la búsqueda de biomarcadores para sepsis graves y nuevas terapias frente a leucemias Itziar Astigarraga/Mª Dolores Boyano Servicio

Más detalles


DIABETES TIPO 2: LA ENFERMEDAD SILENCIOSA DIABETES TIPO 2: LA ENFERMEDAD SILENCIOSA MANUEL R. BENITO Ph.D., D.Phil. Departamento de Bioquímica y Biología Molecular II, Facultad de Farmacia, Universidad Complutense de Madrid. CIBER de Diabetes

Más detalles

Jesús Gómez, Mª Teresa (de)*; San Román Montero, Jesús Mª * *Departamento de Medicina y Cirugía, Universidad Rey Juan Carlos

Jesús Gómez, Mª Teresa (de)*; San Román Montero, Jesús Mª * *Departamento de Medicina y Cirugía, Universidad Rey Juan Carlos Fisiopatología de la placa de ateroma Jesús Gómez, Mª Teresa (de)*; San Román Montero, Jesús Mª * *Departamento de Medicina y Cirugía, Universidad Rey Juan Carlos Inflamación y Aterosclerosis La aterosclerosis

Más detalles

Aplicaciones actuales de la genética en la práctica clínica cardiológica: el caso de las enfermedades complejas. Roberto Elosua IMIM, Barcelona

Aplicaciones actuales de la genética en la práctica clínica cardiológica: el caso de las enfermedades complejas. Roberto Elosua IMIM, Barcelona Aplicaciones actuales de la genética en la práctica clínica cardiológica: el caso de las enfermedades complejas Roberto Elosua IMIM, Barcelona Indice Introducción. Utilidades genética: Mejora en la predicción

Más detalles



Más detalles

INFLAMACION E. CARDIOVASCULAR FRAGILIDAD. Roberto Salinas Durán Universidad Nacional Mayor de San Marcos Sociedad Peruana de Geriatras

INFLAMACION E. CARDIOVASCULAR FRAGILIDAD. Roberto Salinas Durán Universidad Nacional Mayor de San Marcos Sociedad Peruana de Geriatras INFLAMACION E. CARDIOVASCULAR FRAGILIDAD Roberto Salinas Durán Universidad Nacional Mayor de San Marcos Sociedad Peruana de Geriatras Relación entre enfermedad cardiovascular y fragilidad INFLAMACION ECV

Más detalles

Tesis de Maestría titulada


Más detalles

Recuperación tras la adversidad de partida. Una investigación sobre adoptados internacionales en España

Recuperación tras la adversidad de partida. Una investigación sobre adoptados internacionales en España Recuperación tras la adversidad de partida. Una investigación sobre adoptados internacionales en España Recovery after initial adversity. A study on international adoptees in Spain Jesús Palacios Universidad

Más detalles

Sistemas de impresión y tamaños mínimos Printing Systems and minimum sizes

Sistemas de impresión y tamaños mínimos Printing Systems and minimum sizes Sistemas de impresión y tamaños mínimos Printing Systems and minimum sizes Para la reproducción del Logotipo, deberán seguirse los lineamientos que se presentan a continuación y que servirán como guía

Más detalles

Inflamación sistémica crónica y nefropatía en sujetos con diabetes tipo 2

Inflamación sistémica crónica y nefropatía en sujetos con diabetes tipo 2 Inflamación sistémica crónica y nefropatía en sujetos con diabetes tipo 2 Dra. Aida Jiménez Corona Unidad de Investigación en Diabetes y Riesgo Cardiovascular Instituto Nacional de Salud Pública 20 de

Más detalles



Más detalles


ALCOHOL Y RESPUESTA INMUNE I Jornada sobre Alcohol y Alcoholismo Grupo de Trabajo Alcohol y Alcoholismo Sociedad Española de Medicina Interna ALCOHOL Y RESPUESTA INMUNE Miguel Marcos Martín Department of Medicine University of Massachusetts

Más detalles

iclef-2002 at Universities of Alicante and Jaen University of Alicante (Spain)

iclef-2002 at Universities of Alicante and Jaen University of Alicante (Spain) iclef-2002 at Universities of Alicante and Jaen University of Alicante (Spain) ! Introduction! Passage Retrieval Systems! IR-n system! IR-n system at iclef-2002! Conclusions and Future works ! Introduction!

Más detalles

diseases in the South East is also influenced by other risk factors not included in the analysis.

diseases in the South East is also influenced by other risk factors not included in the analysis. Resumen: España es el principal país europeo productor de miel con un censo de colmenas que roza los 2.500.000. Las abejas, tanto por la producción de miel como por su empleo como polinizadores de cultivos

Más detalles

Qué es la arteriosclerosis coronaria

Qué es la arteriosclerosis coronaria Capítulo 26 Qué es la arteriosclerosis coronaria Dr. Antonio Fernández-Ortiz Médico especialista en Cardiología. Jefe de la Unidad Coronaria del Instituto Cardiovascular del Hospital Clínico San Carlos,

Más detalles

DEDICATORIA. A mis queridos padres, por sus enseñanzas y lucha constante para ser lo que hoy soy en día.

DEDICATORIA. A mis queridos padres, por sus enseñanzas y lucha constante para ser lo que hoy soy en día. DEDICATORIA A mis queridos padres, por sus enseñanzas y lucha constante para ser lo que hoy soy en día. A mi hermano, que me motiva a seguir siempre adelante. A mi esposo, por estar a mi lado y brindarme

Más detalles


SISTEMA DE GESTIÓN Y ANÁLISIS DE PUBLICIDAD EN TELEVISIÓN SISTEMA DE GESTIÓN Y ANÁLISIS DE PUBLICIDAD EN TELEVISIÓN Autor: Barral Bello, Alfredo Director: Alcalde Lancharro, Eduardo Entidad Colaboradora: Media Value S.L. RESUMEN DEL PROYECTO El presente proyecto

Más detalles

Avances en el SCA en la realidad. Hospital Regional de Talca. Año 2009. Dr. Patricio Maragaño Lizama Unidad de Hemodinamia. Hospital Regional de Talca

Avances en el SCA en la realidad. Hospital Regional de Talca. Año 2009. Dr. Patricio Maragaño Lizama Unidad de Hemodinamia. Hospital Regional de Talca Avances en el SCA en la realidad Hospital Regional de Talca Año 2009 Dr. Patricio Maragaño Lizama Unidad de Hemodinamia Hospital Regional de Talca Indicaciones de estudio coronario de urgencia IAM con

Más detalles

EDUCACION CONTINUADA. Introducción. Caso clínico nº 1

EDUCACION CONTINUADA. Introducción. Caso clínico nº 1 EDUCACION CONTINUADA L. Castaño, J.R. Bilbao, I. Urrutia An Esp Pediatr 1997;46:513-518. Introducción a la biología molecular y aplicación a la pediatría (5): Casos clínicos. Alteraciones genéticas en

Más detalles


DIABETES MELLITUS TIPO 2 ENFERMEDAD CARDIOVASCULAR. Dr. Iñaki Lekuona Sº Cardiología HGU- Osakidetza DIABETES MELLITUS TIPO 2 ENFERMEDAD CARDIOVASCULAR Dr. Iñaki Lekuona Sº Cardiología HGU- Osakidetza SUMARIO 1.-Introducción 2.- Es diferente la aterosclerosis del diabético? IMAGEN 3.-Mecanismos de la

Más detalles

Efecto antiinflamatorio de la Atorvastatina en pacientes con Síndrome Coronario Agudo. Evaluación del perfil lipídico

Efecto antiinflamatorio de la Atorvastatina en pacientes con Síndrome Coronario Agudo. Evaluación del perfil lipídico Efecto antiinflamatorio de la Atorvastatina en pacientes con Síndrome Coronario Agudo. Evaluación del perfil lipídico MA Sulbarán 1 y L Lanza 1. 1 Servicio de Cardiología. Hospital General del Sur "Dr.

Más detalles

Relación entre diabetes y VHC antes y después del transplante hepático

Relación entre diabetes y VHC antes y después del transplante hepático Relación entre diabetes y VHC antes y después del transplante hepático Dr Xavier Xiol Hospital Universitari de Bellvitge L Hospitalet de Llobregat Barcelona Definiciones Diabetes tipo 1 Secundaria déficit

Más detalles

PEMEX E&P South Region OMC 2015

PEMEX E&P South Region OMC 2015 PEMEX E&P South Region OMC 2015 Austin, TX. USA Por: Mario Alejandro Mosqueda Thompson (PEMEX) Juan D. Osorio Monsalve (OVS GROUP MEXICO) The system is based on integrating databases and capture of different

Más detalles

Herpes virus en biopsias de pacientes con VIH/SIDA. Adolfo Contreras, OD.MSc.Ph.D. Escuela de Odontología Universidad del Valle

Herpes virus en biopsias de pacientes con VIH/SIDA. Adolfo Contreras, OD.MSc.Ph.D. Escuela de Odontología Universidad del Valle Herpes virus en biopsias de pacientes con VIH/SIDA Adolfo Contreras, OD.MSc.Ph.D. Escuela de Odontología Universidad del Valle 1 http://www.uct.ac.za/depts/mmi/stannard/herpes.html 2 Herpetic ulcers 3

Más detalles



Más detalles

Mi ciudad interesante

Mi ciudad interesante Mi ciudad interesante A WebQuest for 5th Grade Spanish Designed by Jacob Vuiller jvuiller@vt.edu Introducción Tarea Proceso Evaluación Conclusión Créditos Introducción Bienvenidos! Eres alcalde de una

Más detalles


BIBLIOGRAFÍA INTERNACIONAL BIBLIOGRAFÍA INTERNACIONAL Clinical infectious diseases HIV infection is associated with decreased thrombin generation La infección por VIH se asocia con disminución de la generación de trombina Hsue PY

Más detalles

Diabetes Focus. Qué es la variabilidad glucémica? NÚMERO 20 Diciembre 2008. www.accu-chek.com

Diabetes Focus. Qué es la variabilidad glucémica? NÚMERO 20 Diciembre 2008. www.accu-chek.com Diabetes Focus NÚMERO 20 Diciembre 2008 Qué es la variabilidad glucémica? Variabilidad glucémica Impacto de una hipótesis emergente Se sabe que la hiperglucemia posprandial (GPP) es un factor de riesgo

Más detalles

MASTER. Zootecnia y Gestión Sostenible: Ganadería Ecológica e Integrada

MASTER. Zootecnia y Gestión Sostenible: Ganadería Ecológica e Integrada http://imgt.cines.fr/textes/imgtveterinary/ http://imgt.cines.fr/textes/imgteducation/ http://www.vetmed.wsu.edu/depts-moab/ ANTICUERPOS HUMANOS EN ANIMALES ANTICUERPOS HUMANOS EN ANIMALES Each of the

Más detalles

Bactrocera oleae (Gmelin) (Díptera: Tephritidae), pero dado el poco rendimiento de nuestra población mantenida en laboratorio, se tomó como modelo la

Bactrocera oleae (Gmelin) (Díptera: Tephritidae), pero dado el poco rendimiento de nuestra población mantenida en laboratorio, se tomó como modelo la RESUMEN El primer objetivo de este trabajo fue aislamiento cepas de hongos entomopatógenos a partir de suelo de olivar de Andalucía (España).El método de la " trampa Gallería" permitió identificar y aislar

Más detalles



Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles



Más detalles



Más detalles



Más detalles

Colonización en EPOC Eva M. Carmona Porquera, M.D., Ph.D.

Colonización en EPOC Eva M. Carmona Porquera, M.D., Ph.D. Colonización en EPOC Eva M. Carmona Porquera, M.D., Ph.D. Senior Associate Consultant Conflictos de interés Co-Investigator: ReSAPH (Registry for patients with sarcoidosis and pulmonary hypertension).

Más detalles



Más detalles



Más detalles

Karina Ocaña Izquierdo

Karina Ocaña Izquierdo Estudié Ingeniería en Sistemas Computacionales (1997) y una Maestría en Ingeniería de Cómputo con especialidad en Sistemas Digitales (2000), ambas en el Instituto Politécnico Nacional (México). En el 2003,

Más detalles

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G.

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G. C825T Sistema para la detección de la mutación C825T en el gene de la proteína G. Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. Info@atgen.com.uy www.atgen.com.uy

Más detalles

CAPÍTULO VII. Patogenia de la Arteriosclerosis. Síndromes Clínicos de Aterosclerosis. Recopilación de Datos y Conclusiones.

CAPÍTULO VII. Patogenia de la Arteriosclerosis. Síndromes Clínicos de Aterosclerosis. Recopilación de Datos y Conclusiones. CAPÍTULO VII. Patogenia de la Arteriosclerosis. Síndromes Clínicos de Aterosclerosis. Recopilación de Datos y Conclusiones. J. I. A. Soler Díaz, A. Martinavarro Domínguez, I. Balaguer Segura. PATOGENIA

Más detalles

La EPOC como factor de riesgo para Cáncer de Pulmón. Dr. Juan Pablo de Torres Tajes Servicio de Neumología Clínica Universidad de Navarra

La EPOC como factor de riesgo para Cáncer de Pulmón. Dr. Juan Pablo de Torres Tajes Servicio de Neumología Clínica Universidad de Navarra La EPOC como factor de riesgo para Cáncer de Pulmón Dr. Juan Pablo de Torres Tajes Servicio de Neumología Clínica Universidad de Navarra Resumen Una asociación letal Nuestros datos Posibles mecanismos

Más detalles


DRA. CLAUDIA PINEDO REVILLA Médico Geriatra DRA. CLAUDIA PINEDO REVILLA Médico Geriatra La salud bucal es un elemento importante de la salud general y la calidad de vida de los individuos. WHO, 2006; Petersen, 2003 MALA SALUD BUCAL PERDIDA DENTAL

Más detalles

Un enfoque multidisciplinario para el estudio de células dendríticas derivadas de la médula ósea

Un enfoque multidisciplinario para el estudio de células dendríticas derivadas de la médula ósea UNIVERSIDAD AUTÓNOMA DE SAN LUIS POTOSÍ POSGRADO EN CIENCIAS BIOMÉDICAS BÁSICAS DEPARTAMENTO DE INMUNOLOGÍA FACULTAD DE MEDICINA Un enfoque multidisciplinario para el estudio de células dendríticas derivadas

Más detalles

Adobe Acrobat Reader X: Manual to Verify the Digital Certification of a Document

Adobe Acrobat Reader X: Manual to Verify the Digital Certification of a Document dobe crobat Reader X: Manual de verificación de Certificación Digital de un documento dobe crobat Reader X: Manual to Verify the Digital Certification of a Document support@bioesign.com Desarrollado por:

Más detalles


BIBLIOGRAFÍA COMENTADA BIBLIOGRAFÍA COMENTADA American Journal of Transplantation Donor and recipient IL-28B polymorphisms in HCV-infected patients undergoing antiviral therapy before and after liver transplantation Polimorfismos

Más detalles

Final Project (academic investigation)

Final Project (academic investigation) Final Project (academic investigation) MÁSTER UNIVERSITARIO EN BANCA Y FINANZAS (Finance & Banking) Universidad de Alcalá Curso Académico 2015/16 GUÍA DOCENTE Nombre de la asignatura: Final Project (academic

Más detalles

Zoonosis parasitaria del hombre, mamíferos y aves producida por un protozoo coccidio el Toxoplasma gondii. Parásito intracelular obligado. En el hombre esta infección habitualmente es asintomática, las

Más detalles

Trading & Investment In Banking

Trading & Investment In Banking Trading & Investment In Banking MÁSTER UNIVERSITARIO EN BANCA Y FINANZAS (Finance & Banking) Universidad de Alcalá Curso Académico 2015/16 GUÍA DOCENTE Nombre de la asignatura: Trading & Investment In

Más detalles

Plan de negocio para la explotación de un sistema de alquiler de bicicletas en la Comunidad de Madrid

Plan de negocio para la explotación de un sistema de alquiler de bicicletas en la Comunidad de Madrid Plan de negocio para la explotación de un sistema de alquiler de bicicletas en la Comunidad de Madrid Autor: Directores: Lago Vázquez, Óscar. Ortíz Marcos, Susana. Entidad Colaboradora: ICAI-Universidad

Más detalles


CONSUMO DE ALCOHOL Y RIESGO VASCULAR. CONSUMO DE ALCOHOL Y RIESGO VASCULAR. Dr. E. Sacanella Hospital Clínic Barcelona 1ª Reunión del Grupo Alcohol-Alcoholismo de la SEMI Salamanca, 13 de Febrero de 29. Consumo de alcohol y mortalidad global.

Más detalles

Papel de las células madre en cirrosis e hipertensión portal. Dr. David Kershenobich

Papel de las células madre en cirrosis e hipertensión portal. Dr. David Kershenobich Papel de las células madre en cirrosis e hipertensión portal Dr. David Kershenobich Thomas et al J Clin Invest 1959 Trasplante de Células Madre 1957: Infusión IV de médula ósea 1958: Reportes de trasplante

Más detalles



Más detalles



Más detalles

"Average years of healthy life (without disabilities). Argentina 2002-2003.

Average years of healthy life (without disabilities). Argentina 2002-2003. Universidad Nacional de Córdoba "Average years of healthy life (without disabilities). Argentina 2002-2003. Alvarez, M. - Carrizo, E. - Peláez, E. - González, L. CONICET - National University of Córdoba,

Más detalles


COLESTEROL: IMPLICACIONES NUTRICIONALES COLESTEROL: IMPLICACIONES NUTRICIONALES Molécula fundamental para el organismo: -Integrante de membranas -Precursor de hormonas, ácidos biliares y vitamina D Su aporte dietético no es imprescindible, porque

Más detalles



Más detalles

Artritis reumatoide. Qué es la artritis reumatoide? Prevalencia e incidencia

Artritis reumatoide. Qué es la artritis reumatoide? Prevalencia e incidencia Artritis reumatoide Qué es la artritis reumatoide? La artritis reumatoide es una enfermedad autoinmune crónica caracterizada por la inflamación de la membrana sinovial, un tejido que recubre las articulaciones,

Más detalles

La inmunodepresión en el ictus. Un síndrome importante poco conocido

La inmunodepresión en el ictus. Un síndrome importante poco conocido Puesta al día La inmunodepresión en el ictus. Un síndrome importante poco conocido Infecciones secundarias al ictus isquémico agudo: manifestación de una inmunodepresión inducida por el cerebro Chamorro

Más detalles

Diabetes y cardiopatía isquémica crónica

Diabetes y cardiopatía isquémica crónica 29 Diabetes y cardiopatía isquémica crónica Contenidos Conceptos fisiopatológicos Cardiopatía isquémica y diabetes en mujeres Diabetes, equivalente de cardiopatía isquémica? Cuándo y cómo investigar cardiopatía

Más detalles

Resumen: Palabras Clave: mamíferos, Intersexos, ADN

Resumen: Palabras Clave: mamíferos, Intersexos, ADN REDVET - Revista electrónica de Veterinaria - ISSN 1695-7504 Utilización de la técnica de Real Time PCR aplicada al estudio de animales intersexuados (bovinos y caninos) - Real Time PCR technique applied

Más detalles



Más detalles

Efectos anti-inflamatorios del Ejercicio

Efectos anti-inflamatorios del Ejercicio Efectos anti-inflamatorios del Ejercicio Beneficios Inmunológicos Potenciales en VIH/SIDA Beatriz Parra Patiño Ph.D VIREM-Virus Emergentes y Enfermedad-D. Microbiologia Universidad del Valle beatrizp@univalle.edu.co

Más detalles

Niveles de interferón en pacientes esquizofrénicos

Niveles de interferón en pacientes esquizofrénicos Niveles de interferón en pacientes esquizofrénicos Dr. Segundo Mesa *Dra. Enma González* Dr. Angel Aguilera** Hospital Psiquiátrico de la Habana* Centro de Ingeniería Genética y Biotecnología** INTRODUCCION

Más detalles

METODOS DE MONITOREO DE LA FUNCION INMUNE CELULAR: BIOMARCADORES. Laboratorio de Genética Molecular rgico Hermanos Ameijeiras

METODOS DE MONITOREO DE LA FUNCION INMUNE CELULAR: BIOMARCADORES. Laboratorio de Genética Molecular rgico Hermanos Ameijeiras Aplicación n de la Biología a Molecular al trasplante de órganos y tejidos METODOS DE MONITOREO DE LA FUNCION INMUNE CELULAR: BIOMARCADORES MSc. Igrid García a González Laboratorio de Genética Molecular

Más detalles



Más detalles

Thank you. US English US Spanish. Australia-English Canada-English Ireland-English New Zealand-English Taiwan-English United Kingdom-English

Thank you. US English US Spanish. Australia-English Canada-English Ireland-English New Zealand-English Taiwan-English United Kingdom-English Dear Healthcare Provider, Included in this PDF are recruitment brochures in several languages to be used in MM Bone study (Protocol No.: 20090482). Kindly note these brochures have been updated according

Más detalles



Más detalles



Más detalles

seguimiento del paciente. Se usó el SPSS versión 15.0 para el análisis de relación entre la mejoría y los factores intrínsecos

seguimiento del paciente. Se usó el SPSS versión 15.0 para el análisis de relación entre la mejoría y los factores intrínsecos 1 RESUMEN Objetivo: madre adultas autólogas de médula ósea por infusión intra arterial. Material y Métodos: seguimiento del paciente. Se usó el SPSS versión 15.0 para el análisis de relación entre la mejoría

Más detalles


PROGRAMA. Operaciones de Banca y Bolsa SYLLABUS BANKING AND STOCK MARKET OPERATIONS PROGRAMA 4º Curso. Grado en Administración y Dirección SYLLABUS BANKING AND STOCK MARKET OPERATIONS 4 rd year. Pág. 1 / 8 Colegio Universitario de Estudios Financieros Leonardo Prieto Castro, 2 Tel. +34

Más detalles


ADAPTACIÓN DE REAL TIME WORKSHOP AL SISTEMA OPERATIVO LINUX ADAPTACIÓN DE REAL TIME WORKSHOP AL SISTEMA OPERATIVO LINUX Autor: Tomás Murillo, Fernando. Director: Muñoz Frías, José Daniel. Coordinador: Contreras Bárcena, David Entidad Colaboradora: ICAI Universidad

Más detalles

Índice XXV BLOQUE 1. PRINCIPIOS BÁSICOS Y CONCEPTOS GENÉTICOS. 1. Genes y conceptos básicos de genética...1

Índice XXV BLOQUE 1. PRINCIPIOS BÁSICOS Y CONCEPTOS GENÉTICOS. 1. Genes y conceptos básicos de genética...1 Índice BLOQUE 1. PRINCIPIOS BÁSICOS Y CONCEPTOS GENÉTICOS 1. Genes y conceptos básicos de genética...1 1.1. Introducción...1 1.2. Estructura y codificación de la información genética...1 1.3. Expresión

Más detalles

TESIS DOCTORAL. Regulación transcripcional durante la activación de los linfocitos T por la enzima Poli-ADP-ribosa polimerasa-1.

TESIS DOCTORAL. Regulación transcripcional durante la activación de los linfocitos T por la enzima Poli-ADP-ribosa polimerasa-1. Unidad de Cirugía Experimental. Hospital Universitario Virgen de la Arrixaca. Universidad de Murcia Dpto. Bioquímica, Biología Molecular B e Inmunología, Facultad de Medicina TESIS DOCTORAL Regulación

Más detalles

MASTER. Zootecnia y Gestión Sostenible: Ganadería Ecológica e Integrada. Inmunogenética.

MASTER. Zootecnia y Gestión Sostenible: Ganadería Ecológica e Integrada. Inmunogenética. Dr. Diego Llanes Dra. Ángela Moreno Dr. José Pérez de la Lastra Inmunogenética. VARIABILIDAD DE LAS MOLÉCULAS RELACIONADAS CON EL SISTEMA INMUNE. PARTE DE LA GENÉTICA EN LA QUE SE USAN ANTICUERPOS PARA

Más detalles