UNIVERSIDAD DE CHILE Doctorado en Nutrición y Alimentos

Tamaño: px
Comenzar la demostración a partir de la página:

Download "UNIVERSIDAD DE CHILE Doctorado en Nutrición y Alimentos"

Transcripción

1 UNIVERSIDAD DE CHILE Doctorado en Nutrición y Alimentos DETERMINACIÓN DEL EFECTO HIPOGLICÉMICO E HIPOLIPÉMICO DE UN ALIMENTO FUNCIONAL EN MODELO DE RATA ALIMENTADA CON DIETA ALTA EN GRASA Tesis presentada como parte de los requisitos para optar al Grado de Doctor en Nutrición y Alimentos Programa Conjunto Facultad de Ciencias Agronómicas, Facultad de Ciencias Químicas y Farmacéuticas, Facultad de Medicina, Facultad de Ciencias veterinarias y Pecuarias e Instituto de Nutrición y Tecnología de Alimentos Financiada gracias al Programa de Formación de Capital Humano Avanzado. CONICYT Por Amaya Susana Oyarzún Arancibia, 2012 Director de Tesis Profesor Doctor: Francisco Pérez Bravo Miguel Arredondo Olguín Santiago, 2012

2 RESUMEN La Diabetes Mellitus (DM) y la Obesidad, se han extendido debido a nuestro paso a una vida mucho más sedentaria, el aumento del consumo de grasas, y a la resistencia a la insulina. Aún en los individuos normales, un aumento de peso significativo puede resultar en el desarrollo de intolerancia a la glucosa, niveles de insulina más altos e insensibilidad a la insulina en el tejido graso y muscular. La modificación en los hábitos alimenticios es fundamental en el manejo de los individuos con intolerancia a la glucosa y con síndrome metabólico. Los ensayos clínicos de tratamiento nutricional con una dieta rica en fibra han demostrado consistentemente ser superiores en lo que se refiere a sus efectos terapéuticos comparados con los medicamentos hipoglicemiantes orales y la insulina. Así también, puede contribuir en el mejor control de la obesidad ya que las dietas altas en fibra poseen un reducido aporte calórico en un mayor volumen de alimento. Los fitoesteroles y sus formas reducidas, los fitoestanoles, son esteroles de origen vegetal ampliamente distribuidos en la naturaleza y cuya estructura es muy similar a la del colesterol. El efecto hipocolesterolémico de los fitoesteroles y de los fitoestanoles es atribuido a tres acciones metabólicas y constituyen un modelo muy adecuado para el desarrollo de alimentos funcionales. Se ha postulado que tanto la hiperglicemia, la hiperinsulinemia y el exceso de ácidos grasos libres (AGL) produciría un desbalance en los mecanismos de oxidación y antioxidación que conllevaría a hiperproducción de especies reactivas de oxígeno (ERO), ocasionando desajustes en la mecánica metabólica de muchos tejidos, células y membranas. Los sujetos obesos y/o con diabetes tipo 2 tienen una alta actividad de ERO. Las especies reactivas de oxígeno causan peroxidación de lípidos y de proteínas que causan lesiones en las membranas, inactivación enzimática y alteraciones a nivel de DNA. Los sujetos obesos y aquellos pacientes con diabetes mellitus tipo 2 por lo general exhiben un control deficiente de la glicemia e insulinemia y en ellos se describe una actividad antioxidante total disminuida, esto induce a defectos en la protección contra los ROS y a una mayor susceptibilidad al daño oxidativo. Por ende, una dieta rica en antioxidantes provocaría una disminución en los daños producidos por ROS.

3 En Chile los residuos agrícolas y agroindustriales son importantes, tanto por el volumen de producción, como por su aporte potencial en compuestos bioactivos. En los últimos años ha cobrado especial importancia a nivel mundial, la utilización de ellos, con el objetivo de obtener ingredientes, denominados productos alimentarios intermedios (PAI). Con ellos se pueden elaborar ingredientes funcionales (IF) con características específicas para la prevención y reducción de desórdenes metabólicos (como por ejemplo, hiperglicemia e hiperlipidemia). En base a estos antecedentes se generó un IF conformado por PAI de afrechillo de arroz, pomaza de tomate y manzana y paleta de tuna, el cual posee gran cantidad de fibra y antioxidantes y analizamos los posibles efectos de éste en ratas alimentadas con dieta alta en grasa (cafetería), o con dieta normal, sobre parámetros metabólicos, bioquímicos, de estrés oxidativo y genómicos. Para ello se utilizaron 32 ratas (Rattus norvegicus) Wistar macho de 21 días de edad. 16 ratas fueron alimentadas con dieta de cafetería hasta presentar obesidad y 16 ratas se mantuvieron normo peso. 8 ratas de cada grupo recibieron el IF al 1%, distribuido de forma homogénea en su comida, durante 30 días. Se registró peso e ingesta durante todo el estudio. Se extrajeron muestras de sangre al inicio del estudio y a los 15 y 30 días, para determinar; glicemia, insulina y perfil lipídico. A los 30 días las ratas fueron sacrificadas según protocolo, y se extrajeron sus órganos. Los resultados muestran que a los 30 días el grupo de ratas obesas que consume el IF logra llegar a los valores del grupo control en: ingesta, colesterol, triglicéridos y VLDL y presenta una disminución en peso, glicemia, insulina, HOMA, y LDL, a pesar de continuar consumiendo dieta alta en grasa. Además aumenta su actividad de superóxido dismutasa y modifica la expresión de sus genes en distintos tejidos a los niveles de expresión del grupo control. Por lo tanto el IF al 1% posee un efecto hipolipémico y normoglicémico cuando es administrado en ratas obesas durante 30 días.

4 ABSTRACT Diabetes Mellitus (DM) and obesity have spread because our lifestyle has become more sedentary, increased fat intake and insulin resistance. Even in normal individuals, significant weight gain can result in the development of glucose intolerance, higher insulin levels and insulin insensitivity in muscle and fat tissue. The change in eating habits is essential in the management of individuals with impaired glucose tolerance and metabolic syndrome. Clinical trials of nutritional therapy with a high fiber diet have consistently shown to be superior in regard to their therapeutic effects compared with oral hypoglycaemic drugs and insulin. Also, can contribute to improve the control of obesity, given that diets high in fiber have a; reduced caloric intake in a greater volume of food. Phytosterols and their reduced forms, stanols, are plant sterols widely distributed in nature and whose structure is very similar to the one of cholesterol. The hypocholesterolemic effect of phytosterols and stanols is attributed to three metabolic actions and they constitute a good model for the development of functional foods. It has been postulated that hyperglycaemia, hyperinsulinemia, and excess free fatty acids (FFA) would produce an imbalance in the mechanisms of oxidation and antioxidation that would lead to overproduction of reactive oxygen species (ROS), causing imbalances in the metabolic mechanics of many tissues, cells and membranes. Obese subjects and / or type 2 diabetes have a high activity of ROS. Reactive oxygen species cause lipid and protein peroxidation, that cause membrane lesions, enzyme inactivation and DNA level alterations. Obese subjects and patients with type 2 diabetes mellitus usually exhibit poor control of glycaemia and insulinemia and they describe a decreased total antioxidant activity, this leads to defects in protection against ROS and increased susceptibility to oxidative damage. Thus, a diet rich in antioxidants would cause a decrease in the damage produced by ROS. In Chile agricultural and agro-industrial residues are important both for the volume of production, and its potential contribution in bioactive compounds. In recent years, (the use of them, in order to obtain ingredients, called intermediate food products (IFP)) has become important worldwide. With these functional ingredient (FI) can be made with specific characteristics for the prevention and reduction of metabolic disorders (eg, hyperglycaemia, and hyperlipidemia).

5 Based on this background we generated a FI consisting in and IFP of rice bran, tomato and apple pomace and prickly pear, which has lots of fiber and antioxidants, and we analyze the possible effects of this in rats fed with a high fat diet (cafeteria), or a normal diet on metabolic, biochemical, oxidative stress and genomic parameters. For this purpose, 32 male Wistar 21 days old rats (Rattus norvegicus) were used. 16 rats were fed with cafeteria diet until they presented obesity and 16 rats were kept in the normal weight. 8 rats in each group received IF at 1% homogeneously distributed in their food for 30 days. Weight and food intake were recorded throughout the study. Blood samples were drawn at the beginning of the study and at 15 and 30 days, to determine; glycaemia, insulin and lipid panel. At 30 days the rats were sacrificed according to protocol and organs removed. Results show that after 30 days the group of obese rats that consumed the FI achieves the control group values regarding: intake, cholesterol, triglycerides and VLDL, and presents decrease in weight, glycaemia, insulin, HOMA and LDL, despite the continued high fat diet intake. More over it increases superoxide dismutase activity and modifies the expression of its genes in different tissues to the expression levels of the control group. Hence the FI at 1% has a normoglycemic and hypolipemic effect when administered in obese rats for 30 days.

6 INTRODUCCIÓN ANTECEDENTES GENERALES Obesidad, diabetes y síndrome metabólico En muchos países de Latinoamérica y Asia se ha pasado rápidamente de una situación de déficit nutricional a otra de problemas por exceso, caracterizada por la presencia de obesidad e hiperlipidemia. En estos países se ha observado un cambio en la dieta, tradicionalmente rica en cereales, plantas y tubérculos y baja en grasa y proteína animal, por otra caracterizada por una alta ingesta de grasas, azúcar y alimentos procesados, cuyo consumo es estimulado por atractivos mensajes que invitan a comer, esto además potenciado por un aumento de sedentarismo. Así, vemos que en Chile en menos de 20 años, se ha producido un alarmante aumento de obesidad, y todas sus enfermedades asociadas. El consumo total de grasas ha aumentado, mientras que el consumo de antioxidantes ha disminuido. Especial relevancia adquiere el hecho que sea la obesidad más frecuente en los estratos de menores ingresos (Albala, y cols., 2002; Uauy y Kain, 2002) La alta y creciente prevalencia de la obesidad, la dificultad de su tratamiento, la frecuencia de recaídas, los graves riesgos para la salud y su alto costo hacen de ella un importante problema de salud pública que es necesario enfrentar desde la edad más temprana posible (Burrows, 2000). Tan graves pueden ser las implicancias de dicha condición, que la Organización Mundial de la Salud, (OMS) se ha pronunciado reconociendo a la OBESIDAD "per se" como una enfermedad, la misma que está afectando a una gran parte de la humanidad y que explica gran parte de las enfermedades crónicas (arteroesclerosis, infartos al miocardio y cerebrales, diabetes tipo II, etc.) (Misra y Khurana, 2008) que en forma alarmante se expresan en las causas de mortalidad de nuestro país. Según la Encuesta Nacional de Salud ENS Chile ( ), Chile presenta un 64,5% de personas con exceso de peso, de las cuales un 25,2% son obesas. Además, un 35,3% de la población presenta síndrome metabólico, un 22,7% tiene niveles altos de LDL, un 31,2% presenta hipertrigliceridemia y un 38,6% hipercolesterolemia. La encuesta indica además, que sólo un 15,7% de la población consume más de 5 porciones al día de frutas o verduras y sólo un 13,8% consume cereales integrales por lo menos una vez al día (ENS, 2010).

7 Por otro lado, el 90 % de los pacientes con diabetes tipo 2 son obesos al momento del diagnóstico. Aún en los individuos normales, un aumento de peso significativo puede resultar en el desarrollo de intolerancia a la glucosa, niveles de insulina más altos e insensibilidad a la insulina en el tejido graso y muscular. La modificación en los hábitos alimenticios es fundamental en el manejo de los individuos con intolerancia a la glucosa y diabetes tipo 2. Los ensayos clínicos de tratamiento nutricional con una dieta rica en fibra han demostrado consistentemente ser superiores en lo que se refiere a sus efectos terapéuticos comparados con los medicamentos hipoglicemiantes orales y la insulina. Así también, puede contribuir en el mejor control de la obesidad, ya que las dietas altas en fibra poseen un reducido aporte calórico en un mayor volumen de alimento y además, facilitan la ingestión de una menor cantidad de comida ya que el tiempo de masticación es mayor, lo que sumado al volumen ingerido, contribuye con una sensación de saciedad (Ford y Liu, 2001; Ford y Mokdad, 2001). Se ha estimado que entre 200 y 300 millones de personas en todo el mundo cumplirán, al final de esta década, los criterios de la Organización Mundial de la Salud para el diagnóstico de la diabetes mellitus (DM). La DM, se ha extendido debido a nuestro paso a una vida mucho más sedentaria, que nos predispone a la obesidad y a la resistencia a la insulina. Los individuos afectados por esta enfermedad también pueden presentar una serie de consecuencias, principalmente del tipo cardiovascular, no deseadas, como por ejemplo hipertensión, dislipidemia e hipercoagulabilidad, que conducen a la morbilidad y mortalidad por enfermedades vasculares ateroscleróticas. Actualmente, el término Diabetes Mellitus se refiere a un trastorno metabólico de etiología múltiple, caracterizado por hiperglicemia crónica debido a las alteraciones del metabolismo de los hidratos de carbono, grasas y proteínas, como consecuencia de defectos en la secreción de la insulina, acción de la hormona o de ambos (García y Durruty, 2003). De acuerdo a los datos de la Encuesta Nacional de Salud ENS Chile ( ), el porcentaje de personas que padecen diabetes corresponde al 9,4% a nivel Nacional, y si observamos a los mayores de 65 años ésta cifra aumenta a un a un 25,6%. La diabetes es menos frecuente en los lugares donde la gente consume una dieta menos elaborada. Aunque se sabe que los factores genéticos parecen ser importantes en la susceptibilidad a la diabetes, se requieren factores ambientales para desarrollarla. El factor ambiental más importante en su desarrollo es una dieta alta en carbohidratos vacíos de fibra. Se sabe que este tipo de dieta induce a la diabetes en los tipos genéticos susceptibles. Se ha demostrado que el porcentaje de calorías en la dieta, especialmente la proveniente de grasa saturada se asocia fuertemente al desarrollo de intolerancia a la glucosa y diabetes tipo 2.

8 La coexistencia de muchos de estos trastornos con la resistencia a la insulina constituye el síndrome metabólico (SM). En la sociedad occidental, el número de enfermos que padecen síndrome metabólico está aumentando con cifras de epidemia: en la actualidad afecta a un 20% de la población general y aproximadamente a un 40% de las personas mayores de 60 años. Los últimos datos epidemiológicos y biológicos indican que las etiologías de estas enfermedades pueden compartir mecanismos genéticos y bioquímicos inesperados y regulares. Últimamente se le ha dado mucha importancia al manejo dietario de estos pacientes, y los mejores resultados se han encontrado aumentando el consumo de frutas y vegetales (Yeon, y cols., 2012). Por lo tanto, un manejo dietario que aumente el consumo de frutas, verduras y fibra es importante para controlar estas enfermedades. Disfunción Mitocondrial Se ha postulado que tanto la hiperglicemia, la hiperinsulinemia y el exceso de ácidos grasos libres (FFA) produciría un desbalance en los mecanismos de oxidación y antioxidación que conllevaría a un aumento de la producción de especies reactivas de oxígeno (ROS), ocasionando disturbios en la mecánica metabólica de muchos tejidos, células y membranas. Los sujetos obesos y/o con diabetes tipo 2 tienen una alta actividad de ROS. Las especies reactivas de oxígeno causan peroxidación de lípidos, de proteínas que causan lesiones en las membranas, inactivación enzimática y alteraciones a nivel de DNA. Los sujetos obesos y aquellos pacientes con diabetes mellitus tipo 2 por lo general exhiben un control deficiente de la glicemia e insulinemia y en ellos se describe una actividad antioxidante total disminuida, esto induce a defectos en la protección contra los ROS y a una mayor susceptibilidad al daño oxidativo. El rol exacto del estrés oxidativo en la iniciación y progresión de la diabetes mellitus aún no es conocido en suficiente detalle. Sin embargo, existe importante evidencia de que las complicaciones relacionadas a la diabetes son asociadas con la inducción del estrés oxidativo inducido por la generación de radicales libres (Baynes y Thorpe, 1999). La hiperglicemia puede llevar a incrementar la generación de radicales libres por múltiples mecanismos. La presencia crónica de altos niveles de glucosa mejora la producción de ROS desde la glicación protéica y la autoxidación de glucosa lo cual a su vez cataliza la peroxidación lipídica (Feillet- Coudray y cols., 1999). De acuerdo a esto, diversas perturbaciones en los sistemas de defensa antioxidante en la diabetes han sido publicados, entre ellas alteraciones en enzimas antioxidantes (Strain, 1991), metabolismo de glutatión deficiente (McLennan y cols., 1991) y disminución en los niveles de ácido ascórbico (Young y cols., 1992).

9 Algunos estudios en diabéticos reportan un aumento significativo en los productos de peroxidación lipídica en plasma y tejido comparado con los controles (Mehmet y cols., 2000). Estos hallazgos resultan en nuevos logros para el tratamiento de pacientes diabéticos y los estudios relevantes se enfocan en fortalecer los sistemas antioxidantes. En individuos con un defecto parcial en la fosforilación oxidativa (OXPHOS), la capacidad de utilización energética de las células para obtener ATP se ve reducida. Al ingerir una dieta altamente calórica, los individuos con un defecto parcial en la OXPHOS sobrecargan sus mitocondrias con excesivas calorías, hiperpolarizando su potencial de membrana y bloqueando la utilización tisular de glucosa. La glucosa no metabolizada permanece en sangre. Esto provoca la señalización en las células β para secretar insulina. De este modo tendremos elevadas cantidades de glucosa e insulina; el marco de la insulina resistencia. (Lowell y Spiegelman, 2000; Fernández-Real y Pickup, 2007; Wilding, 2007; Bach y cols., 2005; Manoli, y cols., 2007) En las células β, una aumentada concentración de ROS mitocondriales, inhiben la producción mitocondrial de ATP, eventualmente declinando la secreción de insulina debido a la cantidad inadecuada de ATP para la glucoquinasa y al bajo radio ATP/ADP que no puede activar el canal KATP. Esto resulta en alta glucosa pero baja insulina en sangre, lo que es llamado diabetes independiente de insulina. Continuando la sobrecarga calórica en las células β pancreáticas y asociado a la producción mitocondrial de ROS se activa el mtptp (poro de permeabilidad transitorio mitocondrial) resultando en la muerte de la célula β pancreática por apoptosis, produciendo diabetes dependiente de insulina. (Kelley, y cols., 2002; Houstis, y cols., 2006; Chakravarthy y Semenkovich, 2007; Wallace, 2005). Los antioxidantes, al oponerse al efecto deletéreo de las especies reactivas del oxigeno (ROS), ejercen una función protectora de la salud. Entre las enfermedades crónicas asociadas con la generación de radicales libres se incluyen la diabetes, la obesidad y la aterosclerosis. El sistema antioxidante del organismo, para combatir la producción de los radicales libres, necesita de un aporte adecuado de nutrientes con acción antioxidante proveniente de la dieta. Las vitaminas A, C, E y los polifenoles desempeñan una función antioxidante. Finalmente, los carotenoides también han demostrado ser de suma importancia en constituir una barrera de protección contra la formación de radicales libres.

10 Estudios en un modelo animal (ratas) han mostrado el fuerte potencial que tendría el uso de sustancias antioxidantes naturales presentes en especies no tradicionales (amaranto y guinda ácida) en el control de la hiperglicemia e hiperlipidemia, con resultados muy llamativos ya que en estos casos se ha observado beneficios con un consumo diario modesto y en períodos de tiempo muy breves, a diferencia de otras intervenciones (Delany y cols., 2000; Kien y cols., 2005; Sánchez-Moreno y cols., 2006). Por otro lado, se ha demostrado que el consumo de esteroles y estanoles de vegetales, reduce significativamente el colesterol plasmático. Su acción hipocolesterolémica estaría relacionada con la captación del colesterol a nivel del intestino (Marcone y cols., 2004). NUTRIGENÓMICA La nutrigenómica pretende proporcionar un conocimiento molecular (genético) sobre los componentes de la dieta que contribuyen a la salud mediante la alteración de la expresión y/o estructuras según la constitución genética individual La nutrigenómica consiste básicamente el estudio de las interacciones entre el genoma y los nutrientes. Existen muchos genes que pueden ser modificados a través de la dieta. A continuación más detalles de los cinco genes que fueron analizados durante esta tesis. Mitofusina 2 La mitofusina 2 (Mfn2), causante de la enfermedad de Charcot Marie Tooth, que se caracteriza por un conjunto de trastornos que afectan los nervios periféricos, podría ser un blanco en casos de obesidad y resistencia a la insulina (Züchner y cols., 2004; Züchner y Vance, 2005; Engerfield, y cols., 2006; Bach, y cols., 2005; Pich, y cols., 2005; Kijima, y cols., 2005). La expresión, tanto de la proteína como del RNA mensajero de Mfn2, está reprimida en el músculo esquelético de los pacientes en situación de obesidad o de DM2. Al estudiar esta proteína in vitro en células musculares de ratas, se comprobó que la represión de ésta afectaba a distintos parámetros metabólicos, por lo que estos cambios en la expresión de Mfn2 alteran la función de la cadena respiratoria.; la expresión de estos complejos está reprimida y la actividad enzimática de los complejos de la cadena, disminuida, lo que se conoce como disfunción mitocondrial (Bach y cols., 2003; Pich y cols., 2005).

11 La sobrexpresión de Mfn2 aumenta la oxidación de sustratos y el potencial de membrana mitocondrial, así como la expresión de complejos de la cadena respiratoria. En síntesis, se logra la situación inversa a la que produce la represión de la Mfn2, lo que confirma la hipótesis de que esta proteína podría ser un buen blanco terapéutico (Pich y cols., 2005; Soriano y cols., 2006). El papel de la mitocondria en la apoptosis se ha relacionado con la pérdida del potencial de membrana, que se considera un punto de no retorno en el proceso apoptótico (Zamzami y cols., 1995). La proteína pro apoptótica de la familia de Bcl2, Bax es esencial en la vía mitocondrial de la apoptosis (Wei y cols., 2001). Bax se localiza en el citosol de las células sanas, pero la iniciación del proceso apoptótico provoca su localización en puntos de la mitocondria junto con el también miembro de la familia de Bcl2, Bak (Karbowski y cols., 2002; Neuspiel y cols., 2005). La sobrexpresión de Mfn2 per se no provoca apoptosis a pesar de modificar la estructura mitocondrial, pero sensibiliza a las células a estímulos apoptóticos. Estímulos como la ceramida C2, el ácido araquidónico o el H 2 O 2 inducen el movimiento de Ca +2 del retículo endoplasmático a la mitocondria, provocando un gran incremento en la concentración de Ca +2 lo que lleva a la permeabilización de la membrana mitocondrial y activación de caspasas (Bernardi, 1999; Shen y cols., 2007; Guo y cols., 2007). La entrada de Ca +2 se produce en puntos de la mitocondria yuxtapuestos al retículo endoplasmático y se propaga a través de la red mitocondrial (Eizirik y cols., 2008). El ejercicio incrementa el contenido, el tamaño, la capacidad oxidante y la capacidad de oxidación de glucosa aeróbica de las mitocondrias en el músculo y esto se debe al aumento de expresión de Mfn2 (Cartoni y cols., 2005). Durante mi Unidad de Investigación validé la técnica de medición de Mfn2, midiendo los cambios de expresión del RNAm de Mfn2 en células mononucleares (CMN) provenientes de pacientes con diabetes tipo 2 y controles. Estas CMN fueron desafiadas con una alta concentración de glucosa (14 μm), lo cual provoca un cambio en la expresión de Mfn2 al comparar con la concentración basal 5 μm. Estos antecedentes sugieren que Mfn2 puede ser un muy buen marcador de estrés oxidativo, que responde en tiempos cortos a variables dietarias. UCP2 El gen de la proteína desacoplante mitocondrial 2 (UCP2) fue descubierto recientemente y podría tener un rol significativo en la etiopatogenia de la diabetes tipo 2 y de la obesidad, aunque la evidencia hasta el presente es sólo incipiente.

12 A diferencia de la UCP1, que se expresa únicamente en grasa parda, la UCP2 se expresa en varios tejidos de variadas funciones, como músculo esquelético, células β del páncreas, pulmón, placenta, riñón, cerebro, hipotálamo e hipófisis. UCP2 sería regulada por la leptina y por los ácidos grasos ingeridos en la dieta (Porter 2001; Chieregatti y Meldolesi, 2005). Estudios recientes le asignan a UCP2 un rol relevante en la regulación de la función de las células β y en la insuficiente secreción de insulina en respuesta al estímulo de la glucosa. Krauss y colaboradores demostraron que la hiperglucemia aumenta la producción de superóxido mitocondrial, una forma de ROS que estimula la expresión del gen de UCP2 en las células β del páncreas y en otros tejidos. El desacople de la mitocondria inducido por UCP2 disminuye la concentración de ATP en las células β y con ello dificulta la secreción de insulina en respuesta a la glucosa. Este efecto se pudo prevenir reduciendo el superóxido o anulando el gen de UCP2. La acción depresora del superóxido sobre la secreción de insulina no se produjo en ratones transgénicos sin UCP2, sugiriendo así que los efectos nocivos del superóxido sobre las células β fueron causados a través de aumentar la actividad de UCP2. La hiperlipidemia crónica también produce pérdida de masa y de función de las células β y afecta la secreción de insulina a través del mecanismo superóxido-ucp2 descrito. Estos hallazgos se correlacionan con la estimulación que induce la hiperlipidemia en la expresión de UCP2 en los islotes. En la diabetes experimental se observan diversas alteraciones del metabolismo lipídico (Krauss y cols., 2003; Friederich y cols. 2008; Zhang, y cols. 2001; Xie, y cols. 2008). Por estos motivos UCP2 es un gen diana modificable por dieta cuyas modificaciones serían un aporte interesante en esta investigación. PPARα y PPARɣ Los receptores activados del proliferador de peroxisoma (PPARs: peroxisome proliferator-activated receptors), han sido reconocidos como blancos terapéuticos contra la dislipidemia y diabetes, desde su descubrimiento en la década de los 90 s. Los PPARs son ligandos activadores de los receptores nucleares de hormonas e incluyen 3 isoformas: PPARα, PPARɣ, y PPARδ/β. PPARα es expresado en la mayoritariamente en tejido adiposo marrón e hígado y es expresado en tejidos no grasos en mayor proporción que PPARɣ, PPARɣ es principalmente expresado en tejido adiposo, y PPARδ/β es expresado en todos los tejidos (Desvergne y Wahli, 1999). La activación de PPARα disminuye los triglicéridos plasmáticos y eleva los niveles de colesterol HDL (Steiner y cols., 2001; Sheng, y cols., 2008), y la activación de PPARɣ incrementa la sensibilidad a insulina y provoca efectos antidiabéticos (Olefsky, 2000; Sheng, y cols., 2008).

13 El rol de PPARα en la regulación de la homeostasis de lípidos intracelular en tejidos no adiposos puede ser más sencillo. PPARα es un factor de transcripción que ha sido conocido por activar o sobre regular las enzimas de oxidación de ácidos grasos en el hígado (Koh, 2003), pero recientes estudios indican que también incrementa la oxidación de ácidos grasos en músculo esquelético (Muoio y cols., 2002). De esta forma incrementa la sensibilidad a la insulina y reduce la adiposidad (Guerre-Millo y cols., 2000) y la acumulación de lípidos en músculo esquelético (Ye y cols., 2001; Koh, 2003). Agonistas de PPARα como fibratos o de PPAR ɣ como las glitazonas inducen la expresión del gen de la lipoproteinlipasa. Los PPARs son factores de transcripción que una vez activados se unen a la región promotora de los genes blancos en este caso, de la lipoproteinlipasa aumentando su expresión. Frente a una mayor cantidad de enzima se degradan más eficazmente los triglicéridos de las VLDL y aumentan los niveles de HDL. Finalmente, con activadores de PPARα aumenta la expresión de los genes de Apo A-I y Apo A-II, incrementando las partículas de HDL; se induce el gen de la lipoproteinlipasa y se reprime el gen del Apo CIII, aumentando la lipólisis de las lipoproteínas ricas en triglicéridos. PPARα es activado a nivel dietario por; ácidos grasos de cadena larga insaturados y por otros antioxidantes. Mn-SOD Los niveles intracelulares de O 2 -. son controlados no sólo por la taza de producción de O 2 -., sino también, regulados por la taza de degradación del mismo. La superóxido dismutasa (SOD), descubierta por McCornd y Fridovich (1969), constituye la primera fase de defensa antioxidante, constituye el mayor mecanismo enzimático para la degradación de O 2 -. y cataliza la conversión de O 2 -. en H2O2, el cual puede ser destruido a su vez por las actividades catalasa o glutatión peroxidasa. -. Tres diferentes isoformas de SOD reaccionan con O 2 en distintos compartimentos celulares: en el citosol actúa Cu/Zn-SOD (SOD1), en las mitocondrias Mn-SOD (SOD2), y en el espacio extracelular EC-SOD (SOD3). La regulación de la actividad endotelial de Cu/Zn-SOD y su expresión juega un rol crítico en la protección contra O -. 2, mediante la reducción de la biodisponibilidad endotelial de óxido nítrico (. NO) (Hwang y cols., 2004).

14 ALIMENTOS FUNCIONALES Los alimentos funcionales son alimentos procesados que contienen componentes llamados compuestos bioactivos que ayudan a funciones específicas del organismo, además de cumplir su función nutricional normal. Estos compuestos bioactivos están por lo general presentes en los alimentos en muy pequeñas cantidades y pueden tener una importante función en la salud humana, en la prevención de enfermedades crónicas no trasmisibles o mejorando el bienestar y la calidad de vida. Las recomendaciones dietéticas se orientan hacia el aumento del consumo de productos de origen vegetal, en especial aquellos que contengan sustancias de alto valor nutricional o productos elaborados con adición de estos compuestos funcionales. Entre los compuestos bioactivos de mayor interés, se pueden mencionar la fibra dietética, los polifenoles, los tocotrienoles, licopeno, fitoesteroles, escualeno, entre otros. En Chile, los residuos agrícolas y agroindustriales son importantes, tanto por el volumen de producción, como por su aporte potencial en compuestos bioactivos. En los últimos años ha cobrado especial importancia a nivel mundial, la utilización de ellos, con el objetivo de obtener ingredientes, denominados productos alimentarios intermedios (PAI). Con ellos se pueden elaborar ingredientes funcionales (IF) con características específicas para la prevención y reducción de desórdenes metabólicos (como por ejemplo, hiperglicemia e hiperlipidemia). Actualmente estas materias primas se destinan principalmente a la alimentación animal, pero en términos generales, están siendo subutilizados en relación con su potencial nutritivo. Por otra parte, hay cultivos que están siendo sub explotados, como el amaranto, y cultivos que son importantes para las zonas áridas y semiáridas como es el caso de la tuna, para los cuales es importante diversificar su utilización. Las industrias agroalimentarias, requieren contar con tecnologías que les permitan dar mayor valor agregado a los residuos que producen, valorizando de este modo su contenido de compuestos bioactivos y convirtiéndolos en co productos de la industria alimentaria, con claro potencial de impacto en la salud de la población. El mercado de ingredientes alimentarios ricos en antioxidantes y fibra es algo novedoso y de desarrollo incipiente en el país y pueden ser utilizados por la industria de alimentos en el diseño de alimentos sanos y saludables. A continuación se encuentra el detalle de la incorporación de los cinco PAI, con los que formularemos nuestro IF; afrechillo de arroz, afrechillo de amaranto, pomaza de manzana, pomaza de tomate y paleta de tuna, en los cuales se centrará este proyecto.

15 Afrechillo de Arroz (Oryza sativa) Durante la elaboración del arroz, se produce entre un 10-12% de afrechillo o harinilla (también llamado pulido o salvado) proveniente de la separación de las capas externas del grano y el germen, realizada en las operaciones de blanqueado y pulido. En Chile, parte de este subproducto se utiliza para alimentación animal, pero una parte significativa tiene problemas de enranciamiento. El afrechillo de arroz constituye una abundante, pero subutilizada materia prima, debido principalmente a la poca estabilidad frente a la rancidez del aceite que contiene, provocada por la presencia de enzimas lipasas y lipoxigenasas. Con una adecuada estabilización, se permitiría su mejor aprovechamiento. El afrechillo de arroz ha mostrado promisorios beneficios para la salud en la prevención de diferentes enfermedades como cáncer, hiperlipemia, hígado graso, hipercalcinuria, cálculos renales, y enfermedades cardíacas (Parrado y cols.., 2006). Entre los compuestos bioactivos de mayor relevancia del afrechillo de arroz se encuentran fibra dietética, vitamina E (tocotrienoles), esteroles, el orizanol y proteína con altos contenido de lisina (Fatemeh y cols., 2000; Vissers y cols., 2000; Tang y cols., 2003), los que se podrían incorporar como ingredientes con propiedades funcionales en productos de consumo masivo. La mayor parte de los componentes de vitamina E en el afrechillo de arroz son el α-tocoferol, α-tocotrienol, ɣ-tocoferol y ɣ-tocotrienol. En el afrechillo de arroz estabilizado térmicamente, se han descubierto nuevos tocotrienoles (d- P25-T3) que han mostrado mayor actividad hipocolesterolémica, antinflamatoria, antitrombótica, y anticancerígena comparada con la de los tocotrienoles conocidos y la de la vitamina E, pudiendo reducir considerablemente las placas de ateroma (42% en ratas) (Qureshi y cols., 2000). Afrechillo de Amaranto (Amaranthus spp) El amaranto es un seudocereal cuyo valor nutricional y funcional ha despertado últimamente mucho interés, por lo cual su consumo es una alternativa interesante debido a su composición química, aporte nutricional y a la vez ser alimento saludable. El amaranto a pesar de ser un cultivo de alta productividad, el cual presenta altos rendimientos en algunas regiones de Chile y poseer sobresalientes características nutricionales que le proporcionan una alta funcionalidad y le permiten innumerables aplicaciones para la industria, está siendo subutilizado, en circunstancias que el aumento de su superficie de cultivo permitiría diversificar la producción de la pequeña y mediana agricultura nacional.

16 El amaranto presenta alto contenido de fibra dietética y en la fracción lipidica no saponificable se encuentran fitoesteroles (R-sitosterol, campesterol y estigmasterol) y fitoestanoles, con un contenido total de esteroles superior al observado en otras plantas. El amaranto, presenta además alto contenido de polifenoles, antocianinas, flavonoides por lo que se ha señalado que por su capacidad antioxidante, este seudo cereal puede ser utilizado como sustituto de los cereales en dietas especiales (Gorinstein y cols., 2007). Se ha informado que el amaranto exhibe un efecto hipocolesterolémico en animales hiperlipidémicos (Czerwiński y cols., 2004). En estudios realizados en animales de laboratorios (ratas diabéticas, hamsters y conejos), alimentados con aceite de amaranto, se encontró una disminución en la concentración de colesterol total, triglicéridos, lipoproteínas de muy baja densidad (VLDL) y relación colesterol Total/HDL; además, aumentó la excreción fecal de colesterol, triglicéridos y ácido biliar. Por otra parte, se encontró una disminución significativa de la glucosa sérica y un aumento en el nivel de insulina sérica. Por lo tanto es posible usar aceite de amaranto como una terapia antioxidante que puede ser beneficiosa para corregir hiperlipidemia, prevenir las complicaciones de la diabetes y enfermedades coronarias y (Hye Kyung y cols., 2006a, 2006b; Berger y cols., 2003; Plate y Areas, 2002). De manera similar, el consumo de cáscara de amaranto en dietas con un nivel 4,5% de fibra dietética, de la cual un 30% correspondió a fibra soluble, causó en ratas un descenso en el colesterol sérico y del hígado de entre 10,7 y 23%, dependiendo del tipo de grasa que tenía la dieta; estos valores son un poco inferiores a los producidos por la cáscara de avena incorporada en las mismas condiciones. Pomaza de Tomate (Lycopersicum esculentum) La pomaza de tomate es el residuo que se obtiene luego del triturado y tamizado del tomate destinado a la elaboración de pasta concentrada. Esta materia prima contiene un gran número de compuestos beneficiosos para la salud como el licopeno, fibra dietética y -tocoferol (vitamina E). En Chile se destinan a procesamiento industrial del orden de de toneladas de tomates, lo que resulta un valor medio de ton de pomaza, cantidad que revela la gran importancia del mismo en las industrias del sector y justifica la necesidad de diversificar la utilización de ellos. El tomate es una hortaliza de amplio consumo ya sea en forma fresca o procesada y puede aportar a la dieta cantidades significativas de fibra, vitaminas A y C y antioxidantes principalmente en la forma de carotenos y compuestos fenólicos. Entre los carotenos predomina el licopeno, el cual constituye el 60-74% de los carotenoides presentes en el tomate y productos de tomate, siendo a su vez responsable de su intenso color rojo (Clinton, 1998).

17 Se estudió el efecto de la fibra del tomate en la respuesta glicémica y colesterol sérico en ratas y concluyeron que la fibra dietética del residuo de tomate disminuye la absorción de glucosa y reduce los niveles de colesterol sérico (Alvarado y cols., 2001). Respecto a la capacidad antioxidante del tomate, se señala que está principalmente relacionada con el contenido de compuestos fenólicos totales extraíbles, y el contenido de licopeno (Martinez-Valverde y cols., 2002). El tomate contiene también compuestos fenólicos, los cuales por su estructura son muy eficientes secuestradores de radicales peroxilos inhibiendo la formación de compuestos oxidados del colesterol LDL y ayudando a retardar el envejecimiento celular. Pomaza de Manzana (Malus spp) La pomaza de manzana, corresponde al residuo de la elaboración de la fruta para la producción de jugo concentrado, representa entre 15 y 20% de la fruta procesada e incluye restos fibrosos de la pulpa, cáscara y semilla, siendo rica en pectinas y ácidos orgánicos, además de fibra dietética y taninos; en el rubro jugos concentrados, el de manzana ocupa el primer lugar en exportación en nuestro país. En Chile, se destina cerca del 31% de la producción nacional de manzanas a este proceso, generando aproximadamente toneladas de pomaza. La pomaza de manzana es rica en ácidos orgánicos, además de fibra dietética y polifenoles. La pomaza de manzana actualmente se comercializa en estado fresco para alimentación animal, por lo cual su uso está limitado a productores ubicados cerca de las plantas procesadoras. La manzana es una buena fuente de fibra con un buen balance entre las fracciones soluble e insoluble (Gorinstein y cols., 2001). Por otra parte la fibra de manzana posee mejor calidad que otras fibras dietéticas debido a la presencia de compuestos bioactivos asociados, tales como flavonoides, polifenoles y carotenos (Wolfe y Liu, 2003). Paleta de Tuna, (Opuntia spp). El cultivo del nopal o tuna, es un recurso importante para las zonas áridas y semiáridas del mundo, de las cuales hay una cantidad significativa en el país. Existen actualmente en Chile cerca de ha plantadas de tuna. Durante la poda del nopal para la producción de fruta se generan considerables cantidades de paletas adultas (2-3 años) cuya materia seca está constituida principalmente por fibra, el uso actual en Chile de este desecho de la poda se limita solo a un escaso uso en alimentación animal quedando en gran parte en los campos donde sufren descomposición y fermentación.

18 Para el país sería interesante poder diversificar los usos de este cultivo aprovechando este residuo agrícola, al contar con procesos tecnológicos para la obtención de fibra purificada que pudiera ser utilizada en la formulación de IF utilizables en diversos alimentos. Los estudios acerca de las propiedades de los cladodios de nopal como agente cicatrizante, antiinflamatorio y antioxidante han ido en aumento en los últimos años (Galati y cols., 2002). Según dichos autores, la capacidad antioxidante de los cladodios se debe principalmente a la presencia de polifenoles del tipo de los flavonol glicósidos y derivados del ácido hidroxicinámico; en forma marginal, el ácido ascórbico presente, colabora con un 15% de la capacidad antioxidante encontrada. También se le ha atribuido a los cladodios de nopal un efecto beneficioso en la reducción del colesterol sérico (Malainine y cols., 2003). Una buena parte de sus propiedades pueden ser atribuidas a componentes asociados a la fibra dietética. COMPUESTOS BIOACTIVOS En las últimas décadas se le ha dado una gran importancia al aporte de compuestos bioactivos que puede tener un alimento. Estos compuestos se definen como componentes de los alimentos que condicionan actividades fisiológicas y celulares que resultan en efectos beneficiosos para la salud y no se clasifican como nutrientes, es decir no son esenciales para la vida. Normalmente, están en pequeñas concentraciones en los alimentos y actúan como antioxidantes, inhibidores o inductores de actividades enzimáticas, actividades de receptores o de expresión de genes, entre otras. Los compuestos bioactivos tienen un gran potencial para la fortificación de alimentos (Kahlon y Smith, 2004; Schwager, 2008). Los compuestos bioactivos dan origen a lo que se conoce como alimentos funcionales, los cuales por definición son considerados como alimentos procesados que demuestran mejorar una o más funciones del organismo, además del valor nutritivo propio de los mismos. Estos alimentos son importantes en la medida que presenten beneficios directos al individuo que los consuma (Barnes, 2008).Estos beneficios pueden ser tanto preventivos, como reducir el riesgo de una enfermedad; o reactivos, mejorando el estado de salud del individuo (Barnes, 2008). En un metanálisis reciente se establece, en un seguimiento por 27 años, que un bajo nivel en sangre, o baja ingesta de β-caroteno y/o α-tocoferol puede predecir independientemente la posibilidad de padecer resistencia a la insulina y diabetes tipo 2 (Ärnlöv y cols., 2009).

19 También se debe tener en cuenta, que estos compuestos presentan propiedades que dependen de su naturaleza y que afectarán las características de los alimentos en los que se incluyan (Wang y cols., 1999). Entre ellos se encuentran la fibra dietética, los antioxidantes como polifenoles, licopeno, tocoles, tioles e isoflavonas, entre otros. La función común de los ingredientes funcionales es su función antioxidante. Por ejemplo, los especies oxígeno reactivas pueden ser oxidadas y estabilizadas por flavonoides. Los compuestos que poseen estructura orthodihidroxi o quinona pueden interactuar con proteínas celulares en la vía Keap/Nrf2/ARE para activar la transcripción génica de enzimas antioxidantes. Los carotenoides y flavonoides pueden ejercer su acción modulando señales de traducción y expresión génica intracelularmente. Estos resultados recientes sugieren que estas actividades son las primeras responsables de la asociación entre los beneficios a la salud y el consumo de frutas y vegetales (Jacob y cols., 2012). Ver Figura N 1. Figura Nº1 Esquema de los blancos de acción de los compuestos bioactivos. Esquema de los blancos celulares de varios tipos de ingredientes funcionales que se encuentran en frutas y vegetales. Abreviaturas: AP1, activator protein 1; APC, antigen presenting cell; ARE, antioxidant response elements; DAG, diacylglycerol; ELK-1 [E Twenty-six (ETS)-like Transcription Factor 1]; ER- Endoplasmic reticulum; ERK, extracellular signal-regulated kinases; GDP/GTP, guanosine di-/triphosphate; HRE, hormone response elements; IP3, inositol trisphosphate; MAPK, mitogen activated protein kinase; NFAT, nuclear factor of activated T cells; NF-κB, nuclear factor kappa-b; PIP2, phosphatidylinositol bisphosphate; PLC, phospholipase C; PPAR, peroxisome proliferator activated receptor; RAF, rapidly activated fibrosarcoma oncogene analog MAPKKK; RAR, retinoic acid receptor; RXR, retinoid X receptor; ras, rat sarcoma subfamily of small GTPases; ROS, reactive oxygen species; Th0, Th1, Th2, T-helper cells.

20 Se ha demostrado que existen dos fenómenos importantísimos que se presentan en los alimentos; primero un fuerte efecto sinérgico entre distintos compuestos bioactivos, y segundo el efecto matriz en el cual estos compuestos presentan su máximo efecto en el alimento y no por sí sólo una vez extraídos (Hu y cols., 2012, Poudyal y cols., 2010). Por lo cual consideraremos como un hecho relevante el potenciar el efecto sinérgico de estos compuestos más que aislar o intentar definir de qué compuesto en particular proviene el beneficio. Aún así podemos intentar inferir algunos efectos de un compuesto en particular, como se observa a continuación. Fibra Dietética La fibra dietética es uno de los componentes de los alimentos más estudiados y en los últimos años, es ampliamente conocida y cada vez más valorada por los consumidores. Las dietas ricas en fibra están asociadas a la prevención, reducción y tratamiento de algunas enfermedades, tales como diverticulosis, cáncer de colon, enfermedades coronarias (Villanueva-Suárez y cols., 2003). El efecto fisiológico está relacionado con las propiedades físicas, químicas y funcionales de la fibra dietética (Chau y Huang, 2003). Ver Figura N 2 Figura Nº2 Efectos de la Fibra Dietética FIBRA DIETÉTICA ESTÓMAGO Retraso Vaciamiento Gástrico Sensación de Saciedad Disminución absorción intestinal de colesterol Inhibición síntesis hepática de colesterol INTESTINO DELGADO Dificulta acción enzimas digestivas Aumenta producción de CCK y GLP-1 Disminución absorción nutrientes (glucosa) Aumento liberación insulina Secuestro ácidos biliares y excreción INTESTINO GRUESO Fermentación (producción AGCC) Incremento síntesis hepática de ácidos biliares Acetato Butirato Propionato Obtención energía en tejidos periféricos Síntesis hepática de ácidos grasos Obtención energía colonocito Facilita absorción colónicana+ y H2O Promueve crecimiento y diferenciación colonocitos Inhibición crecimiento células tumorales Asegura la integridad de la mucosa colónica y la respuesta inmune Mejora resistencia insulínica en adipocitos. Metabolización hepática Activación gluconeogénesis y lipogénesis

21 Los principales efectos fisiológicos positivos de la fibra son una disminución de los niveles de colesterol en la sangre, modificación a la respuesta glicémica y mejoramiento de la función del intestino grueso (Chen, y cols., 2008). En estudios realizados se descubrió que incorporando 30 gramos al día de fibra mejoraron significativamente la sensibilidad a la insulina y muchos otros componentes del síndrome de resistencia a la insulina, incluyendo la hipertensión y la glucosa, el colesterol y los triglicéridos en sangre (Bunzel y cols., 2001; Parillo y Riccardi, 2004). Polifenoles Desde un punto de vista nutricional, la actividad antioxidante se asocia con su papel protector en las enfermedades cardiovasculares y en el cáncer así como en procesos de envejecimiento por lo que está siendo intensamente estudiado mediante ensayos "in vivo" e "in vitro", (Martínez-Valverde y cols., 2000). El ácido ferúlico y cafeíco (ácidos cinámicos) actúan previniendo la formación de carcinógenos a partir de precursores específicos y bloquean la reacción de los carcinógenos con las macromoléculas celulares. Los bioflavonoides son muy útiles como complemento nutricional en los pacientes diabéticos, esto debido a que promueven la secreción de insulina y son potentes inhibidores de la acumulación de sorbitol. Los efectos bioquímicos nutricionales de los bioflavonoides incluyen un aumento en los niveles de vitamina C dentro de las células, una disminución en la fuga y la ruptura de los vasos sanguíneos pequeños y apoyo al sistema inmunológico, todo lo cual beneficia a los pacientes mejorando la sensibilidad a la insulina, con una consecuente disminución de la glucosa, triglicéridos y colesterol séricos totales y un aumento en los niveles de las lipoproteínas de alta densidad (Hu y Van Dam, 2001). Tocoles Los tocoferoles y tocotrienoles (tocoles) son un grupo de compuestos liposolubles, reconocidos genéricamente bajo el término de vitamina E. Se encuentran en buenas cantidades en vegetales, frutas, semillas y nueces. A pesar que los cereales son una modesta fuente de lípidos, estos son considerados una buena fuente de tocoles, aun cuando sus concentraciones y composición varía según la fuente de la cual provenga (Panfili y cols., 2003). Los tocoferoles han sido señalados como los más eficientes antioxidantes para romper la cadena de formación de radicales libres. Sin embargo, estudios de Packer (1995) y Zhimin y cols. (2001) indican que los tocotrienoles son al menos 3 veces más eficientes capturadores de radicales libres que los tocoferoles.

22 La actividad biológica de los tocotrienoles se relaciona con su poder antioxidante mediante la inhibición de la peroxidación de las membranas biológicas (Zhimin y cols., 2001). Se sabe que la oxidación de los productos del colesterol son considerados como compuestos mutagénicos y carcinogénicos, reacción que será inhibida por la presencia de antioxidantes como la vitamina E. Por otra parte, estudios de Zhimin y cols. (2001) y Qureshi y cols. (2000) sugieren que los tocoferoles y tocotrienoles (componentes de la vitamina E) reducen significativamente los riesgos de cáncer y de enfermedades coronarias. Las propiedades multiterapéuticas de los tocotrienoles como hipocolesterolémicas, antioxidante, antitrombótica, anticancerígenas (antiproliferativo) y antinflamatoria han sido señaladas en numerosos estudios con animales y humanos (Qureshi y cols., 2000). Sus actividades biológicas varían y están influenciadas según la ubicación de su grupo metilo. El γ- tocotrienol es considerado como el más potente inhibidor del colesterol, seguido por el α-tocotrienol (Qureshi y cols., 1997). En base a estos antecedentes este proyecto de tesis se propuso generar un ingrediente funcional (IF) formado por PAI de afrechillo de arroz, de afrechillo de amaranto, pomaza de manzana y tomate, y paleta de tuna, cuyo contenido de fibra, fitoesteroles, estanoles, y antioxidantes otorga propiedades normoglicémicas y/o hipolipémicas. Nuestra hipótesis de trabajo propone que ratas Wistar albinas obesas, al ser alimentadas con éste IF durante 30 días, normalizan sus parámetros glicémicos y lipémicos a través de cambios bioquímicos y genómicos. Objetivo General Determinar el efecto de un ingrediente funcional sobre parámetros bioquímicos, genómicos y de estrés oxidativo, en ratas alimentadas con una dieta alta en grasa. Estimación de un posible efecto normoglicémico e hipolipémico. OBJETIVOS ESPECÍFICOS: 1. Estandarización de una dieta de cafetería y determinación de los cambios que esta dieta es capaz de inducir en un modelo experimental de obesidad. 2. Determinación de una mezcla de productos alimentarios intermedios (PAI), para obtener un ingrediente funcional (IF) que posea características funcionales (fibra, capacidad antioxidante y polifenoles) y que mejore la glicemia y/o triglicéridos en un estudio de dosis aguda.

23 3. Determinación de los parámetros metabólicos (peso e ingesta) y bioquímicos en ayuno (glicemia, insulina, y perfil lipídico) en cuatro grupos de ratas alimentadas con dieta control y en ratas alimentadas con dieta alta en grasa. Impacto de la adición del IF en la dieta en un período de 30 días de consumo. 4. Determinación los parámetros de estrés oxidativo tales como: actividad enzimática de SOD y CAT, en los cuatro grupos experimentales. 5. Análisis del patrón de expresión génica del gen Mfn2, UCP2, PPARα, PPARγ y SOD2 en músculo, hígado, páncreas y tejido adiposo en los cuatro grupos experimentales.

24 MATERIALES Y MÉTODOS MATERIAS PRIMAS: Recolección: Las materias primas, se recolectaron de la siguiente forma: -Afrechillo de arroz, de la variedad Diamante, proveniente de los molinos de la planta de Retiro de la Empresa Tucapel, VII Región. -Afrechillo de amaranto, proveniente de la especie Amaranthus cruentus L., de la localidad de Pirque, Región Metropolitana, cosecha 2007/2008 y 2010/ Pomaza de manzana, provino de la Planta de la empresa productora de jugo concentrado de manzana y otros, Patagonia Fresh S.A, ubicada en la localidad de San Fernando, VI Región. -Pomaza de tomate, se obtuvo de la empresa Tres Montes-Lucchetti (Ex- Aconcagua Foods) de la planta ubicada en la localidad de Quinta de Tilcoco, VI Región. Se obtuvo muestras cada 15 días durante toda la temporada de proceso 2009, 2010 y Harina de paleta de tuna, cosechadas el año 2010, provenientes de distintas localidades. La harina de paleta de tuna fue obtenida de cladodios de 2 a 3 años de edad provenientes de la provincia de Til Til (RM) y de la Estación experimental Las Cardas (IV región). Además, se cosecharon paletas de 250, 500, 750 y 1000 g del jardín de variedades de la Facultad de Ciencias Agronómicas de la Universidad de Chile. Obtención de los distintos productos alimentarios intermedios (PAIs), a partir de materias primas: El procedimiento para cada una de las materias primas fue el siguiente; Para arroz y amaranto: acondicionamiento, inactivación de enzimas (sólo arroz), molienda gruesa, molienda fina, y tamizado. Para manzana y tomate: lavado y eliminación de partículas extrañas, centrifugado, secado separación de semilla, molienda gruesa, molienda fina y tamizado. Para nopal: eliminación de partículas extrañas, triturado, lavado, drenado, molienda gruesa, molienda fina y tamizado. Caracterización física de los PAIs e Ingredientes Funcionales (IFs): Las características físicas evaluadas en los PAIs e IFs fueron para afrechillo de arroz, afrechillo de amaranto: humedad, materia seca, color y granulometría. En pomazas de manzana y tomate y cladodios de nopal: humedad, materia seca. La determinación de humedad y porcentaje de materia seca se obtuvo mediante el método de la AOAC (Association of Official Analytical Chemists) (1990).

25 La granulometría se evaluó mediante el método de la AACC (American Association for Clinical Chemistry) (1989) y en aquellas en que se evaluó porcentaje de semillas, primero se separaron las semillas por métodos mecánicos y neumáticos y luego se determinó el porcentaje de semillas por método gravimétrico, con 100 gramos de materia prima. El color fue medido instrumentalmente con colorímetro Minolta modelo CR 200b (Japón), con iluminante D65, se midieron los parámetros de color L, a* y b*. Caracterización química de los PAIs e IFs: Cada uno de los PAIs e IFs se sometió a diferentes análisis químicos; proximal (determinación de proteínas, lípidos, fibra cruda, cenizas y extracto no nitrogenado), fibra dietética (soluble, insoluble y total), compuestos fenólicos totales, capacidad antioxidante (DPPH), tocoles, ácido fítico, lisina, fitoesteroles, escualeno y licopeno, análisis que fueron específicos para cada materia prima. TIPOS DE DIETA: Se utilizaron tres tipos de dieta, detallados a continuación. -Dieta de cafetería (alta en grasa): La dieta de cafetería se realizó mezclando una parte de tocino, pellet comercial, galletas de manjar, papas fritas, chocolate blanco y dos partes de paté de ternera. Cada ingrediente fue cuidadosamente molido y se formó una pasta, la cual fue moldeada en forma de pellets de 20 gr cada uno. La composición de esta dieta se muestra en la Tabla N 1. La elaboración de la dieta y la administración de la misma también tuvo un período de pruebas hasta encontrar la forma más apropiada. (García-Díaz y cols. 2007, Sampey y cols y Sampey y cols. 2012) Tabla Nº1 Composición Dieta de Cafetería (alta en grasa). 100g Tocino Paté Galletas Chocolate Papas Pellet TOTAL x2 fritas Energía (kcal) ,6 432,1 Proteínas (g) 8 11,9 5, ,0 9,8 Grasa total (g) 49, , ,2 27,0 Grasa saturada(g) 18,2 9,2 7, ,0 8,4 Grasa monoinsaturada (g) 23,8 11,1 6, ,5 2,9 12,5 Grasa poliinsaturada (g) 6 4,6 1, ,5 5,3 7,5 Colesterol (mg) ,0 46,4 HC disponibles (g) 0 1,4 71, ,6 34,0 Sodio (mg) ,8 4,0 451,1 Fibra (g) 5 6,2 1,6

26 -Dieta control con pellet comercial especial para ratas y roedores marca Champion -Dieta control estándar, para estudio crónico del IF. Esta dieta se preparó de forma manual y se administró a los animales en forma de polvo. La composición de esta dieta se muestra en la Tabla Nº2. Esta dieta cumple los criterios del Instituto Americano de Nutrición (AIN), basándose en la dieta AIN-93G (Reeves y cols. 1993) Tabla Nº2 Composición Dieta de Estándar AIN g Caseína Almidón Azúcar Aceite de Chuño TOTAL de Maíz flor maravilla Energía (kcal) Proteínas (g) Grasa total (g) Grasa saturada (g) ,93 0 0,93 Grasa monoinsaturada (g) ,31 0 2,31 Grasa poliinsaturada (g) ,76 0 6,76 Colesterol (mg) HC disponibles (g) ,5 0 15,5 30 Sodio (mg) Fibra (g) *Además contiene (en 100g) DL-metionina (0,3g), Mezcla de Minerales (5g), de Vitaminas Liposolubles (2) e Hidrosolubles (3). DISEÑO EXPERIMENTAL Se utilizaron ochenta ratas Wistar adultas, macho (Bioterio de la Facultad de Medicina) con un peso entre 170 y 240 g. Se colocaron en jaulas y se mantuvieron en condiciones normales (humedad, 60±10%; temperatura 23±1 C, y periodos de 12 horas de luz y 12 horas de oscuridad). Las ratas fueron alimentadas, independientemente del tipo de dieta de forma ad libitum, y se les permitió libre acceso al agua. Sin embargo, la comida fue retirada 12 horas antes de cada procedimiento (toma de muestra, test de tolerancia a la glucosa oral o sacrificio). Las ratas fueron utilizadas para 3 protocolos distintos; 16 ratas para determinar los efectos de la dieta de cafetería, 32 ratas para determinar los efectos de la ingesta aguda de los distintos PAIs e IFs y 32 ratas para determinar el efecto de la ingesta crónica del IF seleccionado.

27 Efectos dieta de cafetería: Para determinar los efectos de la dieta de cafetería se tomaron 16 ratas Wistar macho de 21 días de edad, 8 ratas fueron alimentadas con pellet comercial para ratas (Champion ) y 8 ratas fueron alimentadas con dieta de cafetería. Ambos grupos se distribuyeron aleatoriamente de forma que los pesos entre ellos no presentaran una diferencia mayor a una desviación estándar. Se registró la ingesta y el peso de ambos grupos semanalmente. Al cabo de 16 semanas, los animales fueron sacrificados. El día anterior se les retiró su alimentación, luego los animales fueron pesados y se anestesiaron con Ketamina/Diazepan (125/2,5mg/kg de peso corporal). Se extrajeron 2 tubos de 4ml cada uno de sangre en tubo con EDTA, mediante punción cardiaca y se extrajo una muestra hepática para histología y para homogenizado hepático, para determinar; proteínas de glicosilación avanzada, malondialdehído, actividad enzimática de superóxido dismutasa, catalasa y glutatión peroxidasa. Con la muestra de sangre se determinó glicemia, insulina, y perfil lipídico. Efectos ingesta aguda PAIs e IFs: Para determinar los efectos de los distintos PAIs e IFs se tomaron 32 ratas Wistar macho de 21 días de edad, 8 ratas fueron alimentadas con pellet comercial para ratas (Champion ) y 24 ratas fueron alimentadas con dieta de cafetería durante 12 semanas. AL finalizar las 12 semanas se comprobó que el peso de las ratas alimentadas con dieta alta en grasa superara efectivamente a las ratas control en un 25%. Se utilizaron ratas en grupos de 8, un grupo de ratas control y tres grupos de ratas obesas. Dentro del grupo de ratas alimentadas con dieta de cafetería, las ratas se distribuyeron de forma que no existiesen diferencias de peso entre los tres grupos. A cada grupo se le efectuó un test de tolerancia oral a la glucosa (TTGO), y determinación de triglicéridos, con y sin PAI, con y sin IFs. Cada grupo se utilizó para determinar los efectos de 3 PAIs (uno a la vez), y entre determinaciones las ratas tuvieron un período de entre 7 a 10 de descanso sin efectuar mediciones ( wash-out ). La concentración de PAI e IF que se utilizó fue de 250 o 125 (mg/kg) Efectos ingesta crónica de IF: Para determinar los efectos de la ingesta crónica de IF se tomaron 32 ratas Wistar macho de 21 días de edad, 16 ratas fueron alimentadas con dieta control estándar AIN93 y 16 ratas fueron alimentadas con dieta de cafetería. Ambos grupos se distribuyeron aleatoriamente de forma que los pesos entre ellos no presentaran una diferencia mayor a una desviación estándar. Se registró la ingesta y el peso de ambos grupos semanalmente. Al cabo de 12 semanas (considerado tiempo 0), se tomó muestra de sangre la cuál se obtuvo por incisión de la porción distal de la cola, para determinar glicemia, insulina, perfil lipídico, proteínas de glicosilación avanzada, malondialdehído, actividad enzimática de superóxido dismutasa y catalasa. Cada grupo se subdividió en dos grupos de forma que los pesos entre ellos no presentaran una diferencia mayor a una desviación estándar.

28 De esta manera quedaron conformados 4 grupos de trabajo. El Grupo Nº1 alimentado con dieta control estándar AIN93 (DC), el Grupo Nº2 alimentado con dieta control estándar AIN93 más el IF al 1% (DC+IF), el Grupo Nº3 alimentado con dieta de cafetería (CAF) y el Grupo Nº4 alimentado con dieta de cafetería más el IF al 1% (CAF+IF). A los 15 días post inicio del tratamiento se realizó una segunda toma de muestra de sangre la cuál se obtuvo por incisión de la porción distal de la cola. Se extrajo entre 1 y 1,5 ml de sangre en tubo con EDTA y 2 capilares heparinizados para la determinación inmediata de glicemia y triglicéridos mediante Accutrend GCT. Los tubos con EDTA se centrifugaron a 3000 x g por 10 minutos. Se retira el plasma y se alícuota en dos tubos que se dejan a -20º C, para análisis posteriores de insulina y perfil lipídico. A los 30 días post inicio del tratamiento, se realizó la disección de los animales, alternando los grupos. El día anterior se les retiró su alimentación, luego los animales fueron pesados y se anestesiaron con Ketamina/Diazepan (125/2,5 mg/kg de peso corporal). Se extrajeron 2 tubos de 4 ml cada uno de sangre en tubo con EDTA, mediante punción cardiaca. Posteriormente, se abrió la cavidad abdominal mediante incisión recta. Se ubicó el páncreas, se retiró y se trozó en pedazos de 0,5 x 0,5 cm aproximadamente, dejándolos en crio tubos con RNA later (Ambion). Se ubicó el hígado y se ligó la vena porta superior y mediante mariposa colocada en la vena porta inferior se perfundió el hígado con PBS, durante 5 minutos a un flujo de 10 ml/min. Posteriormente se soltó la ligadura para permitir el vaciado de la sangre. Una vez que el hígado perdió su coloración rojiza, el órgano se retiró y trozó. Los cortes se destinaron para corte histológico (dejándolos en tubo Falcon de 15 ml con formalina al 10%) y para extracción de RNA, se retiró y se trozó en pedazos de 0,5 x 0,5 cm aproximadamente, dejándolos en crio tubos con RNA later (Ambion). Paralelamente, se separó 2 g de hígado para preparar un homogeneizado hepático. Se retiró el músculo soleus desde la pierna izquierda del animal y se trozó en pedazos de 0,5 x 0,5 cm aproximadamente, para extracción de RNA dejándolos en crio tubos con RNA later. Iguales procedimientos se realizaron con tejido adiposo visceral. MEDICIÓN DE PARÁMETROS BIOQUÍMICOS: Glicemia y triglicéridos in situ: La determinación de glicemia y triglicéridos inmediata de glicemia y triglicéridos se realizó con tiras reactivas mediante Accutrend GCT. Test de tolerancia oral a la glucosa: Se administró de forma intragástrica, mediante jeringa punta de bola, la cantidad de 1g de glucosa por kilo de rata, y luego se determinaron los niveles de glicemia mediante tira reactiva a los 0, 15, 30, 60, 120, y 180 min. Las muestras de sangre se obtuvieron por incisión de la porción distal de la cola.

29 Medición de triglicéridos: Se determinaron los triglicéridos a los tiempos 0, 60, 120 y 180 min. Las muestras de sangre se obtuvieron por incisión de la porción distal de la cola. Determinación de glicemia y perfil lipídico: Se analizó en plasma la glicemia y el perfil lipídico (colesterol total, HDL, y triglicéridos), mediante método colorimétrico DIALAB, de las muestras de sangre provenientes de los cuatro grupos (n=32) en tres tiempos. Se realizaron los cálculos para determinar LDL mediante la fórmula de Friedewald (colesterol total-((triglicéridos/5)+hdl)) y VLDL (triglicéridos/5) Insulina plasmática y HOMA: Se determinó la concentración de Insulina en plasma de mediante kit para la determinación de Insulina Ultrasensible (Insulin (Rat) Ultrasensitive ELISA, ALPCO). La presencia de insulino resistencia fue evaluada mediante el método homeostasis model assessment (HOMA IR), el cual es un modelo matemático y computarizado desarrollado por Matthews y col. (1985), como una forma alternativa para cuantificar la resistencia a la insulina y la disfunción de la célula beta pancreática, con dos variables como son la glicemia y la insulina plasmática en ayunas. Actividad enzimática de SOD y CAT y cantidad de MDA y AGE en extracto hepático: Se prepararon extractos hepáticos, para ello se colocó el tejido en 5-10 ml de buffer HEPES 20 mm frio, ph 7,2; conteniendo EGTA 1 mm, manitol 210 mm y sacarosa 70 mm por gramo de tejido, se centrifugó a 1,500 x g durante 5 minutos a 4 C, luego se removió el sobrenadante y se almacenó a -80 C para determinaciones posteriores. A estos extractos se les determinó la cantidad de proteínas mediante el kit Pierce BCA Protein Assay Kit. Se determinó la actividad de SOD Superoxide Dismutase Assay Kit CAYMAN, y CAT Catalase Assay Kit CAYMAN, mediante kits de ELISA. Se determinó cantidad de MDA OxiSelect MDA Adduct ELISA kit CELL BOLABS, INC y AGE OxiSelect Advanced Glycation End Product (AGE) ELISA Kit CELL BOLABS, INC, mediante kits de ELISA. Todos estos datos fueron corregidos por la cantidad de proteínas. ANÁLISIS DE EXPRESIÓN DE GENES: Se extrajo RNA mediante EZNA total RNA kit (Omega Biotek) las muestras de hígado, páncreas, y tejido adiposo. La muestra se trató con DNAsa directamente en la columna de extracción de acuerdo al protocolo del proveedor.

30 La extracción de RNA desde músculo, se realizó mediante Trizol. Se cuantificó la cantidad y pureza del RNA. Con el RNA se sintetizó el cdna a partir de RNA mensajero mediante oligo (dt), para ello se utilizó el kit ImProm-II Reverse Transcription System (Promega). Se determinaron las secuencias adecuadas para el diseños de los partidores de los genes en estudio (Mfn2, UCP2, SOD2, PPARα y PPARγ) y de tres endógenos (ATP5b, B2m y TOP1). Las secuencias de todos los partidores se resumen en la Tabla Nº3. Se determinó la temperatura de annealing apropiada y las curvas de calibración para cada gen. Se determinó el gen endógeno adecuado para cada tejido y se cuantificó la expresión de los transcritos mrna para los genes indicados en páncreas, hígado, tejido adiposo visceral y músculo. Los PCRs en tiempo real se realizaron en el equipo Stratagene mx3000p, y los datos fueron analizados en forma individual en planilla EXCEL mediante fórmula de Pfaffl (Pfaffl. 2001). Tabla Nº3 Secuencias de partidores utilizados para PCR en tiempo real. Gen Partidores Secuencia Tm Q Dímeros PPARg forward AGGGCGATCTTGACAGGAAA 55,6 96 No reverse ACAGCTTCCACGGATCGAAA 56,3 96 No PPARa forward AGCCATCTTCACGATGCTGT 56,4 97 No reverse TCATCCAGTTCGAGGGCATT 55,7 96 No UCP2 forward TGTCGAAGCCTACAAGACCA 55,3 95 No reverse AGGCAGAAGTGAAGTGGCAA 56,4 97 No SOD2 forward ACGCGACCTACGTGAACAAT 56,8 97 No reverse TTAGGGCTCAGGTTTGTCCA 55,1 95 No Mfn2 forward ACAGAGGAAGTGGAAAGGCA 55,4 96 No reverse AGCGGTCAGACATGTTTCGT 56,6 97 No ATP5b forward GGGCAAATTGTGGCAGTCAT 56,0 96 No reverse AACCAAGCCTTCAGTGCCAT 56,8 97 No B2m forward CCGTGATCTTTCTGGTGCTT 54,9 94 No reverse TCTATCTGAGGTGGGTGGAA 53,6 93 No Top1 forward AAAAGCGCTAAGGCTGATGC 56,3 96 No reverse AGGTCCCCAAGGCAATTTGT 56,3 96 No

31 ANÁLISIS ESTADÍSTICO Las bases de datos se crearon en Excel y el análisis estadístico se llevó a cabo utilizando el programa SPSS, versión 15 para Windows. Se realizó análisis de normalidad (Wilcoxon). Para las variables normales se realizó ANOVA de una vía y ANOVA de dos vías para variables en función del tiempo con post hoc Tukey. Para variables no paramétricas se utilizó análisis de Kruskal Wallis con post hoc Tukey. Considerándose estadísticamente significativas las diferencias con p < CONSIDERACIONES ÉTICAS Todos los procedimientos (estabulación, manipulación, toma de muestra, anestesia y eutanasia) se realizaron de acuerdo con los Aspectos Bioéticos de la Experimentación Animal, acordados en el 4to Taller de Bioética: Aspectos Bioéticos de la Experimentación Animal en Enero del 2009, organizado por Comité Asesor Bioética Fondecyt - Conicyt. El estudio fue aprobado por el Comité de Ética del INTA.

32 RESULTADOS Y DISCUSIÓN 1. Estandarización de una dieta de cafetería y determinación de los cambios que esta dieta es capaz de inducir en un modelo experimental de obesidad. - Estandarización de Dieta de Cafetería: La obesidad humana ha alcanzado proporciones epidémicas en todo el mundo. Para poder estudiarla se han generado varios modelos animales de obesidad (Reuter, 2007). Sin embargo, estos no necesariamente reflejan el daño que provoca la mala alimentación humana, con alimentos muy calóricos, con un alto contenido de sal y de grasa y bajos en fibra, antioxidantes y micronutrientes. La Dieta de Cafetería o de Palatabilidad, en un comienzo llamada dieta de supermercado, fue diseñada por Sclafani y Berner (1976), en esa ocasión utilizó productos de supermercado densos energéticamente y se lo ofreció de manera ad libitum a las ratas. Éstas aumentaron rápidamente de peso y sus principales conclusiones fueron que esta dieta provocaba hiperfagia. Desde el año 1976, diversos investigadores han utilizado este tipo de dieta con distintos propósitos, pero su composición es variable y por lo tanto siempre es importante su estandarización (Sclafani y Berner, 1976). La composición de la Dieta de Cafetería que ocupamos se observó en la Tabla Nº1 (Ver Material y Métodos). Esta dieta es una modificación a la utilizada por García-Díaz y cols.(2007). Consiste en una parte de papas fritas (Lays ), una parte de galletas dulces (Santiago - Manjar), una parte de chocolate blanco (Costa ), una parte de tocino (La Catalana ), una parte de dieta control (pellet) y dos partes de paté (San Jorge Ternera). La primera modificación que se realizó fue cambiar el chocolate negro por chocolate blanco. Esto se modificó debido a que el chocolate negro posee antioxidantes y como nuestro objetivo era probar el efecto de un ingrediente funcional alto en antioxidantes, necesitábamos una dieta que no los tuviera. La segunda modificación fue la utilización de papas fritas sin sal, la dieta de cafetería es alta en sal, pero esto suele provocar hipertensión, baja palatabilidad y otras complicaciones (Dobrian y cols, 2003), por lo cual decidimos disminuir la ingesta de sal. La dieta de cafetería con papas fritas sin sal posee 451 mg de sodio/100 g, y con papas fritas con sal esta cantidad aumenta a 604 mg de sodio/100 g.

33 Es importante señalar que esta dieta posee sólo el 14% del requerimiento de vitaminas y minerales de acuerdo a la dieta estándar AIN-93. No obstante, Rothwell y Stock (1988) mostraron que no existe evidencia experimental en ratas de que esta dieta produzca un déficit nutricional debido a su consumo a largo tiempo, ya que no afecta ni el tamaño de las crías, ni su peso, ni su crecimiento, ni su longevidad. La composición de la dieta de cafetería y el pellet que consumió el grupo control se observan en la Tabla N 4, estos valores fueron tomados desde la información nutricional informada por los fabricantes. Se observa que el contenido de nutrientes de la dieta de pellet se encuentra balanceada y cumple con los requerimientos de la rata. La dieta de cafetería, en cambio, posee mayor cantidad de grasa total, grasa saturada, grasa mono insaturada, colesterol, sodio, y menor cantidad de proteínas y fibra. Por lo cual la dieta de cafetería es un buen reflejo de la alimentación chatarra que causa un tipo de trastorno de síndrome metabólico similar al que se produce en el ser humano con este tipo de alimentación. Tabla N 4 Composición de las dietas. 100g Pellet Dieta de Cafetería Energía (kcal) 386,6 432,1 Proteínas (g) 20,0 9,8 Grasa total (g) 9,2 27,0 Grasa saturada (g) 1,0 8,4 Grasa monoinsaturada (g) 2,9 12,5 Grasa poliinsaturada (g) 5,3 7,5 Colesterol (mg) 0,0 46,4 HC disponibles 54,6 34,0 Sodio (mg) 4,0 451,1 Fibra (g) 6,2 1,6 Se observa que la dieta de cafetería presentó un 150% más de grasa que el control, con sólo un pequeño aporte extra de energía, por lo cual concluimos que efectivamente corresponde a una dieta alta en grasa. Esta dieta además posee menos proteínas e hidratos de carbono disponibles.

34 Peso (gramos) - - Inducción de Obesidad: En la Figura N 3 se resume el registro del peso semanal de ratas obesas y controles. Se observó que las ratas alimentadas con dieta de cafetería aumentaron de peso más rápido que las ratas alimentadas con pellet comercial. Este aumento se mantuvo hasta las 7 semanas, luego el aumento fue similar al del grupo control. Debido al aumento de las primeras semanas las ratas alimentadas con dieta de cafetería mantuvieron un peso mayor. Figura N 3 Registro de peso de ratas alimentadas con Dieta de Cafetería (CAF) y con pellet control * * * * * * * Tiempo (semanas) CAF Pellet ANOVA de una vía: *p<0.05, comparado contra el grupo pellet. El aumento de peso obtenido es comparable a lo obtenido por Sampey y cols. (2011) quienes compararon las consecuencias obesogénicas e inflamatorias de una dieta de cafetería (CAF) en comparación con una dieta HFD (manteca de cerdo al 45%) en un modelo de ratas macho Wistar. El peso corporal aumentó dramáticamente y se mantuvo significativamente elevado en ratas alimentadas con CAF en comparación con todas las otras dietas. El trabajo experimental se realizó con los grupos: Dieta cafetería y Dieta control, los que se observan en la Tabla N 5.

35 Tabla N 5 Datos Descriptivos de ambos grupos Diferencias entre grupos Dieta de cafetería (n=12) Dieta Control (n=12) Edad al inicio del estudio (días) Edad al término del estudio (días) Peso al inicio del estudio (g) 265,8 264,1 Peso al término del estudio (g) 564,2* 421,8 t-test: *p<0.05, comparado contra el grupo control. Ambos grupos fueron idénticos en edades y no presentaron diferencias significativas en su peso inicial. No obstante, su peso a las 16 semanas fue diferente, llegando las ratas que recibieron dieta de cafetería a tener un 33% más de peso que las ratas controles (p 0,05). Para efectos de este estudio, se consideró como obesidad la característica de poseer un 20% o más de peso corporal comparado con el grupo control. El grupo que recibió la dieta de cafetería presentó más de un 20% más de peso corporal comparado con el grupo control desde la séptima semana de tratamiento. En la Tabla Nº 6, se resume la información relacionada a los cambios metabólicos y bioquímicos que produjo la alimentación ad libitum de las ratas sometidas a dieta de cafetería (alta en grasa). Observamos que la ingesta de la dieta de cafetería provocó un aumento del 44% de ingesta (p 0,005). Shafat y cols. (2009) mostraron similar aumento en la ingesta (58%), utilizando condiciones de estudios similares. Éste aumento de la ingesta fue directamente proporcional a la densidad energética de la dieta ofrecida. Milagro y cols. (2009) demostraron que el consumo de la dieta de cafetería además de aumentar la ingesta, afectó la metilación del promotor de leptina provocando una hipoleptinemia. Finalmente, la dieta de cafetería en conjunto con el aumento en la ingesta, es lo que provoca el aumento de peso de las ratas y la posterior obesidad. Los parámetros bioquímicos observados en la Tabla Nº6, mostraron un aumento de los valores de insulina, glicemia, colesterol total, triglicéridos, LDL y VLDL (p 0,005). Estos resultados concuerdan con lo observado por García- Díaz y cols. (2007); Milagro y cols. (2009); Sampey y cols. (2011) y Sampey y cols. (2012).

36 Tabla N 6 Cambios metabólicos y bioquímicos de ratas alimentadas con Dieta de cafetería y dieta pellet control. Dieta Variables a las 16 semanas % de cambio CAF Pellet p* Prom. DE Prom. DE Peso (g) 33,3 564,2 7,6 421,8 5,7 0,0001 Ingesta (g/sem) 44,3 308,5 6,6 213,7 8,0 0,0001 Glicemia (mg/dl) 44,1 169,1 8,4 117,4 3,6 0,0001 Insulina (ng/ml) 420 2,6 0,1 0,5 0,1 0,0001 Colesterol (mg/dl) 62,8 94,1 5,6 57,8 1,1 0,0001 LDL (mg/dl) 103,6 37,4 2,1 18,4 1,1 0,0001 Triglicéridos (mg/dl) 202,8 166,5 3,5 55,0 9,0 0,0001 VLDL (mg/dl) 202,7 33,3 0,7 11,0 1,7 0,0001 HDL (mg/dl) -17,6 23,4 4,5 28,4 2,4 0,338 *t-test, comparado contra el grupo pellet. Aunque se observó una disminución de los valores de HDL con respecto al grupo control, esta diferencia no fue significativa. Solo Sahin y cols. (2011) han mostrado un descenso significativo de HDL inducido por dieta, esto se debe principalmente a que las ratas poseen un metabolismo de lipoproteínas diferente. Los resultados obtenidos nos permiten sugerir que la dieta de cafetería indujo un cuadro de síndrome metabólico, en el cual es posible observar características de obesidad, dislipidemia e hiperinsulinemia. Para determinar los efectos de la dieta de cafetería en la respuesta frente a una carga de glucosa, se realizó un test de tolerancia a la glucosa oral (TTGO) al grupo de ratas control y a las ratas obesas (Figura N 4). Observamos que la respuesta a la glucosa en las ratas controles se encuentra regulada. Sin embargo, la respuesta de las ratas obesas resultó ser más tardía y el valor de glicemia alcanzó cifras de hasta los 185 mg/dl una hora post ingesta. La normalización de esta curva glicémica se logró después de 3 horas.

37 Glicemia (mg/dl) Figura N 4 Test de Tolerancia a la Glucosa Oral en ratas alimentadas con dieta CAF y pellet Pellet CAF Tiempo (minutos) t-test: *p<0.05, comparado contra el grupo pellet (n=8). Resulta interesante destacar, que el valor pre-ingesta de glucosa es diferente tanto en ratas obesas (135,5 mg/dl) comparada con ratas controles (103,5 mg/dl) (test; p 0,005), lo anterior nos indica que la dieta alta en grasa no solo provocó un aumento sustancial en el peso de la rata, sino también cambios negativos en el metabolismo de la glucosa. Se realizó análisis histológico de cortes de hígado, con el objetivo de observar los posibles efectos deletéreos que podría tener una dieta hipergrasa. Al respecto, se realizaron cortes histológicos (n=6) de los hígados, previamente perfundidos, de las ratas alimentadas con dieta de cafetería o dieta control. Los cortes fueron teñidos con hematoxilina-eosina y se observaron con aumento 40X. En la Figura N 5 y 6, se observan los hepatocitos tanto en ratas alimentadas con dieta control como en aquellas alimentadas con dieta de cafetería respectivamente. La Figura N 5 muestra cordones de hepatocitos que confluyen a la vena central (VC). Los hepatocitos con citoplasma normal y núcleo central con cromatina normal, se observan limitando con capilares sinusoidales (S), en donde se pueden observar algunas de las células endoteliales (CE) que los constituyen y los macrófagos o células de Kupffer (CK).

38 Figura N 5: Hepatocitos de ratas alimentadas con dieta control. Tinción Hematoxilina Eosina. Aumento 40X, n=3. VC: Vena Central, S: capilares Sinusoidales, CE: Células Endoteliales, CK: Células de Kupffer. (n= 3 por grupo) Figura N 6: Hepatocitos de ratas alimentadas con dieta de cafetería. Tinción Hematoxilina Eosina. Aumento 40X, n=3. VC: Vena Central, S: capilares Sinusoidales, CE: Células Endoteliales, CK: Células de Kupffer, MV: esteatosis Micro Vesicular, N: Núcleos. (n= 3 por grupo)

39 La Figura N 6 se muestran cordones de hepatocitos que confluyen a la vena central (VC). La mayoría de los hepatocitos se observaron de forma irregular, con membrana plasmática engrosada y con esteatosis microvesicular (MV) (células espumosas) que probablemente en el tiempo conllevará a una esteatosis macro vesicular por fusión de éstas micro vesículas lipídicas. De hecho, es posible observar algunos hepatocitos con núcleos más periféricos que centrales (N). Cabe destacar que el lumen de los capilares sinusoidales se observa disminuido, lo que probablemente altera al espacio de Disse y dificulta el intercambio metabólico del órgano. La esteatosis microvesicular se debe a alteraciones del ciclo de la beta oxidación intra-mitocondrial de los ácidos grasos de cadena larga. La existencia de alteraciones mitocondriales ha sido comprobada por evidencias morfológicas y por la presencia de las alteraciones metabólicas típicas. En resumen, estos datos me permiten concluir que la dieta de cafetería, provoca un aumento de ingesta y aumento de peso. Además, produce resistencia a la insulina (HOMA elevado) y síndrome metabólico (hipertrigliceridemia, hiperglicemia y niveles bajos de HDL). La perpetuación de este síndrome metabólico provoca un daño hepático a nivel mitocondrial. Esta información demuestra que la dieta de cafetería es capaz de generar un modelo de obesidad muy parecido al humano. De este modo, el disponer de un modelo con estas características, nos permite diseñar estrategias de intervención nutricional, en este caso particular comprobar el posible efecto metabólico de un ingrediente funcional. En suma, la CAF proporciona un modelo robusto de síndrome metabólico humano en comparación con los tradicionales, creando un fenotipo de la obesidad exagerada con intolerancia a la glucosa y la inflamación. Este modelo proporciona una plataforma única para estudiar los mecanismos bioquímicos, genómicos y fisiológicas de la obesidad y la obesidad relacionada con estados de enfermedad que son pandemia en la civilización occidental en la actualidad.

40 2. Determinación de una mezcla de productos alimentarios intermedios (PAI), para obtener un ingrediente funcional (IF) que posea características funcionales (fibra, capacidad antioxidante y polifenoles) y que mejore la glicemia y/o triglicéridos en un estudio de dosis aguda. ANÁLISIS DE LOS PAIs El aspecto de cada uno de los PAIs estabilizados se observa en la Figura N 7. Figura N 7 Fotografía de cada uno de los PAIs estabilizados El PAI de manzana presentó un color marrón, el PAI de arroz y amaranto un tono beige, el PAI de tomate una coloración rojiza y el PAI de nopal mostró una coloración verde. Para la determinación de la mejor mezcla de PAIs se determinaron las características físicas (porcentaje de humedad y materia seca y parámetros de color) de cada PAI, las cuales se resumen en la Tabla N 7. Los parámetros de color o de Hunter cuantifican el color de un objeto. Los tres parámetros en el modelo representan la luminosidad de color (L*, L*=0 rendimientos negro y L*=100 indica blanca), su posición entre rojo y verde (a*, valores negativos indican verde mientras valores positivos indican rojo) y su posición entre amarillo y azul (b*, valores negativos indican azul y valores positivos indican amarillo).

41 Tabla N 7 Características físicas de los PAIs estandarizados. PAI Humedad Materia seca Parámetros de color (%) (%) L a* b* Arroz (afrechillo) 6,0 ± 0,0 94,0 ± 0,0 59,91 3,99 23,98 Amaranto 5,6 ± 0,3 94,4 ± 0,3 34,29 2,83 12,88 Manzana 6,3 ± 0,0 93,7 ± 0,0 52,55 6,42 23,32 Tomate 3,6 ± 0,3 96,4 ± 0,3 54,89 16,09 51,18 Nopal 9,6 ± 0,2 90,4 ± 0,2 81,46-5,00 22,81 Los porcentajes de humedad y materia seca se encontraron dentro de los rangos esperados, lo que facilitó su manejo y almacenamiento, dado que la humedad que poseían es lo suficientemente baja para su autoestabilidad (Estévez y cols, 2003). El análisis proximal de cada PAI, se encuentran en la Tabla N 8. Tabla N 8 Análisis proximal de los 5 PAIs estandarizados (g/100g materia seca). PAI Lípidos Proteínas Fibra cruda Ceniza ENN Afrechillo de arroz 19,2 ± 0,0 7,5 ± 0,0 2,7 ± 0,1 8,9 ± 0,0 61,7 ± 0,0 Amaranto 8,3 ± 0,2 7,8 ± 0,4 4,4 ± 0,0 3,1 ± 0,0 76,4 ± 0,1 Manzana 3,4 ± 0,1 3,1 ± 0,1 34,9 ± 0,2 2,4 ± 0,0 56,2 ± 0,1 Tomate 2,5 ± 0,0 4,2 ± 0,0 66,7 ± 0,4 2,0 ± 0,0 22,1 ± 0,1 Nopal 0,3 ± 0,0 1,6 ± 0,0 6,0 ± 0,0 11,1 ± 0,0 80,7 ± 0,0 El PAI que mostró la mayor cantidad de lípidos fue el afrechillo de arroz, seguido por el amaranto, la manzana, el tomate y el nopal. El PAI más alto en proteínas fue el amaranto, seguido por el arroz, el tomate, la manzana y el nopal. Con respecto a la fibra cruda el tomate posee 10 veces más fibra que el nopal y casi el doble que el tomate. Las cantidades de fibra cruda del amaranto y del afrechillo de arroz son inferiores a las del nopal. Los resultados de la determinación de fibra y fenoles totales para cada PAI se observan en la Tabla N 9.

42 Tabla N 9 Análisis de fibra y fenoles de los PAIs estandarizados (g/100g de materia seca). PAI Fibra (g/100g materia seca) Fenoles totales Insoluble Soluble Total (mg EAG/g) Afrechillo de arroz 33,18 1,7 34,88 4,73 ± 0,02 Amaranto 10,84 3,69 14,52 1,34 ± 0,06 Manzana 33,50 3,48 36,98 2,76 ± 0,04 Tomate 78,61 10,61 89,48 1,78 ± 0,05 Nopal 60,79 7,59 68,38 9,37 ± 0,10 Media ± DE (n=4) De acuerdo a estos resultados concluimos que el PAI que posee mayor cantidad de fibra total fue el Tomate, seguido del Nopal, Manzana, y Arroz (la cantidad de fibra del Amaranto en baja). El PAI que presentó mayor cantidad de fenoles totales correspondió al Nopal, seguido por el Arroz, Manzana y Tomate (la cantidad de fenoles del Amaranto es la más baja). Estudio in vivo Para analizar el efecto de los PAIs en un estudio in vivo, se realizó un test de tolerancia oral a la glucosa. Dentro de la hipótesis de este trabajo se postuló que el consumo de PAI es capaz de modificar la curva de tolerancia oral a la glucosa. La cantidad de PAI administrado fue de 250mg/kg de rata, lo que equivale en términos comparativos, a que un adulto de 68 kg consumiera 17g de PAI, cantidad factible de consumir en cualquier producto comercial (taza de cereales, galletón o dos barritas de cereal). El PAI seleccionado para este efecto fue administrado mediante jeringa punta de bola directo al estómago en una sola dosis. Ver Figura N 8. Se realizó el Test de Tolerancia a la Glucosa Oral (TTGO), en ratas controles, (dieta control; DC), en ratas obesas, (dieta de cafetería; CAF) y en ratas obesas con (dieta de cafetería; CAF) más cada uno de los PAI; de harina de Amaranto (grano entero) en dos concentraciones, de afrechillo de arroz, de pomaza de tomate, de pomaza de manzana y de paleta de tuna. Los resultados del TTGO fueron analizados calculando al área bajo la curva (AUC) de cada muestra. El área bajo la curva se calculó mediante análisis matemático de los datos de cada curva por separado.

43 Figura N 8 Fotografía de procedimiento TTGO mediante jeringa punta de bola. Los resultados de las medias de AUC se ejemplifican en la Figura N 9. Figura N 9 Efecto de cada PAI en Test de Tolerancia Oral a la Glucosa c b b abde abe a ade ea TTGO para ratas control (DC), obesas (CAF) y obesas consumiendo cada uno de los PAI; Am1 (amaranto 250 mg/kg), Am2 (amaranto125 mg/kg), arroz, nopal, manzana y tomate 250 mg/kg. Media del AUC (área bajo la curva) ± SEM. Letras diferentes indican diferencia estadística significativa (ANOVA una vía, α = 0,05, post-hoc Tukey).

44 Este test se hizo a dos concentraciones de amaranto distintas. En primer lugar, se midió la concentración estándar 250 mg/kg de rata y a esta concentración se observó un efecto hiperglicémico no deseado, por lo cual se probó una concentración menor de amaranto correspondiente a 125 mg/kg de rata. Esta modificación mostró el mismo efecto. Si bien disminuir la concentración de amaranto redujo el efecto hiperglicémico, mantuvo de igual forma un efecto mayor sobre la glicemia al compararlo con las ratas que consumen dieta CAF, de este modo el amaranto fue descartado de las futuras mezclas. Éste efecto fue sorpresivo debido a que Chaturvedi y cols. (1997) habían establecido el índice glicémico (IG) para el amaranto sólo y en distintas combinaciones y su IG dependía del tipo de preparación. Sin embargo, Capriles y cols. (2008), determinaron que el amaranto es altamente glicémico principalmente debido al pequeño tamaño de sus partículas de almidón, ya que posee menos del 1% de almidón resistente y a la tendencia a perder su estructura cristalina y granular durante los tratamientos térmicos. Estas moléculas pequeñas de almidón son las que finalmente producen este efecto hiperglicémico cuando se administra en concentración 250mg/kg de rata. No obstante, cuando fue administrado en una concentración de 125 mg/kg, no presentó un efecto hiperglicémico, pero tampoco presentó un efecto normo glicémico, es decir su efecto es nulo. El afrechillo de arroz y el PAI de nopal presentaron efectos discretos, sin mostrar diferencias significativas ni con el grupo DC, ni con el grupo CAF. Éste efecto no fue el esperado ya que existe evidencia de los efectos normoglicémicos que posee el nopal (Roman-Ramos y cols., 1995, Sobierai y Frever, 2010, y Andrade-Cetto y Wiedenfeld, 2011) y el afrechillo de arroz. (Siddiqui y cols., 2010, y Cheng y cols., 2010). El PAI de manzana y tomate presentaron valores similares a los obtenidos en las ratas control, observándose por lo tanto una buena regulación del metabolismo de la glucosa. Este efecto era esperado ya que, Ali y Agha (2009), estudiaron el efecto del licopeno en un modelo de hiperglicemia inducida mediante la administración de estreptozotocina, determinando que existía un descenso, dosis dependiente en los niveles de glicemia debido a la administración exógena de licopeno. Fatema y cols. (2003), estudiaron la respuesta glicémica en respuesta a la manzana (fruta entera cruda) en sujetos con diabetes 2, demostrando su bajo índice glicémico y su efecto regulador disminuyendo los niveles de hemoglobina glicosilada. Por otro lado, se determinó el efecto de la ingesta de cada PAI, administrado de forma intraestomacal, sobre los triglicéridos a las dos horas post ingesta. En la Figura N 10, se ilustran los efectos de los distintos PAI sobre el nivel de los triglicéridos.

45 Figura N 10 Efecto de cada PAI en Triglicéridos a a bc b b bd d c Media de la diferencia entre el valor de triglicéridos a las dos horas menos el valor en tiempo cero, para ratas control (DC), obesas (CAF) y obesas consumiendo cada uno de los PAI; Am1 (amaranto 250 mg/kg), Am2 (amaranto125 mg/kg), arroz, nopal, manzana y tomate 250 mg/kg. Media del AUC (área bajo la curva) ± DE. Letras diferentes indican diferencia estadística significativa (ANOVA una vía, α = 0,05, post-hoc Tukey). Nuestros resultados sustentan que el PAI que más disminuye los valores de los triglicéridos fue el PAI de arroz, esto se debe principalmente a la presencia de tocotrienoles y tocoferoles, que poseen un fuerte efecto hipotrigliceridémico. Bhardwaj y cols. (2001) identificaron en el arroz una lipasa estable, la cual además presenta actividad fosfolipasa A2 (hidrólisis de fosfolípidos) y Qureshi y cols. (2001), estudiaron los tocotrienoles del arroz, demostrando que su efecto en la disminución de placas ateroescleróticas y de los triglicéridos, colesterol y LDL fue superior a la del α-tocoferol. Ambos efectos en conjunto con presencia de vitamina E en el afrechillo del arroz hicieron que Justo y cols. (2012), pusieran en evidencia las propiedades nutracéuticas del afrechillo de arroz contra la patogénesis del síndrome metabólico mediante la atenuación de la dislipidemia, la hipertensión y la resistencia a la insulina, así como mediante la restauración de hipoadiponectinemia asociada a la obesidad. El PAI de amaranto presentó escaso impacto sobre la disminución en triglicéridos, a pesar de estar reportado este efecto junto a un mayor efecto de tipo hipo-colesterolémico (Hye Kyung y cols. 2006a y 2006b) Si bien es cierto, todos los PAI presentaron una disminución en los valores de triglicéridos, el PAI de tomate presentó el mayor efecto después del PAI de arroz.

46 ANÁLISIS DE LOS IFs Como resultado del estudio con el modelo animal agudo y con la caracterización química y física de los PAIs, se formularon tres mezclas con los PAI desarrollados. Un punto clave en la determinación de las mezclas consistió en la determinación de la cantidad de fibra. La Asociación Americana de Diabetes (ADA) indica que los diabéticos deben consumir 40 g de fibra al día, y la recomendación para un adulto sin patologías es de 25 a 30 g de fibra al día (Anderson y cols. 2004). De este modo, el estudio tuvo que suplir estos 10 g de fibra extra. Por lo cual el IF ideal debiese tener un 45 a un 60 % de fibra y basados en este porcentaje se aproximaron nuestras mezclas, porcentajes basados en las cantidades de fibra de los PAI. Además, se potenció la cantidad de fibra soluble. Para esto utilizamos un algoritmo matemático, en el cual incluimos los datos del modelo agudo, con una puntuación de 2 cuando el PAI presentó una actividad hipolipémica o normoglicémica y 1 cuando no presentaba actividad. Las mezclas generadas se resumen en la Tabla Nº 10. Tabla N 10 Composición de cada IF, en porcentajes. IF Arroz(%) Amaranto(%) Manzana(%) Tomate(%) Nopal(%) IF1 44,5 11,1 22,2 22,2 0 IF IF3 46,1 7,7 15,4 15,4 15,4 El IF1 se generó combinando los PAI que poseían un mayor efecto en hipotrigliceridémico, el IF3 y el IF2 se generaron combinando los PAI que poseían un mayor efecto normoglicémico. En la Tabla Nº 11 se indica el análisis físico resultante de los distintos IF formulados. Tabla N 11 Caracterización física de los 3 IFs. IF Humedad Materia seca Parámetros de color (%) (%) L a* b* IF1 8,4±0,5b 91,6±0,5a 70,1±0,1a 1,6±0,2b 20,4±0,1c IF2 7,5±0,4a 92,5±0,4b 67,7±0,2b 5,7±0,1a 26,3±0,004a IF3 8,3±0,6b 91,7±0,6a 68,4±0,2c 5,3±0,1a 24,8±0,04b Media±DE. Letras diferentes indican diferencia estadística significativa (ANDEVA y prueba de rango múltiple, α = 0,05

47 De acuerdo a nuestros datos, el IF2 presentó una menor humedad porcentual lo que facilitó su manejo en el almacenamiento, sin embargo la humedad de los 3 IF fue lo suficientemente baja para ser auto-estables. Con respecto al color el IF1 presentó una coloración más rojiza, seguido por el IF2, el IF3 presenta una coloración más verdosa. La Tabla Nº 12 resume el análisis proximal de cada IF. Tabla N 12 Análisis proximal de los 3 IFs estandarizados (g/100g de materia seca). IF Lípidos Proteínas Fibra cruda Ceniza ENN IF1 12,5±0,5b 2,5±0,2a 12,9±0,4a 7,9±0,6b 64,2±1,3b IF2 5,8±0,3ª 4,0±0,1b 23,9±1,0b 6,1±0,3a 60,2±1,1a IF3 15,2±0,3c 5,9±0,4c 13,3±1,0a 6,2±0,3a 59,4±1,2a Media±DE. Letras diferentes indican diferencia estadística significativa (ANDEVA y prueba de rango múltiple, α = 0,05 Este análisis mostró que hubo diferencias significativas en las tres mezclas, se observó que el IF2 presentó un menor aporte de lípidos y una mayor contribución de fibra. El IF3 tuvo mayor cantidad de proteínas. En base a estos valores se calculó la relación FDS/FDI, la cuál es la razón entre la cantidad de fibra soluble y la cantidad de fibra insoluble. =, donde FDS es la cantidad de fibra dietaria soluble y FDI es la cantidad de fibra dietaria insoluble. El análisis de la cantidad de fibra soluble, insoluble, total y fenoles totales se indica en la Tabla Nº 13. Tabla N 13 Análisis de fibra y fenoles de los IFs estandarizados (g/100g de materia seca). IF Fibra (g/100g de materia seca) Relación Fenoles totales Insoluble Soluble Total FDS/FDI (mg EAG/g) IF1 43,4a 7,2 50,6 1:6,0 5,3a IF2 45,4b 8,7 54,1 1:5,2 5,7b IF3 41,2a 7,6 48,8 1:5,4 4,5b Media±DE. Letras diferentes indican diferencia estadística significativa (ANDEVA y prueba de rango múltiple, α = 0,05 El IF2 presentó una mayor cantidad de fibra insoluble, soluble y total, y mostró la mejor relación FDS/FDI. Además, este IF2 contuvo la mayor cantidad de fenoles totales.

48 La determinación de la composición de estos fenoles de bajo de peso molecular se realizó a través de perfiles cromatográficos de los IF-1, IF-2 e IF-3. Estos resultados se observan en la Figura Nº 11 A, B, C y D. Figura N 11 Perfiles cromatográficos de los IFs: A- IF1, B-IF3, C-IF2 y D patrones. A B C

49 D Aproximadamente a los 12 minutos de corrida, se identificó la presencia de ácido protecatéquico y a los 39 minutos la presencia de vainillina. Entre los minutos 59 y 62 se identificaron una serie de compuestos pertenecientes a la familia de los flavonoles y sus derivados. Y entre los minutos 14 y 36 se observaron al menos 2 compuestos pertenecientes a la familia de las procianidinas. Considerando los análisis de características físicas, el análisis proximal, la cantidad de fibra total y la relación entre fibra soluble e insoluble y los compuestos fenólicos, se concluyó que la mezcla IF2 presentó cualidades superiores al compararlo con las otras dos mezclas (IF1 e IF3). Debido a que previamente validamos la importancia de realizar un estudio in vivo con cada uno de los PAI, se realizó un estudio in vivo para determinar cuál ingrediente funcional era el mejor, debido a que las mezclas de los distintos PAI pueden comportarse de distinta forma a la inferida sólo por la mezcla de sus componentes. El primer análisis realizado, correspondió a la evaluación de TTGO para cada uno de los IFs en ratas obesas, en dosis aguda de 250 mg/kg de rata, administrado vía intragástrica: Los resultados obtenidos se presentan como área bajo la curva (AUC) y se observan en la Figura N 12. IF2 fue el único ingrediente funcional que logró disminuir el área bajo la curva y que fue capaz de aproximarse a los valores del grupo control, siendo esta diferencia significativa. El IF1 y el IF3 no presentaron diferencias con el grupo CAF.

50 Figura N 12 Efecto de cada IF en Test de Tolerancia Oral a la Glucosa b bc bc a ac TTGO para ratas control (DC), obesas (CAF) y obesas consumiendo cada uno de los IF 250 mg/kg. Media del AUC (área bajo la curva) ± SEM. Letras diferentes indican diferencia estadística significativa (ANOVA una vía, α = 0,05, posthoc Tukey). Los IFs se generaron principalmente potenciando las cantidades de fibra, pero las diferencias entre cada uno dependieron de la combinación de los distintos PAIs, y esa mezcla se realizó de acuerdo a potenciar uno u otro efecto. El IF1 se generó combinando los PAI que poseían un mayor efecto en hipotrigliceridémico, el IF3 y el IF2 se generaron combinando los PAI que poseían un mayor efecto normoglicémico. Debido a la nula diferencia que se observó entre el IF1 y el IF3 descartamos el IF3 debido a que el IF2 presenta un mejor efecto normoglicémico que el IF3. No se probó el efecto en triglicéridos debido a que no fue formulado con ese propósito. Finalmente se determinó el efecto hipotrigliceridémico de la ingesta de IF1 y del IF2, administrado de forma intraestomacal, mediante jeringa de punta de bola. Se cuantificaron los triglicéridos antes de la administración del IF y a las 2 horas post ingesta. Los resultados para IF1 e IF2 en triglicéridos se observan en la Figura Nº 13. La gráfica indicó que ambos IFs presentaron un fuerte efecto hipotrigliceridémico, siendo el efecto del IF2 más potente que el del IF1.

51 Figura N 13 Efecto de cada IF en Triglicéridos a a b b Media de la diferencia entre el valor de triglicéridos a las dos horas menos el valor en tiempo cero, para ratas control (DC), obesas (CAF) y obesas consumiendo cada uno de los IF 250 mg/kg. Media del AUC (área bajo la curva) ± DE. Letras diferentes indican diferencia estadística significativa (ANOVA una vía, α = 0,05, post-hoc Tukey). Este efecto es bastante interesante, ya que cuando se analizaron los PAI en forma individual el PAI que tuvo un mayor efecto fue el arroz, y el IF1 posee casi el doble de arroz que el IF2 (44,5% v/s 25%), sin embargo, el efecto hipotrigliceridémico del IF2 fue superior al de IF1, por lo tanto el efecto final de éste IF se produce debido a la mezcla de los PAIs los cuales actúan sinérgicamente, potenciándose entre sí. Finalmente, nuestros resultados corroboran la importancia de efectuar análisis in vivo, ya que los efectos de la matriz alimentaria, efectos post ingesta, y absorción, pueden afectar de forma positiva o enmascarar los posibles efectos de los PAIs o IFs. De este modo, concluimos que el mejor IF fue el IF2 dado que: Contenía una menor cantidad de lípidos. Presentó una mayor cantidad de fibra total, de fibra soluble y una mejor relación FDS/FDI. Su cantidad total de fenoles fue mayor y la composición de éstos es mejor. Fue el único que mostró un efecto sobre el metabolismo de glucosa. Mostró un mayor efecto hipotrigliceridémico

52 3. Determinación de parámetros bioquímicos en ayuno: glicemia, insulina, y perfil lipídico, en 4 grupos; en ratas alimentadas con dieta control y en ratas alimentadas con dieta alta en grasa, con y sin el IF, durante 30 días. Para la determinación de los efectos del IF consumido en forma crónica durante 30 días se establecieron 4 grupos: dos grupos de ratas controles y dos grupos de ratas obesas (inducidas por la ingesta de dieta de cafetería) y que continuaron consumiendo dieta de cafetería. A un grupo de cada tipo de alimentación (cafetería o control) se le adicionó el ingrediente funcional al 1% homogenizado en su dieta. De acuerdo a la ingesta de las ratas y consumiendo IF al 1%, se estimó que éstas ingerían entre 330 y 350 mg de IF al día. Los cuatro grupos quedaron conformados de la siguiente forma: Grupo DC (dieta control), grupo DC+IF (dieta control más IF al1%), grupo CAF (dieta de cafetería), grupo CAF+IF (dieta de cafetería más el IF al 1%). En la Tabla N 13 se observa la descripción de la dieta ingerida por los 4 grupos, obtenida desde el etiquetado nutricional de los ingredientes y del análisis proximal el ingrediente funcional. Tabla 13: Análisis proximal de la dieta ingerida por los 4 grupos experimentales. 100g DC DC+IF CAF CAF+IF Energía (kcal) 428,7 426,1 438,1 435,4 Proteínas (g) 22,8 22,6 10,2 10,1 Grasa total (g) 10,8 10,8 27,3 27,1 Grasa saturada (g) 1 1,0 8,4 8,3 Grasa monoinsaturada (g) 2,6 2,6 12,5 12,3 Grasa poliinsaturada (g) 7,2 7,1 7,8 7,7 Colesterol (mg) 0 0,0 46,4 46,0 Hidratos de carbono disponibles (g) 60 59,6 34,8 34,7 Sodio (mg) 0 0,0 450,5 446,0 Fibra (g) 1,1 1,6 0,9 1,4 (n=8 por grupo).

53 -Modificaciones de Peso e Ingesta: En la Tabla N 14, se observa el registro de ingesta en tres tiempos: al inicio de la intervención, en el día 15 y en el día 30, al finalizar el estudio. Tabla 14: Valores de ingesta (g/día) de las ratas experimentales. Ingesta (g/día) Dieta Inicial Día 15 Día 30 DC 25,9±2,8 34,6±3,4 35,6±3,8 DC+IF 25,9±1,7 29,8±2,6 29,9±0,5 ** CAF 41,6±2,8 *** 46,5±3,0 *** 51,4±3,1 *** CAF+IF 39,6±1,8 *** 36,2±5,6 34,0±1,9 p 0,0001 0,0001 0,0001 CAF v/s CAF +IF ns p 0,001 p 0,001 DC= Grupo que recibe dieta control, DC+IF= Grupo que recibe dieta control más IF al 1%, CAF= Grupo que recibe dieta de cafetería, CAF+IF= Grupo que recibe dieta de cafetería más IF al 1%. Los valores son media ± S.E.M. n=8 ratas por grupo. ANOVA de dos factores para medidas repetidas, post hoc Tukey *p 0,05, ** p 0,01, y ***p 0,001 comparado con los valores del grupo DC. Efecto tiempo, p=0,0001; efecto dieta, p=0,0001; efecto de la interacción dieta-tiempo, p=0,0001. (n=8 por grupo). Con respecto a la ingesta, se observó que a los 30 días de ensayo, el grupo DC+IF disminuyó su ingesta (p 0,01). Al comparar la ingesta de las ratas que consumieron dieta de cafetería (CAF y CAF+IF), se observó que al inicio, ambos grupos presentaron un mayor de ingesta (hiperfagia) con respecto a los grupos DC y DC+IF (p 0,001). Desde el día 15, el grupo CAF+IF no presentó diferencias de ingesta versus el grupo control, pero sí fue diferente al grupo CAF (p 0,001). A los 30 días el grupo CAF+IF ingirió la misma cantidad de alimento que el grupo DC, pese a estar consumiendo una dieta alta en grasa, y ambos grupos (CAF y CAF+IF) fueron diferentes estadísticamente (p 0,001). La hiperfagia que se produce al consumir dieta alta en grasa ya había sido observada previamente cuando se estandarizó el modelo de obesidad mediante la dieta de cafetería (Shafat y cols., 2009, y Milagro y cols., 2009). En éste estudio crónico, el grupo CAF a los 30 días presentó un aumento de ingesta del 44% más que el grupo control y este aumento fue igual al observado en el primer estudio donde se observó que a las 16 semanas de alimentación con la dieta de cafetería las ratas mostraron un 44% más de ingesta que el grupo control.

54 A los 30 días el consumo del IF al 1% fue suficiente para llegar a los niveles de ingesta del grupo control, por lo tanto su consumo fue capaz de anular la hiperfagia que produce la dieta de cafetería. El IF es alto en fibra y se encuentra reportado el efecto de la fibra en la saciedad (Parillo y Riccardi, 2004). Debido a que la ingesta de los 4 grupos fue diferente y que además, ésta cambió durante el tiempo de tratamiento, se graficó la energía ingerida por cada rata en el tiempo para cada uno de los tratamientos. Los resultados se observan en la Figura N 14 Figura N 14 Ingesta de energía (Kcal) diaria en tres tiempos f e b b c c c c d d a a Media de la energía (Kcal) ± DE, en tres tiempos. Energía1= energía en tiempo 0, Energía2= energía a los 15 días y Energía3= energía a los 30 días. Para ratas alimentándose con dieta control (DC), dieta control +IF al 1% (DC+IF), dieta de cafetería (CAF) y dieta de cafetería + IF (CAF+IF) al 1% (n=8 por grupo). Letras diferentes indican diferencia estadística significativa (ANOVA dos vías, α = 0,05, post-hoc Tukey). Al comienzo del experimento (día 0) la ingesta calórica de los grupos alimentados con dieta control (DC y DC+IF) y dieta de cafetería (CAF y CAF+IF) fue distinta, siendo la ingesta calórica de los grupos CAF superior a la de los grupos DC, esta diferencia fue significativa (p 0,0001). A los 15 y 30 días el grupo DC presentó un aumento de ingesta calórica y no mostró diferencias con el grupo CAF+IF. Es decir, desde el día 15 hasta el día 30, el grupo CAF+IF ingirió las mismas calorías que el grupo control, pero el grupo CAF efectivamente consumió más energía que el grupo DC (p 0,0001). La ingesta diaria de grasas por grupo se observa en la Figura N 15

55 Figura N 15 Ingesta de grasa total diaria en tres tiempos d f b b e e a c c a c c Media de la grasa total (g) ± DE, en tres tiempos. GrasaTotal1= grasa total en tiempo 0, GrasaTotal2= grasa total a los 15 dás y GrasaTotal3= grasa total a los 30 días. Para ratas alimentándose con dieta control (DC), dieta control +IF al 1% (DC+IF), dieta de cafetería (CAF) y dieta de cafetería + IF al 1% (CAF+IF) (n=8 por grupo). Letras diferentes indican diferencia estadística significativa (ANOVA dos vías, α = 0,05, post-hoc Tukey). Se estableció que el grupo CAF+IF presentó una ingesta de grasa al día 15 de 9,8 g diarios y comparado con el grupo CAF (12,7 g diarios) su ingesta fue menor (p 0,0001). Sin embargo comparado con el grupo control (3,7 g diarios), su ingesta fue superior en un 164,9%. Por lo tanto, existieron diferencias en la ingesta de grasa diaria que se mantuvieron hasta el día 30, momento en el cuál el grupo CAF ingirió 14,0 g de grasa total diaria, comparado con el grupo control que ingirió 3,8 g diarios. El grupo CAF+IF desde el día 15 presentó valores de ingesta de grasa total diaria diferentes al grupo CAF (p 0,0001), pero a pesar de presentar una menor ingesta de grasa que el grupo CAF (9,2 g/día) sigue siendo una ingesta superior y diferente al grupo DC (p 0,0001). Es importante destacar que el grupo DC+IF a pesar de presentar una diminución en su ingesta, la ingesta de grasa diaria durante todo el tratamiento fue igual a la del grupo CAF. Se determinó el peso e ingesta en forma semanal. En la Tabla N 15, se observa el registro del peso e ingesta en tres tiempos: al inicio de la intervención, en el día 15, y en el día 30, al finalizar el estudio.

56 Con respecto al peso durante todo el tratamiento no se observó diferencias entre los grupos DC y DC+IF. Al comparar los pesos de las ratas que consumieron dieta de cafetería (CAF y CAF+IF), se observó que en el tiempo inicial, ambos grupos presentaron sobre un 20% de peso extra (obesidad) con respecto a los grupos DC y DC+IF. Al día 15 el grupo CAF presentó un peso promedio de 500 g, pero el grupo CAF+IF solamente presentó un peso de 470 g, es decir, sólo un 14,6% de peso extra (ya no es obesidad) y ambos grupos (CAF y CAF+IF) fueron diferentes (p 0,01). A los 30 días el grupo CAF presentó un peso promedio de 521 g, y el grupo CAF+IF presentó un peso promedio de 474 g. Ambos grupos (CAF y CAF+IF) fueron diferentes estadísticamente (p 0,001) desde el día 15 y esta diferencia se mantuvo hasta el día 30. Tabla 15: Valores de peso corporal (g) de las ratas experimentales Peso Corporal (g) Dieta Inicial Día 15 Día 30 DC 402±3,6 412±3,8 422±5,7 DC+IF 407±5,6 409±6,5 417±6,7 CAF 479±5,1 *** 500±7,2 *** 521±7,6 *** CAF+IF 461±5,6 *** 470±6,8 *** 474±9,0 *** p 0,0001 0,0001 0,0001 CAF v/s CAF +IF ns p 0,01 p 0,001 DC= Grupo que recibe dieta control, DC+IF= Grupo que recibe dieta control más IF al 1%, CAF= Grupo que recibe dieta de cafetería, CAF+IF= Grupo que recibe dieta de cafetería más IF al 1%. Los valores son media ± S.E.M. n=8 ratas por grupo. ANOVA de dos factores para medidas repetidas, post hoc Tukey *p 0,05, ** p 0,01, y ***p 0,001 comparado con los valores del grupo DC. Efecto tiempo, p=0,0001; efecto dieta, p=0,0001; efecto de la interacción dieta-tiempo, p=0,062. (n=8 por grupo). Dado que los hábitos alimenticios de las personas que consumen gran cantidad fibra dietética suelen asociarse con la ingesta de menor cantidad de grasa, resulta complicado separar la contribución de ambos factores en el efecto final sobre el control del peso corporal. Sin embargo, los diferentes estudios epidemiológicos han confirmado la eficacia de la fibra dietética en el control de la obesidad. Así, en el estudio Iowa Women s Health Study se comprobó que la ingesta de cereales sin refinar estaba inversamente relacionada con el peso corporal y con la distribución de grasa en el organismo, en comparación con la relación directa observada con el consumo de cereales refinados y el peso corporal (Jacobs y cols. 2007). En el estudio Seven Countries Study, se puso de manifiesto que la mayor ingesta de fibra dietética se relacionó con una reducción en el grosor del

57 pliegue cutáneo (determinación utilizada en la valoración de la obesidad), independiente de la ingesta de grasa en la dieta. De acuerdo a esto, el incremento en la proporción de fibra dietética en la dieta, en el contexto de un plan de acción de promoción de la salud, puede constituir una estrategia adecuada en prevenir la obesidad y, secundariamente, a las enfermedades asociadas con ésta situación (enfermedades crónicas no transmisibles), independientemente de la acción directa que la fibra dietética pueda tener sobre estas patologías (Kromhout y cols. 2001). Finalmente, tres fueron los factores que hicieron que éste ingrediente funcional alto en fibra provoque que las ratas que siguen alimentándose con dieta de cafetería no presenten obesidad: La elevada capacidad de la fibra para retener agua y su bajo poder energético contribuyen a disminuir la densidad calórica de la dieta. Se reduce la velocidad del vaciamiento gástrico, disminuyendo el apetito y prolongando la sensación de saciedad. La formación de soluciones de elevada viscosidad por la fibra soluble altera la estructura de la comida en la luz intestinal, dificultando el acceso de las enzimas digestivas a los nutrientes y, por tanto, disminuye la absorción de ácidos grasos y de hidratos de carbono en el intestino delgado, reduciendo así el aporte calórico. Debido a estos resultados, todas las determinaciones de los parámetros metabólicos fueron corregidos por la variable peso, de este modo eliminamos este factor, aislando el efecto neto del consumo de ingrediente funcional. -Evaluación Efecto Normo-glicémico: En la Tabla N 16, se observan los valores de glicemia en ayuno corregidos por peso. No se observaron diferencias entre los grupos DC y DC+IF durante todo el tratamiento. Al comparar los valores de glicemia en ayuno de las ratas que consumieron dieta de cafetería (CAF y CAF+IF), se observó que en el tiempo inicial, ambos grupos presentaron mayores valores de glicemia (122,0 y 128,6 mg/dl, respectivamente) con respecto a los grupos que consumieron dieta control (98,1 y 99,8 mg/dl, respectivamente). Al día 15 los dos grupo que recibieron dieta de cafetería presentaron niveles de glicemia superiores al grupo control, el valor de glicemia del grupo CAF fue de 132,3 mg/dl (p 0,001 vs DC), y el valor para el grupo CAF+IF fue de 105 mg/dl (p 0,05 vs DC) y ambos grupos (CAF y CAF+IF) fueron diferentes (p 0,001). A los 30 días el valor de glicemia del grupo CAF fue de 169,1 mg/dl y el valor del grupo CAF+IF fue de 144,3 mg/dl y

58 ambos grupos fueron diferentes con respecto al control (p 0,001), pero a la vez ambos grupos (CAF y CAF+IF) fueron diferentes estadísticamente (p 0,05). Tabla 16: Valores de Glicemia en ayuno (mg/dl) de las ratas experimentales. Glicemia en ayuno(mg/dl) Dieta Inicial Día 15 Día 30 DC 98,1±4,2 90,4±3,6 117,4±3,6 DC+IF 99,8±5,2 81,5±2,3 103,0±1,8 CAF 122,0±3,6 *** 132,3±4,6 *** 169,1±8,4 *** CAF+IF 128,6±1,7 *** 105,3±3,9 * 144,3±5,8 *** p 0,0001 0,0001 0,0001 CAF v/s CAF +IF ns p 0,001 p 0,05 DC= Grupo que recibe dieta control, DC+IF= Grupo que recibe dieta control más IF al 1%, CAF= Grupo que recibe dieta de cafetería, CAF+IF= Grupo que recibe dieta de cafetería más IF al 1%.Los valores son media ± S.E.M. n=8 ratas por grupo. ANOVA de dos factores para medidas repetidas, post hoc Tukey *p 0,05, ** p 0,01, y ***p 0,001 comparado con los valores del grupo DC. Valores normales glicemia hasta 125 mg/dl. Valores normales insulina hasta 0,8 ng/ml. Efecto tiempo, p=0,0001; efecto dieta, p=0,0001; efecto de la interacción dieta-tiempo, p=0,001. (n=8 por grupo). Es así, como el ingrediente funcional en 30 días fue capaz disminuir la hiperglicemia producida por la ingesta de la dieta de cafetería en un 14,7%. En la Tabla N 17, se observan los valores de insulina en ayuno, corregidos por peso. No se observaron diferencias entre los grupos DC y DC+IF durante todo el tratamiento. Tabla 17: Valores de Insulina en ayuno (ng/ml) de las ratas experimentales. Insulina en ayuno(ng/ml) Dieta Inicial Día 15 Día 30 DC 0,39±0,06 0,59±0,06 0,50±0,08 DC+IF 0,41±0,05 0,49±0,04 0,46±0,03 CAF 0,72±0,09 *** 1,04±0,11 ** 2,60±0,12 *** CAF+IF 0,79±0,05 *** 0,97±0,11 * 1,14±0,07 *** p 0,0001 0,0001 0,0001 CAF v/s CAF +IF ns ns p 0,001 DC= Grupo que recibe dieta control, DC+IF= Grupo que recibe dieta control más IF al 1%, CAF= Grupo que recibe dieta de cafetería, CAF+IF= Grupo que recibe dieta de cafetería más IF al 1%. Los valores son media ± S.E.M. n=8 ratas por grupo. ANOVA de dos factores para medidas repetidas, post hoc Tukey *p 0,05, ** p 0,01, y ***p 0,001 comparado con los valores del grupo DC. Valores normales glicemia hasta 125 mg/dl. Valores normales insulina hasta 0,8 ng/ml. Efecto tiempo, p=0,0001; efecto dieta, p=0,0001; efecto de la interacción dieta-tiempo, p=0,0001. (n=8 por grupo).

59 Al comparar los valores de insulina en ayuno de las ratas que consumieron dieta de cafetería (CAF y CAF+IF), se observó que al inicio, ambos grupos presentaron mayores valores de insulina (0,72 y 0,79 ng/ml) con respecto a los grupos que consumieron dieta control (0,39 y 0,41 ng/ml). Al día 15 la insulina del grupo CAF aumentó a 1,09 ng/ml y el grupo CAF+IF aumentó a 0,97 ng/ml, sin presentar diferencias entre ellos, pero siendo sus valores superiores al grupo control. A los 30 días los valores de insulina continuaron aumentando a 2,6 ng/ml el grupo CAF y 1,14 ng/ml y a pesar de que ambos grupos fueron diferentes del grupo control (p 0,001), el grupo CAF+IF presentó valores más bajos de insulina, y su diferencia con el grupo CAF fue significativa (p 0,001). El ingrediente funcional en 30 días fue capaz de disminuir la hiperinsulinemia producida por la ingesta de la dieta de cafetería en un 56,2%. En la Tabla N 18, se resumen los valores de HOMA-IR. No se observaron diferencias entre los grupos DC y DC+IF durante todo el tratamiento. Tabla 18 Valores de HOMA de las ratas experimentales HOMA IR Dieta Inicial Día 15 Día 30 DC 1,2±0,5 2,4±0,8 2,5±1,0 DC+IF 1,8±0,8 1,4±0,5 2,1±0,5 CAF 3,9±1,5 *** 6,2±2,1 *** 19,7±4,4 *** CAF+IF 4,0±0,9 *** 4,6±1,5 * 8,4±1,7 *** p 0,0001 0,0001 0,0001 CAF v/s CAF +IF ns ns p 0,001 DC= Grupo que recibe dieta control, DC+IF= Grupo que recibe dieta control más IF al 1%, CAF= Grupo que recibe dieta de cafetería, CAF+IF= Grupo que recibe dieta de cafetería más IF al 1%. Los valores son media ± S.E.M. n=8 ratas por grupo. ANOVA de dos factores para medidas repetidas, post hoc Tukey *p 0,05, ** p 0,01, y ***p 0,001 comparado con los valores del grupo DC. Valores normales HOMA hasta 3,8. Efecto tiempo, p<0,0001; efecto dieta, p=0,0001; efecto de la interacción dieta-tiempo, p=0,0001. (n=8 por grupo). Con respecto a los valores de HOMA, las ratas que consumieron dieta de cafetería (CAF y CAF+IF), en el tiempo inicial, presentaron valores mayores de HOMA (3,9 y 4,0) con respecto a los grupos que consumieron dieta control (1,2 y 1,8). Al día 15 el grupo CAF aumento su HOMA a un valor de 6,17 y 4,55 el grupo CAF+IF.

60 A los 30 días el valor de HOMA del grupo CAF fue de 19,7 y para el grupo CAF+IF de 8,39 con respecto al control, y ambos grupos (CAF y CAF+IF) fueron diferentes (p 0,001). De este modo, el ingrediente funcional en 30 días fue capaz disminuir la insulino resistencia producida por la ingesta de la dieta de cafetería en un 57,3%. Existe evidencia de que la fibra tiene efecto sobre el metabolismo de la glucosa, con niveles de glucosa pos-prandial más bajos y una mayor sensibilidad a la insulina tanto en los individuos normales como en los diabéticos. Un metaanálisis de 6 estudios prospectivos demostró que la ingesta de 2 porciones diarias de cereal podía reducir el riesgo de diabetes en un 21% (Ford y Liu, 2001; Ford y Mokdad, 2001, Gross y cols. 2004, Hur y Reicks, 2012). La fibra alimentaria soluble tiene efectos fisiológicos sobre el estómago y el intestino delgado que regulan la glucemia pos-prandial. Estos efectos incluyen el retardo del vaciamiento gástrico responsable del 35% de la variación del pico de la concentración de glucosa después de la ingesta; la modificación de la actividad mio-eléctrica gastrointestinal y el enlentecimiento del tránsito del intestino delgado; la disminución de la difusión de la glucosa a través de la capa de agua, y la reducción del contacto de la alfa amilasa con los sustratos debido a la viscosidad del contenido intestinal (Papathanasopoulos y Camilleri, 2010, Chen, y cols., 2008). El factor determinante de la regulación de la glucemia es el aumento de la viscosidad y la propiedad gelificante de la fibra soluble. Además, la absorción intestinal de carbohidratos puede ser retrasada por la fibra soluble por la alteración de los niveles de incretina (Papathanasopoulos y Camilleri, 2010, Chen, y cols., 2008). El principal efecto de la fibra insoluble sobre metabolismo de la glucosa se ejerce sobre la sensibilidad a la insulina. El mecanismo por el que dicha sensibilidad aumenta no está aclarado todavía. En este sentido, se han propuesto alteraciones de la flora intestinal dado que se ha observado que ésta difiere entre los individuos obesos y los delgados; ya que existe un contenido menor de bacterias gram-negativas en quienes consumen dietas ricas en fibras y bajas en grasas, y que la resistencia a la insulina puede inducirse por la inyección subcutánea de lipopolisacáridos de bacterias gram negativas (Papathanasopoulos y Camilleri, 2010). Los datos experimentales a favor de la función beneficiosa transmitida por los antioxidantes en el metabolismo de la glucosa son contundentes (Delany y cols., 2000; Kien y cols., 2005; Sánchez-Moreno y cols., 2006), pero los datos

61 clínicos en seres humanos siguen siendo controversiales (Avignon y cols. 2012, Scott y King, 2004, Ylönen y cols., 2003). El ingrediente funcional al ser alto en fibra y tener una buena proporción entre fibra dietética soluble e insoluble, además de una alta cantidad de antioxidantes ejerce una efecto normo-glicémico. Si bien sus niveles de glicemia, insulina y HOMA, en 30 días de ingesta del ingrediente funcional, no llegaron a los valores del grupo control, disminuyeron contrarrestando el efecto nocivo de la dieta de cafetería. -Evaluación Efecto Hipolipémico: En la Tabla N 19, se observan los valores de colesterol, corregidos por peso. No se observaron diferencias entre los grupos DC y DC+IF durante todo el tratamiento. Al comparar los valores de colesterol en ayuno de las ratas que consumieron dieta de cafetería (CAF y CAF+IF), se observó que en el tiempo inicial, sólo el grupo CAF presentó mayores niveles de colesterol con respecto a los grupos que consumieron dieta control (p 0,003). Al día 15 ambos grupos (CAF y CAF+IF) no presentaron diferencias significativas con respecto al grupo control. A los 30 días el grupo CAF presentó un valor de 94,1mg/dl y el grupo CAF+IF presentó un valor de colesterol de 63,6mg/dl y ambos grupos (CAF y CAF+IF) fueron diferentes (p 0,001). Tabla 19 Valores de Colesterol (mg/dl) de las ratas experimentales Colesterol (mg/dl) Dieta Inicial Día 15 Día 30 DC 52,1±2,9 65,7±1,4 57,8±1,1 DC+IF 50,5±2,2 67,4±1,9 66,0±2,8 CAF 64,9±3,3 * 71,7±2,4 94,1±5,6 *** CAF+IF 55,9±2,1 71,9±2,6 63,6±1,8 p 0,003 0,116 0,0001 CAF v/s CAF +IF ns ns p 0,001 DC= Grupo que recibe dieta control, DC+IF= Grupo que recibe dieta control más IF al 1%, CAF= Grupo que recibe dieta de cafetería, CAF+IF= Grupo que recibe dieta de cafetería más IF al 1%. Los valores son media ± S.E.M. n=8 ratas por grupo. ANOVA de dos factores para medidas repetidas, post hoc Tukey *p 0,05, ** p 0,01, y ***p 0,001 comparado con los valores del grupo DC. Valores normales colesterol hasta 67 mg/dl. Valores normales triglicéridos hasta 112 mg/dl. Efecto tiempo, p<0,0001; efecto dieta, p=0,0001; efecto de la interacción dieta-tiempo, p=0,0001. (n=8 por grupo).

62 Es así como el ingrediente funcional en 30 días fue capaz disminuir la hipercolesterolemia producida por la ingesta de la dieta de cafetería en un 32,4%, llegando a los valores del grupo control. En la Tabla N 20, se presentan los valores de triglicéridos corregidos por peso. No se observaron diferencias entre los grupos DC y DC+IF durante el tratamiento. Tabla 20 Valores de Triglicéridos (mg/dl) de las ratas experimentales. Triglicéridos (mg/dl) Dieta Inicial Día 15 Día 30 DC 78,7±6,4 77,7±6,4 55,1±8,6 DC+IF 71,2±3,2 73,6±3,9 45,8±2,6 CAF 158,3±11,9 *** 158,9±4,5 *** 166,5±3,5 *** CAF+IF 153,3±6,9 *** 128,3±3,1 *** 56,8±4,4 p 0,0001 0,0001 0,0001 CAF v/s CAF +IF ns p 0,001 p 0,001 DC= Grupo que recibe dieta control, DC+IF= Grupo que recibe dieta control más IF al 1%, CAF= Grupo que recibe dieta de cafetería, CAF+IF= Grupo que recibe dieta de cafetería más IF al 1%. Los valores son media ± S.E.M. n=8 ratas por grupo. ANOVA de dos factores para medidas repetidas, post hoc Tukey *p 0,05, ** p 0,01, y ***p 0,001 comparado con los valores del grupo DC. Valores normales colesterol hasta 67 mg/dl. Valores normales triglicéridos hasta 112 mg/dl. Efecto tiempo, p<0,0001; efecto dieta, p=0,0001; efecto de la interacción dieta-tiempo, p=0,0001. (n=8 por grupo). Al comparar los valores de triglicéridos en ayuno de las ratas que consumieron dieta de cafetería (158,3 y 153,3 mg/dl), ambos grupos presentaron mayores valores de triglicéridos con respecto a los grupos que consumieron dieta control (78,7 y 71,2 mg/dl). Al día 15 el grupo CAF presentó valores de triglicéridos de 158,4 mg/dl (no aumentó en el tiempo), el grupo CAF+IF presentó valores de triglicéridos superiores de 128,3 mg/dl (disminuyó en el tiempo) y ambos grupos fueron diferentes (p 0,001). A los 30 días el grupo CAF continuó aumentando sus valores de triglicéridos a 166,5 mg/dl, y el grupo CAF+IF disminuyó sus valores a 56,8 mg/dl (no fue diferente al grupo control). Ambos grupos (CAF y CAF+IF) fueron diferentes (p 0,001). De esta forma, el ingrediente funcional en 30 días fue capaz disminuir la hipertrigliceridemia producida por la ingesta de la dieta de cafetería en un 66,4%, llegando a los valores del grupo control. En la Tabla N 21, se observan los valores de LDL corregidos por peso. No se observaron diferencias entre los grupos DC y DC+IF durante todo el tratamiento.

63 Tabla 21 Valores de LDL (mg/dl) de las ratas experimentales. LDL (mg/dl) Dieta Inicial Día 15 Día 30 DC 8,9±1,4 13,4±1,0 18,4±3,2 DC+IF 8,3±1,2 16,8±1,1 18,8±5,6 CAF 13,3±0,4 * 19,2±1,1 ** 37,4±6,0 *** CAF+IF 9,2±1,2 21,2±1,1 *** 25,1±4,0 * p 0,013 0,0001 0,0001 CAF v/s CAF +IF ns ns p 0,001 DC= Grupo que recibe dieta control, DC+IF= Grupo que recibe dieta control más IF al 1%, CAF= Grupo que recibe dieta de cafetería, CAF+IF= Grupo que recibe dieta de cafetería más IF al 1%. Los valores son media ± S.E.M. n=8 ratas por grupo. ANOVA de dos factores para medidas repetidas, post hoc Tukey *p 0,05, ** p 0,01, y ***p 0,001 comparado con los valores del grupo DC. Valores normales LDL hasta 17 mg/dl. Efecto tiempo, p<0,0001; efecto dieta, p=0,0001; efecto de la interacción dieta-tiempo, p=0,0001. (n=8 por grupo). Cuando comparamos los valores de LDL en ayuno de las ratas que consumieron dieta de cafetería (CAF y CAF+IF), se observó que en el tiempo inicial, el grupo CAF presentó valores de LDL de 13,3 mg/dl, presentando diferencias (p 0,013) con respecto a los grupos que consumieron dieta control (DC y DC+IF). Al día 15 el grupo CAF presentó valores de LDL de 19,2 mg/dl, mientras que el grupo CAF+IF presentó valores de LDL de 21,2 mg/dl. A los 30 días el grupo CAF incrementó su valor a 37,2 mg/dl y el grupo CAF+IF a 25,1. Ambos grupos (CAF y CAF+IF) fueron diferentes (p 0,001). El ingrediente funcional en 30 días fue capaz disminuir los LDL elevados producidos por la ingesta de la dieta de cafetería en un 32,9%. Los valores de VLDL corregidos por peso se presentan en la Tabla N 22, se observan. No se advirtieron diferencias entre los grupos DC y DC+IF durante todo el tratamiento. Al comparar los valores de VLDL en ayuno de las ratas que consumieron dieta de cafetería, presentaron mayores valores de VLDL (31,7 y 30,7 mg/dl) con respecto a los grupos que consumieron dieta control (15,7 y 14,2 mg/dl). Al día 15, el grupo CAF presentó valores de VLDL de 31,8 mg/dl y el grupo CAF+IF disminuyó sus valores de VLDL a 25,7 mg/dl, y ambos grupos son diferentes (p 0,001). A los 30 días el grupo CAF aumentó sus valores de VLDL a 33,3 mg/dl, pero el grupo CAF+IF disminuyó sus valores a 11,4 mg/dl (no fue diferente al grupo control) y ambos grupos (CAF y CAF+IF) fueron diferentes (p 0,001).

64 Tabla 22 Valores de VLDL (mg/dl) de las ratas experimentales. VLDL (mg/dl) Dieta Inicial Día 15 Día 30 DC 15,7±1,3 15,6±1,3 11,0±1,7 DC+IF 14,2±0,6 14,7±0,8 9,2±0,5 CAF 31,7±2,4 *** 31,8±0,9 *** 33,3±0,7 *** CAF+IF 30,7±3,9 *** 25,7±0,6 *** 11,4±0,9 p 0,0001 0,0001 0,0001 CAF v/s CAF +IF ns p 0,001 p 0,001 DC= Grupo que recibe dieta control, DC+IF= Grupo que recibe dieta control más IF al 1%, CAF= Grupo que recibe dieta de cafetería, CAF+IF= Grupo que recibe dieta de cafetería más IF al 1%. Los valores son media ± S.E.M. n=8 ratas por grupo. ANOVA de dos factores para medidas repetidas, post hoc Tukey *p 0,05, ** p 0,01, y ***p 0,001 comparado con los valores del grupo DC. Valores normales LDL hasta 17 mg/dl. Efecto tiempo, p<0,0001; efecto dieta, p=0,0001; efecto de la interacción dieta-tiempo, p=0,0001. (n=8 por grupo). De este modo el ingrediente funcional en 30 días fue capaz disminuir los VLDL elevados por la ingesta de la dieta de cafetería en un 65,8%, llegando a los valores del grupo control. En la Tabla N 23, se presentan los valores de HDL corregidos por peso. No existen diferencias significativas entre los grupos DC y DC+IF durante todo el tratamiento. Los valores de HDL no presentaron diferencias entre grupos en ninguno de los tres tiempos. Tabla 23 Valores de HDL (mg/dl) de las ratas experimentales. HDL (mg/dl) Dieta Inicial Día 15 Día 30 DC 27,6±6.1 36,7±5,6 33,0±6,1 DC+IF 29,2±3,1 35,7±4,8 35,4±9,7 CAF 22,0±2,7 30,8±1,2 * 37,4±3,4 CAF+IF 24,9±3,6 31,7±2,0 31,6±3,0 p 0,009 0,010 0,267 CAF v/s CAF +IF ns ns ns DC= Grupo que recibe dieta control, DC+IF= Grupo que recibe dieta control más IF al 1%, CAF= Grupo que recibe dieta de cafetería, CAF+IF= Grupo que recibe dieta de cafetería más IF al 1%. Los valores son media ± S.E.M. n=8 ratas por grupo. ANOVA de dos factores para medidas repetidas, post hoc Tukey *p 0,05, ** p 0,01, y ***p 0,001 comparado con los valores del grupo DC. Valores normales LDL hasta 17 mg/dl. Efecto tiempo, p<0,0001; efecto dieta, p=0,0001; efecto de la interacción dieta-tiempo, p=0,0001. Para ambas variables. (n=8 por grupo).

65 Existen varios componentes presentes en el ingrediente funcional que provocan el efecto hipolipemiante observado. El efecto fibra en el metabolismo del colesterol ha sido ampliamente reportado (Alvarado y cols., 2001, Bunzel y cols., 2001; Parillo y Riccardi, 2004, y Chen, y cols., 2008, Hye Kyung y cols., 2006a, 2006b; Berger y cols., 2003; Plate y Areas, 2002, Hu y Van Dam, 2001, y Malainine y cols., 2003). Además los esteroles, estanoles y tocotrienoles tienen una importante función hipocolesterolémica y esta función ha sido demostrada tanto en numerosos estudios con animales y humanos (Qureshi y cols., 2000, Qureshi y cols., 1997, Czerwiński y cols., 2004 y Marcone y cols., 2004). El ingrediente funcional al ser alto en fibra y tener una buena proporción entre fibra dietética soluble e insoluble, además de una alta cantidad de esteroles y tocotrienoles ejerce una efecto hipolipémico. Este efecto fue capaz de normalizar los niveles de colesterol total triglicéridos y VLDL, y de disminuir los valores de LDL, en 30 días de ingesta del ingrediente funcional, contrarrestando el efecto nocivo de la dieta de cafetería. Al día 0, o inicio del estudio ambos grupos son comparables en todas las variables de acuerdo a su dieta base. Al día 15, el consumo de ingrediente funcional provocó una reducción en: 1) aumento del peso (dejando de ser obesas); 2) ingesta (valores grupo DC); 3) glicemia, triglicéridos y VLDL, cuando comparamos CAF+IF v/s CAF. Al día 30, éstas variables mantienen esta reducción, tiempo en el cual ésta diferencia es mayor. Además, las siguientes variables: insulina, HOMA, colesterol y LDL, presentan una disminución con respecto al grupo control, diferenciándose del grupo que sólo recibe dieta de cafetería. Al día 30 los parámetros que llegan a los valores del grupo control son: ingesta, colesterol, triglicéridos y VLDL. Demostrando de este modo que el IF posee una actividad normoglicémica y una actividad hipolipémica.

66 4. Determinación de los parámetros de estrés oxidativo: actividad enzimática de SOD, CAT, y GPx (en hígado) y TBARS-MAD y AGE (en plasma), en los 4 grupos; en ratas alimentadas con dieta control y en ratas alimentadas con dieta alta en grasa, con y sin el IF, durante 30 días. El registro de los parámetros de estrés oxidativo, en extracto hepático, se observan en la Tabla N 24. Los valores de los parámetros de estrés oxidativo en extracto hepático, fueron corregidos por la cantidad de proteína presente en los extractos. Tabla 24 Valores de SOD, CAT, MDA y AGE en extracto hepático de las ratas experimentales. Grupos SOD CAT MDA AGE (U/mg prot) (UM/mg prot) (pmol/mg prot) (µg/mg prot) DC 102,3±5,8 28,7±1,1 0,30±0,02 0,90±0,04 DC+IF 103,3±5,5 26,8±0,9 0,39±0,04 0,75±0,04 * CAF 65,0±2,9 *** 17,1±0,9 *** 0,40±0,03 1,00±0,02 CAF+IF 86,6±2,6 17,9±0,5 *** 0,30±0,03 0,92±0,04 p 0,0001 0,0001 0,043 0,001 CAF v/s CAF +IF p 0,01 ns ns ns DC= Grupo que recibe dieta control, DC+IF= Grupo que recibe dieta control más IF al 1%, CAF= Grupo que recibe dieta de cafetería, CAF+IF= Grupo que recibe dieta de cafetería más IF al 1%. Los valores son media ± S.E.M. n=8 ratas por grupo. Anova una vía, post hoc Tukey. *p 0,05, ** p 0,01, y ***p 0,001 comparado con los valores del grupo DC. Observamos que existen diferencias en la actividad SOD y CAT entre grupos dependiendo de la dieta y ambas enzimas presentaron una actividad disminuida en los grupos que consumieron dieta de cafetería. En MDA no se observan diferencias debido a la dieta y en AGE sólo observamos una disminución en el grupo DC+IF. Se ha demostrado que la ingesta de dieta de cafetería provoca una disminución de la actividad de las enzimas superóxido dismutasa (SOD) y catalasa (CAT) (Bouanane y cols. 2009, Sampey y cols. 2012, y Ghanim y cols. 2011, y Boden y cols., 2012). Nuestros resultados concuerdan con este hecho y se observó una disminución en la actividad de ambas enzimas al consumir la dieta de cafetería.

67 De acuerdo a estos resultados podemos decir que en el grupo alimentado con dieta de cafetería, la ingesta crónica del ingrediente funcional durante 5 semanas aumentó: la actividad SOD (33,3%) (p 0,01)y no tuvo efecto en la actividad de la CAT, ni en la cantidad de MDA, ni en AGE. Los valores de SOD en el grupo CAF+IF al cabo de 5 semanas no tienen diferencia significativa con el grupo control, esto a pesar de seguir consumiendo su dieta alta en grasa. La vía por la cual la ingesta de antioxidantes es capaz de modular la expresión de SOD, CAT y glutatión es mediante el factor de transcripción Nrf2, el cual se une a secuencias ARE e induce la expresión de los genes que contienen estos elementos. En condiciones normales, el factor de transcripción Nrf2 es retenido y degradado en el citoplasma a través de su interacción con el inhibidor Keap1, sin embargo, en respuesta a un aumento en los niveles de las ROS, Keap1 libera a Nrf2, el cual se transloca al núcleo donde promueve la expresión de diversas enzimas antioxidantes. Entonces, la vía de señalización "Nrf2-Keap1" sería una de las principales vías de defensa contra el estrés oxidativo. Últimamente, se ha demostrado que esta vía puede ser inducida por la presencia de flavonoides, carotenoides y polifenoles en forma dosis dependiente (Xing y cols y Jacob y cols. 2012). Ghanim y cols. 2011, comprobaron que el uso de resveratrol, un potente polifenol (3,5,4'-trihidroxiestilbeno) presente en el vino tinto, suprimía el incremento de estrés oxidativo provocado por una dieta alta en grasa. El efecto se debía principalmente a la estimulación de la actividad de Nrf-2. Este estudio se realizó en hombres y mujeres consumiendo 100 mg de resveratrol, lo cual equivale a 75 mg de polifenoles totales. En nuestro estudio, la cantidad de fenoles totales que posee el ingrediente funcional es de 5,7 mg EAG/g, como la ingesta de IF fue de 330 a 350 mg diarios, significa que las ratas consumieron 1,8 a 1,9 mg EAG al día, lo que equivale a aproximadamente 3,6 a 3,8 mg EAG/kg de rata. Entonces, 100 mg del ingrediente funcional contiene 570 mg de fenoles totales, es decir 7,6 veces el resveratrol. No sólo los antioxidantes aumentan la capacidad antioxidante, la fibra también posee un efecto, aunque el mecanismo de acción aún no se encuentra definido (Lin y cols. 2012). El ingrediente funcional alto en fibra y polifenoles, consumido al 1% durante 30 días, fue capaz de aumentar un 33% la actividad de SOD, llegando a los valores del grupo control, la cual se encontraba disminuida debido a la ingesta de la dieta de cafetería.

68 5. Evaluación mediante análisis RT-PCR del patrón de expresión de los genes Mfn2, UCP-2, PPARα, PPARγ y SOD, en 4 grupos; en ratas alimentadas con dieta control y en ratas alimentadas con dieta alta en grasa, con y sin el IF, durante 30 días. Se realizó la determinación de la abundancia relativa de los RNAm de los genes Mfn2, UCP-2, PPARα, PPARγ y SOD, en músculo (soleus), tejido adiposo (visceral), páncreas e hígado. No se observaron diferencias significativas entre los grupos DC y DC+IF, para la expresión de los genes en los tejidos estudiados. Expresión del gen de Mitofusina 2 (Mfn2): Para Mfn2 se observó que existió el mismo patrón de expresión en los tres tejidos analizados: páncreas, músculo y tejido adiposo, en los cuales se observó un aumento de la expresión de Mfn2 en el grupo CAF. La expresión del gen de mitofusina en páncreas se observa en la Figura N 16. Figura N 16 Expresión relativa de mrna del gen Mfn2 en páncreas, según tipo de dieta. *** *** ** ** DC= Grupo que recibe dieta control, DC+IF= Grupo que recibe dieta control más IF al 1%, CAF= Grupo que recibe dieta de cafetería, CAF+IF= Grupo que recibe dieta de cafetería más IF al 1%. Los valores son media ± S.E.M. n=8 ratas por grupo. Kruskal-Wallis, comparaciones múltiples *p 0,05, ** p 0,01, y ***p 0,001.

69 En páncreas el grupo CAF+IF se aproximó a los valores de expresión del grupo DC, presentando una diferencia comparado con el grupo CAF (Kruskal-Wallis, comparaciones múltiples p 0,01). La expresión del gen de mitofusina en músculo se observa en la Figura N 17. Figura N 17 Expresión relativa de mrna del gen Mfn2 en músculo, según tipo de dieta. ** ** * * *** DC= Grupo que recibe dieta control, DC+IF= Grupo que recibe dieta control más IF al 1%, CAF= Grupo que recibe dieta de cafetería, CAF+IF= Grupo que recibe dieta de cafetería más IF al 1%. Los valores son media ± S.E.M. n=8 ratas por grupo. Kruskal-Wallis, comparaciones múltiples *p 0,05, ** p 0,01, y ***p 0,001. En el músculo existió una diferencia significativa entre los grupos CAF y CAF+IF, en los que el grupo CAF+IF disminuyó su expresión mostrando niveles de expresión más bajos que el grupo DC, y presentando la mayor diferencia estadística comparado con el grupo CAF (Kruskal-Wallis, comparaciones múltiples p 0,001). La expresión del gen de mitofusina en tejido adiposo se observa en la Figura N 18. En tejido Adiposo CAF+IF presentó una menor disminución al comparar con los otros tejidos, y no consiguió llegar a los niveles de expresión del grupo DC, pero si presentó una diferencia respecto al grupo CAF (Kruskal-Wallis, comparaciones múltiples p 0,05).

70 Figura N 18 Expresión relativa de mrna del gen Mfn2 en tejido adiposo, según tipo de dieta. *** * * *** ** DC= Grupo que recibe dieta control, DC+IF= Grupo que recibe dieta control más IF al 1%, CAF= Grupo que recibe dieta de cafetería, CAF+IF= Grupo que recibe dieta de cafetería más IF al 1%. Los valores son media ± S.E.M. n=8 ratas por grupo. Kruskal-Wallis, comparaciones múltiples *p 0,05, ** p 0,01, y ***p 0,001. Como no existieron cambios en el grupo DC+IF, en los tres tejidos estudiados, el efecto del IF se produjo sólo en un estado de lipotoxicidad provocado por la dieta alta en grasa. Mfn2 se encuentra reprimido en pacientes obesos (Engerfield, y cols., 2006; Bach, y cols., 2005; Pich, y cols., 2005; y Soriano y cols., 2006). No obstante, los últimos hallazgos indican que Mfn2 es inducida por Sp1, el cual aumenta mediante la activación de TNFα a través de NF-kB, y como TNFα aumenta su expresión a través del incremento de ROS y de dieta alta en grasa, no es extraño observar un aumento de Mfn2 en ratas alimentadas con dieta de cafetería. (Sorianello y cols y Knowlton y Chen, 2012). Ver figura N 19 Figura N 19 Esquema de regulación de la expresión de Mfn2 TNFα Nf-κB Sp1 Mfn2 ROS Dieta HF Dieta HF (dieta alta en grasa), ROS (especies oxígeno reactivas), TNFα (factor de necrosis tumoral α), Nf-κB (factor nuclear κ B), Sp1 (proteína específica 1), Mfn2 (mitofusina 2).

71 Además, la expresión de TNFα es inhibida por fibra y algunos otros compuestos bioactivos como los flavonoides, lo que se evidencia de acuerdo a la adición del IF en la disminución de la expresión de Mfn2 en los tres tejidos analizados. Mfn2 posee un importante rol en la fisión mitocondrial, y su aumento de función incrementa el potencial de membrana y aumenta la oxidación de glucosa (Zhang y Zhang 2012, Galland L y Ye y cols. 2001). Expresión del gen de la Proteína desacoplante 2 (UCP2): Se analizó la expresión de la proteína desacoplante 2 (UCP2) en tres tejidos; tejido adiposo, músculo y páncreas. En páncreas no se observaron diferencias entre los distintos grupos estudiados. La expresión de UCP2 en tejido adiposo, y músculo, fue diferente, es decir, UCP2 presentó una expresión tejido específico. En la Figura N 20 se observa la expresión de UCP2 en tejido adiposo. Figura N 20 Expresión relativa de mrna del gen UCP2 en tejido adiposo, según tipo de dieta. DC= Grupo que recibe dieta control, DC+IF= Grupo que recibe dieta control más IF al 1%, CAF= Grupo que recibe dieta de cafetería, CAF+IF= Grupo que recibe dieta de cafetería más IF al 1%. Los valores son media ± S.E.M. n=8 ratas por grupo. Kruskal-Wallis, comparaciones múltiples *p 0,05, ** p 0,01, y ***p 0,001.

72 En tejido adiposo se observó un aumento de expresión en el grupo CAF y CAF+IF y al comparar ambos grupos no existieron diferencias. Cabe destacar que las diferencias encontradas fueron marginales y por lo poco homogéneo que es éste tejido, el cuál en la obesidad se encuentra infiltrado por otros tipos celulares, por ejemplo macrófagos y éstos poseen niveles de expresión distintos a los del tejido adiposo, y esto puede enmascarar la expresión real del tejido. El aumento de la expresión de UCP2 en tejido adiposo se encuentra reportado y concuerda con los resultados observados (Porter 2001; Chieregatti y Meldolesi, 2005, Krauss y cols., 2003; Friederich y cols. 2008; Zhang, y cols. 2001; y Xie, y cols. 2008). En la Figura N 21 se observa un esquema de la vía por la cual aumenta la expresión de UCP2 en tejido adiposo (Ravnskjaer y cols., 2005, Teruyo y cols. 2002, Oh y cols. 2006, Fatehi-Hassanabad y cols. 2007, Holmes y cols. 2008, Castro y cols. 2011, Patterson y cols. 2012). Figura N 21 Esquema de regulación de la expresión de UCP2, en Tejido Adiposo ROS Dieta HF Nf-κB PPARα UCP2 ROS (especies oxígeno reactivas), Dieta HF (dieta alta en grasa), PPARα (receptor activado de proliferación de los peroxisomas alfa), Nf-κB (factor nuclear κ B), UCP2 (proteína desacoplante 2). La dieta alta en grasa y el aumento de especies oxígeno reactivas provocan un aumento de la expresión de Nf-κB y de PPARα, UCP2 se encuentra regulado por ambos factores de transcripción, por lo cual aumenta su expresión. La expresión del gen de UCP2 en músculo se observa en la Figura N 22.

73 Figura N 22 Expresión relativa de mrna del gen UCP2 en músculo, según tipo de dieta. DC= Grupo que recibe dieta control, DC+IF= Grupo que recibe dieta control más IF al 1%, CAF= Grupo que recibe dieta de cafetería, CAF+IF= Grupo que recibe dieta de cafetería más IF al 1%. Los valores son media ± S.E.M. n=8 ratas por grupo. Kruskal-Wallis, comparaciones múltiples *p 0,05, ** p 0,01, y ***p 0,001. En músculo se determinó que el grupo CAF presentó una expresión disminuida con respecto al grupo DC. Esta disminución es atenuada por el consumo de IF, el grupo CAF+IF aumentó su expresión a niveles similares a los del grupo DC, siendo diferente del grupo CAF (Kruskal-Wallis, comparaciones múltiples p 0,01). Se observó una tendencia en el grupo DC+IF de un aumento de expresión, por lo cual podríamos inferir que el aumento de expresión podría ser debido a la ingesta del IF. En páncreas, UCP2 posee un rol relevante en la función de las células β; la hiperglicemia aumenta la producción de superóxido mitocondrial, lo que gatilla un aumento en la expresión de UCP2, éste gen desacopla la mitocondria disminuyendo la concentración de ATP, lo que dificulta la secreción de insulina. Esto sucede también ante un estímulo de lipotoxicidad, y éste efecto se encuentra disminuido si la actividad de SOD dentro del órgano es la correcta (Krauss y cols., 2003; Friederich y cols. 2008; Zhang, y cols. 2001; Xie, y cols. 2008). La expresión de UCP2 en modelos alimentados con dieta alta en grasa y obesidad es controversial dependiendo de si el estímulo es agudo o crónico, y del tipo de tejido. Incluso se ha comprobado que la expresión de UCP2 es diferente entre distintos tipos de músculo, ante diferentes estímulos (Samec y cols. 1998, Harrold y cols. 2000).

74 En sujetos diabéticos sometidos a una dieta estricta para bajar de peso los niveles de expresión de UCP2 y UCP3 disminuyen (Schrauwen y cols. 2000) En modelos de inducción de diabetes la información también es controversial, sin embargo, se puede inferir que UCP2 es un regulador del metabolismo de energía y de este modo jugaría un rol en la insulino resistencia (Boss y cols. 2000, Chan y Harper, 2006, Fisler y cols. 2006). En nuestro modelo, cuando las ratas fueron alimentadas con dieta de cafetería, la expresión de PPARα en músculo se vio incrementada (ver Figura N 24), como la expresión de UCP2 se encuentra regulada por los niveles de PPARα, lo esperado hubiese sido que la expresión de UCP2 fuera mayor que la del grupo DC. Pero esto no fue así, por lo tanto, debe existir otro tipo de señalización, hasta el momento desconocida, que a pesar del aumento de PPARα y de Nf-κB, provoque la represión de UCP2. Marti y cols. (2002) y Zhang y cols. (2012), demuestran que en músculo cardíaco de ratas alimentadas con dieta alta en grasa UCP2 disminuye como un mecanismo para no disipar energía, por lo tanto debido a que el músculo también posee un alto requerimiento energético disminuya la expresión de UCP2. Esta represión es muy nociva para el órgano (músculo) y provocaría un aumento exacerbado del estrés oxidativo del órgano. En la Figura N 23 observamos un esquema propuesto de la expresión de UCP2 en músculo. Figura N 23 Esquema de regulación de la expresión de UCP2, en Tejido Adiposo ROS AG - glucosa Nf-κB? PPARα UCP2 ROS (especies oxígeno reactivas), AG-glucosa (ácidos grasos y glucosa), PPARα (receptor activado de proliferación de los peroxisomas alfa), Nf-κB (factor nuclear κ B), UCP2 (proteína desacoplante 2).

75 Expresión génica del Receptor Activado de Proliferación de los Peroxisomas alfa (PPARα): Se analizó la expresión del receptor activado de proliferación de los peroxisomas alfa (PPARα) en tres tejidos; músculo, hígado y páncreas. La expresión del gen de PPARα en músculo e hígado se observa en la Figura N 24 y N 25 respectivamente. En ambos tejidos se observa el mismo patrón de expresión por lo cual serán analizados en conjunto. Figura N 24 Expresión relativa de mrna del gen PPAR alfa en músculo, según tipo de dieta. *** ** *** DC= Grupo que recibe dieta control, DC+IF= Grupo que recibe dieta control más IF al 1%, CAF= Grupo que recibe dieta de cafetería, CAF+IF= Grupo que recibe dieta de cafetería más IF al 1%. Los valores son media ± S.E.M. n=8 ratas por grupo. Kruskal-Wallis, comparaciones múltiples *p 0,05, ** p 0,01, y ***p 0,001. En músculo y en hígado se observó que en el grupo CAF existió un aumento de expresión de PPARα con respecto al control. Éste aumento de expresión concuerda con Olefsky (2000), Koh (2003), y Sheng y cols. (2008), en que dietas altas en grasa u obesidad provocan un aumento de PPARα en el músculo o hígado, de este modo PPARα mediante su unión con NF-κB bloquea la transcripción de COX2, IL1 y TNFα, y de esta forma disminuye la inflamación, PPARα también activa la síntesis de genes que incrementan el metabolismo y transporte de ácidos grasos, la proliferación de los peroxisomas y la hipolipidemia (ACO, CYP4A, FABP, ADRP, y ApoA).

76 Figura N 25 Expresión relativa de mrna del gen PPAR alfa en hígado, según tipo de dieta. ** ** *** DC= Grupo que recibe dieta control, DC+IF= Grupo que recibe dieta control más IF al 1%, CAF= Grupo que recibe dieta de cafetería, CAF+IF= Grupo que recibe dieta de cafetería más IF al 1%. Los valores son media ± S.E.M. n=8 ratas por grupo. Kruskal-Wallis, comparaciones múltiples *p 0,05, ** p 0,01, y ***p 0,001. En ambos tejidos se observó que el IF provocó una disminución en la expresión, esto se observa como una tendencia en el grupo DC+IF. La diferencia entre el grupo CAF+IF y el grupo CAF es significativa (Kruskal-Wallis, comparaciones múltiples p 0,001), en ambos tejidos. Por este motivo ésta sería una disminución de la expresión provocada por el IF y potenciada en un estado patológico de obesidad. (Desvergne y Wahli, 1999, Steiner y cols., 2001; Sheng, y cols., 2008, Olefsky, 2000; Koh, 2003, Muoio y cols., 2002, y Guerre- Millo y cols., 2000) El esquema de regulación de la expresión de PPARα en músculo e hígado se resume en la Figura N 26.

77 Figura N 26 Esquema de regulación de la expresión de PPARα, en Músculo e Hígado Obesidad Dieta HF COX2 PPARα Nf-κB TNFα RXR IL1 ACO CYP4A FABP ADRP - ApoA Transporte AG β oxidación Proliferación peroxisomas Nf-κB (factor nuclear κ B), COX2 (ciclo oxigenasa 2), TNFα (factor de necrosis tumoral α), IL1 (interleuquina 1), RXR (receptor X retinoide), AP2 (proteína adipocítica 2), ADRP (proteína relacionada a la diferenciación de adipocitos), LPL (lipoproteín lipasa), Adipo, C/EBP (CCAAT-proteínas incrementadoras de unión). En la Figura N 27 se observa la expresión relativa del gen PPARα en páncreas. Figura N 27 Expresión relativa de mrna del gen PPAR alfa en páncreas, según tipo de dieta. *** *** ** * *** DC= Grupo que recibe dieta control, DC+IF= Grupo que recibe dieta control más IF al 1%, CAF= Grupo que recibe dieta de cafetería, CAF+IF= Grupo que recibe dieta de cafetería más IF al 1%. Los valores son media ± S.E.M. n=8 ratas por grupo. Kruskal-Wallis, comparaciones múltiples *p 0,05, ** p 0,01, y ***p 0,001.

Asociación Argentina de Neuroentrenamiento www.neuroentrenamiento.com.ar

Asociación Argentina de Neuroentrenamiento www.neuroentrenamiento.com.ar 1 2 NUTRIENTES II Minerales A diferencia de las vitaminas, que tienen una función exclusivamente reguladora del metabolismo, los minerales pueden tener tanto una función reguladora (forman parte de hormonas

Más detalles

LA INSULINA DE ACCION EN EL HIPERTIROIDISMO: UN ENFOQUE EN LOS MUSCULOS Y TEJIDO ADIPOSO.

LA INSULINA DE ACCION EN EL HIPERTIROIDISMO: UN ENFOQUE EN LOS MUSCULOS Y TEJIDO ADIPOSO. LA INSULINA DE ACCION EN EL HIPERTIROIDISMO: UN ENFOQUE EN LOS MUSCULOS Y TEJIDO ADIPOSO. INTRODUCCION Las hormonas tiroideas pueden influir en un número de procesos en el cuerpo. Los cambios en sus niveles

Más detalles

FIBRA DIETETICA Y SALUD Gloria Jury Jamis. Directora NUT, Centro de Psiconutrición. San Pascual 736 - Las Condes. Fono: 208-73 51 / 207-48 06. http://www.psiconutricion.cl La deficiencia de fibra dietética

Más detalles

Lamentablemente los resultados obtenidos revelan una condición alarmante, que sin duda alguna debemos atender con prontitud.

Lamentablemente los resultados obtenidos revelan una condición alarmante, que sin duda alguna debemos atender con prontitud. La Unidad Médica realizó un pequeño estudio sobre las condiciones de salud del personal según el perfil de lípidos tomado a los funcionarios de la DGSC, a partir de la valoración de los exámenes de laboratorio

Más detalles

Existen distintos tipos? Efectivamente existen distintos tipos de diabetes, según el mecanismo de producción de la enfermedad.

Existen distintos tipos? Efectivamente existen distintos tipos de diabetes, según el mecanismo de producción de la enfermedad. Diabetes Qué es la diabetes? La diabetes mellitus comprende un grupo de trastornos metabólicos que comparten la existencia de niveles elevados de glucosa en sangre. Es una enfermedad en la que el organismo

Más detalles

EL COLESTEROL LMCV 05-2011 LMCV

EL COLESTEROL LMCV 05-2011 LMCV 05-2011 El Colesterol Es una sustancia grasa que se encuentra en forma natural en todas las células del organismo. Es utilizado para la formación de tejidos y hormonas; y también interviene en la absorción

Más detalles

INDICE GENERAL 1. DIABETES: ASPECTOS GENERALES... 1

INDICE GENERAL 1. DIABETES: ASPECTOS GENERALES... 1 INDICE GENERAL Página INTRODUCCION GENERAL... 1 1. DIABETES: ASPECTOS GENERALES... 1 1.1 Definición... 1 1.2 Tipos de diabetes... 1 1.2.1 Diabetes insulinodependiente o tipo 1... 1 1.2.2 Diabetes no insulinodependiente

Más detalles

Son alimentos que además de nutrir aportan un beneficio específico para la salud

Son alimentos que además de nutrir aportan un beneficio específico para la salud Son alimentos que además de nutrir aportan un beneficio específico para la salud Grande Covián: El alimento funcional tiene la apariencia de un alimento convencional, se consume como parte de una dieta

Más detalles

Síndrome Metabólico NUESTRA REALIDAD. Fausto Carrillo Estrada

Síndrome Metabólico NUESTRA REALIDAD. Fausto Carrillo Estrada Síndrome Metabólico NUESTRA REALIDAD Fausto Carrillo Estrada SINDROME METABOLICO CADA DIA MAS FRECUENTE SINDROME METABOLICO Incorporación de malos hábitos Mala alimentación (Ac grasos sat) Altos grados

Más detalles

ÁREA DE BIOLOGÍA CELULAR DEPARTAMENTO DE BIOLOGÍA AMBIENTAL Y SALUD PÚBLICA FACULTAD DE CIENCIAS EXPERIMENTALES UNIVERSIDAD DE HUELVA ESTRÉS OXIDATIVO

ÁREA DE BIOLOGÍA CELULAR DEPARTAMENTO DE BIOLOGÍA AMBIENTAL Y SALUD PÚBLICA FACULTAD DE CIENCIAS EXPERIMENTALES UNIVERSIDAD DE HUELVA ESTRÉS OXIDATIVO ÁREA DE BIOLOGÍA CELULAR DEPARTAMENTO DE BIOLOGÍA AMBIENTAL Y SALUD PÚBLICA FACULTAD DE CIENCIAS EXPERIMENTALES UNIVERSIDAD DE HUELVA ESTRÉS OXIDATIVO Concepto de estrés oxidativo. Formación de especies

Más detalles

Curso de Fisiología a II

Curso de Fisiología a II Curso de Fisiología a II INSULINA, GLUCAGÓN N Y DIABETES MELLITUS Dr. Iván Martínez Duncker R. Profesor-Investigador, UAEM El Páncreas esta compuesto de: a) una porción acinar: secreta jugos digestivos

Más detalles

Lácteos en la Prevención y tratamiento de la Obesidad

Lácteos en la Prevención y tratamiento de la Obesidad Dr. Mauricio Barahona Cruz, MSc. Médico-Cirujano Máster en Nutrición Humana Presidente Asociación Costarricense para el Estudio de la Obesidad (A.C.E.O.) Presidente de la Federación Centroamericana y del

Más detalles

Nutrición. Cómo mantener una vida saludable? Lípidos:

Nutrición. Cómo mantener una vida saludable? Lípidos: Nutrición La salud física y mental depende de muchos factores, uno de ellos es nuestra forma de alimentarnos. Los alimentos nos dan la energía y los nutrientes que necesitamos para una vida saludable.

Más detalles

Manual de Nutrición y Dietética. La fibra dietética o alimentaria es un componente importante de la dieta y debe consumirse en cantidades adecuadas.

Manual de Nutrición y Dietética. La fibra dietética o alimentaria es un componente importante de la dieta y debe consumirse en cantidades adecuadas. 8. Fibra dietética La fibra dietética o alimentaria es un componente importante de la dieta y debe consumirse en cantidades adecuadas. Bajo la denominación de fibra dietética se incluyen un amplio grupo

Más detalles

La insulina es una hormona peptídica secretada por el páncreas en respuesta al aumento de azúcar en la sangre, por lo general después de una comida.

La insulina es una hormona peptídica secretada por el páncreas en respuesta al aumento de azúcar en la sangre, por lo general después de una comida. Qué es la insulina? La insulina es una hormona peptídica secretada por el páncreas en respuesta al aumento de azúcar en la sangre, por lo general después de una comida. Sin embargo, no tienes que comer

Más detalles

TEMA 7. PÁNCREAS ENDOCRINO

TEMA 7. PÁNCREAS ENDOCRINO TEMA 7. PÁNCREAS ENDOCRINO Introducción. Insulina. Glucagón. Somatostatina. Polipéptido pancreático. Regulación de la glucemia. 1. OBJETIVOS Comprender la importancia que tiene el control de la glucemia

Más detalles

CHAPTER 9 Sumario en español

CHAPTER 9 Sumario en español CHAPTER 9 Sumario en español Mecanismos de muerte celular inducidos por estrés oxidativo en hepatocitos. Objetivos para una intervención de protección Chapter 9 Radical libre es aquella especie química

Más detalles

bioactivas. Bebidas envejecimiento y la salud

bioactivas. Bebidas envejecimiento y la salud Innovación en el sector de jugos y bebidas Innovación en el sector de jugos y bebidas bioactivas. Lic. David Pineda Técnico Sectorial Célula de Alimentos y Bebidas Durante las últimas 2 décadas, el consumo

Más detalles

Comprenda el colesterol

Comprenda el colesterol ilearning about your health Comprenda el colesterol Understanding Cholesterol www.cpmc.org/learning Qué es el colesterol? El colesterol es una sustancia adiposa que forma parte de las membranas celulares.

Más detalles

EResumen. Metabolismo Colónico de la Fibra. Panorama

EResumen. Metabolismo Colónico de la Fibra. Panorama Panorama Metabolismo Colónico de la Fibra P. García Peris, I. Bretón Lesmes, C. de la Cuerda Compes y M. Camblor Álvarez grasos de cadena corta, con funciones importantes a nivel del colon, y a nivel sistémico.

Más detalles

GUÍA DE ATENCIÓN Y EDUCACIÓN NUTRICIONAL PARA DISLIPIDEMIAS

GUÍA DE ATENCIÓN Y EDUCACIÓN NUTRICIONAL PARA DISLIPIDEMIAS 1. OBJETIVO Revisó Jefe DBU/ Jefe SSISDP PROCESO BIENESTAR ESTUDIANTIL Aprobó Rector Página 1 de 7 Fecha de aprobación Diciembre 09 de 2014 Resolución No. 2515 Establecer los lineamientos necesarios para

Más detalles

LA INTOLERANCIA A LA GLUCOSA

LA INTOLERANCIA A LA GLUCOSA 1 LA INTOLERANCIA A LA GLUCOSA Luego de ingerir alimentos, muchos de ellos son degradados a azúcares en el intestino (el azúcar más importante es la glucosa); esa glucosa es absorbida desde el intestino

Más detalles

CRECIENDO CON LA NATURALEZA! AGRO ENSANCHA

CRECIENDO CON LA NATURALEZA! AGRO ENSANCHA CRECIENDO CON LA NATURALEZA! AGRO ENSANCHA BENEFICIOS: SEMILLA DE CHIA La fibra actúa en el colesterol secuestrándolo durante la digestión y eliminándolo del cuerpo antes de que consiga entrar en la corriente

Más detalles

PROTOCOLO DE ATENCIÓN A PACIENTES CON ESTANOLES y/o ESTEROLES VEGETALES IPS GORDITOS DE CORAZÓN

PROTOCOLO DE ATENCIÓN A PACIENTES CON ESTANOLES y/o ESTEROLES VEGETALES IPS GORDITOS DE CORAZÓN PROTOCOLO DE ATENCIÓN A PACIENTES CON ESTANOLES y/o ESTEROLES VEGETALES IPS GORDITOS DE CORAZÓN Presentación Los estilos de vida poco saludables hacen que la prevalencia de enfermedades cardiovasculares

Más detalles

CAPÍTULO 5. - RADICALES LIBRES DE OXIGENO

CAPÍTULO 5. - RADICALES LIBRES DE OXIGENO CAPÍTULO 5. - RADICALES LIBRES DE OXIGENO RADICALES LIBRES: La vida en el planeta Tierra depende fundamentalmente del Oxígeno, la vida de los humanos no sería posible sin oxígeno pero también algunas de

Más detalles

EL PAPEL DE LOS TRIGLICÉRIDOS EN LA ATEROSCLEROSIS Y SU RELACIÓN CON LA RESISTENCIA A LA INSULINA: UNA RUTA DESCONOCIDA.

EL PAPEL DE LOS TRIGLICÉRIDOS EN LA ATEROSCLEROSIS Y SU RELACIÓN CON LA RESISTENCIA A LA INSULINA: UNA RUTA DESCONOCIDA. EL PAPEL DE LOS TRIGLICÉRIDOS EN LA ATEROSCLEROSIS Y SU RELACIÓN CON LA RESISTENCIA A LA INSULINA: UNA RUTA DESCONOCIDA. Marcelo Alejandro Storino Farina 1, Miguel Ángel Contreras Zambrano 2 1 Medistar

Más detalles

Estos polisacáridos dan a las plantas su estructura - piensa en las paredes celulares de las plantas.

Estos polisacáridos dan a las plantas su estructura - piensa en las paredes celulares de las plantas. Qué es la fibra? La fibra dietética es un polisacárido no digerible, lo que significa que es una forma compleja de hidratos de carbono (poli = "muchos"; sacárido = "azúcar"). Checa la lección Qué son los

Más detalles

XXVI CONGRESO DE LA SOCIEDAD ESPAÑOLA DE DIABETES. Pie de riesgo. Técnicas de motivación HUEVOS: Un placer con pecado? Diabetes en el embarazo

XXVI CONGRESO DE LA SOCIEDAD ESPAÑOLA DE DIABETES. Pie de riesgo. Técnicas de motivación HUEVOS: Un placer con pecado? Diabetes en el embarazo PUBLICACIÓN DE LA SOCIEDAD ESPAÑOLA DE DIABETES revistadiabetes.org Nº 33 - JUNIO 2015 en el embarazo Pie de riesgo HUEVOS: Un placer con pecado? Técnicas de motivación XXVI CONGRESO DE LA SOCIEDAD ESPAÑOLA

Más detalles

CURSO BIOLOGIA CELULAR INGENIERIA CIVIL - BIOTECNOLOGIA SEÑALIZACION CELULAR

CURSO BIOLOGIA CELULAR INGENIERIA CIVIL - BIOTECNOLOGIA SEÑALIZACION CELULAR CURSO BIOLOGIA CELULAR INGENIERIA CIVIL - BIOTECNOLOGIA SEÑALIZACION CELULAR ORGANISMO: Es todo ser vivo animal o vegetal capaz de desempeñar funciones a través de sus órganos ORGANO: Parte estructural

Más detalles

Qué son los nutrientes?

Qué son los nutrientes? Qué son los nutrientes? Se llaman nutrientes a aquellas sustancias que se encuentran en los alimentos y que nuestro organismo aprovecha para cubrir sus necesidades vitales. En el proceso de la digestión,

Más detalles

Clase 7. Continuación sobre Genética del envejecimiento celular y orgánico..

Clase 7. Continuación sobre Genética del envejecimiento celular y orgánico.. Clase 7 Continuación sobre Genética del envejecimiento celular y orgánico.. Síndrome de Werner También conocido como progeria adulta, enfermedad autosómica recesiva muy rara caracterizada por envejecimiento

Más detalles

DIABETES CHARLAS PARA LA COMUNIDAD

DIABETES CHARLAS PARA LA COMUNIDAD CHARLAS PARA LA COMUNIDAD DIABETES La diabetes es una enfermedad en franco aumento. Si bien la predisposición genética es determinante, los factores ambientales son los que la desencadenan: obesidad, sedentarismo.

Más detalles

Www.Body-Fat.Org. ROPHYLAXE Ehrlich e. K. SOBREPESO Y OBESIDAD

Www.Body-Fat.Org. ROPHYLAXE Ehrlich e. K. SOBREPESO Y OBESIDAD Www.Body-Fat.Org ROPHYLAXE Ehrlich e. K. SOBREPESO Y OBESIDAD Sobrepeso - obesidad Son trastornos de la composición orgánica por un exceso absoluto o relativo de grasa corporal. En la actualidad se consideran

Más detalles

Resistencia a la insulina: de la fisiología a la patología

Resistencia a la insulina: de la fisiología a la patología Resistencia a la insulina: de la fisiología a la patología 10/12/2010 En el marco de la Jornada Fisiopatología, avances en el tratamiento nutricional e influencia del estilo de vida en la resistencia a

Más detalles

Las fibras: distintos tipos, distintos beneficios

Las fibras: distintos tipos, distintos beneficios 20.nutrición Las fibras: distintos tipos, distintos beneficios Gemma Baciero Comunicación Científica Royal Canin Ibérica, S.A. Las fibras, uno de los ingredientes fundamentales en cualquier alimento, pertenecen

Más detalles

Diabetes y azúcar. 1. Qué es la diabetes mellitus? 2. Qué es el índice glicémico? 3. Tipos de azúcares disponibles 4. Xylitol

Diabetes y azúcar. 1. Qué es la diabetes mellitus? 2. Qué es el índice glicémico? 3. Tipos de azúcares disponibles 4. Xylitol Diabetes y azúcar 1. Qué es la diabetes mellitus? 2. Qué es el índice glicémico? 3. Tipos de azúcares disponibles 4. Xylitol 1. Qué es la diabetes mellitus? La diabetes mellitus (DM) es un conjunto de

Más detalles

PREGUNTAS FRECUENTES (FAQs)

PREGUNTAS FRECUENTES (FAQs) PREGUNTAS FRECUENTES (FAQs) 1. Qué es la oxidación? La oxidación es una reacción química donde un compuesto cede electrones, y por lo tanto aumenta su estado de oxidación. La reacción química opuesta a

Más detalles

Aprendamos de. Síndrome Metabólico. N o 30. El Síndrome Metabólico, conocido también como. declarada y el 90% se declara sedentaria.

Aprendamos de. Síndrome Metabólico. N o 30. El Síndrome Metabólico, conocido también como. declarada y el 90% se declara sedentaria. Aprendamos de N o 30 1ª Edición / Ficha coleccionable N o 30 / Febrero 2010 Síndrome Metabólico El Síndrome Metabólico, conocido también como Síndrome X o Síndrome de Resistencia a la Insulina ha ido ganando

Más detalles

Libro La Nutrición es conciencia José A. Lozano Teruel

Libro La Nutrición es conciencia José A. Lozano Teruel Libro La Nutrición es conciencia José A. Lozano Teruel Capítulo 2. NUTRIENTES EN RESUMEN Carbohidratos Los carbohidratos desempeñan un papel insustituible como nutrientes a pesar de que su concentración

Más detalles

Número de preguntas correctas Aprobó Sí No VALOR DEL EXAMEN 20 PUNTOS, MÍNIMO PUNTAJE PARA ACREDITACION 14 PUNTOS

Número de preguntas correctas Aprobó Sí No VALOR DEL EXAMEN 20 PUNTOS, MÍNIMO PUNTAJE PARA ACREDITACION 14 PUNTOS COD. o Cédula Nombre del participante: Nombre de la actividad: Seminario de Actualización en Diabetes Mellitus I y II Fecha: 13 de setiembre 2014 Número de preguntas correctas Aprobó Sí No VALOR DEL EXAMEN

Más detalles

Una ingesta suficiente de vitamina E (alfa-tocoferol) es importante puesto que:

Una ingesta suficiente de vitamina E (alfa-tocoferol) es importante puesto que: Vitamina E RESUMEN Introducción El término vitamina E describe una familia de ocho moléculas liposolubles relacionadas. De ellas, el alfatocoferol tiene la mayor actividad biológica y es el más abundante

Más detalles

LA DIABETES DIABETES TIPO 1:

LA DIABETES DIABETES TIPO 1: Hoy comenzamos una serie de capítulos en los que hablaremos de una enfermedad muy extendida entre la población, la diabetes Mellitus. Es un síndrome caracterizado por unos niveles excesivamente elevados

Más detalles

En los países industrializados se consumen alrededor de 15 gramos de fibra al día, en promedio (17,8 g para los hombres y 13,6 g para las mujeres).

En los países industrializados se consumen alrededor de 15 gramos de fibra al día, en promedio (17,8 g para los hombres y 13,6 g para las mujeres). Por qué es tan importante la fibra? En 1972, los científicos propusieron una "hipótesis de la fibra dietética", la que sugería que las enfermedades gastrointestinales comunes como el cáncer de colon, diverticulosis

Más detalles

DIABETES MELLITUS. Dra. Luz Don Centro de Nutrición

DIABETES MELLITUS. Dra. Luz Don Centro de Nutrición DIABETES MELLITUS Dra. Luz Don Centro de Nutrición DEFINICIÓN ENFERMEDAD CRÓNICA METABÓLICA PRESENCIA DE HIPERGLUCEMIA DEFECTO EN LA SECRECIÓN DE INSULINA O EN LA ACCÍON DE LA INSULINA O DE AMBAS DIAGNÓSTICO

Más detalles

- Evaluación en Especialidad:

- Evaluación en Especialidad: Profesionales: Nutricion Deportiva Los profesionales serán capaces de: Realizar práctica profesional en nivel de excelencia, en los diferentes gimnasio de la cadena Pacific, para lo cual deberá obtener

Más detalles

Hacia un nuevo enfoque de los trastornos de lípidos en la diabetes: el Heart Protection Study

Hacia un nuevo enfoque de los trastornos de lípidos en la diabetes: el Heart Protection Study Hacia un nuevo enfoque de los trastornos de lípidos en la diabetes: el Heart Protection Study Roger Lehmann Los beneficios de la terapia de reducción del colesterol en la prevención de las enfermedades

Más detalles

CARACTERÍSTICAS NUTRICIONALES Y SALUDABLES DE LA CARNE DE POLLO Y PAVO

CARACTERÍSTICAS NUTRICIONALES Y SALUDABLES DE LA CARNE DE POLLO Y PAVO CARACTERÍSTICAS NUTRICIONALES Y SALUDABLES DE LA CARNE DE POLLO Y PAVO Documento 2: PRINCIPALES CONCLUSIONES DEL ESTUDIO - RAFAEL CODONY SALCEDO - FRANCESC GUARDIOLA IBARZ - RICARD BOU NOVENSA Grupo de

Más detalles

Alimentos funcionales

Alimentos funcionales 1. Qué son? 2. Su origen... 3. Qué hace funcional a un alimento? 4. Los hay naturales y modificados 5. Son indispensables? 6. Atención a las etiquetas 7. Situación actual: Marco legal Qué son? Huevos Omega-3,

Más detalles

Son productos que, manteniendo las características organolépticas de los tradicionales y consumidos dentro de una dieta variada y equilibrada, además

Son productos que, manteniendo las características organolépticas de los tradicionales y consumidos dentro de una dieta variada y equilibrada, además ALIMENTOS Son productos que, manteniendo las características organolépticas de los tradicionales y consumidos dentro de una dieta variada y equilibrada, además de satisfacer las necesidades nutricionales

Más detalles

Problemas de Azúcar en la Sangre

Problemas de Azúcar en la Sangre Problemas de Azúcar en la Sangre Qué es diabetes? La diabetes es una condición en la que el cuerpo no puede regular los niveles de azúcar en la sangre, dando lugar a una acumulación insalubre de glucosa

Más detalles

COLESTEROL: IMPLICACIONES NUTRICIONALES

COLESTEROL: IMPLICACIONES NUTRICIONALES COLESTEROL: IMPLICACIONES NUTRICIONALES Molécula fundamental para el organismo: -Integrante de membranas -Precursor de hormonas, ácidos biliares y vitamina D Su aporte dietético no es imprescindible, porque

Más detalles

GRASAS Y ACEITES CHARLAS PARA LA COMUNIDAD

GRASAS Y ACEITES CHARLAS PARA LA COMUNIDAD CHARLAS PARA LA COMUNIDAD GRASAS Y ACEITES En los últimos años, el estudio de la nutrición ha podido comprobar que las denominadas enfermedades por exceso : obesidad, diabetes del adulto, aterosclerosis,

Más detalles

Prevención de Riesgo Cardiovascular. Dra. Clara Luz Forero León Médico Laboral-APP Colmena Seguros Noviembre de 2015

Prevención de Riesgo Cardiovascular. Dra. Clara Luz Forero León Médico Laboral-APP Colmena Seguros Noviembre de 2015 Prevención de Riesgo Cardiovascular Dra. Clara Luz Forero León Médico Laboral-APP Colmena Seguros Noviembre de 2015 Datos generales y cifras Las ENFERMEDADES CARDIOVASCULARES (ECV) son la principal causa

Más detalles

X-Plain Hipoglucemia Sumario

X-Plain Hipoglucemia Sumario X-Plain Hipoglucemia Sumario Introducción La hipoglucemia es una afección que causa que el azúcar en la sangre baje a niveles peligrosos. Esto suele ocurrir mayormente en pacientes diabéticos que toman

Más detalles

ES 2 179 789 A1 A23L 1/0528 A23L 1/0526 A61P 3/04. Número de publicación: 2 179 789 PATENTES Y MARCAS. Número de solicitud: 200101561

ES 2 179 789 A1 A23L 1/0528 A23L 1/0526 A61P 3/04. Número de publicación: 2 179 789 PATENTES Y MARCAS. Número de solicitud: 200101561 k 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 k Número de publicación: 2 179 789 21 k Número de solicitud: 0161 1 k Int. Cl. 7 : A61K 3/78 A23L 1/028 A23L 1/026 A61P 3/04 k 12 SOLICITUD DE PATENTE

Más detalles

La Importancia de los Servicios Agrarios en el Valor de la Marca

La Importancia de los Servicios Agrarios en el Valor de la Marca La Importancia de los Servicios Agrarios en el Valor de la Marca Mitos y Falsedades Sobre el Consumo de Leche y Productos Lácteos Sergio Calsamiglia Dpt. Ciencia Animal i dels Aliments Universitat Autonoma

Más detalles

EL EJERCICIO Y EL COLESTEROL

EL EJERCICIO Y EL COLESTEROL 1 EL EJERCICIO Y EL COLESTEROL ALGUNAS DEFINICIONES PREVIAS Qué es el colesterol? La palabra colesterol se refiere tanto a aquél encontrado en el cuerpo (colesterol sanguíneo), como al que proviene de

Más detalles

20/7/12. Importancia de la elección de la fibra para mejorar el tránsito intestinal. Prof. Dr. Martínez Álvarez sedca@nutricion.

20/7/12. Importancia de la elección de la fibra para mejorar el tránsito intestinal. Prof. Dr. Martínez Álvarez sedca@nutricion. Importancia de la elección de la fibra para mejorar el tránsito intestinal Prof. Dr. Martínez Álvarez sedca@nutricion.org Cuestiones sobre la fibra. Realmente Cuanta se come? Cómo se ingiere? Qué se recomienda?

Más detalles

1. DESCRIPCIÓN. 2. FUNCIONES.

1. DESCRIPCIÓN. 2. FUNCIONES. 1. DESCRIPCIÓN. La taurina es un derivado de la cisteína que está formada por azufre, el cual es necesario para mantener la estructura proteínica, la actividad enzimática, y el metabolismo de la energía.

Más detalles

Suero de Proteína. Aumenta los niveles del glutatión. Protege contra posibles tumores. Protege contra la osteoporosis. Mejora la cura de heridas.

Suero de Proteína. Aumenta los niveles del glutatión. Protege contra posibles tumores. Protege contra la osteoporosis. Mejora la cura de heridas. BENEFICIOS Suero de Proteína Aumenta los niveles del glutatión. Protege contra la osteoporosis. Ayuda a la buena formacion de los musculos. Mejora la cura de heridas. Ayuda a reforzar el sistema inmune.

Más detalles

PATRONES DE ALIMENTACIÓN SALUDABLE

PATRONES DE ALIMENTACIÓN SALUDABLE PATRONES DE ALIMENTACIÓN SALUDABLE 1. ALIMENTACIÓN-NUTRICIÓN 2. GRUPOS DE ALIMENTOS 3. NORMAS PARA UNA DIETA EQUILIBRADA Alimentación es el proceso mediante el cual los seres vivos consumen diferentes

Más detalles

RELACIÓN ENTRE LA NUTRICIÓN Y EL FUNCIONAMIENTO INTEGRAL DEL CUERPO HUMANO.

RELACIÓN ENTRE LA NUTRICIÓN Y EL FUNCIONAMIENTO INTEGRAL DEL CUERPO HUMANO. RELACIÓN ENTRE LA NUTRICIÓN Y EL FUNCIONAMIENTO INTEGRAL DEL CUERPO HUMANO. El metabolismo de los seres vivos es el conjunto de transformaciones químicas y físicas mediante las cuales los organismos aprovechan

Más detalles

DISLIPIDEMIAS ESPECIALMENTE HIPERCOLESTEROLEMIA

DISLIPIDEMIAS ESPECIALMENTE HIPERCOLESTEROLEMIA FUCALEC DISLIPIDEMIAS ESPECIALMENTE HIPERCOLESTEROLEMIA NOTA IMPORTANTE: PARA VISUALIZAR ESTE TRABAJO ES PRECISO TENER INSTALADO EL PROGRAMA OFFICE XP SI NO ES ASÍ, NO PODRÁ VER ADECUADAMENTE LA MAYORÍA

Más detalles

la diabetes mellitus tipo 1

la diabetes mellitus tipo 1 AVANCES CLÍNICOS Células madre adultas contra la diabetes mellitus tipo 1 La investigación se fundamenta en los resultados obtenidos por un equipo del Área de Terapia Celular de la Clínica en un ensayo

Más detalles

Inmunología de la aterosclerosis

Inmunología de la aterosclerosis UNIVERSIDAD DE CONCEPCIÓN DEPTO. DE ESPECIALIDADES MEDICAS FACULTAD DE MEDICINA Inmunología de la aterosclerosis Expositor : Efraín Mora Aguayo INTRODUCCION Tradicionalmente, esta era entendida como un

Más detalles

Diabetes Mellitus Felina

Diabetes Mellitus Felina 18.nutrición Diabetes Mellitus Felina Gemma Baciero Comunicación Científica Royal Canin Ibérica, S.A. La diabetes mellitus es una enfermedad endocrina frecuente en los gatos. Su incidencia está aumentando,

Más detalles

Si tiene usted diabetes, conozca su nivel de A1c Manténgase por debajo de...

Si tiene usted diabetes, conozca su nivel de A1c Manténgase por debajo de... Si tiene usted diabetes, conozca su nivel de A1c Manténgase por debajo de... para prevenir complicaciones CONOZCA SU NIVEL DE A1c Y ACTÚE LA VIDA ES MEJOR POR DEBAJO DE 7 Folleto informativo para personas

Más detalles

DIABETES: DULCE ENEMIGO

DIABETES: DULCE ENEMIGO DIABETES: DULCE ENEMIGO La diabetes está alcanzando proporciones epidémicas. Los expertos atribuyen la causa de la epidemia a nuestro estilo de vida sedentario, la mala alimentación y la obesidad. La diabetes

Más detalles

Harina de Alcachofa (Cynara Scolymus L.)

Harina de Alcachofa (Cynara Scolymus L.) Harina de Alcachofa (Cynara Scolymus L.) La Alcachofa es un vegetal muy conocido a nivel internacional, excelente alimento altamente nutritivo que previene, alivia y cura las enfermedades que usted pueda

Más detalles

Marcadores sanguíneos utilizados en el diagnóstico y pronóstico del riesgo cardiovascular

Marcadores sanguíneos utilizados en el diagnóstico y pronóstico del riesgo cardiovascular Capítulo 25 Marcadores sanguíneos utilizados en el diagnóstico y pronóstico del riesgo cardiovascular Dra. Petra Jiménez Mateos-Cáceres Bióloga especialista en Biología Molecular y Celular. Unidad de Investigación

Más detalles

No, son: las legumbres

No, son: las legumbres Baja el colesterol!, Previene el cáncer! Bueno para el corazón! Con fibra! Refuerza tus defensas! Recomendado para diabéticos! Prebiótico!... Son yogures?, son cereales enriquecidos?, son alimentos nuevos?,

Más detalles

SINDROME METABÓLICO. Dra Verónica Mujica Escudero Diabetóloga. Hospital Regional Talca P.I.. Factores de Riesgo ECV.

SINDROME METABÓLICO. Dra Verónica Mujica Escudero Diabetóloga. Hospital Regional Talca P.I.. Factores de Riesgo ECV. SINDROME METABÓLICO Dra Verónica Mujica Escudero Diabetóloga Hospital Regional Talca P.I.. Factores de Riesgo ECV. SALUD ENFERMEDAD INSULINO RESISTENCIA SINDROME METABÓLICO PRE DIABETES DIABETES EVOLUCIÓN

Más detalles

Cómo dar una respuesta nutricional específica a los trastornos gastrointestinales

Cómo dar una respuesta nutricional específica a los trastornos gastrointestinales 16.nutrición Cómo dar una respuesta nutricional específica a los trastornos gastrointestinales Los problemas digestivos pueden tener distinta procedencia y cursar de formas diversas, por lo que es importante

Más detalles

CONSUMO DE FRUTAS Y VERDURAS. Aspectos de interés para la salud. Plan de Consumo de Fruta en las Escuelas.

CONSUMO DE FRUTAS Y VERDURAS. Aspectos de interés para la salud. Plan de Consumo de Fruta en las Escuelas. CONSUMO DE FRUTAS Y VERDURAS. Aspectos de interés para la salud. Plan de Consumo de Fruta en las Escuelas. Guión Frutas y verduras en el marco de una alimentación saludable: dieta mediterránea Consumo

Más detalles

ANTIOXIDANTES ; PREVENCION DEL ENVEJECIMIENTO.

ANTIOXIDANTES ; PREVENCION DEL ENVEJECIMIENTO. ANTIOXIDANTES ; PREVENCION DEL ENVEJECIMIENTO. Los medios de información insisten en las virtudes de productos alimenticios enriquecidos con vitaminas y sus posibles beneficios para la salud, alabando

Más detalles

Laboratorio Nº 4 Tema: INTERRELACIONES METABÓLICAS

Laboratorio Nº 4 Tema: INTERRELACIONES METABÓLICAS Laboratorio Nº 4 Tema: INTERRELACIONES METABÓLICAS Contenidos conceptuales: Integración del metabolismo de hidratos de carbonos, lípidos y proteínas. Interrelación de diferentes tejidos y órganos. La glucosa

Más detalles

LA COMPOSICIÓN DE LOS ALIMENTOS

LA COMPOSICIÓN DE LOS ALIMENTOS LA COMPOSICIÓN DE LOS ALIMENTOS Para vivir nuestro organismo necesita unas cantidades determinadas de las sustancias nutritivas que se encuentran en los alimentos. El estudio de estas sustancias nos proporcionará

Más detalles

Qué es perder grasa? ACUMULACIÓN DE GRASA Y ENERGÍA

Qué es perder grasa? ACUMULACIÓN DE GRASA Y ENERGÍA Qué es perder grasa? Con toda la atención que se la ha dado a los macronutrientes, la dieta y el consumo de alimentos procesados en los últimos 30 años, los niveles de grasa se han incrementado. En otras

Más detalles

Posición anatómica, planos anatómicos, segmentos, EFECTOS DE LA INSULINA SOBRE LA GLICEMIA. Nombre del alumno: Profesor: Fecha:

Posición anatómica, planos anatómicos, segmentos, EFECTOS DE LA INSULINA SOBRE LA GLICEMIA. Nombre del alumno: Profesor: Fecha: Posición anatómica, planos anatómicos, segmentos, EFECTOS DE LA INSULINA SOBRE LA GLICEMIA Nombre del alumno: Profesor: Fecha: 2. Espacio sugerido: Laboratorio Polifuncional. 3. Desempeños y habilidades:

Más detalles

Pon COLOR en tu plato!

Pon COLOR en tu plato! Blanco Los alimentos de color blanco son ricos en fitoquímicos, como la alicina, y en potasio. Su consumo nos ayuda a: Reducir los niveles de colesterol Disminuir la presión arterial Prevenir la diabetes

Más detalles

MANUAL DE. nutrición deportiva. Manuel Arasa Gil EDITORIAL PAIDOTRIBO

MANUAL DE. nutrición deportiva. Manuel Arasa Gil EDITORIAL PAIDOTRIBO MANUAL DE nutrición deportiva Manuel Arasa Gil EDITORIAL PAIDOTRIBO 1. INTRODUCCIÓN GENERAL EXPLICATIVA DEL MANUAL...7 ÍNDICE 2. ALIMENTOS Y NUTRIENTES...9 2.1. Concepto de alimento...9 2.1.1. Tipos de

Más detalles

Una mirada interactiva al. del tracto gastrointestinal (GI) Bienvenido a esta guía interactiva

Una mirada interactiva al. del tracto gastrointestinal (GI) Bienvenido a esta guía interactiva Una mirada interactiva al tracto gastrointestinal (GI) Bienvenido a esta guía interactiva del tracto gastrointestinal (GI) Haga clic sobre el nombre del órgano para obtener información sobre las zonas

Más detalles

EFECTO DE LOS PRODUCTOS FINALES DE GLICOSILACIÓN AVANZADA (AGES) EN LA RESPUESTA VASCULAR DE AORTAS DE RATAS CON SÍNDROME METABÓLICO.

EFECTO DE LOS PRODUCTOS FINALES DE GLICOSILACIÓN AVANZADA (AGES) EN LA RESPUESTA VASCULAR DE AORTAS DE RATAS CON SÍNDROME METABÓLICO. EFECTO DE LOS PRODUCTOS FINALES DE GLICOSILACIÓN AVANZADA (AGES) EN LA RESPUESTA VASCULAR DE AORTAS DE RATAS CON SÍNDROME METABÓLICO. Rubio Ruiz M.E.*, Díaz Díaz E., Cárdenas León M., Argüelles Medina

Más detalles

VALOR NUTRITIVO USO DE LA SOJA EFECTOS TÓXICOS CONSUMO

VALOR NUTRITIVO USO DE LA SOJA EFECTOS TÓXICOS CONSUMO VALOR NUTRITIVO USO DE LA SOJA EFECTOS TÓXICOS CONSUMO MONOGRÁFICOS TODO SOBRE LOS ALIMENTOS INTRODUCCIÓN La judía de soja es una legumbre que comenzó a cultivarse en Asia alrededor del año 2.800 a.c,

Más detalles

Alimentación sana y crecimiento en niños y adolescentes. Guía para padres

Alimentación sana y crecimiento en niños y adolescentes. Guía para padres Alimentación sana y crecimiento en niños y adolescentes Guía para padres Consulte nuestra página web: www.sintesis.com En ella encontrará el catálogo completo y comentado Alimentación sana y crecimiento

Más detalles

Cómo aproximarse al diagnóstico para un tratamiento exitoso del Síndrome Metabólico?

Cómo aproximarse al diagnóstico para un tratamiento exitoso del Síndrome Metabólico? Cómo aproximarse al diagnóstico para un tratamiento exitoso del Síndrome Metabólico? Dr. Gustavo Oviedo Colón Centro de Investigaciones en Nutrición Universidad de Carabobo Síndrome Metabólico Síndrome

Más detalles

El colesterol. El colesterol se desplaza por la sangre mediante unas moléculas denominadas lipoproteínas. Los tres tipos principales son:

El colesterol. El colesterol se desplaza por la sangre mediante unas moléculas denominadas lipoproteínas. Los tres tipos principales son: El colesterol Introducción El colesterol es un lípido (grasa). Se forma en el hígado a partir de alimentos grasos y es necesario para el funcionamiento normal del organismo. El colesterol está presente

Más detalles

CEREALES Y LEGUMBRES

CEREALES Y LEGUMBRES CHARLAS PARA LA COMUNIDAD CEREALES Y LEGUMBRES La base de una alimentación sana En los últimos años, la ciencia de la nutrición puso mayor énfasis en el estudio de la alimentación orientada a preservar

Más detalles

Factores de riesgo Dra. Rosario Artigao

Factores de riesgo Dra. Rosario Artigao Factores de riesgo Dra. Rosario Artigao Cardióloga Unidad de Rehabilitación Cardiaca. Hospital Ramón y Cajal. Madrid Presidenta de la Sección de Cardiología Preventiva y Rehabilitación de la Sociedad Española

Más detalles

Qué son los alimentos?

Qué son los alimentos? Qué son los alimentos? Los alimentos son productos naturales o transformados que contienen numerosas sustancias químicas. Unas sustancias desempeñan un papel conocido en la nutrición humana. Son los nutrientes:

Más detalles

ALIMENTACIÓN SALUDABLE

ALIMENTACIÓN SALUDABLE ALIMENTACIÓN SALUDABLE 1. Esquema de la correcta nutrición humana 2. Grupos de alimentos según las funciones y los nutrientes que aportan. 3. Pirámide alimentaria: raciones y frecuencia de consumo de los

Más detalles

PRUEBAS DE DESEMPEÑO DE PRODUCTOS Saber para comprar

PRUEBAS DE DESEMPEÑO DE PRODUCTOS Saber para comprar Qué es un alimento funcional? Alimento es todo producto, natural o transformado, que le suministra a todo organismo que lo ingiere, la energía y las sustancias químicas necesarias para mantenerse en buen

Más detalles

La nutrición en el programa de fitness. Miguel Ángel Buil Bellver

La nutrición en el programa de fitness. Miguel Ángel Buil Bellver La nutrición en el programa de fitness Miguel Ángel Buil Bellver CAPÍTULO II HIDRATOS DE CARBONO CAPIITULO IIII HIIDRATOS DE CARBONO COMPOSICIÓN Y CLASIFICACIÓN Compuestos formados por carbono, hidrógeno

Más detalles

VEGETALES Y FRUTAS LOS ANTIOXIDANTES NATURALES

VEGETALES Y FRUTAS LOS ANTIOXIDANTES NATURALES CHARLAS PARA LA COMUNIDAD VEGETALES Y FRUTAS LOS ANTIOXIDANTES NATURALES En los últimos años, estudios científicos apoyan la evidencia de que el consumo diario de abundantes hortalizas y frutas se correlaciona

Más detalles

Prevenir, mejor que curar. La dieta en la diabetes tipo 2. Factores de riesgo coronario

Prevenir, mejor que curar. La dieta en la diabetes tipo 2. Factores de riesgo coronario Página nº 1 L a dieta constituye uno de los principales retos en el tratamiento de la diabetes por su elevado índice de fracasos relacionados con su complejidad y bajo cumplimiento. Desde el punto de vista

Más detalles

Mermeladas tradicionales

Mermeladas tradicionales Elegí lo Natural Ayuda Nutricional Este manual intenta despejar dudas y ser una ayuda para elegir correctamente nuestros productos. De ninguna forma sustituye la asistencia de un profesional capacitado

Más detalles

Zinc en la Nutrición

Zinc en la Nutrición Zinc en la Nutrición VII Curso Actualización en Nutrición Sociedad Peruana de Nutrición Lima, Perú, 28 de Mayo 2010 Daniel López de Romaña, Ph.D. Instituto de Nutrición y Tecnología de los Alimentos Universidad

Más detalles

RIESGO CARDIOVASCULAR

RIESGO CARDIOVASCULAR RIESGO CARDIOVASCULAR Cuando hablamos de la palabra Riesgo tendemos a asociarla directamente con: Probabilidad de algo es decir que algo podría suceder o quizás es una evaluación de algún evento. En la

Más detalles

DTC - UCSF DATOS SOBRE EL COLESTEROL Y LAS GRASAS GLOSARIO

DTC - UCSF DATOS SOBRE EL COLESTEROL Y LAS GRASAS GLOSARIO DATOS SOBRE EL COLESTEROL Y LAS GRASAS GLOSARIO COLESTEROL El colesterol es una sustancia parecida a la grasa que se encuentra en el tejido de los humanos y otros animales. Desempeña papeles importantes

Más detalles

BIOQUIMICA NUTRICIONAL Sílabo. Teoría: Miércoles de 13:10 15:00 p.m. PK- 206 Laboratorio

BIOQUIMICA NUTRICIONAL Sílabo. Teoría: Miércoles de 13:10 15:00 p.m. PK- 206 Laboratorio UNIVERSIDAD CIENTIFICA DEL SUR FACULTAD DE NUTRICION Y DIETETICA BIOQUIMICA NUTRICIONAL Sílabo I.- DATOS GENERALES Curso: Bioquímica Nutricional Condición: Obligatorio Código: N-0410 Naturaleza: Teórico-Práctica

Más detalles