UNIVERSIDAD AUTÓNOMA DE CIUDAD JUÁREZ INSTITUTO DE CIENCIAS BIOMÉDICAS DEPARTAMENTO DE CIENCIAS QUÍMICO-BIOLÓGICAS PROGRAMA DE BIOLOGÍA

Tamaño: px
Comenzar la demostración a partir de la página:

Download "UNIVERSIDAD AUTÓNOMA DE CIUDAD JUÁREZ INSTITUTO DE CIENCIAS BIOMÉDICAS DEPARTAMENTO DE CIENCIAS QUÍMICO-BIOLÓGICAS PROGRAMA DE BIOLOGÍA"

Transcripción

1 UNIVERSIDAD AUTÓNOMA DE CIUDAD JUÁREZ INSTITUTO DE CIENCIAS BIOMÉDICAS DEPARTAMENTO DE CIENCIAS QUÍMICO-BIOLÓGICAS PROGRAMA DE BIOLOGÍA MANUAL DE PRÁCTICAS BIOLOGÍA MOLECULAR

2 MANUAL DE PRÁCTICAS DE BIOLOGÍA MOLECULAR COMPILADORES: Principal: Dra. Florinda Jimenez Vega Colaboradores: Revisado por: Academia de Biologia 2011 Ciudad Juárez, Chihuahua Universidad Autónoma de Ciudad Juárez 2011 p. 69

3 M. en C. Emilio Clarke Crespo Coordinador de la Academia de Biología D. Ph. Antonio de la Mora Covarrubias Coordinador del Programa de Biología Dr. Alejandro Martínez Martínez Jefe del Departamento de Ciencias Químico-Biológicas M.C. Hugo Staines Orozco Director del Instituto de Ciencias Biomédicas Aprobados por la Academia de Biología, 2011

4 INTRODUCCIÓN La es una ciencia cuyo objetivo fundamental es la comprensión de todos aquellos procesos celulares, que contribuyen a que la información genética se transmita eficientemente de unos seres a otros, y se exprese en los nuevos individuos. Este conocimiento ha rebasado barreras naturales entre especies y instalar genes de cualquier organismo, en un organismo hospedador no relacionado mediante el empleo de herramientas genéticas. Una de las consecuencias importantes derivadas, fue la producción de fragmentos de ácidos nucleícos a gran escala, abriendo las puertas a la secuenciación de los ácidos nucleícos, y por ende a nuevas disciplinas como el diagnóstico molecular, la terapia génica o la obtención de organismos superiores recombinantes. Cronológicamente todos estos eventos inician en el año 1866 cuando Mendel publica sus experimentos conducentes a los principios de segregación y clasificación independiente de los genes. En 1953 se marca la pauta que dio origen a la revolución genética con la publicación de Watson y Crick en la cual describen la estructura del DNA como una doble hélice complementaria que recuerda la estructura de una escalera de caracol. A partir de entonces y de manera exponencial, se ha llegado hasta la secuenciación de los genomas y los procesos de clonación y mutagénesis. El presente manual tiene como finalidad la transportación al maravilloso estudio de las macromoléculas y su integración como herramientas moleculares para el estudio y caracterización de estas. Es solo el inicio de un largo camino por andar, esperando sea de interés para ustedes.

5 TABLA DE CONTENIDO Practica No Preparación de soluciones de concentración definida y soluciones amortiguadoras... 4 Practica No Determinación de proteínas por la técnica de Bradford... 9 Practica No Electroforesis en Geles de Poliacrilamida desnaturalizantes SDS-PAGE Practica No Tinción de Geles de Poliacrilamida por Coomassie Blue Practica No Extracción de DNA utilizando DNAZOL Practica No Extracción de DNA utilizando Fenol Cloroformo Alcohol isoamílico Practica No Extracción de RNA Practica No Cuantificación de RNA y DNA Practica No Electroforesis de DNA en geles de agarosa Practica No Electroforesis de RNA en geles de agarosa-formaldehido Practica No Síntesis de cdna Practica No Reacción en cadena de la Polimerasa Practica No Dra. Florinda Jiménez Vega Pag. 2

6 Aislamiento de un fragmento de DNA a partir de un soporte solido Practica No Ligación de productos de PCR a un vector de clonación Practica No Preparación de células químicamente competentes Practica No Transformación bacteriana en E. coli Practica No Análisis de colonias recombinantes por PCR Practica No Aislamiento de DNA plasmídico Practica No Digestión de DNA plasmídico con endonucleasas de restricción Practica No Introducción a la Bioinformática Dra. Florinda Jiménez Vega Pag. 3

7 PRACTICA NO. 1 PREPARACIÓN DE SOLUCIONES DE CONCENTRACIÓN DEFINIDA Y SOLUCIONES AMORTIGUADORAS OBJETIVO Que el estudiante aprenda a preparar disoluciones en concentraciones definidas en porciento, normalidad, molalidad y molaridad. INTRODUCCIÓN La composición de una solución se debe medir en términos de volumen y masa, por lo tanto es indispensable conocer la cantidad de soluto disuelto por unidad de volumen o masa de disolvente, es decir su concentración. Durante cualquier trabajo experimental, el uso de soluciones se hace indispensable, por lo que es necesario conocer los procedimientos para su elaboración. En la presente práctica se realizarán soluciones utilizando como concentración la molaridad, la normalidad y las relaciones porcentuales. La molalidad se define como el número de moles de soluto disueltos en 1 kg de disolvente, esto es: M =[( numero de moles de soluto )/( peso del disolvente en kg) ] La unidad de porcentaje peso tiene la ventaja de que no se necesita conocer la masa molar del soluto. Además, el porcentaje peso de una solución es independiente a la Dra. Florinda Jiménez Vega Pag. 4

8 temperatura, ya que se define en términos de pesos, el termino de fracción molar no se emplea normalmente para expresar la concentración de soluciones. Sin embargo es de utilidad para calcular las presiones parciales de los gases y en el estudio de concentración que se emplean con frecuencia, la ventaja del empleo de la molaridad es que por lo general resulta más sencillo medir el volumen de una solución utilizando matraces volumétricos calibrados con precisión, que pesar al disolvente. Su principal inconveniente es que depende de la temperatura, ya que el volumen de una solución suele aumentar con el incremento de la temperatura. Otro inconveniente es que la molaridad no especifica la cantidad de disolvente presente. Por otra parte, la molalidad es independiente de la temperatura, ya que se define como una relación del número de moles de soluto y el peso del disolvente. Por esta razón, la molalidad es la unidad de concentración de empleo preferente en los estudios que involucran cambios de temperatura, al igual que en aquellos de las propiedades negativas de las soluciones. Por su parte la Normalidad se define como el número de equivalentes químicos de sustancia disuelta por litro de solución. # de equivalentes = peso molecular del soluto Así también dentro de las concentraciones porcentuales, el %peso se define como el peso del componente entre el peso de la solución por 100 y el % mol es el numero de moles de cada uno de los componentes entre el número total de moles de solución por 100. MATERIALES Cloruro de Sodio Hidróxido de Sodio Ácido clorhídrico Dra. Florinda Jiménez Vega Pag. 5

9 Fosfato de Sodio Probeta, pipetas, Balanza, Papel encerado, placa de agitación, magnetos, matraces volumétricos y vasos de precipitado. PROCEDIMIENTO I. Disoluciones de concentración en peso Preparación de 50 ml de una solución de NaCl al 0.9% (p/v) 1. Pesar NaCl en la balanza 2. Disolver los X g de NaCl en agua destilada (aprox. 30 ml) 3. Colocar la disolución de NaCl en un matraz volumétrico de 50 ml y aforar con agua destilada. Preparación de 50 ml de una disolución de alcohol etílico al 70% (v/v) 1. Con base a la concentración del alcohol etílico comercial determinar el volumen necesario para tener 35 ml de alcohol etílico. 2. Medir el alcohol en una probeta 3. Colocar el alcohol etílico en un matraz volumétrico de 50 ml y aforar con agua destilada. II. Disoluciones de concentración molar Preparación de 200 ml una disolución de NaOH 1 M 1. Determinar los gramos requeridos de NaOH para preparar 200 ml de NaOH 1M. 2. Pese el NaOH requerido y colocarlo en un vaso de precipitado de 500 ml para su disolución con agua destilada (aprox. 150 ml). 3. Colocar la disolución en un matraz volumétrico de 200 ml y aforar con agua destilada. Dra. Florinda Jiménez Vega Pag. 6

10 Nota: Los ácidos y los álcalis son agentes corrosivos. Extreme precauciones para su manejo, evite todo el contacto con la piel y ojos. Preparación de 100 ml de una disolución de NaOH 25 mm a partir de la disolución de NaOH 1M Aplicar la fórmula C 1 x V 1 = C 2 x V 2 para calcular los ml de NaOH 1 M necesarios para preparar 100 ml de una disolución de NaOH 25 mm V1= (C2 x V2)/ C1 Donde: C 1= Concentración inicial V 1= Volumen inicial C 2= Concentración final V 2= Volumen final Medir el volumen requerido de NaOH 1M con una pipeta y colocarlos en un matraz volumétrico de 100 ml y aforar con agua destilada. III. Disoluciones de Concentración Normal Preparación de HCL 1N 1. Conocer la concentración del HCL concentrado comercial. 2. Calcular la cantidad de HCL conc. requerido para preparar 50 ml de HCl 1N. 3. Colocar el agua destilada (aprox. 30 ml) en un vaso de precipitado. 4. Con cuidado agregar poco a poco la cantidad de HCL concentrado requerido. a. Nota: Siempre se agrega el ácido al agua nunca el agua al ácido. 5. Agitar en la placa de agitación 6. Colocar la disolución en un matraz volumétrico de 50 ml y aforar con agua destilada. Dra. Florinda Jiménez Vega Pag. 7

11 TEMAS A DEMOSTRAR Cálculos estequiométricos RESULTADOS Desarrollar los cálculos que realizaron para preparar las soluciones. Concluya la importancia de los diferentes procesos para preparar soluciones. Dra. Florinda Jiménez Vega Pag. 8

12 PRACTICA NO. 2 DETERMINACIÓN DE PROTEÍNAS POR LA TÉCNICA DE BRADFORD OBJETIVO Por medio de la siguiente práctica el alumno será capaz de elaborar una curva de calibración para cuantificar la concentración de una proteína. INTRODUCCIÓN Las moléculas proteicas se organizan de manera característica en distintos niveles. El nivel primario es la secuencia de aminoácidos, dictada por el gen. Esta secuencia a su vez determina el plegamiento local (estructura secundaria, el plegamiento global (estructura terciaria) y la organización en estructuras de múltiples subunidades (estructura cuaternaria). Para la cuantificación de estas moléculas existen diversos métodos los cuales se basan en a) la propiedad intrínseca de las proteínas para absorber luz en el UV, b) para la formación de derivados químicos, o c) la capacidad que tienen las proteínas de unir ciertos colorantes. Dentro de la unión a colorantes específicos la cuantificación proteica por Bradford se basa en la unión del Coomassie Brillant Blue G-250 a moléculas de proteína en ph ácido produciendo un cambio de color de rojo-café a azul, que presenta un máximo de absorbancia a 595 nm. La interacción del Coomassie se ha demostrado con residuos de arginina y muy levemente con cisteína, lisina, tirosina, triptófano y residuos de fenilalanina. Debido a que la respuesta Dra. Florinda Jiménez Vega Pag. 9

13 de color no es lineal en un amplio intervalo de concentración, es recomendable correr una curva estándar. MATERIALES Reactivo de Bradford Disolver 100 mg de Coomassie B-Blue G-250 en 50 ml de etanol por agitación con un magneto, cuando este perfectamente disuelto adicionar 100 ml de ac.fosfórico 85% y aforar a un 1Lt CUIDADO!!! (ácido + agua) Filtrar con papel (Listo para ser empleado). Almacenar a temperatura ambiente. Agua Albúmina Celdas para luz visible PROCEDIMIENTO Elaboración de curva patrón 1. A partir de una alícuota de proteína de aproximadamente 4 mg/ml (C1), realizar las diluciones necesarias para tener alícuotas de 500 ul con las siguientes concentraciones (0.05, 0.1, 0.2, 0.3, 0.4 mg/ml) Conc. mg/ml µl apartir de µl de agua Volumen final C2 la alícuota de 4mg/mL V1 C1 500 µl V Dra. Florinda Jiménez Vega Pag. 10

14 2. Para la cuantificación, se realizara, cada determinación por duplicado. 3. Marcar para cada concentración 2 tubos Adicionar 100 µl de la proteína de cada una de las concentraciones conocidas 4. Incluir un par de tubos sin muestra, intercambiar por agua (será el control) 5. Adicionar 1 ml de reactivo 6. Incubar por 5 minutos a temperatura ambiente 7. Determinar absorbancia a 595 nm Información Adicional Verificar que el material empleado se encuentre perfectamente limpio ya que concentraciones muy bajas de detergentes pueden interferir en la reacción. Sustancias compatibles con Bradford NaCl, MgCl, KCl, (NH 4 ) 2 SO 4, Etanol Sustancias incompatibles con Bradford: Tris 2 M, Ac. Acético, 2- Mercaptoetanol 1 M, Sacarosa 1 M, Glicerol 99 %, EDTA 0.1 M, Triton X %, SDS 1 %, Hemosol 0.1 % TEMAS A DEMOSTRAR RESULTADOS Caracterización de macromoléculas Graficar la concentración de proteína (mg/ml) en el eje X y lectura de absorbancia (595nm) eje Y. Utilizando el programa Excel, realizar una regresión lineal de los datos y determinar la curva estándar para cuantificar. Dra. Florinda Jiménez Vega Pag. 11

15 Dra. Florinda Jiménez Vega Pag. 12

16 PRACTICA NO. 3 ELECTROFORESIS EN GELES DE POLIACRILAMIDA DESNATURALIZANTES SDS PAGE OBJETIVO Conocer los principios y aplicaciones de la electroforesis. INTRODUCCIÓN La electroforesis es una técnica para la separación de moléculas (proteínas o ácidos nucleícos) según la movilidad de estas en un campo eléctrico a través de una matriz porosa, la cual finalmente las separa por tamaños moleculares y carga eléctrica, dependiendo de la técnica que se use. Los ácidos nucleícos ya disponen de una carga eléctrica negativa, que los dirigirá al polo positivo, mientras que las proteínas se cargan con sustancias como el SDS (detergente) que incorpora cargas negativas de una manera dependiente del peso molecular. Para la separación se usa un gel de agarosa o poliacrilamida (fibras cruzadas, como una malla). Al poner la mezcla de moléculas y aplicar un campo eléctrico, éstas se moverán y deberán ir pasando por la malla, por la que las pequeñas se moverán mejor, más rápidamente. Así, las más pequeñas avanzarán más y las más grandes quedarán cerca del lugar de partida. Por lo general para caracterizar la molécula se determina la velocidad a la que esta se mueve en un campo eléctrico y se utiliza para determinar el peso molecular en el caso de Dra. Florinda Jiménez Vega Pag. 13

17 proteínas o para detectar cambios de aminoácidos y separar cuantitativamente distintas especies moleculares. MATERIALES Soluciones proteicas Marcadores de peso molecular Fuente de poder Cámara de electroforesis Puntas de micropipeta Papel absorbente Soluc. Azul de Coomasie (tinción) (tabla anexa) Soluc. PAGE-SDS (Tabla anexa) PROCEDIMIENTO Preparación del gel de corrimiento (10%) 1. La preparación del gel de separación se efectúa de acuerdo a la tabla anexa 2. Una vez polimerizado en el portagel, lavarlo y eliminar el exceso de agua usando tiras de papel Whatman. 3. Preparar el gel de concentración (stacking gel) de acuerdo a la tabla anexa. 4. Una vez llena la cámara, colocar el peine evitando la formación de burbujas. 5. Una vez polimerizado el gel, lavarlo con agua destilada y llenarlo con buffer de corrimiento (running buffer). Dra. Florinda Jiménez Vega Pag. 14

18 6. Resuspender la buffer muestra en proporción 1:4 (si es necesario agregar más azul de bromofenol y glicerol). 7. Colocar las muestras y marcadores de peso molecular en los carriles correspondientes. 8. Fijar las condiciones de corrimiento en 60 V hasta que entre la muestra al gel de separación, una vez dentro, cambiar a V (2 h) y vigilar que las muestras no salgan del gel. 9. Desprender cuidadosamente el gel de los vidrios dividir el gel. 10. Teñir el gel utilizando Coomassie Blue, de acuerdo al protocolo anexo. 11. Calcular el peso molecular de las proteínas problema. TEMAS A DEMOSTRAR Caracterización de macromoléculas RESULTADOS 1. Determinación de la aparente masa molecular de las proteínas 2. Mida la distancia total del principio al fin del gel de corrido 3. Mida la distancia del origen a cada uno de los estándares de peso molecular 4. Mida la distancia de la proteína desconocida (X) 5. Para cada banda calcula la movilidad relativa: a / total, b / total 6. Ejemplo a = 0.5cm, total = 4.9cm. 0.5/4.9 = Calcular el logaritmo del peso molecular de cada estándar Dra. Florinda Jiménez Vega Pag. 15

19 8. Hacer una grafica del log pm contra la movilidad relativa de los estándares 9. Localizar la movilidad relativa de la proteína de la proteína desconocida, extrapolando el log PM correspondiente y calcular el antiligaritmo. L OG MW M OVILIDAD Dra. Florinda Jiménez Vega Pag. 16

20 ANEXO Preparación del Gel y Reactivos para la Electroforesis en Geles de SDS-Poliacrilamida (SDS-PAGE) (Laemmli) A) Acrilamida/Bis (30% T, 2.67%C) Acrilamida N N Bismetilenacrilamida g 4.0 g 500 ml de agua destilada. Filtrar, guardar a 4 C en la obscuridad. Vida media 30 días. B) 1.5 M Tris-HCl, ph 8.8 Tris base Agua destilada g 150 ml Ajustar el ph 8.8 con HCl 1.0 N. Aforar a 300 ml con agua destilada. Almacenar a 4 C C) 0.5 M Tris-HCl, ph 6.8 Tris base Agua destilada 6.0 g 60 ml Ajustar el ph 6.8 con HCl 1.0 N. Aforar a 100 ml con agua destilada y almacenar a 4 C. D) 10% (w/v) SDS Disolver 10 g de SDS en agua destilada, agitar suavemente y aforar a 100 ml E) 10% (w/v) Persulfato de Amonio Dra. Florinda Jiménez Vega Pag. 17

21 100 mg de sulfato de amonio. Adicionar 1 ml de agua destilada, preparar en el momento. F) Buffer de corrimiento (5x), 25 mm Tris, 192 mm Glicina, 1% de SDS, ph 8.3 Tris base Glicina SDS 45.0 g g 15.0 g No incluir el SDS cuando se requiera hacer corrimiento bajo condiciones nativas (PAGE). Aforar a 3 L con agua destilada. No ajustar el ph con acido o base. Almacenar a 4 C. Calentar a 37 C antes de usar en caso de precipitación. G) Buffer muestra Agua destilada 4.4 ml 0.5 M Tris-HCl ph ml Glicerol 0.8 ml 10 % SDS 1.6 ml 0.5 (w/v) azul de bromofenol en agua 0.2 ml Diluir la muestra por lo menos 1:4 con el sample buffer. *Si el gel fuese en condiciones desnaturalizantes y reductoras, se deberá adicionar 0.4 ml al buffer muestra de betamercaptoetanol y posteriormente de diluir 1:4 habrá que calentar las muestras a 95 C por 4 min. *Cuando son condiciones nativas (PAGE) omitir SDS, Dra. Florinda Jiménez Vega Pag. 18

22 H) Preparación de PAGE-SDS 10% Volúmenes requeridos para dos placas del sistema Mini-Gel BioRad MR Gel Separador (Separating) (10 ml) Agua destilada 4.0 ml 1.5 M Tris-HCl ph ml Acrilamida 3.3 ml 10 % SDS 0.1 ml Persulfato de amonio 10% Temed 0.1 ml ml Gel Concentrador (Stacking) (4mL) Agua destilada 2.7 ml 0.5 M Tris-HCl ph ml Acrilamida 0.67 ml 10 % SDS 0.04 ml Persulfato de amonio Temed 0.10 ml ml Dra. Florinda Jiménez Vega Pag. 19

23 TINCIÓN DE GELES DE POLIACRILAMIDA POR COOMASSIE BLUE PRACTICA NO. 4 OBJETIVO INTRODUCCIÓN MATERIALES El alumno evaluara el proceso para la detección de proteínas en gel. Las proteínas que se han separado en un gel de poliacrilamida (o otros soportes) pueden ser detectadas por diferentes métodos, entre los que destacan los colorantes y la tinción con plata. La tinción de azul de coomassie permite detectar hasta o.2 a 0.6 µg de proteína y es cuantitativo (lineal) hasta 15 a 20 µg. Se utilizan principalmente solventes como metano y ácido acético para fijar las proteínas. Dentro de las diversidad de técnicas que existen podemos mencionar también la tinción con Plata que aunque es más sensible el proceso suele ser más tardado y más caro. El uso de la tinción por Comassie tiene dentro de sus bondades bajo costo y rapidez. Coomassie Blue-R250 al 0.1% Disolver 0.1 g en solución de desteñido, dejar a temperatura ambiente hasta el siguiente día, agregar el agua. Filtrar siempre antes de su uso. Dra. Florinda Jiménez Vega Pag. 20

24 Solución A Solución de fijado / desteñido (Metanol 50%, Ac. Acético 10%) Recipientes plásticos o de vidrio PROCEDIMIENTO 1. Sumergir el gel por 10 minutos en solución A. 2. Teñir con la solución de Coomassie. 3. Desteñir con la solución A hasta que se observen las bandas. 4. Enjuagar con agua destilada. 5. Documente su gel fotograficamente TEMAS A DEMOSTRAR Caracterización de macromoléculas RESULTADOS Determine la pureza de sus muestras, así como el tamaño de las bandas proteicas obtenidas Defina otras metodologías para tinciones electroforéticas mencionando el rango de sensibilidad así como bondades y deficiencias en comparación a la tinción con azul de comassie. Dra. Florinda Jiménez Vega Pag. 21

25 PRACTICA NO. 5 EXTRACCIÓN DE DNA UTILIZANDO DNAZOL OBJETIVO Por medio de la siguiente práctica el alumno será capaz de extraer DNA, partiendo de tejido de tipo animal o vegetal, a través de esta práctica el alumno pondrá en práctica los conocimientos adquiridos en clase para el manejo y almacenamiento del DNA. INTRODUCCIÓN La doble cadena de DNA está compuesta de potenciales grupos reactivos que están arreglados dentro de una hélice central unida a través de enlaces de puente de hidrógeno. Estas pares de bases están protegidas por azucares y fosfatos los cuales están unidos internamente por fuerzas superiores. A pesar de su estabilidad química el DNA es físicamente frágil, para su extracción a través de células o tejidos es necesaria Proteinasa K en presencia de EDTA y una solubilización de membranas y desnaturalización de proteínas con un detergente como SDS. Los ácidos nucleicos pueden ser purificados a través de extracciones con solventes orgánicos y ser aplicados a una infinidad de técnicas desde análisis de southern blot, como templado en reacciones en cadena de la polimerasa y construcción de librerías genómicas entre otros. MATERIALES Material Biológico Dra. Florinda Jiménez Vega Pag. 22

26 DNAzol Puntas, micropipetas, microtubos PROCEDIMIENTO 1. Lisis celular adicionar mL de DNAzol Células crecidas en monocapa 10cm 2 de cultivo Suspensión celular 1-3 x 10 7 Tejidos mg 2. Mezclar por homogenización, si se trata de tejidos, habrá que fragmentar en porciones pequeñas, previo a la homogenización. 3. Sedimentar el homogenizado por centrifugación por 10 min a x g a una temp. ambiente o 4 C. Transferir la fase sobrenadante a un tubo nuevo. 4. Precipitación.- Precipitar el DNA por adición de 0.5 ml de Etanol al 100% por ml de DNAzol. Mezclar por inversión y mantener a temperatura ambiente por 1-3 min. El DNA puede ser visible como una nube precipitante. Si es probable, enroscar las hebras de DNA con la ayuda de la punta de una pipeta (Si es que es visible) y transferir a un tubo nuevo. Si tenemos pequeñas cantidades, centrifugar a 4000 x g por 1-2 min a temp. ambiente o 4 C y retirar el sobrenadante. 5. Lavado del DNA.- Lavar el DNA precipitado 2 veces con ml de etanol al 75% por inversión del tubo 3-6 veces. Mantener los tubos en posición vertical por 1-2 min para sedimentar el DNA y remover el etanol por pipeteo o decantación. 6. Resuspender el DNA en un pequeño volumen de agua destilada. 7. Evaluar calidad y concentración Dra. Florinda Jiménez Vega Pag. 23

27 8. Almacenar el DNA a -20 ºC hasta su cuantificación y corrimiento electroforético. TEMAS A DEMOSTRAR Caracterización de los ácidos nucleícos RESULTADOS Determine como puede interferir la presencia de proteínas en la muestra. Investigue en caso de tener proteínas en la muestra de DNA que proceso utilizaría para poder purificarla? Que características le da si obtiene una relación de absorbancia 260/280 = 1.9? Dra. Florinda Jiménez Vega Pag. 24

28 PRACTICA NO. 6 EXTRACCIÓN DE DNA UTILIZANDO FENOL CLOROFORMO ALCOHOL ISOAMILICO OBJETIVO Evaluar el aislamiento de DNA a partir de extracciones con solventes. INTRODUCCIÓN El DNA puede ser aislado de diferentes formas dependiendo si es cromosomal o extracromosomal, para su purificación se requiere de debilitar la pared bacteriana por congelación y descongelación o por tratamiento con lizosima y agentes quelantes como EDTA. La lisis celular tanto de procariotes como eucariotes, se realiza con la adición de detergentes, como el dodecil sulfato de sodio (SDS). Después de la lisis se degrada el RNA y las proteínas con ribonucleasa pancreatíca y proteasa. Las proteínas se extraen con solventes orgánicos como fenol, debido a que este solvente permite su desnaturalización y su concentración en la fase orgánica, en tanto que el DNA es recuperado de la fase acuosa y precipitado con etanol. MATERIALES Material Biológico Dra. Florinda Jiménez Vega Pag. 25

29 Buffer de Lisis ( Tris 0.1M ph 8.0, EDTA 0.1M, NaCl 0.15 M, 2% β- mercaptoetanol, 4% L-Sarkosil) Proteasa (10 mg/ml) RNAsa (10mg/mL) Fenol cloroformo alcohol isoamilico 24:25:1 Acetato de sodio 3M ph 5.4 Etanol absoluto Etanol al 70% Agua destilada estéril TE ph 8.0 PROCEDIMIENTO 1. Colocar una muestra de tejido finamente cortado aproximadamente 10 mg de tejido en tubos eppendorf de 1.5 ml 2. Adicionar 500 μl de Bufer de lisis y 3 μl de proteinasa 3. Incubar durante 1 hr a 37ºC. Vortex cada 30 min 4. Adicionar 3 μl de proteinasa e Incubar durante 1 hr a 37ºC. Vortex cada 30 min 5. Adicionar 500 μl de Fenol Cloroformo Alcohol Isoamilico 25:24:1 6. Mezclar por inversión 7. Centrifugar a 14 rpm durante 10 min a 4ºC 8. Colectar el sobrenadante y colocarlo em um tubo eppendorf nuevo 9. Adicionar 2 volúmenes de etanol absoluto previamente enfriado a -20ºC. Dra. Florinda Jiménez Vega Pag. 26

30 10. Mezclar por inversión, adicionar 1/10 del volumen de acetato de sodio 3M 11. Incubar a -20 ºC durante 10 min. 12. Centrifugar a rpm durante 20 min a 4ºC 13. Decantar el sobrenadante 14. Lavar el pellet con 250 μl de alcohol al 70 % previamente enfriado a -20º 15. Dejar secar por inversión 16. Resuspender el pellet en 50 μl de agua estéril o buffer TE TEMAS A DEMOSTRAR Caracterización de ácidos nucleícos RESULTADOS Dra. Florinda Jiménez Vega Pag. 27

31 PRACTICA NO. 7 EXTRACCIÓN DE RNA OBJETIVO INTRODUCCIÓN Por medio de la siguiente práctica el alumno será capaz de extraer RNA de tejido, y pondrá en práctica los conocimientos adquiridos en clase para su manejo y almacenamiento. Una típica célula de mamíferos contiene aproximadamente 10-5 µg de RNA, 80-85% del cual es ribosomal. El remanente 15-20% consiste de RNAs de bajo peso molecular (RNAs de transferencia y pequeño nuclear). Estos RNAs abundantes han sido determinados en tamaño y secuencia, y pueden ser aislados por electroforesis, centrifugación a través de gradientes de densidad, o cromatografía de intercambio iónico. En contraste con el RNA mensajero, el cual se encuentra entre el 1 al 5 % del total del RNA celular. La clave para poder extraer un RNA intacto es dada a través de la inactivación del RNAsa, muchos métodos, utilizan para la purificación fuertes agentes desnaturalizantes como tiocionato de guanidina para disruptar las células, solubilizar sus componentes y desnaturalizar simultáneamente RNAsas endógenas. La técnica más utilizada fue descrita por Chomczynski and Sacchi en 1987, en la cual el tiocianato de guanidina es extraído utilizando solventes como fenol cloroformo. Lo cual genera una segunda fase orgánica en la cual el DNA y las proteínas son extraídos liberando en RNA en la fase sobrenadante. El RNA puede ser precipitado utilizando Dra. Florinda Jiménez Vega Pag. 28

32 Isopropanol y purificado por cromatografía o utilizado como tal para análisis de hibridación tipo Northen Blot, transcripción reversa o transcripción reversa-pcr MATERIALES Tejido fresco Estuche de disección, tubos eppendorf, Trizol, Agua tratada con DEPC, Homogenizadores PROCEDIMIENTO 1. Cuidadosamente con ayuda de un equipo de disección, extraer el tejido a utilizar no contaminar con otro tejido, y de ser posible enjuagar con agua DEPC. 2. Fragmentar el tejido, pesar y colocar en un tubo 3. Mezclar 10 mg de tejido con 0.75 ml de trizol, homogenizar la muestra e Incubar el homogenizado por 5 min a temperatura ambiente (En este paso la muestra puede ser almacenada a -80 ºC). 4. Adicionar 0.2 ml de cloroformo por cada 0.75 ml de Trizol, mezclar vigorosamente con la mano por 15 seg e incubar a temperatura ambiente por 2-15 min. Centrifugar la muestra a no más de 12,000 x g por 15 min a 4 ºC. 5. Transferir la fase acuosa a un tubo limpio, libre de RNAsas. 6. Precipitar el RNA por adición de 0.5 ml de isopropanol por cada 0.75 ml de Trizol, e incubar a 4 ºC por 10 min. 7. Centrifugar a no más de 12,000 x g, por 10 min a 4 ºC. El RNA precipitara formando una especie de gel, en la parte inferior del tubo 8. Remover el sobrenadante. Lavar el pellet con 1 ml de EtOH al 75% Dra. Florinda Jiménez Vega Pag. 29

33 9. Centrifugar a no más de 7500 x g por 5 min a 4 ºC 10. Secar el precipitado de RNA por 5-10 min 11. Disolver el RNA en 50 µl de agua libre de RNAsas, por mezcla con la pipeta o incubando por 10 min a ºC. 12. Almacenar el RNA a -80 ºC hasta su cuantificación y corrimiento electroforético. TEMAS A DEMOSTRAR Caracterización de ácidos nucleícos RESULTADOS Determine la calidad y concentración del ácido nucleícos Investigue que efecto tiene la solución DEPC dentro del proceso de aislamiento de RNA Mencione que tipos de RNA existen en un tejido Dra. Florinda Jiménez Vega Pag. 30

34 PRACTICA NO. 8 CUANTIFICACIÓN DE RNA Y DNA OBJETIVO El alumno será capaz de determinar la concentración de DNA y RNA por espectroscopia. INTRODUCCIÓN Medir la concentración de ácidos nucleicos de alto peso molecular es difícil, cuando se trata realizar a través de métodos estándares. Esto es debido a que la solución de DNA es usualmente viscosa, el problema se minimiza al realizar diluciones de la muestra en buffer TE ph 8.0 y mezclando vigorosamente. La absorbancia puede ser determinada a 260 y 280 nm. Una solución con una A260 de 1 contiene aproximadamente 50 µg de DNA/mL en tanto que para DNA de simple cadena o RNA A 260 equivale a un coeficiente de 38 µg de RNA/mL. MATERIALES DNA, RNA Buffer TE o agua PROCEDIMIENTO 1. Colocar 1 µl del ácido nucleícos a cuantificar y diluir con 89 µl de agua. Mezclar bien. 2. Ajustar a 0.0 la lectura del espectrofotómetro a 260 y 280 nm con agua. Dra. Florinda Jiménez Vega Pag. 31

35 3. Leer la absorbancia de la solución a 260 y 280 nm. 4. Utilizar la relación de 50 µg/ml de DNA= 1 unidad de absorbancia a 260 nm y calcular la concentración y pureza del DNA, en base a los principios estudiados en clase. 5. Utilizar la relación de 40 µg/ml de RNA= 1 unidad de absorbancia a 260 nm y calcular la concentración y pureza del RNA, en base a los principios estudiados en clase. TEMAS A DEMOSTRAR RESULTADOS Caracterización de ácidos nucleícos Evalue los datos obtenidos y reporte Dra. Florinda Jiménez Vega Pag. 32

AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO

AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO E l estudio del genoma de los seres vivos a sido uno d los principales objetivos de la Biología. Desde los trabajos de Mendel (1866),

Más detalles

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles

Práctico: Genética bacteriana 2007.

Práctico: Genética bacteriana 2007. Práctico: Genética bacteriana 2007. Actividad integrada Departamento de Genética Departamento de Bacteriología y Virología. OBJETIVOS Objetivos generales El estudiante al terminar la actividad práctica

Más detalles

38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa

38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa 38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa José Luis Caballero Repullo, Enriqueta Moyano, Juan Muñoz Blanco Departamento de Bioquímica y Biología Molecular, Campus

Más detalles

Bioquímica III- 2009

Bioquímica III- 2009 Facultad de Ciencias Exactas, Universidad Nacional de La Plata Bioquímica III- 2009 Trabajo Práctico Nro 4 Extracción de RNA y DNA bacteriano INTRODUCCIÓN El RNA es el ácido nucleico más abundante en la

Más detalles

DANAGENE RNA PURIFICATION KIT

DANAGENE RNA PURIFICATION KIT DANAGENE RNA PURIFICATION KIT REF.0801.1 100 EXTRACCIONES REF.0801.2 500 EXTRACCIONES 1.INTRODUCCION Este kit permite la permite la obtención de ARN total a partir de cultivos celulares, tejidos animales,

Más detalles

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN 5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN Materiales - Eppendorf de 1,5 ml estériles - Eppendorf de pared fina para PCR - Puntas de pipeta estériles desechables - Guantes

Más detalles

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR Módulo 1 Amplificación de un fragmento de ADN genómico por PCR En este primer módulo se amplificará por PCR, mediante el uso de oligonucleótidos específicos, un fragmento de ADN genómico de Aspergillus

Más detalles

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles

ELECTROFORESIS EN GELES DE AGAROSA. Agustín Garrido. agugarrido@hotmail.com

ELECTROFORESIS EN GELES DE AGAROSA. Agustín Garrido. agugarrido@hotmail.com 1 ELECTROFORESIS EN GELES DE AGAROSA Agustín Garrido agugarrido@hotmail.com Introducción En este trabajo práctico se utilizó la técnica de electroforesis. Este proceso se basa en la migración de las moléculas

Más detalles

Guía Práctica 9. Producción de micelio en medio líquido para extracción de ADN. Micelio de hongos. Contenido

Guía Práctica 9. Producción de micelio en medio líquido para extracción de ADN. Micelio de hongos. Contenido Guía Práctica 9 Micelio de hongos Producción de micelio en medio líquido para extracción de ADN Guillermo Castellanos, Experto en Investigación 2 Carlos Jara, Ing. Agr. M.Sc., Asociado en Investigación

Más detalles

CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA. Grado en Medicina

CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA. Grado en Medicina DEPARTAMENTO DE BIOQUÍMICA Y BIOLOGÍA MOLECULAR III FACULTAD DE MEDICINA UNIVERSIDAD COMPLUTENSE DE MADRID CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA Grado en Medicina CURSO ACADÉMICO 2014/2015 INDICE

Más detalles

CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL

CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL LIBRO DE MEMORIAS 2 CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL Santiago de Cali, 23 al 28 de agosto de 2010 3 Libro de memorias

Más detalles

Clonación molecular. Clonar significa hacer copias idénticas

Clonación molecular. Clonar significa hacer copias idénticas INGENIERÍA GENÉTICA Clonación molecular Clonar significa hacer copias idénticas Este término originalmente fue aplicado al procedimiento de aislar una célula y permitirle reproducirse creando una población

Más detalles

39. Aislamiento y purificación del DNA de un plásmido recombinante

39. Aislamiento y purificación del DNA de un plásmido recombinante 39. Aislamiento y purificación del DNA de un plásmido recombinante Aurora Galván Cejudo, Manuel Tejada, Antonio Camargo, José Javier Higuera, Vicente Mariscal, Emilio Fernández Reyes Departamento de Bioquímica

Más detalles

Grado en Química. 4º Curso Bioquímica. Guión de Prácticas

Grado en Química. 4º Curso Bioquímica. Guión de Prácticas Grado en Química 4º Curso Bioquímica Guión de Prácticas UTILES A TRAER POR EL ALUMNO Bata Gafas de Seguridad Cuaderno de Laboratorio NORMAS DE TRABAJO Antes de empezar Antes de empezar cada práctica, el

Más detalles

17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico

17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico 17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico Carmen Alicia Padilla Peña, Jesús Diez Dapena, Emilia Martínez Galisteo, José

Más detalles

TRABAJO PRÁCTICO Nº 5: ÁCIDOS NUCLEICOS DESCRIPCIÓN DE LOS MÉTODOS A UTILIZAR

TRABAJO PRÁCTICO Nº 5: ÁCIDOS NUCLEICOS DESCRIPCIÓN DE LOS MÉTODOS A UTILIZAR TRABAJO PRÁCTICO Nº 5: ÁCIDOS NUCLEICOS DOCENTES: Andrés Ciocchini, Gabriela Niemirowicz. DESCRIPCIÓN DE LOS MÉTODOS A UTILIZAR Purificación de ácido desoxiribonucleico (ADN) por partición diferencial

Más detalles

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a Introducción Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a los investigadores verificar la expresión de una proteína, determinar la cantidad relativa

Más detalles

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Para la purificación de ADN genómico de todos los kits de colección Oragene y ORAcollect. Visite nuestro sitio

Más detalles

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas ELEMENTOS BÁSICOS DE LA INVESTIGACIÓN EN GENES Análisis

Más detalles

37. Purificación de ácidos nucleicos

37. Purificación de ácidos nucleicos 37. Purificación de ácidos nucleicos Mª José Prieto Álamo, Juan López Barea, Carmen Pueyo de la Cuesta Departamento de Bioquímica y Biología Molecular, Campus Universitario de Rabanales, Edificio Severo

Más detalles

5. MATERIALES Y MÉTODOS

5. MATERIALES Y MÉTODOS 5. MATERIALES Y MÉTODOS 5.1 Equipos Los siguientes termocicladores se emplearon para la amplificación por PCR: - Perkin Elmer, GeneAmp PCR System 2400. - Perkin Elmer, GeneAmp PCR System 9600. - Applied

Más detalles

NORMAS DE TRABAJO EN BIOLOGÍA MOLECULAR Y GUÍA DE PROBLEMAS HABITUALES Y SU SOLUCIÓN

NORMAS DE TRABAJO EN BIOLOGÍA MOLECULAR Y GUÍA DE PROBLEMAS HABITUALES Y SU SOLUCIÓN NORMAS DE TRABAJO EN BIOLOGÍA MOLECULAR Y GUÍA DE PROBLEMAS HABITUALES Y SU SOLUCIÓN 1. PROCEDIMIENTOS BÁSICOS: En este apartado pretendemos detallar algunos factores muy importantes a la hora de realizar

Más detalles

ELECTROFORESIS EN GELES DE POLIACRILAMIDA SDS-PAGE. Presencia de Sodio Dodecil Sulfato bajo condiciones reductoras (SDSPAGE)

ELECTROFORESIS EN GELES DE POLIACRILAMIDA SDS-PAGE. Presencia de Sodio Dodecil Sulfato bajo condiciones reductoras (SDSPAGE) ELECTROFORESIS EN GELES DE POLIACRILAMIDA SDSPAGE Presencia de Sodio Dodecil Sulfato bajo condiciones reductoras (SDSPAGE) Método rápido, reproducible y de bajo costo Utilizado para cuantificar, comparar

Más detalles

MANUAL DE PRÁCTICAS DE LABORATORIO

MANUAL DE PRÁCTICAS DE LABORATORIO MANUAL DE PRÁCTICAS DE LABORATORIO INGENIERIA ENBIOTECNOLOGÍA INGENIERÍA GENÉTICA FICHA TECNICA FICHA TÉCNICA SEMINARIO DE BIOTECNOLOGÍA MÉDICO-FARMACÉUTICA Fecha: Nombre del catedrático: 10-Julio-2012

Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

Técnicas de Biología Molecular

Técnicas de Biología Molecular Técnicas de Biología Molecular DNA I. Enzimas de restricción Análisis Las enzimas de restricción fueron aisladas de bacterias; su función natural es proteger contra DNA extraño II. Separación electroforética

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

TEMA 6. PURIFICACIÓN DE PROTEÍNAS

TEMA 6. PURIFICACIÓN DE PROTEÍNAS TEMA 6. PURIFICACIÓN DE PROTEÍNAS 1. Introducción 2. Métodos de rotura celular y extracción de proteínas 3. Métodos cromatográficos 4. Métodos electroforéticos 1. Introducción La mayor parte de las investigaciones

Más detalles

CICLO 2 : Fraccionamiento subcelular

CICLO 2 : Fraccionamiento subcelular Curso de Fisicoquímica Biológica 2006 Licenciatura de Bioquímica. Facultad de Ciencias. CICLO 2 : Fraccionamiento subcelular OBJETIVOS GENERALES: 1) Obtención de preparados enriquecidos en fracciones subcelulares

Más detalles

Protocolos de secuenciación de ADN

Protocolos de secuenciación de ADN 1 Protocolos de secuenciación de ADN Introducción El método de secuenciación utilizado aquí es el desarrollado por Sanger en 1975. Este consiste en la incorporación de didesixinucleótidos marcados fluorescentemente

Más detalles

Curso de biología molecular CIMAT 2010

Curso de biología molecular CIMAT 2010 Curso de biología molecular CIMAT 2010 INTRODUCCIÓN Este curso-taller tiene como propósito mostrar de manera teórica y práctica algunos principios básicos de biología molecular e ingeniería genética. Conocerás

Más detalles

ELECTROFORESIS AVANZADA

ELECTROFORESIS AVANZADA Ref.ELECAVANZADA (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO ELECTROFORESIS AVANZADA El objetivo de este experimento es introducir a los alumnos en el conocimiento de la teoría electroforética y familiarizarse

Más detalles

TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO

TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO TEST de PATERNIDAD Este experimento introduce a los alumnos en el uso del ADN y la PCR para simular una determinación de paternidad. Los estudiantes

Más detalles

Materiales para la secuenciación de ADN

Materiales para la secuenciación de ADN Introduccion La Secuenciación Sanger es un método de secuenciación de ADN en el que el ADN diana se desnaturaliza y se hibrida con un cebador de oligonucleótidos, que se extiende entonces gracias a la

Más detalles

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR)

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) Centro de de Microscopía Electrónica Facultad de de Ciencias Médicas Universidad Nacional de de Córdoba

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. info@atgen.com.uy www.atgen.com.uy

Más detalles

III. METODOLOGÍA EXPERIMENTAL

III. METODOLOGÍA EXPERIMENTAL III. METODOLOGÍA EXPERIMENTAL 3.1 Análisis Previos Se utilizaron los filtros con muestra de partículas suspendidas en el aire PM 10 que el Instituto Municipal de Ecología (IME) proporcionó para llevar

Más detalles

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS Prácticas docentes en la COD: 10-71 APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS FUNDAMENTO TEÓRICO La PCR es una técnica que permite llevar a cabo la síntesis in vitro de fragmentos de ADN. Está basada

Más detalles

INTRODUCCIÓN A LA METODOLOGÍA MOLECULAR. 2002 `Derechos Reservados Pontificia Universidad Javeriana Instituto de Genética Humana Bogotá COLOMBIA

INTRODUCCIÓN A LA METODOLOGÍA MOLECULAR. 2002 `Derechos Reservados Pontificia Universidad Javeriana Instituto de Genética Humana Bogotá COLOMBIA INTRODUCCIÓN A LA METODOLOGÍA MOLECULAR 2002 `Derechos Reservados Pontificia Universidad Javeriana Instituto de Genética Humana Bogotá COLOMBIA Equipos de Laboratorio Un equipo de laboratorio es un conjunto

Más detalles

I. 15microlitros de agua esteril, perforar el pozo y diluir. II. Se tomaron 2 microlitros para la primera transformación.

I. 15microlitros de agua esteril, perforar el pozo y diluir. II. Se tomaron 2 microlitros para la primera transformación. 23 de agosto 2007 Se comenzó la elaboración de la bitácora Medio LB Broth, Billar (Luria-Bertani) 25gr/litro Se preparó 500 mililitros agregando 12.5 gramos Se diluyó y esterilizó por autoclave Medio LB

Más detalles

Reacción en cadena de la polymerasa (PCR)

Reacción en cadena de la polymerasa (PCR) Reacción en cadena de la polymerasa (PCR) 1 PCR Que es? Es una técnica in vitro diseñada para amplificar una región específica de DNA. Es extremadamente sensible, con la capacidad de amplificar millones

Más detalles

UNIVERSIDAD DE PUERTO RICO EN AGUADILLA DEPARTAMENTO DE CIENCIAS NATURALES. Laboratorio de Genética BIOL 3306

UNIVERSIDAD DE PUERTO RICO EN AGUADILLA DEPARTAMENTO DE CIENCIAS NATURALES. Laboratorio de Genética BIOL 3306 UNIVERSIDAD DE PUERTO RICO EN AGUADILLA DEPARTAMENTO DE CIENCIAS NATURALES Laboratorio de Genética BIOL 3306 Liza V. Jiménez Rodríguez, Ph.D. Agosto, 2014 Pre-prueba I. Pareo 1) Geles de agarosa 2) Loading

Más detalles

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA BIOLOGIA MOLECULAR Hemos elaborado un programa en 3 niveles, en función del tipo de estudiante y las posibilidades del centro educativo: 1. NIVEL BASICO 2. NIVEL MEDIO DANAEXTRACTOR KIT Práctica que constituye

Más detalles

Tema 11. Herramientas de la genética molecular

Tema 11. Herramientas de la genética molecular Tema 11. Herramientas de la genética molecular Genética CC. Mar 2004-05 Objetivos Técnicas de clonación Construcción de genotecas e identificación de secuencias Mapas de restricción Amplificación (PCR)

Más detalles

CROMATOGRAFÍA DE FILTRACIÓN EN GEL

CROMATOGRAFÍA DE FILTRACIÓN EN GEL 1.- FUNDAMENTO TEÓRICO CROMATOGRAFÍA DE FILTRACIÓN EN GEL Filtración en gel - 1 (Farmacia) La cromatografía de exclusión o filtración en gel es una clase de cromatografía sólido-líquido que permite la

Más detalles

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml)

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml) PCR SIMULADA Ref.PCR Simulada (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

GUÍA PARA LA SECUENCIACIÓN AUTOMÁTICA DE DNA

GUÍA PARA LA SECUENCIACIÓN AUTOMÁTICA DE DNA Página 1 de 16 GUÍA PARA LA SECUENCIACIÓN AUTOMÁTICA DE DNA SERVICIO DE SECUENCIACIÓN-S.C.S.I.E. UNIVERSITAT DE VALÈNCIA Página 2 de 16 CONTENIDOS: 1.- Secuenciación automática de DNA 2.- Tipos de molde

Más detalles

PRACTICA No. 9 PREPARACION DE DISOLUCIONES

PRACTICA No. 9 PREPARACION DE DISOLUCIONES 1 UNIVERSIDAD DE SAN CARLOS DE GUATEMALA FACULTAD DE CIENCIAS QUÍMICAS Y FARMACIA ESCUELA DE QUÍMICA DEPARTAMENTO DE QUÍMICA GENERAL QUÍMICA GENERAL II PRACTICA No. 9 PREPARACION DE DISOLUCIONES INTRODUCCION:

Más detalles

DANAGENE SALIVA KIT. Ref.0603.4 50 Extracciones / Ref.0603.41 160 Extracciones

DANAGENE SALIVA KIT. Ref.0603.4 50 Extracciones / Ref.0603.41 160 Extracciones DANAGENE SALIVA KIT Ref.0603.4 50 Extracciones / Ref.0603.41 160 Extracciones 1.INTRODUCCION DANAGENE SALIVA Kit provee un método para la extracción de ADN genómico de alta calidad a partir de muestras

Más detalles

ACTIVIDAD PRACTICA No. 8 BIOLOGIA CELULAR EXTRACCIÓN DE ADN

ACTIVIDAD PRACTICA No. 8 BIOLOGIA CELULAR EXTRACCIÓN DE ADN Universidad Centroccidental Lisandro Alvarado Decanato de Ciencias de la Salud ACTIVIDAD PRACTICA No. 8 BIOLOGIA CELULAR EXTRACCIÓN DE ADN Octubre 2009 INTRODUCCION La molécula de ADN (que es la que se

Más detalles

TP1: Diluciones. Objetivos. Introducción. Introducción a la Biología Celular y Molecular

TP1: Diluciones. Objetivos. Introducción. Introducción a la Biología Celular y Molecular TP1: Diluciones Objetivos Familiarizarse con las unidades mas utilizadas en biología molecular y ser capaces de intercambiar ágilmente las distintas unidades. Familiarizarse con el material de uso corriente

Más detalles

MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR)

MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) OBJETIVOS - Definir PCR, conocer los reactivos que

Más detalles

C A P Í T U L O 3 M A T E R I A L E S Y M É T O D O. Se ejecutaron varias pruebas para la inactivación de Escherichia Coli ATCC 25922 en agua

C A P Í T U L O 3 M A T E R I A L E S Y M É T O D O. Se ejecutaron varias pruebas para la inactivación de Escherichia Coli ATCC 25922 en agua C A P Í T U L O 3 M A T E R I A L E S Y M É T O D O Se ejecutaron varias pruebas para la inactivación de Escherichia Coli ATCC 25922 en agua destilada utilizando Dióxido de Titanio dopado con Nitrógeno,

Más detalles

INTERFERÓN BETA-1A BIOFARMACO, SOLUCIÓN CONCENTRADA

INTERFERÓN BETA-1A BIOFARMACO, SOLUCIÓN CONCENTRADA MONOGRAFÍA NUEVA Con fundamento en el numeral 4.11.1 de la Norma Oficial Mexicana NOM-001-SSA1-2010, se publica el presente proyecto a efecto de que los interesados, a partir del 1º de agosto y hasta el

Más detalles

Extracción de DNA por el Método Adaptado de Drábek.

Extracción de DNA por el Método Adaptado de Drábek. Extracción de DNA por el Método Adaptado de Drábek. El aislamiento de DNA constituye un paso esencial para la realización de estudios de tamizaje genético, análisis de polimorfismos genéticos, estudios

Más detalles

CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015

CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 DEFINICIÓN PCR: Constituye la técnica más importante para amplificar ácidos nucleicos in vitro. Ambas hebras del DNA de interés son replicadas

Más detalles

Purificación de RNA IG 2010

Purificación de RNA IG 2010 Purificación de RNA IG 2010 1 Purificación de RNA Para qué sirve? Cómo se trabaja con RNA? Pasos generales: Homogeneizar células Purificar el RNA (total o no total, ej mrna) Cuantificar el RNA purificado

Más detalles

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082 Página 1 de 5 1. OBJETIVO Detectar la presencia de Campylobacter jejuni en hamburguesa de pollo mediante técnica de PCR. 2. CAMPO DE APLICACIÓN Y ALCANCE Aplicar este procedimiento a muestras de hamburguesa

Más detalles

Reacción en cadena de la polimerasa (PCR)

Reacción en cadena de la polimerasa (PCR) Dr. Alejandro Leal Reacción en cadena de la polimerasa (PCR) La reacción en cadena de la polimerasa (PCR, por sus siglas en inglés de "polymerase chain reaction") es un método de amplificación in vitro

Más detalles

QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA. Julio A. Carrasco Vallejo Julio 2014

QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA. Julio A. Carrasco Vallejo Julio 2014 QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA Julio A. Carrasco Vallejo Julio 2014 Definiciones Biología Molecular: Estudio de los flujos de información genética en una célula Biotecnología: Uso de sistemas

Más detalles

3.- TECNOLOGIA EN EL DIAGNOSTICO MOLECULAR

3.- TECNOLOGIA EN EL DIAGNOSTICO MOLECULAR 3.- TECNOLOGIA EN EL DIAGNOSTICO MOLECULAR 3.1.- INTRODUCCIÓN Pocas áreas de la Biología Molecular han permanecido inalteradas con la aparición de una serie de técnicas englobadas dentro del término genérico

Más detalles

MEMORIA DE PRÁCTICAS

MEMORIA DE PRÁCTICAS MEMORIA DE PRÁCTICAS Empresa: Centro Nacional de Tecnología y Seguridad Alimentaria (CNTA)- Laboratorio del Ebro. San Adrián (Navarra). Alumna: Laura Sánchez Vicente Período de prácticas: 01-07-08 hasta

Más detalles

MATERIALES Y MÉTODOS

MATERIALES Y MÉTODOS MATERIALES Y MÉTODOS Para la obtención, aislamiento y caracterización de la proteína de superficie HSPB66 de H. pylori ATCC 43504 se realizó un cultivo de esta cepa, seguido de la extracción de proteínas

Más detalles

Medición de ph y dureza

Medición de ph y dureza Medición de ph y dureza 363 Medición de ph y dureza Isabel Romero Terán Medición de ph Campo de aplicación Este procedimiento complementario es útil para todos los ensayos de toxicidad que requieran medir

Más detalles

Practica la genética Ficha didáctica del profesorado Bachillerato

Practica la genética Ficha didáctica del profesorado Bachillerato Ficha didáctica del profesorado Bachillerato www.eurekamuseoa.es Extracción de ADN Cuál es la función de cada uno de los ingredientes utilizados para realizar la disolución tampón para la visualización

Más detalles

Laboratorio. Objetivos I N T R O D U C C I Ó N. Al finalizar este laboratorio el estudiante podrá:

Laboratorio. Objetivos I N T R O D U C C I Ó N. Al finalizar este laboratorio el estudiante podrá: Laboratorio 12 Biología molecular Objetivos Al finalizar este laboratorio el estudiante podrá: 1. Conocer los principios básicos de la técnica de electroforesis y su aplicación al análisis del ADN. 2.

Más detalles

UNIDAD 4. Reparto entre dos disolventes. Separaciones por Extracción

UNIDAD 4. Reparto entre dos disolventes. Separaciones por Extracción UNIDAD 4 Reparto entre dos disolventes. Separaciones por Extracción Introducción En los análisis químicos es necesario, después de la toma de muestra y su disolución en el disolvente adecuado, aislar el

Más detalles

TaqMan GMO Maize Quantification Kit. Part No: 4481972

TaqMan GMO Maize Quantification Kit. Part No: 4481972 TaqMan GMO Maize Quantification Kit Part No: 4481972 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan

Más detalles

Electroforesis en gel de poliacrilamida y electrotransferencia

Electroforesis en gel de poliacrilamida y electrotransferencia Electroforesis en gel de poliacrilamida y electrotransferencia INDICE ELECTROFORESIS Fundamento y características Tipos de electroforesis: libre y de zona Electroforesis en papel, acetato de celulosa Electroforesis

Más detalles

TRABAJ O PRÁCTICO: PRECIPITACIÓN Y FILTRACIÓN

TRABAJ O PRÁCTICO: PRECIPITACIÓN Y FILTRACIÓN TRABAJ O PRÁCTICO: PRECIPITACIÓN Y FILTRACIÓN PREGUNTA DE ENFOQUE: Es posible conocer la cantidad de cloruro de plata que se forma al mezclar una disolución acuosa de cloruro de sodio con una de nitrato

Más detalles

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri OBJETIVO Desarrollar un banco de datos a partir de plantas de origen indudable y del uso

Más detalles

ASIGNATURA: QUIMICA AGROPECUARIA (RB8002) GUÍA N 2: PREPARACION DE DISOLUCIONES

ASIGNATURA: QUIMICA AGROPECUARIA (RB8002) GUÍA N 2: PREPARACION DE DISOLUCIONES I. Presentación de la guía: ASIGNATURA: QUIMICA AGROPECUARIA (RB8002) GUÍA N 2: PREPARACION DE DISOLUCIONES Competencia: El alumno será capaz de aplicar los conceptos básicos de concentración y solubilidad

Más detalles

CUANTIFICACIÓN DE ADENOSIN DESAMINASA (ADA)

CUANTIFICACIÓN DE ADENOSIN DESAMINASA (ADA) CUANTIFICACIÓN DE ADENOSIN DESAMINASA (ADA) PROTOCOLO ADA FUNDAMENTO DEL METODO: La adenosindesaminasa (ADA) es una enzima del catabolismo de las purinas que cataliza la conversión de la adenosina en inosina

Más detalles

PROCEDIMIENTO PARA DETERMINACIÓN DE SODIO, POTASIO y CALCIO EN ALIMENTOS. Método Espectrofotometría de Absorción Atómica de llama. Método AOAC 985.

PROCEDIMIENTO PARA DETERMINACIÓN DE SODIO, POTASIO y CALCIO EN ALIMENTOS. Método Espectrofotometría de Absorción Atómica de llama. Método AOAC 985. Página 1 de 8 1. OBJETIVO Determinar la concentración de sodio, potasio y calcio en muestras de alimentos con bajo contenido de grasa. 2. CAMPO DE APLICACIÓN Y ALCANCE El método es aplicable a alimentos

Más detalles

PRÁCTICA 7 INSTRUMENTACIÓN BÁSICA EN QUÍMICA

PRÁCTICA 7 INSTRUMENTACIÓN BÁSICA EN QUÍMICA PRÁCTICA 7 INSTRUMENTACIÓN BÁSICA EN QUÍMICA OBJETIVOS En esta práctica se tratarán aspectos de interés relacionados con la instrumentación básica utilizada en química, haciendo especial hincapié en la

Más detalles

AUTOR: JORGE CONTRERAS PINEDA 1. Titulo:

AUTOR: JORGE CONTRERAS PINEDA 1. Titulo: Página 1 de 1 1. Titulo: Electroforesis de DNA 2. Objetivo Conocer los principios básicos de la electroforesis horizontal en geles de agarosa y aplicarlo para la separación de DNA humano, plasmídico, recombinante

Más detalles

Técnicas moleculares.

Técnicas moleculares. Técnicas moleculares. DMTV Carolina Acevedo Curso de Microbiología 2015 SÍNTESIS IN VITRO DE UNA GRAN CANTIDAD DE COPIAS DE UN SEGMENTO DE ADN EXISTENTE EN UNA MUESTRA. O sea. Amplificamos en forma exponencial

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa?

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa? 2º BIOQUÍMICA CUESTIONES 1. Por qué la PCR convencional no es cuantitativa? En la PCR convencional, la cuantificación del ADN de la muestra es complicada debido a que la eficacia de amplificación va disminuyendo

Más detalles

ELECTROFORESIS BASICA

ELECTROFORESIS BASICA Ref.ELECBASICA (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO ELECTROFORESIS BASICA El objetivo de este experimento es introducir a los alumnos en el conocimiento de la teoría electroforética y familiarizarse

Más detalles

ANEXO I. Inmunofenotipificación Celular por Citometría de Flujo

ANEXO I. Inmunofenotipificación Celular por Citometría de Flujo ANEXO I Inmunofenotipificación Celular por Citometría de Flujo Reactivos Anticuerpos monoclonales fluoromarcados (BD Bioscience Pharmingen) Medio DMEM con 0.02% de azida de sodio Paraformaldehido (PFA)

Más detalles

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN.

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. PROGRAMA CONTROL DE CALIDAD DE MUESTRAS El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. El programa completo de control de calidad de muestras de ADN y ARN engloba diferentes

Más detalles

INSTITUTO POLITÉCNICO NACIONAL UNIDAD PROFESIONAL INTERDISCIPLINARIA DE BIOTECNOLOGÍA DEPARTAMENTO DE BIOPROCESOS ACADEMIA DE BIOTECNOLOGÍA

INSTITUTO POLITÉCNICO NACIONAL UNIDAD PROFESIONAL INTERDISCIPLINARIA DE BIOTECNOLOGÍA DEPARTAMENTO DE BIOPROCESOS ACADEMIA DE BIOTECNOLOGÍA INSTITUTO POLITÉCNICO NACIONAL UNIDAD PROFESIONAL INTERDISCIPLINARIA DE BIOTECNOLOGÍA DEPARTAMENTO DE BIOPROCESOS ACADEMIA DE BIOTECNOLOGÍA MANUAL DEL LABORATORIO DE BIOTECNOLOGÍA MOLECULAR ELABORADO POR:

Más detalles

B Fig. 2. Ley de Lambert

B Fig. 2. Ley de Lambert INTRODUCCION TEORICA FUNDAMENTOS DE ESPECTROFOTOMETRÍA Introducción : La espectrofotometría es uno de los métodos de análisis más usados, y se basa en la relación que existe entre la absorción de luz por

Más detalles

Electroforesis de proteínas en geles de poliacrilamida. Electroforesis de proteínas en geles de poliacrilamida: Introducción y técnica básica

Electroforesis de proteínas en geles de poliacrilamida. Electroforesis de proteínas en geles de poliacrilamida: Introducción y técnica básica Electroforesis de proteínas en geles de poliacrilamida Electroforesis de proteínas en geles de poliacrilamida: Introducción y técnica básica La electroforesis de proteínas en geles con una matriz de poliacrilamida,

Más detalles

EXTRACCIÓN DE ADN (2)

EXTRACCIÓN DE ADN (2) EXTRACCIÓN DE ADN (2) PROCEDIMIENTO BÁSICO Muchos estudios de Biología Molecular comienzan con la extracción de ácidos nucleicos. La lisis celular libera las moléculas en una fase acuosa que es separada

Más detalles

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

FISIOLOGÍA BACTERIANA 2015 TÉCNICAS BÁSICAS DE MICROBIOLOGIA - TÉCNICAS ASÉPTICAS - SIEMBRA Y AISLAMIENTO

FISIOLOGÍA BACTERIANA 2015 TÉCNICAS BÁSICAS DE MICROBIOLOGIA - TÉCNICAS ASÉPTICAS - SIEMBRA Y AISLAMIENTO FISIOLOGÍA BACTERIANA 2015 1 TRABAJO PRÁCTICO TÉCNICAS BÁSICAS DE MICROBIOLOGIA - TÉCNICAS ASÉPTICAS - SIEMBRA Y AISLAMIENTO OBJETIVOS: Conocer la importancia de la esterilización y familiarizarse con

Más detalles

ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA

ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA FACULTAD DE VETERINARIA DEPARTAMENTO DE SANIDAD ANIMAL ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA GUIÓN DE PRÁCTICAS DE LABORATORIO CURSO 2014 2015 MÓDULO: PORCINO Síndrome respiratorio y reproductor

Más detalles

CAPÍTULO 10 APÉNDICE A CARACTERIZACIÓN DEL SUELO. A.1. Determinación del ph. (Domínguez et al, 1982)

CAPÍTULO 10 APÉNDICE A CARACTERIZACIÓN DEL SUELO. A.1. Determinación del ph. (Domínguez et al, 1982) CAPÍTULO 10 APÉNDICE A CARACTERIZACIÓN DEL SUELO A.1. Determinación del ph (Domínguez et al, 1982) Pesar 10 gramos de suelo y colocarlos en un vaso de precipitados. Agregar 25 ml de agua destilada y agitar

Más detalles

DIAGNÓSTICO GENÉTICO DE LA HIPERCOLESTEROLEMIA FAMILIAR POR RFLP Ref.PCRCOLEST(4 prácticas)

DIAGNÓSTICO GENÉTICO DE LA HIPERCOLESTEROLEMIA FAMILIAR POR RFLP Ref.PCRCOLEST(4 prácticas) DIAGNÓSTICO GENÉTICO DE LA HIPERCOLESTEROLEMIA FAMILIAR POR RFLP Ref.PCRCOLEST(4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios

Más detalles

Cómo llevar a cabo una reacción química desde el punto de vista experimental

Cómo llevar a cabo una reacción química desde el punto de vista experimental Cómo llevar a cabo una reacción química desde el punto de vista experimental Para obtener un compuesto se pueden utilizar varias técnicas, que incluyen el aislamiento y la purificación del mismo. Pero

Más detalles

Universidad de Córdoba

Universidad de Córdoba DEPARTAMENTO DE QUÍMICA AGRÍCOLA Y EDAFOLOGÍA ESCUELA TÉCNICA SUPERIOR DE INGENIEROS AGRONOMOS Y DE MONTES Universidad de Córdoba GRADO EN INGENIERÍA AGROALIMETARIA Y DEL MEDIO RURAL ASIGNATURA: QUÍMICA

Más detalles

Curso de biología molecular CIMAT 2008

Curso de biología molecular CIMAT 2008 Curso de biología molecular CIMAT 2008 Resumen Este curso-taller tiene como propósito mostrar de manera teórica y práctica algunos principios básicos de biología molecular e ingeniería genética. Conocerás

Más detalles

Práctica 3 EXTRACCIÓN DE LA CASEINA Y DETERMINACIÓN DEL PUNTO ISOELECTRICO

Práctica 3 EXTRACCIÓN DE LA CASEINA Y DETERMINACIÓN DEL PUNTO ISOELECTRICO Práctica 3 EXTRACCIÓN DE LA CASEINA Y DETERMINACIÓN DEL PUNTO ISOELECTRICO 1.- OBJETIVO El objetivo fundamental de esta practica es la determinación del punto isoeléctrico de la caseína una vez extraída

Más detalles

1) a) En la figura señale, englobando con un trazo continuo, lo siguiente:

1) a) En la figura señale, englobando con un trazo continuo, lo siguiente: CÁTEDRA: BIOQUÍMICA Carreras: Farmacia Profesorado en Química Licenciatura en Química Licenciatura en Alimentos ÁCIDOS NUCLEICOS 1) a) En la figura señale, englobando con un trazo continuo, lo siguiente:

Más detalles

Se trabajó con jugo de zanahorias obtenidas de tres fuentes diferentes elegidas al azar

Se trabajó con jugo de zanahorias obtenidas de tres fuentes diferentes elegidas al azar 5. METODOLOGIA Se trabajó con jugo de zanahorias obtenidas de tres fuentes diferentes elegidas al azar (supermercado, mercado de San Pedro Cholula y tienda de verduras). Revisando la bibliografía se encontraron

Más detalles