Las pruebas moleculares cuentan con técnicas. estandarizadas y un punto crítico son los reactivos con los

Tamaño: px
Comenzar la demostración a partir de la página:

Download "Las pruebas moleculares cuentan con técnicas. estandarizadas y un punto crítico son los reactivos con los"


1 INSTITUTO NACIONAL DE SALUD. PLAN DE COMPRAS 202 Valor total Item Actividad Plan Acción Cantidad Elemento Marca Justificación Marca Referencia Presentación Unidad Medida Tipo de elemento Valor unitario Identificación presupuestal Grupo destino Modalidad incluido IVA Oficina Asesora Plan. y Sist Contratar y administrar el canal dedicado de internet. Canal Dedicado a Internet Unidad software DIRECCIÓN MISIONAL Informacion Contratar y administrar el canal dedicado de internet. Canal Dedicado a Internet Unidad software DIRECCIÓN MISIONAL Oficina Asesora Plan. y Sist Informacion Implementar, sostener y dar soporte de los Portales Institucionales y soluciones informaticas de tipo público del INS, bajo el cumplimiento de las politicas de Gobierno en Línea. Contrato prestación servicios Servicios personales DIRECCIÓN MISIONAL Oficina Asesora Plan. y Sist Informacion Realizar la adquisición y/o actualización de equipos de cómputo y comunicaciones con el fin de fortalecer las TIC S en el INS. Contrato prestación servicios Servicios personales DIRECCIÓN MISIONAL Oficina Asesora Plan. y Sist Informacion Realizar la adquisición y/o actualización de equipos de cómputo y comunicaciones con el fin de fortalecer las TIC S en el INS. Contrato prestación servicios Servicios personales DIRECCIÓN MISIONAL Oficina Asesora Plan. y Sist Informacion Realizar la adquisición y/o actualización de equipos de cómputo y comunicaciones con el fin de fortalecer las TIC S en el INS. Contrato prestación servicios Servicios personales DIRECCIÓN MISIONAL Oficina Asesora Plan. y Sist Informacion Realizar actividades de soporte, mantenimiento preventivo y correctivo, que garantice el funcionamiento de la plataforma de Computo del INS. 7 mantenimiento de equipos de computo Unidad Mantenimiento DIRECCIÓN MISIONAL Para aprox. 600 Equipos de Cómputo, así como para los servidores del INS.Planta Telefonica, UPS, Con Generar las etapas tecnicas iniciales para la implementación de la solución de Contacto Ciudadano. Servicio de Contac Center Unidad Servicio de Contac Center DIRECCIÓN MISIONAL Despacho del Director Oficina Asesora Plan. y Sist Informacion Implementar, sostener y dar soporte de los Portales Institucionales y soluciones informaticas de tipo público del INS, bajo el cumplimiento de las politicas de Gobierno en Línea. Servicio de Software Unidad software DIRECCIÓN MISIONAL Oficina Asesora Plan. y Sist Informacion Generar contratos y/o servicios de Soporte, Mantenimiento, actualización, renovación, modificación, desarrollo, upgrade, y/o prestación de SaaS (Software como servicio) para las soluciones de Sistemas de Información Existentes y requeridas al Servicio de Software Unidad software DIRECCIÓN MISIONAL Oficina Asesora Plan. y Sist Informacion Realizar actividades de soporte, mantenimiento preventivo y correctivo, que garantice el funcionamiento de la plataforma de Computo del INS. Para aprox. 600 Equipos de Cómputo, así como para los servidores del INS.Planta Telefonica, UPS, Con Servicio de Software Unidad software DIRECCIÓN MISIONAL Oficina Asesora Plan. y Sist Informacion Generar contratos y/o servicios de Soporte, Mantenimiento, actualización, renovación, modificación, desarrollo, upgrade, y/o prestación de SaaS (Software como servicio) para las soluciones de Sistemas de Información Existentes y requeridas al Servicio de Software Unidad software DIRECCIÓN MISIONAL Oficina Asesora Plan. y Sist Informacion CONCURSO DE MERITOS Realizar actividades de soporte, mantenimiento preventivo y correctivo, que garantice el funcionamiento de la plataforma de Computo del INS. Para aprox. 600 Equipos de Cómputo, así como para los servidores del INS.Planta Telefonica, UPS, Con Servicio de Software Unidad software DIRECCIÓN MISIONAL Oficina Asesora Plan. y Sist Informacion Desarrollar e implementar la Fase I del subsistema de vigilancia Entomológica -SIVIEN SERVICIO DE SOFTWARE - SIVIEN Unidad software DIRECCIÓN MISIONAL Oficina Asesora Plan. y Sist Informacion CONCURSO DE MERITOS Generar contratos y/o servicios de Soporte, Mantenimiento, actualización, renovación, modificación, desarrollo, upgrade, y/o prestación de SaaS (Software como servicio) para las soluciones de Sistemas de Información Existentes y requeridas al Servicio de Software como servicio Unidad software DIRECCIÓN MISIONAL Oficina Asesora Plan. y Sist Informacion Generar las fases para el Desarrollo o adquisición, e implementación del subsistema de Información de Programas de control de Calidad de línea-pcc en Linea Servicio Software - PCC Unidad software DIRECCIÓN MISIONAL Oficina Asesora Plan. y Sist Informacion Intervenir y/o adecuar las áreas misionales y administrativas de acuerdo al plan maestro de intervención de la infraestructura física para mitigación del riesgo y disponibilidad presupuestal. Cerramiento, entrada y recepción Unidad Obras S. GENERAL MISIONAL Despacho de la Secretaria General Adquirir e instalar los equipos de laboratorio, elementos de laboratorio, equipos y suministros de oficina, elementos de consumo, traslado de equipos. Contrato prestación servicios Servicios personales S. GENERAL MISIONAL Grupo Ingenieria y Mantenimiento Revisión, ajuste de diseños, construcción y adecuación de.02 M2 de estructura, obras civiles y acabados arquitectónicos, del bloque H. Convenios Interinstitucionales Convenio Interinstitucional S. GENERAL MISIONAL Despacho de la Secretaria General Adquirir e instalar los equipos de laboratorio, elementos de laboratorio, equipos y suministros de oficina, elementos de consumo, traslado de equipos. Convenios Interinstitucionales Convenio Interinstitucional S. GENERAL MISIONAL Despacho de la Secretaria General Intervenir y/o adecuar las áreas misionales y administrativas de acuerdo al plan maestro de intervención de la infraestructura física para mitigación del riesgo y disponibilidad presupuestal. Desmonte tuberías de vapor Unidad Obras S. GENERAL MISIONAL Despacho de la Secretaria General Revisión, ajuste de diseños, construcción y adecuación de.02 M2 de estructura, obras civiles y acabados arquitectónicos, del bloque H. Desmonte tuberías de vapor Unidad Obras S. GENERAL MISIONAL Despacho de la Secretaria General Realizar las instalaciones hidrosanitarias (Desagües de aguas lluvias, suministro de agua, equipo hidroneumático incluyendo base, conexiones, válvulas y controles, calentador de agua mediante serpentín de vapor, bombas para recirculación de ag Desmonte tuberías de vapor Unidad Obras S. GENERAL MISIONAL Despacho de la Secretaria General Realizar las instalaciones mecánicas del sistema de vapor y retorno condensados, Sistema de aire comprimido, sistema de co2 y del sistema de ACPM, del bloque H Desmonte tuberías de vapor Unidad Obras S. GENERAL MISIONAL Despacho de la Secretaria General Realizar las instalaciones de detección y extinción de incendios en el bloque H Desmonte tuberías de vapor Unidad Obras S. GENERAL MISIONAL Despacho de la Secretaria General Realizar las Instalaciones eléctricas del bloque H del INS. Desmonte tuberías de vapor Unidad Obras S. GENERAL MISIONAL Despacho de la Secretaria General Realizar las instalaciones del sistema aire acondicionado del bloque H del INS. Desmonte tuberías de vapor Unidad Obras S. GENERAL MISIONAL Despacho de la Secretaria General Realizar la instlación del Sistema de control del bloque H del INS. Desmonte tuberías de vapor Unidad Obras S. GENERAL MISIONAL Despacho de la Secretaria General Adquirir e instalar los equipos de laboratorio, elementos de laboratorio, equipos y suministros de oficina, elementos de consumo, traslado de equipos. Desmonte tuberías de vapor Unidad Obras S. GENERAL MISIONAL Despacho de la Secretaria General Intervenir y/o adecuar las áreas misionales y administrativas de acuerdo al plan maestro de intervención de la infraestructura física para mitigación del riesgo y disponibilidad presupuestal. Impermeabilizaciòn de terrazas Unidad Mantenimiento S. GENERAL MISIONAL Despacho de la Secretaria General Intervenir y/o adecuar las áreas misionales y administrativas de acuerdo al plan maestro de intervención de la infraestructura física para mitigación del riesgo y disponibilidad presupuestal. Interventoria Unidad Obras S. GENERAL MISIONAL Despacho de la Secretaria General Intervenir y/o adecuar las áreas misionales y administrativas de acuerdo al plan maestro de intervención de la infraestructura física para mitigación del riesgo y disponibilidad presupuestal. Interventoria Unidad Obras S. GENERAL MISIONAL Despacho de la Secretaria General Intervenir y/o adecuar las áreas misionales y administrativas de acuerdo al plan maestro de intervención de la infraestructura física para mitigación del riesgo y disponibilidad presupuestal. Interventoria Unidad Obras S. GENERAL MISIONAL Despacho de la Secretaria General Intervenir y/o adecuar las áreas misionales y administrativas de acuerdo al plan maestro de intervención de la infraestructura física para mitigación del riesgo y disponibilidad presupuestal. Mantenimiento bienes inmuebles Unidad Obras S. GENERAL MISIONAL Despacho de la Secretaria General Intervenir y/o adecuar las áreas misionales y administrativas de acuerdo al plan maestro de intervención de la infraestructura física para mitigación del riesgo y disponibilidad presupuestal. Mobiliario áreas administrativas, Gestión contractual, administrativo y financiero y recursos humanos Unidad Unidad Muebles S. GENERAL MISIONAL Despacho de la Secretaria General Intervenir y/o adecuar las áreas misionales y administrativas de acuerdo al plan maestro de intervención de la infraestructura física para mitigación del riesgo y disponibilidad presupuestal. Transformador Unidad Unidad Elementos de ferreteria S. GENERAL MISIONAL Despacho de la Secretaria General place hinged boxes, natural USA Scientific que se trabaja en cada uno, para asegurar la reproducibilidad Paquete Paquete x 5 Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Parasitologia place tiered rack, blue USA Scientific que se trabaja en cada uno, para asegurar la reproducibilidad Unidad Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Parasitologia 3 24-place Floating Foam Rack USA Scientific que se trabaja en cada uno, para asegurar la reproducibilidad Paquete Paquete x 5 Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Parasitologia Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. 50pb DNA Ladder Vial Invitrogen que se trabaja en cada uno, para asegurar la reproducibilidad Vial Unidad Reactivos SUB. INVESTIGA MISIONAL Grupo Parasitologia 5 80-place tube rack, natural USA Scientific que se trabaja en cada uno, para asegurar la reproducibilidad Unidad Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Parasitologia CON FORMALIDADES PLENAS Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 7 Acetato lente repuesto Unidad Elementos Bioseguridad SUB. INVESTIGA MISIONAL de Investigación Acetona MPB Preparación de reactivos para activida de inmuno microscopía electrónica de Estudio de las miosinas que Frasco por litro Reactivos SUB. INVESTIGA MISIONAL participan en la invasión Grupo Morfología Celular 5 Este reactivo es necesario para la preparaciòn de soluciones 8 5 Acido Acético Al 96 % Merck empleadas en tinciòn con nitrato de plata bpara Frasco por litro Reactivos SUB. INVESTIGA MISIONAL macromolèculas, asi como para la detecciòn de àcidos Grupo fisiolofia molecular 5 nucleicos por quimioluminiscencia 9 2 Acido Acético Al 96 % Frasco por litro Reactivos SUB. INVESTIGA MISIONAL Grupo Microbiologia 2

2 0 4 Acido Bórico (Grado Biologìa Molecular) Frasco Por Kg Reactivos SUB. INVESTIGA MISIONAL Estandarizar y transferir 2 metodologias de Biologia Molecular en marco de las medidas sanitarias y fitosanitarias Acido Bórico (Grado Biologìa Molecular) Frasco Por Kg Reactivos SUB. INVESTIGA CONPES 3676 Grupo Microbiologia 4 Grupo Microbiologia 2 4 Acido clorhidrico Sigma Necesario para la determinacion de solventes del Grupo de Salud Ambiental de la Subdireccion de Investigacion 25848X2.5L-GL Frasco Por 2.5 Litros Reactivos SUB. INVESTIGA MISIONAL Laboral Realizar 4 actividades de apoyo en las areas de Biologia Molecular, Chagas y PECIG (programa de erradicacion de cultivos ilicitos) a la Subdirección de Vigilancia y Control en S.P. para monitorear problemas de salud pública Adaptador de tubos CAPACIDAD DE 0,5 ML Cole Palmer divulgacion de resultados de proyectos de investigacion del Grupo de Micobacterias de la Subdireccion de Investigacion RZ Unidad Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Micobacterias 4 6 Agar BHI BBL-Difco Reactivo estandarizado para la Vigilancia molecular de Unidad Por 500 gramos Reactivos SUB. INVESTIGA MISIONAL bacterias causantes de EDA, ETA y Brotes Grupo Microbiologia 6 5 Agar granulado Difco Reactivo utilizado para desarrollo de técnicas estandarizadas Frasco Por 500 gramos Reactivos SUB. INVESTIGA MISIONAL para el laboratorio Grupo Microbiologia 6 Agar macconkey sorbitol Oxoid Reactivo necesario para la implementación de metodologías CM-83 Frasco Por 500 gramos Reactivos SUB. INVESTIGA MISIONAL diagnósticas Grupo Microbiologia 7 2 Agar saboraud Difco Reactivo utilizado para desarrollo de técnicas estandarizadas Frasco Por 500 gramos Reactivos SUB. INVESTIGA MISIONAL para el laboratorio Grupo Microbiologia Doce técnicas o metodologías de investigación adaptadas y estandarizadas en tecnicas moleculares, Histoquimicas, ultraestructurales y cromatograficas. Agarosa seakem Cambrex Reactivo necesario para visualizar los productos de PCR Frasco x 500 gramos Frasco Reactivos SUB. INVESTIGA MISIONAL obtenidos. Biologia Celular Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. Agarosa seakem Cambrex Necesario para visualización de productos de PCR de ensayos moleculares de genotipificación Frasco x 500 gramos Frasco Reactivos SUB. INVESTIGA MISIONAL Biologia Celular 20 Agarosa seakem gold x 25 gr. cambrex-lonza ref Lonza Reactivo estandarizado para la Vigilancia molecular de 5050 Frasco por 25 gramos Reactivos SUB. INVESTIGA MISIONAL bacterias causantes de EDA, ETA y Brotes Grupo Microbiologia Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. Agarosa ultra pure invitrogen Invitrogen que se trabaja en cada uno, para asegurar la reproducibilidad V384 Bolsa Por 500 gramos Reactivos SUB. INVESTIGA MISIONAL Grupo Parasitologia Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 2 Agua destilada Botella Por 500 cc Desinfectantes SUB. INVESTIGA MISIONAL Doce técnicas o metodologías de investigación adaptadas y estandarizadas en tecnicas moleculares, Histoquimicas, ultraestructurales y cromatograficas. Agua libre de nucleasas Promega Necesaria para la realización de PCRs pues garantiza que no se presentan DNAsas o RNAsas que deterioren el P-93 2x25ml Reactivos SUB. INVESTIGA MISIONAL producto. Biologia Celular 24 2 Agua libre de nucleasas Promega Reactivo necesario para la realización de ensayos P93 2x25ml Reactivos SUB. INVESTIGA MISIONAL moleculares Biologia Celular Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. 3 Agua libre de nucleasas Promega Reactivo necesario para ensayos moleculares de genotipificación P93 2x25ml Reactivos SUB. INVESTIGA MISIONAL Biologia Celular Grupo Parasitologia Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. 6 Agua libre de pirógenos. Vial por 50 ml. Promega que se trabaja en cada uno, para asegurar la reproducibilidad P95 Vial Por 50 ml Reactivos SUB. INVESTIGA MISIONAL Grupo Parasitologia 6 "Reactivo necesario para procesamiento de las muestras y Doce técnicas o metodologías de investigación adaptadas y estandarizadas en tecnicas moleculares, Histoquimicas, ultraestructurales y cromatograficas. Albumina bovina libre de globulina, para aplicaciones de ELISA Sigma A4503 Frasco Por 50 gramos Reactivos SUB. INVESTIGA MISIONAL realización del estudio. Contrapartida Proyecto INS- Grupo Morfología Celular Colciencias" 28 2 Alcohol anhídrido MPB Reactivo necesario para procesamiento de las muestras y 3000 Frasco por 4 litros Reactivos SUB. INVESTIGA MISIONAL realización de estudios en neurociencias Grupo Morfología Celular Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 2592 Alcohol Antiseptico 70% Botella por 750 ml Desinfectantes SUB. INVESTIGA MISIONAL de Investigación Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 30 Algodón absorbente en rama Unidad Elementos Bioseguridad SUB. INVESTIGA MISIONAL de Investigación Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 90 Algodón Absorbente en rollo Rollo Por 000 gramos Elementos Bioseguridad SUB. INVESTIGA MISIONAL de Investigación alimento autoclavable Bulto por 25 kilos Alimento para animales SUB. INVESTIGA MISIONAL de Investigación Doce técnicas o metodologías de investigación adaptadas y estandarizadas en tecnicas moleculares, Histoquimicas, ultraestructurales y cromatograficas. Anti-Calbindina-D-28K anticuerpo monoclonal clone CB-955 Sigma Reactivo necesario para procesamiento de las muestras y realización del estudio. Contrapartida Proyecto INS- C9848 Frasco por 0.2 ml Reactivos SUB. INVESTIGA MISIONAL Colciencias Grupo Morfología Celular 34 Anti-Calretinina anticuerpo Millipore Reactivo necesario para procesamiento de las muestras y realización del estudio. Contrapartida Proyecto INS- AB49 Frasco por 0. ml Reactivos SUB. INVESTIGA MISIONAL Colciencias Grupo Morfología Celular 35 Anticuerpo contra vimentina producido en raton Sigma Reactivo necesario para procesamiento de las muestras y B6630 Frasco Por 0.5 ml Reactivos SUB. INVESTIGA MISIONAL realización de estudios en neurociencias Grupo Morfología Celular "Reactivo necesario para procesamiento de las muestras y Doce técnicas o metodologías de investigación adaptadas y estandarizadas en tecnicas moleculares, Histoquimicas, ultraestructurales y cromatograficas. Anti-GABA Sigma A2052 Frasco por 0.2 ml Reactivos SUB. INVESTIGA MISIONAL realización del estudio. Contrapartida Proyecto INS- Grupo Morfología Celular Colciencias" 37 Anti-GFAP (anti- proteína ácida glial fibrilar) anticuerpo policlonal Dako Reactivo necesario para procesamiento de las muestras y Z-0334 Frasco Por ml Reactivos SUB. INVESTIGA MISIONAL realización de estudios en neurociencias Grupo Morfología Celular Doce técnicas o metodologías de investigación adaptadas y estandarizadas en tecnicas moleculares, Histoquimicas, ultraestructurales y cromatograficas. Anti-Glutamato anticuerpo producido en conejo Sigma Reactivo necesario para procesamiento de las muestras y realización del estudio. Contrapartida Proyecto INS- G6642 Frasco por 0.2 ml Reactivos SUB. INVESTIGA MISIONAL Colciencias Grupo Morfología Celular 39 Anti-MAP2 monoclonal clone HM-2 Sigma Reactivo necesario para procesamiento de las muestras y realización del estudio. Contrapartida Proyecto INS- M4403 Frasco por 0.2 ml Reactivos SUB. INVESTIGA MISIONAL Colciencias Grupo Morfología Celular 40 2 Anti-mouse IgG Biotin Conjugated (In rabbit) Sigma Reactivo necesario para procesamiento de las muestras y B8520 Frasco Por ml Reactivos SUB. INVESTIGA MISIONAL realización de estudios en neurociencias Grupo Morfología Celular 2 4 Anti-NeuN, anticuerpo monoclonal clone A60 Millipore Reactivo necesario para procesamiento de las muestras y MAB377 Frasco Por 500 ug Reactivos SUB. INVESTIGA MISIONAL realización de estudios en neurociencias Grupo Morfología Celular 42 Anti-Neurofilamento 200 (Phos. Sigma Reactivo necesario para procesamiento de las muestras y realización del estudio. Contrapartida Proyecto INS- N042 Frasco por 0.2 ml Reactivos SUB. INVESTIGA MISIONAL Colciencias Grupo Morfología Celular Doce técnicas o metodologías de investigación adaptadas y estandarizadas en tecnicas moleculares, Histoquimicas, ultraestructurales y cromatograficas. Anti-Parvoalbumina anticuerpo monoclonal clone PARV-9 Sigma Reactivo necesario para procesamiento de las muestras y realización del estudio. Contrapartida Proyecto INS- P3088 Frasco por 0.2 ml Reactivos SUB. INVESTIGA MISIONAL Colciencias Grupo Morfología Celular Doce técnicas o metodologías de investigación adaptadas y estandarizadas en tecnicas moleculares, Histoquimicas, ultraestructurales y cromatograficas. Anti-Rabbitt IgG biotin conjugated (in goat) Sigma Reactivo necesario para procesamiento de las muestras y B8895 Frasco Por 2 ml Reactivos SUB. INVESTIGA MISIONAL realización de estudios en neurociencias Grupo Morfología Celular 45 3 Aplicadores con algodón, de cabeza sencilla, en madera, corto, blanco Paquete Por 00 unidades Elementos Bioseguridad SUB. INVESTIGA MISIONAL Grupo Microbiologia Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 27 Aplicadores con algodón, de cabeza sencilla, en madera, corto, blanco Paquete Por 00 unidades Elementos Bioseguridad SUB. INVESTIGA MISIONAL de Investigación Aplicadores en madera, sin algodón Paquete por 00 Elementos Bioseguridad SUB. INVESTIGA MISIONAL Grupo Microbiologia Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos 4 Archivador lateral Unidad Unidad Muebles SUB. INVESTIGA MISIONAL Grupo Parasitologia Realizar Veinte asesorías y capacitaciones sobre metodologia moleculares, y temas de nutricion, Parasitologia y Salud Ambiental y laboral que contribuyan a la actualización y generación del conocimiento del talento humano involucrado en las á Armario de 200x30/50x90 cm de alto, con puertas en la parte inferior y entrepaños en la parte superior, en aglomerado terminado en fórmica Unidad Unidad Muebles SUB. INVESTIGA MISIONAL Grupo Nutricion Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 5 Arnes mascara cara completa Unidad Elementos Bioseguridad SUB. INVESTIGA MISIONAL de Investigación 5 DERECHO PRIVADO Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 300 Az Tamaño Carta Unidad Unidad Papeleria y elementos de oficina SUB. INVESTIGA MISIONAL de Investigación Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 200 Az Tamaño Oficio Unidad Unidad Papeleria y elementos de oficina SUB. INVESTIGA MISIONAL de Investigación 200 El azul tripán es un colorante aniónico grande del grupo de los colorantes 53 2 Azul De Trypan Sigma azoicos. El azul tripán se usa tradicionalmente como T-854 Frasco por 00 ml Reactivos SUB. INVESTIGA MISIONAL componente en tinciones polícromas. Con este colorante se Grupo fisiolofia molecular 2 realiza el recuento celular: Se usa azul tripán para hacer la color Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 5 Baja lengua en madera Caja por 500 Unidades Elementos Bioseguridad SUB. INVESTIGA MISIONAL de Investigación 5 55 Bálsamo de Canadá Sigma Reactivo necesario para procesamiento de las muestras y realización de estudios en neurociencias C795 Unidad por 00 ml Reactivos SUB. INVESTIGA MISIONAL Grupo Morfología Celular

3 Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 2 bata en dacron - blanca, larga, tres bolsillos frontales uno en pecho y dos en cintura, manga larga puño de punto, logo del INS bordado talla 40 Unidad Unidad Dotación de bioseguridad SUB. INVESTIGA MISIONAL de Investigación Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 22 Bata para laboratorio material gabardina tempo Blanca, larga, cierre por 5 botones frontales, elástico en puños, logo institucional, 3 bolsillos (uno de pecho y dos cintura.) con un pasador Unidad Unidad Dotación de bioseguridad SUB. INVESTIGA MISIONAL 22 y abertura en la parte de atras, talla 36 con un pasador y abertu Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 07 Bata para laboratorio material gabardina tempo Blanca, larga, cierre por 5 botones frontales, elástico en puños, logo institucional, 3 bolsillos (uno de pecho y dos cintura.), con un pasador Unidad Unidad Dotación de bioseguridad SUB. INVESTIGA MISIONAL 07 y abertura en la parte de atrastalla Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 73 Bata para laboratorio material gabardina tempo Blanca, larga, cierre por 5 botones frontales, elástico en puños, logo institucional, 3 bolsillos (uno de pecho y dos cintura.), talla 34 con un Unidad Unidad Dotación de bioseguridad SUB. INVESTIGA MISIONAL de Investigación 73 pasador y abertura en la parte de atras Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 4 Bata para laboratorio material gabardina tempo Blanca, larga, cierre por 5 botones frontales, elástico en puños, logo institucional, 3 bolsillos (uno de pecho y dos cintura.), talla 44 Unidad Unidad Dotación de bioseguridad SUB. INVESTIGA MISIONAL Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 55 Bata para laboratorio material gabardina tempo Blanca, larga, cierre por 5 botones frontales, elástico en puños, logo institucional, 3 bolsillos (uno de pecho y dos cintura.),con un pasador Unidad Unidad Dotación de bioseguridad SUB. INVESTIGA MISIONAL de Investigación 55 y abertura en la parte de atras talla Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 5 Bata para laboratorio material gabardina tempo Blanca, larga, cierre por 5 botones frontales, elástico en puños, logo institucional, 3 bolsillos (uno de pecho y dos cintura.),con un pasador Unidad Unidad Dotación de bioseguridad SUB. INVESTIGA MISIONAL de Investigación 5 y abertura en la parte de atrás talla Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 400 Batas Desechable Para Laboratorio, antifluidos manga larga ajustable, color azul, puño resortado, velcro en la parte anterior, puños y cuello de punto, talla unica Unidad Unidad Dotación de bioseguridad SUB. INVESTIGA MISIONAL de Investigación Bateria recargable de 6V, 2Am Unidad de 6V, 2Am Elemento de laboratorio SUB. INVESTIGA MISIONAL Estos elementos de laboratorio se necesitan para realizar los 65 5 BenchPro 400 Western Card Invitrogen western blots y cuantificar los niveles relativos de exptesión WP00 Caja Por 0 Unidades Reactivos SUB. INVESTIGA MISIONAL de proteínas Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos 66 4 Biblioteca lateral Unidad Unidad Muebles SUB. INVESTIGA MISIONAL BigDyeTM Terminator cycle secuencing ready reaction kit v3.; (00rxn) with secuencing Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. Applied Biosystems que se trabaja en cada uno, para asegurar la reproducibilidad Estuche Unidad Reactivos SUB. INVESTIGA MISIONAL buffer Grupo entomologia 20 Grupo fisiolofia molecular 5 Grupo Parasitologia 4 Grupo Parasitologia Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 4 Biohazard papel absorvente de salpicadura para derrames de material biologicos, mantel de laboratorio blanco en rollo. Rollo Unidad Elementos Bioseguridad SUB. INVESTIGA MISIONAL Realizar 4 actividades de apoyo en las areas de Biologia Molecular, Chagas y PECIG (programa de erradicacion de cultivos ilicitos) a la Subdirección de Vigilancia y Control en S.P. para monitorear problemas de salud pública Bisturí con mango Cole-Palmer divulgacion de resultados de proyectos de investigacion del Grupo de Micobacterias de la Subdireccion de Investigacion RZ Caja por 0 Caja por 0 Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Micobacterias Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 8 Bolsa roja autoclavable con indicador de esterilizacion, texto de impresion con cierre tamaño 36 x 48 cm Unidad Unidad Elementos Bioseguridad SUB. INVESTIGA MISIONAL Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 500 Bolsa plástica transparente calibre 3 de 54 cmx45 xm Unidad Unidad Elementos Bioseguridad SUB. INVESTIGA MISIONAL de Investigación Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 200 bolsa plateada, cierre zipper 6x6cms. Unidad Elementos Bioseguridad SUB. INVESTIGA MISIONAL Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 262 Bolsas De Plástico (Sellapack) Grandes. 25 Cmpor36 Cm Calibre 2. Unidad Unidad Equipos y suministros de aseo SUB. INVESTIGA MISIONAL de Investigación Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 3790 Bolsas De Plástico (Sellapack) Medianas. 20Cmpor30Cm Calibre 2. Unidad Unidad Equipos y suministros de aseo SUB. INVESTIGA MISIONAL de Investigación Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 2 Bota de seguridad media caña, en cuero color negro, suela de caucho negra, con cordones color negro talla 40 Unidad Dotación de bioseguridad SUB. INVESTIGA MISIONAL de Investigación Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 2 Bota de seguridad en cuero con punta de acero, forro de algodòn, plantilla en aglomerado poliester algodòn, suela en caucho y una altura de 23cm, tallas varias Unidad Dotación de bioseguridad SUB. INVESTIGA MISIONAL de Investigación Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 6 Botas de caucho negras caña alta, talla 39 par Elementos Bioseguridad SUB. INVESTIGA MISIONAL de Investigación Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 8 Botas de caucho negras caña alta talle 37 par Dotación de bioseguridad SUB. INVESTIGA MISIONAL de Investigación Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 3 Botas en PVC Color Negro, caña alta número 36par par Unidad Dotación de bioseguridad SUB. INVESTIGA MISIONAL de Investigación Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 3 Botas en PVC Color Negro, caña alta número 38par par Unidad Dotación de bioseguridad SUB. INVESTIGA MISIONAL de Investigación Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 5 botas en PVC color blanco,caña altatalla 37 par Dotación de bioseguridad SUB. INVESTIGA MISIONAL de Investigación Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 3 Botas PVC C/puntera de seguridad dielectrica RH, Talla 4 par Dotación de bioseguridad SUB. INVESTIGA MISIONAL de Investigación 3 83 Buffer (0X) con EDTA Applied Biosystems Estos reactivos son necesarios para realizar el proceso de secuenciación de ácidos nucleicos. Son compatibles con el Frasco por 25 ml Reactivos SUB. INVESTIGA MISIONAL equipo disponible en el laboratorio. Grupo fisiolofia molecular Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. 2 Buffer de carga 6x Blue/Orange 3xml Promega que se trabaja en cada uno, para asegurar la reproducibilidad G88 Unidad 3 x ml Reactivos SUB. INVESTIGA MISIONAL Grupo Parasitologia 2 La solución contiene azul de bromofenol y sacarosa para aumentar la densidad y facilitar la carga de la muestra Realizar 4 actividades de apoyo en las areas de Biologia Molecular, Chagas y PECIG (programa de erradicacion de cultivos ilicitos) a la Subdirección de Vigilancia y Control en S.P. para monitorear problemas de salud pública 5 buffer de carga gel, Rnase no detectado Sigma contiene EDTA para inhibir nucleasas que requieren G-2526 Frasco Por 5 ml Reactivos SUB. INVESTIGA MISIONAL cationes divalentes Grupo Micobacterias 5 y SDS s para ayudar a disociar los complejos de ADNproteína que p Estandarizar y transferir 2 metodologias de Biologia Molecular en marco de las medidas sanitarias y fitosanitarias Cabina seguridad biologica tipo B2 Labconco Equipo para el desarrollo de una metodología molecular para el diagnostico de tuberculosis MDR y XDR con base en las Unidad Equipo de laboratorio SUB. INVESTIGA CONPES 3676 Grupo Micobacterias mutaciones presentes en los aislamientos colombianos Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos Cabina seguridad biologica tipo B2 Labconco Equipo para el desarroloo de una metodologia molecular para el diagnostico de tuberculosos MDR Y XDR con base en las Unidad Unidad Equipo de laboratorio SUB. INVESTIGA MISIONAL mutaciones presentes en los aislamientos colombianos Grupo Micobacterias Caja color negro para almacenamiento de 00 láminas para microscopio de 3"x", con índice en la tapa batible, con bisagra y pestillo niquelados. Unidad Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo entomologia Caja de almacenamiento de tubos de 0,6-,5 capacidad 64 tubos. Caja Caja X 6 bolsas de 4 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Biologia Celular 90 0 Caja de petri en polipropileno, con tamaño de 00x5 mm, con tapa Caja por 500 Unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Microbiologia 0 9 Caja de petri en polipropileno, con tamaño de 00x5 mm, con tapa Caja por 500 Unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Microbiologia Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos caja menor Unidad Unidad Caja Menor SUB. INVESTIGA MISIONAL Realizar Veinte asesorías y capacitaciones sobre metodologia moleculares, y temas de nutricion, Parasitologia y Salud Ambiental y laboral que contribuyan a la actualización y generación del conocimiento del talento humano involucrado en las á caja menor Unidad Unidad Caja Menor SUB. INVESTIGA MISIONAL Grupo Nutricion Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos caja menor Unidad Unidad Caja Menor SUB. INVESTIGA MISIONAL 95 Cajas de almacenamiento en polipropileno.con tapa colgante para 00 tubos de.5 ml. Cole Palmer Necesario para el procesamiento de muestras de todos los proyectos de investigacion CP Paquete Paquete x 6 Elemento de laboratorio SUB. INVESTIGA MISIONAL Laboral

4 Cajas De Petri Desechables Estériles Por 94X6 Mm Caja Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL Biologia Celular Cajas para almacenamiento de tubos,5ml-2ml Capacidad 00 tubos, resistencia de -90 a USA Scientific 2 C - Las muestras a las que se les realizará extracción de ADN necesitan ser almacenadas a -70 por lo cual es necesario Paquete Por 5 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL emplear estas cajas. Biologia Celular Cajas para criopreservación en policarbonato con tapa transparente numerada, con capacidad de 8 viales de 0.5 a 2 ml Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo entomologia 2 Esta garantiza el cultivo de parásitos dado que son 99 5 Cajas plásticas para cultivo X 200 ml Bd técnicas estandarizadas con esta de elemento y un punto crítico son los elementos para la recuperación y CAT. REF:32676 Paquete Por 20 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL aislamiento de parásitos, para asegurar la reproducibilidad Grupo Parasitologia 5 de los procedimientos, d Esta garantiza el cultivo de parásitos dado que son 00 5 Cajas plásticas para cultivo X 50 ml Bd técnicas estandarizadas con esta de elemento y un punto crítico son los elementos para la recuperación y REF Paquete Por 20 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL aislamiento de parásitos, para asegurar la reproducibilidad Grupo Parasitologia 5 de los procedimientos, d 0 Calibrador digital en acero inoxidable de 0 a 50 mm Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo entomologia Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 3 Calzado para dama blanco antideslizante sin a marre y sin costura talla 34 par Dotación de bioseguridad SUB. INVESTIGA MISIONAL de Investigación Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 0 Calzado para dama blanco antideslizante sin a marre y sin costura talla 35 par Dotación de bioseguridad SUB. INVESTIGA MISIONAL Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 24 Calzado para dama blanco zuela goma sin amarre y sin costura T 36 par Dotación de bioseguridad SUB. INVESTIGA MISIONAL de Investigación Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 26 Calzado para dama blanco zuela goma sin amarre y sin costura T 37 par Dotación de bioseguridad SUB. INVESTIGA MISIONAL de Investigación Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 4 Calzado para dama blanco zuela goma sin amarre y sin costura T 38 par Dotación de bioseguridad SUB. INVESTIGA MISIONAL Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 0 Calzado para dama blanco zuela goma sin amarre y sin costura T 39 par Dotación de bioseguridad SUB. INVESTIGA MISIONAL Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 6 Calzado para hombre blanco zuela goma sin amarre y sin costura T 40 par Dotación de bioseguridad SUB. INVESTIGA MISIONAL de Investigación Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos Calzado para hombre blanco zuela goma sin amarre y sin costura T 4 par Dotación de bioseguridad SUB. INVESTIGA MISIONAL Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 4 Calzado para hombre blanco zuela goma sin amarre y sin costura T 42 par Dotación de bioseguridad SUB. INVESTIGA MISIONAL de Investigación 4 Cámara de electroforesis horizontal con bandeja para gel (2.8 x 5 centímetros) y juego de peines. Unidad Unidad Equipo de laboratorio SUB. INVESTIGA MISIONAL Biologia Celular 2 Camara de Neubauer Sigma que se trabaja en cada uno, para asegurar la reproducibilidad Z EA Unidad Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL 3 Capacitacion y eventos Unidad Unidad Capacitacion y Eventos SUB. INVESTIGA MISIONAL 4 Capacitacion y eventos Unidad Unidad Capacitacion y Eventos SUB. INVESTIGA MISIONAL Participar en eventos de divulgación sobre resultados de la investigación desarrollada. Capacitacion y eventos Unidad Unidad Capacitacion y Eventos SUB. INVESTIGA MISIONAL Grupo Parasitologia Grupo Microbiologia Grupo Morfología Celular Grupo Parasitologia 6 Capacitacion y eventos Unidad Unidad Capacitacion y Eventos SUB. INVESTIGA MISIONAL Grupo Parasitologia 7 Capacitacion y eventos Unidad Unidad Capacitacion y Eventos SUB. INVESTIGA MISIONAL Biologia Celular 8 Capacitacion y eventos Unidad Unidad Capacitacion y Eventos SUB. INVESTIGA MISIONAL Grupo entomologia publicar y distribuir 4 numeros y un suplemento de la revista Biomédica a nivel nacional e internacional Capacitacion y eventos Unidad Unidad Capacitacion y Eventos SUB. INVESTIGA MISIONAL Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos Capacitacion y eventos Unidad Unidad Capacitacion y Eventos SUB. INVESTIGA MISIONAL Capacitar en procesos y procedimientos de investigación científica en las areas de epidemiologia basica, metodologia moleculares y manejo de software especializado a por lo menos cinco funcionarios Capacitacion y eventos Unidad Unidad Capacitacion y Eventos SUB. INVESTIGA MISIONAL Biologia Celular 22 Capacitacion y eventos Unidad Unidad Capacitacion y Eventos SUB. INVESTIGA MISIONAL Laboral Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos Capacitacion y eventos Unidad Unidad Capacitacion y Eventos SUB. INVESTIGA MISIONAL Participar en eventos de divulgación sobre resultados de la investigación desarrollada. Capacitacion y eventos Unidad Unidad Capacitacion y Eventos SUB. INVESTIGA MISIONAL Grupo Micobacterias 25 Capacitacion y eventos Unidad Unidad Capacitacion y Eventos SUB. INVESTIGA MISIONAL Grupo fisiolofia molecular Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos Capacitacion y eventos Unidad Unidad Capacitacion y Eventos SUB. INVESTIGA MISIONAL 27 Capacitacion y eventos Unidad Unidad Capacitacion y Eventos SUB. INVESTIGA MISIONAL Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. Capillary 47cm x 50um ID, 30GA Aplied Biosystems que se trabaja en cada uno, para asegurar la reproducibilidad Unidad Reactivos SUB. INVESTIGA MISIONAL 29 6 Capsulas de porcelana de base redondeada de 30 ml Paquete Por 6 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Nutricion Grupo Parasitologia Grupo entomologia Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos Careta para soldador cara completa Unidad Unidad Elementos Bioseguridad SUB. INVESTIGA MISIONAL 3 2 Cargador de baterias bombas Passport Unidad Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL Laboral Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 00 Carpeta plastica blanca de 3 aros tipo folder x 2" Unidad Papeleria y elementos de oficina SUB. INVESTIGA MISIONAL Estandarizar y transferir 2 metodologias de Biologia Molecular en marco de las medidas sanitarias y fitosanitarias 2 CARTUCHO CON RESINA SUAVIZADORA, 0", COD. F. Millipore Cartucho Millipore polygard-ct 5 micras 9 3/4 Millipore Cartucho polygard-ct micra de poro nominal, en polipropileno dimension 9 3/4 Millipore 36 Cartucho polygard-ct micra de poro nominal, en polipropileno dimension 9 3/4 Millipore Estandarizar y transferir 2 metodologias de Biologia Molecular en marco de las medidas sanitarias y fitosanitarias 2 Cartucho polygard-ct micra de poro nominal, en polipropileno dimensión 9 3/4 Millipore Estandarizar y transferir 2 metodologias de Biologia Molecular en marco de las medidas sanitarias y fitosanitarias 2 Cartucho Polygard-CT 0 micras 9 3/4 Pulg Millipore 39 3 Cartucho Polygard-CT 0 micras 9 3/4 Pulg Millipore Implementación de metodologías diagnósticas del Grupo de CDFCF553 Unidad Por 0" Elemento de laboratorio SUB. INVESTIGA CONPES 3676 Microbilogia de la Subdireccion de Investigacion Necesario para el desarrollo de proyectos de investigación en el Grupo de Salud Ambiental de la Subdireccion de CT05FC50 Unidad Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL Investigacion Necesario para el desarrollo de proyectos de investigación del Grupo de Salud Ambiental de la Subdireccion de CT0FC50 Unidad Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL Investigacion que se trabaja en cada uno, para asegurar la reproducibilidad CT0FC50 Unidad Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL estandarizado y validado Insumo necesario para la implementación de metodologías CT0FC50 Unidad Unidad Elemento de laboratorio SUB. INVESTIGA CONPES 3676 diagnósticas Elemento necesario para la implementación de metodologías CT0FC50 Unidad Elemento de laboratorio SUB. INVESTIGA CONPES 3676 diagnósticas que se trabaja en cada uno, para asegurar la reproducibilidad CT0FC50 Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL estandarizado y validado Grupo Microbiologia 2 Laboral 25 Laboral 20 Grupo Nutricion Grupo Microbiologia 2 Grupo Microbiologia 2 Grupo Nutricion 3

5 Cartucho Polygard-CT 0 micras 9 3/4 Pulg Millipore 30 Cartucho Polygard-CT 0 micras 9 3/4 Pulg Millipore 0 Cartucho Polygard-CT 5 micras 9 3/4 Pulg Millipore Estandarizar y transferir 2 metodologias de Biologia Molecular en marco de las medidas sanitarias y fitosanitarias 2 Cartucho Polygard-CT 5 micras 9 3/4 Pulg Millipore Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos 44 Cartucho QPAK E Millipore que se trabaja en cada uno, para asegurar la reproducibilidad CT0FC50 Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL estandarizado y validado Necesario para el desarrollo de proyectos de investigación del Grupo de Salud Ambiental de la Subdireccion de CT0FC50 Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL Investigacion que se trabaja en cada uno, para asegurar la reproducibilidad CT05FC50 Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL estandarizado y validado Elemento necesario para la implementación de metodologías CT05FC50 Unidad Elemento de laboratorio SUB. INVESTIGA CONPES 3676 diagnósticas que se trabaja en cada uno, para asegurar la reproducibilidad CPMQ004RE Unidad Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL estandarizado y validado Grupo Nutricion 7 Laboral 30 Grupo Nutricion 0 Grupo Microbiologia 2 Grupo Micobacterias Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 200 Cartulina bristol /8 colores x 0 Paquete Papeleria y elementos de oficina SUB. INVESTIGA MISIONAL de Investigación Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 300 Cartulina Tamaño Oficio Paquete Por 0 Unidades Papeleria y elementos de oficina SUB. INVESTIGA MISIONAL de Investigación Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 2 Cinta de seguridad de je 3M 5702, amariilla negra ancho: Unidad Elementos Bioseguridad SUB. INVESTIGA MISIONAL de Investigación 2 48 Clorhidrato de L-Cisteina Fluka Necesario para la determinación de mercurio del Grupo de G Frasco por 250 gramos Reactivos SUB. INVESTIGA MISIONAL Salud Ambiental de la Subdireccion de Investigacion Laboral 49 4 Cloruro de metil mercurio Fluka Necesario para la determinación de mercurio del Grupo de MG-R Frasco por 00 mg Reactivos SUB. INVESTIGA MISIONAL Salud Ambiental de la Subdireccion de Investigacion Laboral Cloruro Estannoso dihidratado min 98% Sigma Necesario para la determinación de mercurio del Grupo de G Frasco Por 00 gramos Reactivos SUB. INVESTIGA MISIONAL Salud Ambiental de la Subdireccion de Investigacion Laboral 0 5 Columna gases masas HP-5MS Unidad por 0,25ml Elemento de laboratorio SUB. INVESTIGA MISIONAL Laboral 52 2 Columna GC DB m 0,25mm ID Film 0,25um Agilen Technologies Necesario para el procesamiento de muestras de todos los proyectos de investigacion Unidad Por 0,25mm Elemento de laboratorio SUB. INVESTIGA MISIONAL Laboral Columna GC HP -5 60m 0.25mm ID film 0.25 um Unidad Por 0,25mm Elemento de laboratorio SUB. INVESTIGA MISIONAL Laboral Columna GC HP-5MSI 30m 0,25mm ID Film 0,25um Unidad Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL Laboral 2 55 Columna HPLC Kinetex C-8 2,6um Phenomenex Necesario para el procesamiento de muestras de todos los 00B-4462-AN Unidad Por 50x2, mm Elemento de laboratorio SUB. INVESTIGA MISIONAL proyectos de investigacion Laboral 56 Columna HPLC Kinetex C-8 2,6um Phenomenex Necesario para el procesamiento de muestras de todos los 00D-4462-AN Unidad Por 00x2,mm Elemento de laboratorio SUB. INVESTIGA MISIONAL proyectos de investigacion Laboral 57 Columna HPLC Kinetex C-8 2,6um Phenomenex Necesario para el procesamiento de muestras de todos los 00B-4462-EO Unidad Por 50x4,6 mm Elemento de laboratorio SUB. INVESTIGA MISIONAL proyectos de investigacion Laboral 58 Columna HPLC Kinetex C-8 2,6um Phenomenex Necesario para el procesamiento de muestras de todos los 00D-4462-EO Unidad Por 00x4,6 mm Elemento de laboratorio SUB. INVESTIGA MISIONAL proyectos de investigacion Laboral 59 Columna HPLC Kinetex C-8 2,6um Phenomenex Necesario para el procesamiento de muestras de todos los 00F-4462-EO Unidad Por 50x4,6 mm Elemento de laboratorio SUB. INVESTIGA MISIONAL proyectos de investigacion Laboral 60 Columna Kinetex C8 50x4,6 Phenomenex Necesario para la determinacion de solventes del Grupo de 00B-446-E0 Unidad Caja x Elemento de laboratorio SUB. INVESTIGA MISIONAL Salud Ambiental de la Subdireccion de Investigacion Laboral 6 Columna Kinetex C8 50x4,6 Phenomenex Necesario para la determinacion de solventes del Grupo de 00B-4462-E0 Unidad Caja x Elemento de laboratorio SUB. INVESTIGA MISIONAL Salud Ambiental de la Subdireccion de investigacion Laboral 62 Comb, for CHEF Mapper system, 30-well,.5 mm 2 cm wide BIO-RAD Elemento se ajusta a otros elementos y equipos de la misma Unidad Unidad Equipo de laboratorio SUB. INVESTIGA MISIONAL que se tienen en el laboratorio. Grupo Microbiologia 63 Compact PCR tube rack, mixed neon colors USA Scientific que se trabaja en cada uno, para asegurar la reproducibilidad Paquete Paquete x 5 Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Parasitologia 64 3 Concentrado de hígado Sigma Esta y referencia se ha preparado la alimentación para 2023 Frasco Por 500 gramos Reactivos SUB. INVESTIGA MISIONAL los insectos, demostrando su óptimo funcionamiento Grupo entomologia Concentrado para gallinas // Alimento para aves Bulto Alimento para animales SUB. INVESTIGA MISIONAL Grupo entomologia 5 66 Congelador portatil Unidad por 20 litros Equipo de Frio y Calor SUB. INVESTIGA MISIONAL Laboral Realizar 4 actividades de apoyo en las areas de Biologia Molecular, Chagas y PECIG (programa de erradicacion de cultivos ilicitos) a la Subdirección de Vigilancia y Control en S.P. para monitorear problemas de salud pública Contenedor de puntas capacidad 480ml Cole Palmer divulgacion de resultados de proyectos de investigacion del Grupo de Micobacterias de la Subdireccion de Investigacion RZ Unidad Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Micobacterias Definir, implementar, o consolidar el modelo institucional, operativo y técnico para contribuir a mejorar las medidas sanitarias y fitosanitarias en Colombia. Contrato prestación servicios Servicios personales SUB. INVESTIGA CONPES Definir, implementar, o consolidar el modelo institucional, operativo y técnico para contribuir a mejorar las medidas sanitarias y fitosanitarias en Colombia. Contrato prestación servicios Servicios personales SUB. INVESTIGA CONPES Definir, implementar, o consolidar el modelo institucional, operativo y técnico para contribuir a mejorar las medidas sanitarias y fitosanitarias en Colombia. Contrato prestación servicios Servicios personales SUB. INVESTIGA CONPES Definir, implementar, o consolidar el modelo institucional, operativo y técnico para contribuir a mejorar las medidas sanitarias y fitosanitarias en Colombia. Contrato prestación servicios Servicios personales SUB. INVESTIGA CONPES Definir, implementar, o consolidar el modelo institucional, operativo y técnico para contribuir a mejorar las medidas sanitarias y fitosanitarias en Colombia. Contrato prestación servicios Servicios personales SUB. INVESTIGA CONPES Definir, implementar, o consolidar el modelo institucional, operativo y técnico para contribuir a mejorar las medidas sanitarias y fitosanitarias en Colombia. Contrato prestación servicios Servicios personales SUB. INVESTIGA CONPES Definir, implementar, o consolidar el modelo institucional, operativo y técnico para contribuir a mejorar las medidas sanitarias y fitosanitarias en Colombia. Contrato prestación servicios Servicios personales SUB. INVESTIGA CONPES Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Grupo Parasitologia Definir, implementar, o consolidar el modelo institucional, operativo y técnico para contribuir a mejorar las medidas sanitarias y fitosanitarias en Colombia. Contrato prestación servicios Servicios personales SUB. INVESTIGA CONPES Desarrollar e implementar un sistema de información en el marco de las medidas sanitarias y fitosanitarias Contrato prestación servicios Servicios personales SUB. INVESTIGA CONPES Desarrollar e implementar un sistema de información en el marco de las medidas sanitarias y fitosanitarias Contrato prestación servicios Servicios personales SUB. INVESTIGA CONPES Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL

6 Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Biologia Celular 89 Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Grupo Nutricion 90 Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Grupo Nutricion 9 Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Grupo Nutricion 92 Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Grupo Nutricion 93 Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Grupo Nutricion 94 Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Grupo Nutricion 95 Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Grupo Nutricion 96 Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Grupo Nutricion Realizar Veinte asesorías y capacitaciones sobre metodologia moleculares, y temas de nutricion, Parasitologia y Salud Ambiental y laboral que contribuyan a la actualización y generación del conocimiento del talento humano involucrado en las á Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Grupo Nutricion Realizar Veinte asesorías y capacitaciones sobre metodologia moleculares, y temas de nutricion, Parasitologia y Salud Ambiental y laboral que contribuyan a la actualización y generación del conocimiento del talento humano involucrado en las á Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Grupo Nutricion 99 Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Laboral 200 Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Laboral 20 Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Grupo entomologia 202 Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Grupo entomologia 203 Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Grupo entomologia Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Laboral Contribuir a la formación de 30 profesionales o investigadores en salud y biomedicina. Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Grupo Parasitologia Contribuir a la formación de 30 profesionales o investigadores en salud y biomedicina. Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Biologia Celular Contribuir a la formación de 30 profesionales o investigadores en salud y biomedicina. Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Contribuir a la formación de 30 profesionales o investigadores en salud y biomedicina. Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Contribuir a la formación de 30 profesionales o investigadores en salud y biomedicina. Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Contribuir a la formación de 30 profesionales o investigadores en salud y biomedicina. Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Contribuir a la formación de 30 profesionales o investigadores en salud y biomedicina. Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Contribuir a la formación de 30 profesionales o investigadores en salud y biomedicina. Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Grupo fisiolofia molecular Grupo entomologia Grupo Microbiologia Grupo Morfología Celular Grupo Parasitologia Grupo Morfología Celular Contribuir a la formación de 30 profesionales o investigadores en salud y biomedicina. Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Laboral Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Grupo Morfología Celular Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Grupo Morfología Celular Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Grupo Micobacterias Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Grupo Microbiologia Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Grupo Micobacterias Grupo Nutricion Grupo Nutricion Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Laboral Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Contribuir a la formación de 30 profesionales o investigadores en salud y biomedicina. Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Grupo Parasitologia

7 Contribuir a la formación de 30 profesionales o investigadores en salud y biomedicina. Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Grupo Parasitologia Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos Contrato prestación servicios Servicios personales SUB. INVESTIGA MISIONAL Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos Convenios Interinstitucionales Convenio Interinstitucional SUB. INVESTIGA MISIONAL 239 Convenios Interinstitucionales Convenio Interinstitucional SUB. INVESTIGA MISIONAL 240 Convenios Interinstitucionales Convenio Interinstitucional SUB. INVESTIGA MISIONAL 24 Convenios Interinstitucionales Convenio Interinstitucional SUB. INVESTIGA MISIONAL Realizar Veinte asesorías y capacitaciones sobre metodologia moleculares, y temas de nutricion, Parasitologia y Salud Ambiental y laboral que contribuyan a la actualización y generación del conocimiento del talento humano involucrado en las á Convenios Interinstitucionales Convenio Interinstitucional SUB. INVESTIGA MISIONAL Realizar Veinte asesorías y capacitaciones sobre metodologia moleculares, y temas de nutricion, Parasitologia y Salud Ambiental y laboral que contribuyan a la actualización y generación del conocimiento del talento humano involucrado en las á Convenios Interinstitucionales Convenio Interinstitucional SUB. INVESTIGA MISIONAL 244 Convenios Interinstitucionales Convenio Interinstitucional SUB. INVESTIGA MISIONAL Realizar 4 actividades de apoyo en las areas de Biologia Molecular, Chagas y PECIG (programa de erradicacion de cultivos ilicitos) a la Subdirección de Vigilancia y Control en S.P. para monitorear problemas de salud pública Convenios Interinstitucionales Convenio Interinstitucional SUB. INVESTIGA MISIONAL Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos Convenios Interinstitucionales Convenio Interinstitucional SUB. INVESTIGA MISIONAL Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos Convenios Interinstitucionales Convenio Interinstitucional SUB. INVESTIGA MISIONAL Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos Convenios Interinstitucionales Convenio Interinstitucional SUB. INVESTIGA MISIONAL Contribuir a la formación de 30 profesionales o investigadores en salud y biomedicina. Convenios Interinstitucionales Convenio Interinstitucional SUB. INVESTIGA MISIONAL Doce técnicas o metodologías de investigación adaptadas y estandarizadas en tecnicas moleculares, Histoquimicas, ultraestructurales y cromatograficas. Convenios Interinstitucionales Convenio Interinstitucional SUB. INVESTIGA MISIONAL Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. Convenios Interinstitucionales Convenio Interinstitucional SUB. INVESTIGA MISIONAL publicar y distribuir 4 numeros y un suplemento de la revista Biomédica a nivel nacional e internacional Convenios Interinstitucionales Convenio Interinstitucional SUB. INVESTIGA MISIONAL Estandarizar y transferir 2 metodologias de Biologia Molecular en marco de las medidas sanitarias y fitosanitarias Convenios Interinstitucionales Convenio Interinstitucional SUB. INVESTIGA CONPES Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos Convenios Interinstitucionales Convenio Interinstitucional SUB. INVESTIGA MISIONAL Desarrollar e implementar un sistema de información en el marco de las medidas sanitarias y fitosanitarias Convenios Interinstitucionales Convenio Interinstitucional SUB. INVESTIGA CONPES Definir, implementar, o consolidar el modelo institucional, operativo y técnico para contribuir a mejorar las medidas sanitarias y fitosanitarias en Colombia. Convenios Interinstitucionales Convenio Interinstitucional SUB. INVESTIGA CONPES 3676 Con este estuche se pretende realizar la evaluación del 257 CpG WIZ MGMT Amplification Kit. Millipore proceso de metilación de ADN. Comparado con otros estuches disponibles en el mercado este estuche es más S7803 Estuche por 25 reacciones Reactivos SUB. INVESTIGA MISIONAL económico y contiene los reactivos necesarios para llevar a Grupo fisiolofia molecular cabo la reacción de metilación en Con este estuche se pretende realizar la evaluación del 258 CpGenome DNA Modification Kit. Millipore proceso de metilación de ADN. Comparado con otros estuches disponibles en el mercado este estuche es más S7820 Estuche por 00 reacciones Reactivos SUB. INVESTIGA MISIONAL económico y contiene los reactivos necesarios para llevar a Grupo fisiolofia molecular cabo la reacción de metilación en Con este estuche se pretende realizar la evaluación del 259 CpGenome Fast DNA Modification Kit. Millipore proceso de metilación de ADN. Comparado con otros estuches disponibles en el mercado este estuche es más S7824 Estuche por 25 reacciones Reactivos SUB. INVESTIGA MISIONAL económico y contiene los reactivos necesarios para llevar a Grupo fisiolofia molecular cabo la reacción de metilación en Con este estuche se pretende realizar la estandarización del CpGenome Turbo Bisulfite Modification Kit Millipore proceso de metilación de ADN. Comparado con otros estuches disponibles en el mercado este estuche es más S7847 Estuche por 50 reacciones Reactivos SUB. INVESTIGA MISIONAL económico y contiene los reactivos necesarios para llevar a Grupo fisiolofia molecular 2 cabo la reacción de metilació Con este estuche se pretende realizar la evaluación del 26 CpGenome Universal Methylated DNA Millipore proceso de metilación de ADN. Comparado con otros estuches disponibles en el mercado este estuche es más S782 Vial Por 0 ug Reactivos SUB. INVESTIGA MISIONAL económico y contiene los reactivos necesarios para llevar a Grupo fisiolofia molecular cabo la reacción de metilación en Criocaja dimensiones 33por33por52 para 8 viales Nalgene Para guardar muestras en crioviales, en revco, poseen el tamaño específico para guardar en los anaqueles de la Paquete por 4 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL nevera Grupo Micobacterias 6 Las cajas de esta a diferencia de las ofrecidas por Criocajas de policarbonato para almacenamiento de 8 crioviales USA Scientific otras s, por ser de policarbonato tienen la ventaja de mantener su estructura rigida sin dañarse ni romperse en los Paquete por 4 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL procesos de congelamiento y descongelamiento rutinario. Por Grupo fisiolofia molecular 5 su diseño, perm Criodores cryoware marker Paquete por 4 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo entomologia Realizar 4 actividades de apoyo en las areas de Biologia Molecular, Chagas y PECIG (programa de erradicacion de cultivos ilicitos) a la Subdirección de Vigilancia y Control en S.P. para monitorear problemas de salud pública 4 Criodores cryoware marker Paquete por 4 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Micobacterias Realizar Veinte asesorías y capacitaciones sobre metodologia moleculares, y temas de nutricion, Parasitologia y Salud Ambiental y laboral que contribuyan a la actualización y generación del conocimiento del talento humano involucrado en las á 5 Crioviales cónicos graduado transparentes de 2ml autosostenibles tapa rosca. Precinto de seguridad entre -92 C y 2 C 4090, 4T, no esteriles Paquete Por 00 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Nutricion Crioviales de 2 ml, esteriles, tapa rosca azul. Ideales para el almacenamiento o transporte de material a temperaturas extremadamente bajas. Paquete por 500 Unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Microbiologia Crioviales de 2 ml, esteriles, tapa rosca azul. Ideales para el almacenamiento o transporte de material a temperaturas extremadamente bajas. Paquete por 500 Unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Microbiologia Cromato de potasio Merck Reactivo necesario para procesamiento de las muestras y realización del estudio. Contrapartida Proyecto INS Frasco por 250 gramos Reactivos SUB. INVESTIGA MISIONAL Colciencias Grupo Morfología Celular 270 Cuchillas para microtomo HP35 coated (50 blades) Microtomo blade Thermo Scientific desarrollo de la actividad diaria del laboratorio en el grupo de Micobacterias de la Subdireccion de Investigacion THERMO SCIENTIFIC Caja Por 50 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Micobacterias 27 4 Culture - Swab Cary-Blair Agar Becton Dickinson Reactivo necesario para la implementación de metodologías Caja Por 50 unidades Reactivos SUB. INVESTIGA MISIONAL diagnósticas. Grupo Microbiologia CULTURE - SWAB PlUS AMIES CON CARBON Becton Dickinson Reactivo necesario para la Implementación de metodologías 2202 Caja Por 50 unidades Reactivos SUB. INVESTIGA MISIONAL diagnósticas Grupo Microbiologia D? Sorbitol Sigma Necesario para la sincronización de cepas de P. falicparum S3889 KG Frasco Por Kg Reactivos SUB. INVESTIGA MISIONAL del banco Biologia Celular Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. 2 Desoxy - NTP Set solution PCR grade Roche Reactivo necesario para ensayos moleculares de genotipificación Unidad Unidad Reactivos SUB. INVESTIGA MISIONAL Biologia Celular 2

8 Doce técnicas o metodologías de investigación adaptadas y estandarizadas en tecnicas moleculares, Histoquimicas, ultraestructurales y cromatograficas. Desoxy - NTP Set solution PCR grade Roche Reactivo necesario para la realización de PCRs, técnica Unidad Unidad Reactivos SUB. INVESTIGA MISIONAL estandarizada Biologia Celular 276 Destilador compacto de propósito general. Rango de residualidad 0.5 MO cm, consumo de agua de enfriamiento 60 litros/hora, presión de agua 4.26 psi (min), VAC/220 Hz, dimensiones 7-3/8" x 8-/4", capacidad de 4 litros/hora. Unidad Unidad Equipo de laboratorio SUB. INVESTIGA MISIONAL Laboral Determinación de ferritina x 250 T Siemens Técnica estandarizada con este reactivo para el desarrollo de Prueba Reactivos SUB. INVESTIGA MISIONAL procedimientos en el laboratorio Grupo Nutricion Realizar Veinte asesorías y capacitaciones sobre metodologia moleculares, y temas de nutricion, Parasitologia y Salud Ambiental y laboral que contribuyan a la actualización y generación del conocimiento del talento humano involucrado en las á 90 Determinación de ferritina x 250 T Siemens Técnica estandarizada con este reactivo para el desarrollo de Prueba Reactivos SUB. INVESTIGA MISIONAL procedimientos en el laboratorio Grupo Nutricion Realizar Veinte asesorías y capacitaciones sobre metodologia moleculares, y temas de nutricion, Parasitologia y Salud Ambiental y laboral que contribuyan a la actualización y generación del conocimiento del talento humano involucrado en las á 000 Determinación Perfil Lipidico kit que incluye calibradores y consumibles? Prueba? 5.900? Reactivo Siemens Los procedimientoscuentan con técnicas estandarizadas y un punto crítico son los reactivos con los que se trabaja en cada uno, para asegurar la reproducibilidad de los procedimientos Prueba Unidad Reactivos SUB. INVESTIGA MISIONAL Grupo Nutricion Dispensador análogo de volumen ajustable Brand Dispensette III Especificaciones: Rango: 0.5 a 5 ml División de la escala: 0. ml Cole-Palmer Necesario para el procesamiento de muestras de todos los proyectos de investigacion CP Unidad Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL Laboral 28 DITIZONA PARA ANALISIS (,5-DIFENILTIOCARBAZONA) REAG. PH EUR Sigma Necesario para la determinación de mercurio em el Grupo de Salud Ambiental de la Subdireccion de Investigacion Frasco Por 50 gramos Reactivos SUB. INVESTIGA MISIONAL Laboral Esta garantiza el cultivo de parásitos dado que son Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. 2 DMEM Sigma técnicas estandarizadas con esta de elemento y un punto crítico son los elementos para la recuperación y D6429 Frasco 6 frascos x 500 ml Reactivos SUB. INVESTIGA MISIONAL Grupo Parasitologia 2 aislamiento de parásitos, para asegurar la reproducibilidad de los procedimientos Estandarizar y transferir 2 metodologias de Biologia Molecular en marco de las medidas sanitarias y fitosanitarias 2 DNA Ladder 00pb Vial por 50 ug Invitrogen Reactivo para técnica estandarizada para implementación de Vial por 50 ug Reactivos SUB. INVESTIGA CONPES 3676 metodologías diagnósticas Grupo Microbiologia Estandarizar y transferir 2 metodologias de Biologia Molecular en marco de las medidas sanitarias y fitosanitarias DNEASY BLOOD AND TIISSUE KIT Qiagen Reactivo estandarizado para la implementación de metodologías diagnósticas Kit Por 250 racciones Reactivos SUB. INVESTIGA CONPES 3676 Grupo Microbiologia Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. 4 DNTP SET 00 mm Ref: Invitrogen Set Invitrogen que se trabaja en cada uno, para asegurar la reproducibilidad Set por 4 viales Reactivos SUB. INVESTIGA MISIONAL Grupo Parasitologia 4 Se emplean en el proceso de PCR, sintesis de cadn, RT DNTP SET 00 mm Ref: Invitrogen Set Invitrogen PCR, y están certificados para Biología Molecular. Su presentaciòn en 4 viales separados, permite realizar ajustes Set por 4 viales Reactivos SUB. INVESTIGA MISIONAL en la concentraciòn de trabajo, de cualquiera de estos Grupo fisiolofia molecular 3 dinucleotidos dependiendo la ap Realizar 4 actividades de apoyo en las areas de Biologia Molecular, Chagas y PECIG (programa de erradicacion de cultivos ilicitos) a la Subdirección de Vigilancia y Control en S.P. para monitorear problemas de salud pública 2 ECL Direct laberlling detection system to label RPN300 Amersham Para je directo de sondas de ADN revelado facil y rapido evitando presencia de background para RFLP y RPN300 Kit Reactivos SUB. INVESTIGA MISIONAL Spoligotyping Grupo Micobacterias EDAC-(N-(3-dimetilaminopropil)-N- clorhidrato de etilcarbomdimida de calidad comercial, en Sigma polvo). Reactivo usado como agente de je del DNA en el grupo E7750 Frasco por 5 gramos Reactivos SUB. INVESTIGA MISIONAL fosfato 5 Grupo Micobacterias EDTA Invitrogen Reactivo usado para el desarrollo de técnicas de laboratorio Frasco Por 500 gramos Reactivos SUB. INVESTIGA MISIONAL Grupo Microbiologia EDTA (Ethylenediaminetetraacetic acid disodium salt dihydrate)-reactivo Sigma Reactivo necesario para procesamiento de las muestras y realización del estudio. Contrapartida Proyecto INS- E534 Frasco por 250 gramos Reactivos SUB. INVESTIGA MISIONAL Colciencias Grupo Morfología Celular Realizar 4 actividades de apoyo en las areas de Biologia Molecular, Chagas y PECIG (programa de erradicacion de cultivos ilicitos) a la Subdirección de Vigilancia y Control en S.P. para monitorear problemas de salud pública 3 EDTA 0.5M Sigma reactivo preparado con agua ultrapura. Grado biologia E-7889 Frasco por 00 ml Reactivos SUB. INVESTIGA MISIONAL molecular libre de DNAsa, RNAsa, Proteasa Grupo Micobacterias 3 El ácido etilendiaminotetraacético o EDTA, es una sustancia 292 EDTA molecular biology reagent disodium Sigma utilizada como agente quelante que puede crear complejos con un metal que tenga una estructura octaédrica. El EDTA y E-534 Frasco Por Kg Reactivos SUB. INVESTIGA MISIONAL sus derivados tienen la valiosa propiedad química de Grupo fisiolofia molecular combinarse con iones metá Reactivo grado biología molecular necesario para 293 EGTA molecular Biology Sigma experimentos de fisiología molecular. Los reactivos EDTA y EGTA Sigma se han empleado rutinariamente para la E-3889 Frasco Por 00 gramos Reactivos SUB. INVESTIGA MISIONAL preparación de buffers y soluciones de alta pureza, Grupo fisiolofia molecular necesarios para obtener células cardiac 295 Enzima de restricción AFL II New England Biolabs Necesario para detección de la mutación relacionada con resistencia a COARTEM R0520L Vial Por 0000 unidades Reactivos SUB. INVESTIGA MISIONAL Biologia Celular 296 Enzima ApaI Promega Técnica estandarizada con este reactivo para la R636 Unidad Por 0und/ul X 6000 und Reactivos SUB. INVESTIGA MISIONAL implementación de metodologías diagnósticas. Grupo Microbiologia 297 Enzima AscI New England Biolabs Técnica estandarizada con este reactivo para la R0558L Frasco Por 2.500U Reactivos SUB. INVESTIGA MISIONAL implementación de metodologías diagnósticas. Grupo Microbiologia Realizar 4 actividades de apoyo en las areas de Biologia Molecular, Chagas y PECIG (programa de erradicacion de cultivos ilicitos) a la Subdirección de Vigilancia y Control en S.P. para monitorear problemas de salud pública 2 Enzima de restriccion Bst EII from bacillus stearothermophilus ET solucion glicerol bufer acuosa Sigma Presenta una especificidad de corte del 00% La actividad de la enzima rompe por completo mg?dna en hora. a 60 R4253 Frasco Por 500 UN Reactivos SUB. INVESTIGA MISIONAL C en el buffer de incubación que viene en el kit. Grupo Micobacterias Enzima de restriccion PVU II Sigma Enzima de restricción Sma I Promega Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. 2 Enzima Taq polimerasa (Go Taq flexi DNA polymerase) Promega "Presenta una especificidad de corte del 00% y de nuevo recorte del 90%. Esta enzima presenta excelente actividad cuando se utiliza en condiciones de baja fuerza R-263 Frasco Por KU Reactivos SUB. INVESTIGA MISIONAL iónica, en altas concentraciones de la enzima, con una concentración de glicerol > 5%, o p Reactivo necesario para el desarrollo de técnicas de R-62 Frasco Por 000 unidades Reactivos SUB. INVESTIGA MISIONAL laboratorio Reactivo necesario para ensayos moleculares de M8295 Vial por 500 Unidades Reactivos SUB. INVESTIGA MISIONAL genotipificación Grupo Micobacterias Grupo Microbiologia 7 Biologia Celular Doce técnicas o metodologías de investigación adaptadas y estandarizadas en tecnicas moleculares, Histoquimicas, ultraestructurales y cromatograficas. 2 Enzima Taq polimerasa (Go Taq flexi DNA polymerase) Promega Necesarios para realizar las PCR para detección de M8295 Vial por 500 Unidades Reactivos SUB. INVESTIGA MISIONAL mutaciones Biologia Celular Enzima Taq polimerasa (Go Taq flexi DNA polymerase) Promega Reactivo necesario para la realización de ensayos M8295 Vial por 500 Unidades Reactivos SUB. INVESTIGA MISIONAL moleculares Biologia Celular Enzima Xbal Promega Reactivo estandarizado para la Vigilancia molecular de R-68 Frasco por 2000 Unidades Reactivos SUB. INVESTIGA MISIONAL bacterias causantes de EDA, ETA y Brotes Grupo Microbiologia Equipo para preparación y lisis celular. Precellys 24. Unidad Unidad Equipo de laboratorio SUB. INVESTIGA MISIONAL Grupo fisiolofia molecular 306 Espátula de acero inoxidable de laboratorio en acero, con /2?L cuchara final y / 4? L Cole-Palmer Planos fanales Necesario para el procesamiento de muestras de todos los CP Unidad Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL proyectos de investigacion Laboral 307 Espátula en Acero Inoxidable Un extremo plano cónico de /2? de largo y el otro extremo plano redondeado 3/2? de largo Cole-Palmer Necesario para el procesamiento de muestras de todos los proyectos de investigacion CP Paquete Paquete por 3 Elemento de laboratorio SUB. INVESTIGA MISIONAL Laboral Realizar 4 actividades de apoyo en las areas de Biologia Molecular, Chagas y PECIG (programa de erradicacion de cultivos ilicitos) a la Subdirección de Vigilancia y Control en S.P. para monitorear problemas de salud pública Espátula plana medidas de - ¼ "x L ¾" W. Cole Palmer divulgacion de resultados de proyectos de investigacion del Grupo de Micobacterias de la Subdireccion de Investigacion RZ Unidad Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Micobacterias 309 Estandar de mercurio AA: 000 ug/ml en 2-5% acido nítrico Accustandard Necesario para la determinación de mercurio del Grupo de Salud Ambiental de la Subdireccion de Investigacion AA34N- Frasco por 00 ml Reactivos SUB. INVESTIGA MISIONAL Laboral Realizar 4 actividades de apoyo en las areas de Biologia Molecular, Chagas y PECIG (programa de erradicacion de cultivos ilicitos) a la Subdirección de Vigilancia y Control en S.P. para monitorear problemas de salud pública Estreptavidina peroxidasa Roche reactivo especifico para revelar souter blot, concentracion de mu/ml que rinde mayor numeor de reaaciones Kit Unidad Reactivos SUB. INVESTIGA MISIONAL Grupo Micobacterias Doce técnicas o metodologías de investigación adaptadas y estandarizadas en tecnicas moleculares, Histoquimicas, ultraestructurales y 3 2 Estuche extracción DNA a partir de gel (QIAquick Gel Estraction kit 50) Millipore cromatograficas Estandarizar y transferir 2 metodologias de Biologia Molecular en marco de las medidas sanitarias y fitosanitarias Estuche extracción y purificación DNA Roche Necesaria para la realización extracción de los productos de PCR para enciar a secuenciar. Se eligió esta porque LSKGEL050 Kit por 50 reacciones Reactivos SUB. INVESTIGA MISIONAL este kit permite la extracción a partir de agarosa convencional. Reactivo usado para la implementación de metodologías Kit por 00 reacciones Reactivos SUB. INVESTIGA CONPES 3676 diagnósticas Biologia Celular 2 Grupo Microbiologia Este producto es 00% etanol y no ha sido desnaturalizado Realizar 4 actividades de apoyo en las areas de Biologia Molecular, Chagas y PECIG (programa de erradicacion de cultivos ilicitos) a la Subdirección de Vigilancia y Control en S.P. para monitorear problemas de salud pública 2 Etanol 200 Proof Sigma No presenta nucleasas ni trazas de otros elementos, lo cual E-7023 Frasco por 500 ml Reactivos SUB. INVESTIGA MISIONAL es ultrapuro para procedimientos moleculares, ademas se Grupo Micobacterias 2 han publicado 4 protocolos donde se referencia su uso Etanol Absoluto ACS Aldrich Reactivo necesario para procesamiento de las muestras y Frasco por 2000 ml Reactivos SUB. INVESTIGA MISIONAL realización de estudios en neurociencias Grupo Morfología Celular ETANOL ABSOLUTO PARA ANALISIS EMSURETM ACS,ISO,REAG. PH EUR Merck Se requiere para precipitación y lavado de ácids nucleicos Frasco Por 2.5 Litros Reactivos SUB. INVESTIGA MISIONAL necesario para el proceso de secuenciación. Grupo fisiolofia molecular ETANOL ABSOLUTO PARA ANALISIS. Botella Por 2.5 Litros Reactivos SUB. INVESTIGA MISIONAL Grupo Microbiologia ETANOL ABSOLUTO PARA ANALISIS. Botella Por 2.5 Litros Reactivos SUB. INVESTIGA MISIONAL Grupo Microbiologia 3 38 Etanol Absoluto Para Biología Molecular Frasco por 500 ml Reactivos SUB. INVESTIGA MISIONAL Grupo Parasitologia 39 2 Etilo acetato para análisis, Sigma Necesario para la determinacion de solventes del Grupo de Frasco por 4 litros Reactivos SUB. INVESTIGA MISIONAL Salud Ambiental de la Subdireccion de Investigacion Laboral Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 5000 Etiquetas adhesivas en policromia para residuos peligrosos infecciosos de 5x0 cm y para residuos químicos de 4x8 cm. Unidad Impresos y publicaciones SUB. INVESTIGA MISIONAL de Investigación 5000 Técnicas de biología molecular estandarizadas en el grupo para identificación bacteriana, seguimiento de patrones, 32 fenol equilibrado Sigma P-4557 Frasco por 00 ml Reactivos SUB. INVESTIGA MISIONAL epidemiologia molecular de patógenos de interés en salud pública Fenol liquido al 90% Frasco Por 250 ml Reactivos SUB. INVESTIGA MISIONAL El inhibidor de ARNasas de esta, es un inhibidor no competitivo de ARNasas que inhibe ARNasa A, B y C, Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. Fenol-cloroformo-alcohol isoamílico Grado Biología Molecular Sigma ademàs es purificado por cromatografia de afinidad, y su P Frasco por 400 ml Reactivos SUB. INVESTIGA MISIONAL efectividad ha sido garantizada en tècnicas como sintesis de cadn, RT-PCR; traducciòn y Grupo Parasitologia Grupo entomologia 2 Grupo Parasitologia

9 324 2 Ferrula grafito 0,4 mm 85/5% precond vespel Blister x 0 Paquete Por 0 Elemento de laboratorio SUB. INVESTIGA MISIONAL Laboral Ferrula grafito 0,5mm short Blister x 0 Paquete Por 0 Elemento de laboratorio SUB. INVESTIGA MISIONAL Laboral 2 Esta garantiza el cultivo de parásitos dado que son Filtro De 0,22 Um De 33 Mm de Diámetro Para Filtrar Con Jeringa, membrana de Millipore nitrocelulosa técnicas estandarizadas con esta de elemento y un punto crítico son los elementos para la recuperación y CAT-N SLHA033SS Caja Por 50 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL aislamiento de parásitos, para asegurar la reproducibilidad Grupo Parasitologia 2 de los procedimientos, d Estandarizar y transferir 2 metodologias de Biologia Molecular en marco de las medidas sanitarias y fitosanitarias FILTRO DE VENTEO PARA TANQUE DE ALMACENAMIENTO DE AGUA PURIFICADA, Millipore MARCA MILLIPORE. ref TANKMPK0 Elemento necesario para la Implementación de metodologías TANKMPK0 Unidad Unidad Reactivos SUB. INVESTIGA CONPES 3676 diagnósticas Grupo Microbiologia Filtros de membrana millipore en esteres de celulosa, 0.22 micras de tamaño de poro, 25 mm de diametro Millipore Los filtros de esta son necesarios para los procesos de filtración y esterilización de medios de cultivo y soluciones GSWPO2500 Caja Por 00 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL necesarias en cultivos celulares y biología molecular. Grupo fisiolofia molecular Filtros para maquina de hielo Scotsman Millipore estandarizadas y un punto crítico son los elementos con los que se trabaja en cada uno, para asegurar la reproducibilidad AFE400A Unidad de 5 micras Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Microbiologia 2 estandarizado Filtros para maquina de hielo Scotsman Millipore estandarizadas y un punto crítico son los elementos con los AFE400A Unidad de 25 micras Elemento de laboratorio SUB. INVESTIGA MISIONAL que se trabaja en cada uno, para asegurar la reproducibilidad Grupo Microbiologia 2 de los procedimientos Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 300 Folder celuguia tamaño carta horizontal con marbete Unidad Unidad Papeleria y elementos de oficina SUB. INVESTIGA MISIONAL de Investigación Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 300 Folder celuguia tamaño oficio horizontal con marbete Unidad Unidad Papeleria y elementos de oficina SUB. INVESTIGA MISIONAL de Investigación 300 Como todos los insumos de esta, estas cajas estan Frascos De Cultivo De 25 Cm/50 Ml Estériles, Greiner USA Scientific garantizadas como libres de ADNasas, ARNasas y pirogenos, condiciones necesarias requeridas para el Caja Por 200 Unidaes Elemento de laboratorio SUB. INVESTIGA MISIONAL mantenimiento de cultivos celulares y biología molecular en el Grupo fisiolofia molecular 2 laboratorio. Además, estas cajas pe Como todos los insumos de esta, estas cajas estan 334 Frascos De Cultivo De 75 Cm/250 Ml Estériles. USA Scientific garantizadas como libres de ADNasas, ARNasas y pirogenos, condiciones necesarias requeridas para el Caja Por 200 Unidaes Elemento de laboratorio SUB. INVESTIGA MISIONAL mantenimiento de cultivos celulares y biología molecular en el Grupo fisiolofia molecular laboratorio. Además, estas cajas pe FRASCOS DE ORINA Caja x ML Elemento de laboratorio SUB. INVESTIGA MISIONAL Laboral Frascos lavadores de 250 ml Paquete Por 250 ml Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo entomologia Frascos tapa rosca de capacidad de 50ml para recolección de orina Frasco Por 50 ml Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Parasitologia Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 7 Gárrafa plástica industrial de boca ancha con tapa rosca de seguridad de 30 litros para almacenamiento de los residuos peligrosos quimicos par Elementos Bioseguridad SUB. INVESTIGA MISIONAL de Investigación Gasa Absorbente Rollo por 90 yardas Elementos Bioseguridad SUB. INVESTIGA MISIONAL Grupo Parasitologia Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos Gases industriales Bala gases industriales SUB. INVESTIGA MISIONAL de Investigación Generador de Hidrogeno Cole Palmer Necesario para el desarrollo de proyectos de investigación del Grupo de Salud Ambiental de la Subdireccion de SN Unidad Unidad Equipo de laboratorio SUB. INVESTIGA MISIONAL Investigacion Laboral Gentamicina solución. Sigma que se trabaja en cada uno, para asegurar la reproducibilidad CAT. REF 272 Frasco por 0 ml Reactivos SUB. INVESTIGA MISIONAL Grupo Parasitologia Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos Gestiòn ambiental Unidad Otros SUB. INVESTIGA MISIONAL El estuche de purificación illustra? GFX? PCR DNA and Gel Band, está diseñado para realizar purificación de productos Gfx Pcr And Gel Band Purification x 00 Amersham - Biosciencies de amplificación por PCR a partir de geles de agarosa o de Kit Por 00 unidades Reactivos SUB. INVESTIGA MISIONAL fragmentos de DNA de tamaños entre 50 pb a 0 Kb, con un porcentaje de recuper Realizar 4 actividades de apoyo en las areas de Biologia Molecular, Chagas y PECIG (programa de erradicacion de cultivos ilicitos) a la Obtencion de material adecuado para proceseos de GFX Wizard PCR preps DNA purification system Promega A770 Kit Unidad Reactivos SUB. INVESTIGA MISIONAL Subdirección de Vigilancia y Control en S.P. para monitorear problemas de salud pública secuenciacion Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. 2 GLICERINA 87 % PARA ANALISIS REAG. PH EUR Frasco por litro Reactivos SUB. INVESTIGA MISIONAL Grupo fisiolofia molecular 4 Grupo Micobacterias 5 Biologia Celular Gradilla en acero inoxidable para almacenamiento de 2 cajas para crioviles Unidad Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo entomologia 348 Gradilla para tubos de centrifuga de 50 ml Tubo de tamaño: 50 ml Capacidad : 8 tubos Cole-Palmer Longitud 5-/2? Ancho de 3? Altura 3-/2 Necesario para el procesamiento de muestras de todos los CP Unidad Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL proyectos de investigacion Laboral Esta garantiza el cultivo de parásitos dado que son Gradillas para tubo tamaño mm capacidad 40 tubos dimensiones 293X 28X83 Fisher técnicas estandarizadas con esta de elemento y un punto crítico son los elementos para la recuperación y CAT. KHO Unidad De mm Elemento de laboratorio SUB. INVESTIGA MISIONAL aislamiento de parásitos, para asegurar la reproducibilidad Grupo Parasitologia 2 de los procedimientos, d Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. 8 Guanidina hidrocloride Invitrogen que se trabaja en cada uno, para asegurar la reproducibilidad Frasco Por 500 gramos Reactivos SUB. INVESTIGA MISIONAL Grupo Parasitologia Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 55 Guantes de cirugía estéril # 6 latex de caucho natural en empaque individual par Elementos Bioseguridad SUB. INVESTIGA MISIONAL de Investigación Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 50 Guantes de cirugía estéril # 8 latex de caucho natural en empaque individual par Elementos Bioseguridad SUB. INVESTIGA MISIONAL de Investigación Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 50 Guantes de cirugía estéril # 9 latex de caucho natural en empaque individual par Elementos Bioseguridad SUB. INVESTIGA MISIONAL de Investigación Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 3 Guantes de cirugia esteriles empacados individualmente talla 7 Paquete Por 50 unidades Elementos Bioseguridad SUB. INVESTIGA MISIONAL de Investigación Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 26 Guantes de uso doméstico calibre 35 Nº 9 hasta el codo par Equipos y suministros de aseo SUB. INVESTIGA MISIONAL Hepes? Reactivo Sigma Tampón para el proceso de transferencia durante el proceso H 4034 Unidad por 25 gramos Reactivos SUB. INVESTIGA MISIONAL de hibridización reversa Grupo Micobacterias High Pure PCR Template Preparation Kit Invitrogen que se trabaja en cada uno, para asegurar la reproducibilidad Kit por 00 muestras Reactivos SUB. INVESTIGA MISIONAL Grupo Parasitologia Hoja quirúrgica para bisturí, Grande Numero 22 Surgiase Necesarias para realizar extracción de ADN a apartir de muestras en papel filtro Caja Por 00 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Biologia Celular Realizar Veinte asesorías y capacitaciones sobre metodologia moleculares, y temas de nutricion, Parasitologia y Salud Ambiental y laboral que contribuyan a la actualización y generación del conocimiento del talento humano involucrado en las á Horno secado de material Unidad Unidad Equipo de Frio y Calor SUB. INVESTIGA MISIONAL Grupo Nutricion Con este lit se realizará la ción y detección de micro Human mirna Microarray Kit Release 6.0, 8x60K Agilen Technologies RNAs en cardiomiocitos aislados en condiciones de lesión y protección; para evaluar los genes regulados por el factor de G4870A Kit Reactivos SUB. INVESTIGA MISIONAL transcripción MITF y de genes diferencialmente expresados Grupo fisiolofia molecular 2 en condiciones Realizar 4 actividades de apoyo en las areas de Biologia Molecular, Chagas y PECIG (programa de erradicacion de cultivos ilicitos) a la Subdirección de Vigilancia y Control en S.P. para monitorear problemas de salud pública ICE PANS Cole Palmer divulgacion de resultados de proyectos de investigacion del Grupo de Micobacterias de la Subdireccion de Investigacion RZ Unidad Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Micobacterias Participar en eventos de divulgación sobre resultados de la investigación desarrollada. Impresos y publicaciones Unidad Impresos y publicaciones SUB. INVESTIGA MISIONAL Grupo Micobacterias 363 Impresos y publicaciones Unidad Impresos y publicaciones SUB. INVESTIGA MISIONAL Grupo Microbiologia Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos Impresos y publicaciones Unidad Impresos y publicaciones SUB. INVESTIGA MISIONAL

10 publicar y distribuir 4 numeros y un suplemento de la revista Biomédica a nivel nacional e internacional Impresos y publicaciones Unidad Impresos y publicaciones SUB. INVESTIGA MISIONAL 366 Impresos y publicaciones Unidad Impresos y publicaciones SUB. INVESTIGA MISIONAL Grupo Nutricion El inhibidor de ARNasas de esta, es un inhibidor no Inhibidor de RNasa 40U/µl Invitrogen Frasco Invitrogen competitivo de ARNasas que inhibe ARNasa A, B y C, ademàs es purificado por cromatografia de afinidad, y su Frasco por 500 reacciones Reactivos SUB. INVESTIGA MISIONAL efectividad ha sido garantizada en tècnicas como sintesis de Grupo fisiolofia molecular 3 cadn, RT-PCR; traducciòn y El vector pgemt Sistema II es ampliamente utilizado para la clonación de fragmentos provenientes de una amplificación Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. Inhibidor De Rnasa 40U/µl Invitrogen Frasco Invitrogen por PCR. Su uso se basa en la capacidad de la Taq ADN Frasco Reactivos SUB. INVESTIGA MISIONAL polimerasa de adicionar un nucleótido de adenina en los extremos 3 de los fragmento Iniciadores * 00nm F (30 pb de extensión )/ OLIGONUCLEÓTIDO DE 30 pb EN Insumo necesario para la implementación de metodologías Estandarizar y transferir 2 metodologias de Biologia Molecular en marco de las medidas sanitarias y fitosanitarias 48 Invitrogen 30 PB Vial Vial Reactivos SUB. INVESTIGA CONPES 3676 CONCENTRACION 00 nm (SINTETIZADO POR IDT) diagnósticas Iniciadores * 00nm F (30 pb de extensión )/ OLIGONUCLEÓTIDO DE 30 pb EN Insumo necesario para la implementación de metodologías 370 Invitrogen 30 PB Vial Vial Reactivos SUB. INVESTIGA MISIONAL CONCENTRACION 00 nm (SINTETIZADO POR IDT) diagnósticas Reactivo necesario para procesamiento de las muestras y Atender en promedio 3 solicitudes para desarrollo de pruebas de alta complejidad en Microscopia Electronica. Inmunoglobulina G anticonejo da con oro coloidal de 0nm Sigma G7402 Frasco Por 2 ml Reactivos SUB. INVESTIGA MISIONAL realización de estudios en neurociencias Reactivo necesario para procesamiento de las muestras y Atender en promedio 3 solicitudes para desarrollo de pruebas de alta complejidad en Microscopia Electronica. Inmunoglobulina G antiraton da con oro coloidal de 0nm Sigma G7652 Frasco Por 2 ml Reactivos SUB. INVESTIGA MISIONAL realización de estudios en neurociencias Insertos 250 ul en vidrio Paquete por 500 Unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Parasitologia Grupo Microbiologia 48 Grupo Microbiologia Grupo Morfología Celular Grupo Morfología Celular Laboral Contribuir a la formación de 30 profesionales o investigadores en salud y biomedicina. Insertos 250 ul, polipropileno Agilen Technologies Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. IPTG Invitrogen Doce técnicas o metodologías de investigación adaptadas y estandarizadas en tecnicas moleculares, Histoquimicas, ultraestructurales y 376 IPTG Invitrogen cromatograficas. Elemento necesario para la ejecución de los proyectos de Paquete Por 00 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL investigación PTG (isopropylthio-?-galactoside) es un inductor de la actividad del Gen la beta-galactosidasa en bacterias, que al Frasco Por gramo Reactivos SUB. INVESTIGA MISIONAL emplearlo junto con el X-Gal y antibioticos permite realizar la selecciòn de clonos recombinantes. Reactivo necesario para realizar ensayos moleculares en Frasco Por gramo Reactivos SUB. INVESTIGA MISIONAL procesos estandarizados Laboral Biologia Celular Biologia Celular PTG (isopropylthio-?-galactoside) es un inductor de la IPTG Invitrogen actividad del Gen la beta-galactosidasa en bacterias, que al Frasco Por gramo Reactivos SUB. INVESTIGA MISIONAL emplearlo junto con el X-Gal y antibioticos permite realizar la Biologia Celular 0 Grupo fisiolofia molecular 2 selecciòn de clonos recombinantes. Esta garantiza el cultivo de parásitos dado que son JERINGA ML CON AGUJA 29 X /2 Becton Dickinson técnicas estandarizadas con esta de elemento y un punto crítico son los elementos para la recuperación y aislamiento de parásitos, para asegurar la reproducibilidad Caja Por 00 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo entomologia 5 de los procedimientos Esta garantiza el cultivo de parásitos dado que son Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. 5 JERINGA ML CON AGUJA 29 X /2 Becton Dickinson técnicas estandarizadas con esta de elemento y un punto crítico son los elementos para la recuperación y Caja Por 00 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Parasitologia 5 aislamiento de parásitos, para asegurar la reproducibilidad de los procedimientos Esta garantiza el cultivo de parásitos dado que son 380 Jeringa 20 ml luer con aguja 2 x /2 ", de 2 partes, dimensiones de 20 cc. (por 80 Becton Dickinson unidades) técnicas estandarizadas con esta de elemento y un punto crítico son los elementos para la recuperación y S7563 Caja Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL aislamiento de parásitos, para asegurar la reproducibilidad Grupo Parasitologia de los procedimientos 38 4 Jeringa con aguja fina de 29por3 de 3 partes dimension Becton Dickinson Elemento necesario para procesamiento de las muestras y Caja Por 00 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL realización de estudios en neurociencias Grupo Morfología Celular 4 Esta garantiza el cultivo de parásitos dado que son Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. 0 jeringa hipodérmica cc con aguja 27 x /2 Becton Dickinson técnicas estandarizadas con esta de elemento y un punto crítico son los elementos para la recuperación y Caja Por 00 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Parasitologia 0 aislamiento de parásitos, para asegurar la reproducibilidad de los procedimientos Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. Juego de pipetas 5, 20, 200, 000 USA Scientific Unidad Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL que se trabaja en cada uno, para asegurar la reproducibilidad de los procedimientos Ketamina Frasco por 50 ml Frasco Por 50 ml Medicamento SUB. INVESTIGA MISIONAL Elemento necesario para procesamiento de las muestras y 385 Kit de disección Shandon Unidad Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL realización de estudios en neurociencias Necesario para el análisis molecular del proyecto. Se pide Kit de PCR en tiempo real Dynamo HS SYBR green q pcr Finzymes específicamente este kit por compatibilidad con el equipo que F-40-L Kit por 500 reacciones Reactivos SUB. INVESTIGA MISIONAL se va a usar. Grupo Parasitologia Grupo entomologia 0 Grupo Morfología Celular Biologia Celular 2 Grupo fisiolofia molecular Kit de viales preensamblados, cabeza de rosca, ámbar con zona de escritura Agilen Technologies Necesario para el procesamiento de muestras de todos los proyectos de investigacion Paquete Por 00 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Laboral 4 Estos reactivos son necesarios para realizar el proceso de Kit Para Secuenciacion En Ciclo: Bigdye Terminator V3. Cycle Sequencing Applied Biosystems secuenciación de ácidos nucleicos. Son compatibles con el Kit por 00 reacciones Reactivos SUB. INVESTIGA MISIONAL equipo disponible en el laboratorio. Técnica estandarizada con este reactivo para la 389 Lambda Ladder PFG marker New England Biolabs N0340S Vial Vial Reactivos SUB. INVESTIGA MISIONAL implementación de metodologías diagnósticas Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. 00 Laminillas De 22 X22 mm con un grosor de ( ). Caja Por 00 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo fisiolofia molecular 3 Grupo Microbiologia Grupo Parasitologia LEAD CARE II Test Reactivo (incluye controles) Por 48 test 48 test Reactivos SUB. INVESTIGA MISIONAL Laboral Estandarizar y transferir 2 metodologias de Biologia Molecular en marco de las medidas sanitarias y fitosanitarias 3 LightCycler 480 Multiwell Plate 96 Roche Reactivo usado para implementación de metodologías Caja Reactivos SUB. INVESTIGA CONPES 3676 diagnósticas Grupo Microbiologia Estandarizar y transferir 2 metodologias de Biologia Molecular en marco de las medidas sanitarias y fitosanitarias 6 LightCycler 480 Probes Master Roche Reactivo usado para la implementación de metodologías Estuche por 480 pruebas Reactivos SUB. INVESTIGA CONPES 3676 diagnósticas Grupo Microbiologia LightCycler 480 Probes Master Roche Reactivo utilizado para desarrollo de técnicas estandarizadas Estuche por 480 pruebas Reactivos SUB. INVESTIGA MISIONAL para el laboratorio Grupo Microbiologia Realizar Veinte asesorías y capacitaciones sobre metodologia moleculares, y temas de nutricion, Parasitologia y Salud Ambiental y laboral que contribuyan a la actualización y generación del conocimiento del talento humano involucrado en las á Locker de 2 Mts de alto por.3 Mts de ancho distribuido de la siguiente manera. 2 cajones de 65 cm de ancho con puertas cada uno de apertura frontal, y encima otros 2 cajones de 65 cm de ancho con puertas cada uno de apertura frontal. Unidad Unidad Muebles SUB. INVESTIGA MISIONAL Grupo Nutricion Realizar Veinte asesorías y capacitaciones sobre metodologia moleculares, y temas de nutricion, Parasitologia y Salud Ambiental y laboral que contribuyan a la actualización y generación del conocimiento del talento humano involucrado en las á mantenimiento Unidad Unidad Mantenimiento SUB. INVESTIGA MISIONAL Realizar Veinte asesorías y capacitaciones sobre metodologia moleculares, y temas de nutricion, Parasitologia y Salud Ambiental y laboral que contribuyan a la actualización y generación del conocimiento del talento humano involucrado en las á mantenimiento Unidad Unidad Mantenimiento SUB. INVESTIGA MISIONAL Grupo Nutricion Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos mantenimiento Unidad Unidad Mantenimiento SUB. INVESTIGA MISIONAL Laboral Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos mantenimiento Unidad Unidad Mantenimiento SUB. INVESTIGA MISIONAL Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos mantenimiento Unidad Unidad Mantenimiento SUB. INVESTIGA MISIONAL Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos mantenimiento Unidad Unidad Mantenimiento SUB. INVESTIGA MISIONAL Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos mantenimiento Unidad Unidad Mantenimiento SUB. INVESTIGA MISIONAL Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos mantenimiento Unidad Unidad Mantenimiento SUB. INVESTIGA MISIONAL Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos mantenimiento Unidad Unidad Mantenimiento SUB. INVESTIGA MISIONAL Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos mantenimiento Unidad Unidad Mantenimiento SUB. INVESTIGA MISIONAL Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos mantenimiento Unidad Unidad Mantenimiento SUB. INVESTIGA MISIONAL Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos mantenimiento Unidad Unidad Mantenimiento SUB. INVESTIGA MISIONAL Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos mantenimiento Unidad Unidad Mantenimiento SUB. INVESTIGA MISIONAL

11 Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos mantenimiento Unidad Unidad Mantenimiento SUB. INVESTIGA MISIONAL Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos mantenimiento Unidad Unidad Mantenimiento SUB. INVESTIGA MISIONAL Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos mantenimiento Unidad Unidad Mantenimiento SUB. INVESTIGA MISIONAL Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos mantenimiento Unidad Unidad Mantenimiento SUB. INVESTIGA MISIONAL Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos mantenimiento Unidad Unidad Mantenimiento SUB. INVESTIGA MISIONAL Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos mantenimiento Unidad Unidad Mantenimiento SUB. INVESTIGA MISIONAL Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos mantenimiento Unidad Unidad Mantenimiento SUB. INVESTIGA MISIONAL Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos mantenimiento Unidad Unidad Mantenimiento SUB. INVESTIGA MISIONAL Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos mantenimiento Unidad Unidad Mantenimiento SUB. INVESTIGA MISIONAL Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos mantenimiento Unidad Unidad Mantenimiento SUB. INVESTIGA MISIONAL 49 mantenimiento Unidad Unidad Mantenimiento SUB. INVESTIGA MISIONAL Grupo Nutricion 420 mantenimiento Unidad Unidad Mantenimiento SUB. INVESTIGA MISIONAL Grupo Nutricion Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos mantenimiento Unidad Unidad Mantenimiento SUB. INVESTIGA MISIONAL Doce técnicas o metodologías de investigación adaptadas y estandarizadas en tecnicas moleculares, Histoquimicas, ultraestructurales y cromatograficas. mantenimiento Unidad Unidad Mantenimiento SUB. INVESTIGA MISIONAL Grupo fisiolofia molecular 423 mantenimiento Unidad Unidad Mantenimiento SUB. INVESTIGA MISIONAL Laboral Doce técnicas o metodologías de investigación adaptadas y estandarizadas en tecnicas moleculares, Histoquimicas, ultraestructurales y cromatograficas. dor de peso Kb Promega Necesario para evidenciar el tamaño de los productos G-694 Unidad Unidad Reactivos SUB. INVESTIGA MISIONAL obtenidos por PCR y de los plámidos. Biologia Celular Doce técnicas o metodologías de investigación adaptadas y estandarizadas en tecnicas moleculares, Histoquimicas, ultraestructurales y cromatograficas. Marcador de peso de 00 pb GeneRuler 00 bp Plus DNA Ladder Promega Necesario para evidenciar el tamaño de los productos G20 Vial Por 00 unidades Reactivos SUB. INVESTIGA MISIONAL obtenidos por PCR Biologia Celular Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. 2 Marcador de peso de 00 pb GeneRuler 00 bp Plus DNA Ladder Promega que se trabaja en cada uno, para asegurar la reproducibilidad G20 Vial Por 00 unidades Reactivos SUB. INVESTIGA MISIONAL Grupo Parasitologia 2 Reactivo grado biología molecular necesario para Marcador de peso de 00 pb GeneRuler 00 bp Plus DNA Ladder Promega experimentos de separación de moléculas de DNA El dor de peso molecular de 00 pb de Promega, se ha G20A Vial Por 00 unidades Reactivos SUB. INVESTIGA MISIONAL venido empleando en el laboratorio de Fisiología molecular, Grupo fisiolofia molecular 2 tanto en electroforesis empleando geles Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. MARCADOR DE PESO DE 00 PB GENERULER 00 BP PLUS LADDER Promega que se trabaja en cada uno, para asegurar la reproducibilidad G20 Vial por 00 pruebas Reactivos SUB. INVESTIGA MISIONAL Grupo Parasitologia "Este dor está especialmente diseñado 429 Marcador de peso molecular 50 pb Reactivo Sigma para la determinación del tamaño de la PCR de fragmentos S-7025 Frasco por 50 ug Reactivos SUB. INVESTIGA MISIONAL de ADN generados y pueden utilizarse con cualquiera de Grupo Micobacterias agarosa o geles de poliacrilamida." Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. 3 Marcador para crioviales punta fina de diferentes colores, resistente a nitrogeno liquido y temperaturas de -96ºC Paquete por 4 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Parasitologia 3 Este dor está especialmente 43 dor peso molecular 00 pb Sigma diseñado para la determinación del tamaño de la PCR de P-473 Frasco Reactivos SUB. INVESTIGA MISIONAL fragmentos de ADN generados y pueden utilizarse con Grupo Micobacterias cualquiera de agarosa o geles de poliacrilamida. Reactivo grado biología molecular necesario para experimentos de separación de moléculas deproteínas El Marcador preteñido para proteínas: Bench Mark Pre-Stained protein ladder Invitrogen dor de peso molecular Benchmark de Invitorgen, se ha Vial por 250 umol Reactivos SUB. INVESTIGA MISIONAL venido empleando en el laboratorio de Fisiología molecular, en electroforesis en geles de Doce técnicas o metodologías de investigación adaptadas y estandarizadas en tecnicas moleculares, Histoquimicas, ultraestructurales y Marcador punta de diamante Unidad Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL cromatograficas. Implementación de metodologías diagnósticas del Grupo de 434 Medio de cultivo Fraser Reactivo Oxoid CM-895 Frasco Por 500 gramos Reactivos SUB. INVESTIGA MISIONAL Microbiologia de la Subdireccion de Investigacion El medio de cultivo OPTI-MEM producido exclusivamente por Invitrogen, es un medio versátil, químicamente definido y Medio De Cultivo Opti-Mem I Con Buffer Hepes, Bicarbonato De Sodio, Hipoxanthine R Gibco formulado para disminuir la cantidad de suero requerida Frasco por 500 ml Reactivos SUB. INVESTIGA MISIONAL rutinariamente para cultivar células de mamífero in vitro. Es un medio multipropósi Con el medio de la MPB se estandarizaron las Medio Eagle S Modificado Por Dulbecco S Con L-Glutamina, Con 4.5 G/L De Dextrosa, Sin MPB condiciones de cultivo celular de las lineas celulares de Caja Por 00 unidades Reactivos SUB. INVESTIGA MISIONAL Bicarbonato De Sodio melanoma membrana utilizada en la caracterizacion molecular de Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. 4 Membrana De Spoligotyping Isogen Isogen IM970 Paquete Elemento de laboratorio SUB. INVESTIGA MISIONAL M. tuberculosis y M. bovis 438 Membrana Hybond N 30 CM X 3 MTS Unidad Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL Necesarios para realizar ensayos moleculares de western 439 Membrana PVDF de 0,45 um. Rollo 26.5cms x 3,75m. Pierce 8858 Rollo Elemento de laboratorio SUB. INVESTIGA MISIONAL blot para pruebas de inmunodetección. Grupo fisiolofia molecular 5 Grupo Morfología Celular 2 Grupo Microbiologia Grupo fisiolofia molecular 2 Grupo fisiolofia molecular 4 Grupo Micobacterias 4 Grupo Micobacterias Biologia Celular Membranas PVDF tamaño de poro 0.2 um Invitrogen Estos elementos de laboratorio se necesitan para realizar los western blots y cuantificar los niveles relativos de exptesión LC2002 Caja Por 20 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL de proteínas. Grupo fisiolofia molecular Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos Mesa de Juntas 5 puestos Unidad Unidad Muebles SUB. INVESTIGA MISIONAL Grupo Parasitologia Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos Mesa de juntas de,20 x 3,00. Superficie en táblex, enchapada en fórmica, estructura metálica, sistema de conducción de cableado. Unidad Unidad Muebles SUB. INVESTIGA MISIONAL Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos Mesa en U. Medidas aproximadas de 3,60 x,50 elaborada en táblex enchapada en fórmica, estructura metálica. Unidad Unidad Muebles SUB. INVESTIGA MISIONAL 444 Micro espátula en acero inoxidable niquelado. Especificaciones: Con extremo tipo cuchara en plastisol. Cole-Palmer Necesario para el procesamiento de muestras de todos los proyectos de investigacion CP Paquete Paquete por 3 Elemento de laboratorio SUB. INVESTIGA MISIONAL Laboral Microtubos de 0,6 ml estériles Paquete Por 000 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Biologia Celular Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos Módulo de biblioteca de,4 x 2,20 de altura x 45 de fondo, estructura metálica y frentes en táblex enchapado en fórmica. Unidad Unidad Muebles SUB. INVESTIGA MISIONAL Realizar Veinte asesorías y capacitaciones sobre metodologia moleculares, y temas de nutricion, Parasitologia y Salud Ambiental y laboral que contribuyan a la actualización y generación del conocimiento del talento humano involucrado en las á 4 MODULO DE PRETRATAMIENTO QGARD,MARCA MILLIPORE, PARA EQUIPO MILLI- Q ACADEMIC ALIMENTADO CON AGUA DESTILADA O PURIFICADA POR OSMOSIS Millipore INVERSA. CONTIENE RESINAS DE INTERCAMBIO IONICO Y CARBON ACTIVADO. que se trabaja en cada uno, para asegurar la reproducibilidad QGARD00R Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Nutricion 4 estandarizado y validado Estandarizar y transferir 2 metodologias de Biologia Molecular en marco de las medidas sanitarias y fitosanitarias MODULO DE PURIFICACION PARA EQUIPO MILLI Q PLUS DE MILLIPORE. INCLUYE Millipore MILLIPAK. ref CPMQK05RE Elemento necesario para la implementación de metodologías CPMQK05RE Unidad Unidad Reactivos SUB. INVESTIGA CONPES 3676 diagnósticas Grupo Microbiologia 449 MODULO DE PURIFICACION PROGARD-2 PARA EQUIPO DE OSMOSIS INVERSA MARCA MILLIPORE TIPO MILLI RIOS, EL CUAL CONTIENE CARBON GRANULAR, Millipore PREFILTRO DE CARBON DE MICRA Y PREFILTRO EN POLIPROPILENO. ref. PROG00002 as pruebas moleculares cuentan con técnicas estandarizadas y un punto crítico son los reactivos con los que se trabaja en cada uno, para asegurar la reproducibilidad de los PROG0000 Unidad Unidad Reactivos SUB. INVESTIGA MISIONAL procedimientos, de cada ensayo de laboratorio estandarizado y validado Grupo Nutricion Realizar Veinte asesorías y capacitaciones sobre metodologia moleculares, y temas de nutricion, Parasitologia y Salud Ambiental y laboral que contribuyan a la actualización y generación del conocimiento del talento humano involucrado en las á 4 MODULO DE PURIFICACION PROGARD-2 PARA EQUIPO DE OSMOSIS INVERSA MARCA MILLIPORE TIPO MILLI RIOS, EL CUAL CONTIENE CARBON GRANULAR, Millipore PREFILTRO DE CARBON DE MICRA Y PREFILTRO EN POLIPROPILENO. ref. PROG00002 que se trabaja en cada uno, para asegurar la reproducibilidad PROG00002 Unidad Unidad Reactivos SUB. INVESTIGA MISIONAL estandarizado y validado Grupo Nutricion 4

12 45 Molde reutilizable (Plug) para CHEF Mapper System BIO-RAD Elemento se ajusta a otros elementos y equipos de la misma que se tienen en el laboratorio Unidad Unidad Reactivos SUB. INVESTIGA MISIONAL Grupo Microbiologia CONCURSO DE MERITOS Realizar Veinte asesorías y capacitaciones sobre metodologia moleculares, y temas de nutricion, Parasitologia y Salud Ambiental y laboral que contribuyan a la actualización y generación del conocimiento del talento humano involucrado en las á Mueble metálico con pintura electrostática con 2 aperturas de 60 cms de profunidad x 2Ms de frente en la base x mt de altura con puerta corrediza interna de visagra. Espacio libre de 30 cms. 2 aperturas a altura de,30 cms de Mt con 40 cms de profund Unidad Unidad Muebles SUB. INVESTIGA MISIONAL Grupo Nutricion Realizar Veinte asesorías y capacitaciones sobre metodologia moleculares, y temas de nutricion, Parasitologia y Salud Ambiental y laboral que contribuyan a la actualización y generación del conocimiento del talento humano involucrado en las á Mueble mixto vestir-archivador. Vestir de 25 cm de ancho por.05 Mts de alto con profundidad de 52 cm. Archivador distribuidor en 4 gavetas para carpetas legajadoras de 30 cm de ancho x 60 cm de alto y profundidad de 52 cm, las gavetas vienen distribuida Unidad Unidad Muebles SUB. INVESTIGA MISIONAL Grupo Nutricion Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos Mueble modular de,80 x 2,20 de alto x 45 de fondo, estructura metálica, frentes en tablex enchapado en fórmica. Unidad Unidad Muebles SUB. INVESTIGA MISIONAL 455 Mueble para lavamanos de altura de 79 cm y de ancho de 56 cm de dos puertas con dos entrepaños. Color BLANCO Unidad Unidad Muebles SUB. INVESTIGA MISIONAL Grupo Nutricion Muebles para lavamanos de altura de 79 cm y de ancho de 48.5 cm de dos puertas con dos entrepaños. Color BEIGE Unidad Unidad Muebles SUB. INVESTIGA MISIONAL de Investigación Multivitaminico para gallinas. Garrafa por 4 litros Medicamento SUB. INVESTIGA MISIONAL Grupo entomologia NaOH 5M para biologia molecular (SOlucion de cloruro de sodio). Sigma Reactivo necesario para Denaturación sonda. Técnica S-550 Frasco por litro Reactivos SUB. INVESTIGA MISIONAL estandarizada. Grupo Micobacterias Níquel / espátula de laboratorio de acero inoxidable, con ½? L en forma de V y final /? L Cole Palmer final con la punta doblada afilado. Necesario para el procesamiento de muestras de todos los CP Paquete de 3 Paquete por 3 Elemento de laboratorio SUB. INVESTIGA MISIONAL proyectos de investigacion Laboral "Reactivo necesario para procesamiento de las muestras y Doce técnicas o metodologías de investigación adaptadas y estandarizadas en tecnicas moleculares, Histoquimicas, ultraestructurales y cromatograficas. Nitrato de plata Ref: S857 MP Biomedicals MP Ampolla Por 00 gramos Reactivos SUB. INVESTIGA MISIONAL realización del estudio. Contrapartida Proyecto INS- Grupo Morfología Celular Colciencias" El primer oligo dt 2 a8 residuos, permite la hibridación de la 46 6 Oligo Dt 2-8 Primer. Invitrogen cola de poli-a de los ARNs mensajeros, durante el proceso de síntesis de cadn, con alta eficiencia. Este oligo dt, puede Vial por 25 ug Reactivos SUB. INVESTIGA MISIONAL usarse con cualquier transcriptasa reversa, a temperaturas Grupo fisiolofia molecular 6 iguales o oligonucleotidos de captura modificados con grupo amino en 5 Invitrogen Reactivo necesario para el desarrollo de la actividad diaria 924PB Unidad Unidad Reactivos SUB. INVESTIGA MISIONAL del laboratorio Grupo Micobacterias O-ring liner Blister Agilen Technologies Necesario para el procesamiento de muestras de todos los Unidad Por 0 Elemento de laboratorio SUB. INVESTIGA MISIONAL proyectos de investigacion Laboral Papel estericlin con fuelle e indicadores de 20x5x00 Rollo Por 00 mts Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo entomologia Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 30 Papel filtro Whatman diametro 24 cm Caja Por 00 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL de Investigación Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 500 Papel Fotocopia Oficio 75Gr Alta Blancura Unidad Papeleria y elementos de oficina SUB. INVESTIGA MISIONAL de Investigación Papel Glossy tamaño carta para impresión de fotografía digital Epson Elemento necesario para la divulgación y socialización de los resultados del proyecto. Contrapartida Proyecto INS- SO44 Paquete Por 20 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Colciencias Grupo Morfología Celular Paquete de baterias bomba ESCORT ELF Unidad Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL Laboral Paraformaldehído MPB Reactivo necesario para procesamiento de las muestras y realización del estudio. Contrapartida Proyecto INS- MP-5046 Frasco Por Kg Reactivos SUB. INVESTIGA MISIONAL Colciencias Grupo Morfología Celular Pares De Iniciadores IDT Unidad Unidad Reactivos SUB. INVESTIGA MISIONAL Grupo fisiolofia molecular Peinilla para Chef Mapper System peinilla, 5 pozos,.5 mm,2 cm BIO-RAD Elemento se ajusta a otros elementos y equipos de la misma Unidad Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL que se tienen en el laboratorio. Grupo Microbiologia Este antibiótico de la Invitrogen, esta garantizado para Penicilina Estreptomicina En Solución Sigma uso en Cultivos celulares, y lo hemos empleado con buenos P-4333 Frasco por 00 ml Reactivos SUB. INVESTIGA MISIONAL resultados para mantener los cultivos primarios y las Grupo fisiolofia molecular 3 diferentes lineas celulares libres de contaminantes Doce técnicas o metodologías de investigación adaptadas y estandarizadas en tecnicas moleculares, Histoquimicas, ultraestructurales y cromatograficas. 2 Peroxidasa vectastain ABC standart Kit Vector Reactivo necesario para procesamiento de las muestras y PK-4000 Kit Unidad Reactivos SUB. INVESTIGA MISIONAL realización de estudios en neurociencias Grupo Morfología Celular Doce técnicas o metodologías de investigación adaptadas y estandarizadas en tecnicas moleculares, Histoquimicas, ultraestructurales y cromatograficas. 2 Peroxidase substrate DAB kit. Vector Reactivo necesario para procesamiento de las muestras y SK-400 Unidad Unidad Reactivos SUB. INVESTIGA MISIONAL realización de estudios en neurociencias Grupo Morfología Celular Realizar 4 actividades de apoyo en las areas de Biologia Molecular, Chagas y PECIG (programa de erradicacion de cultivos ilicitos) a la Subdirección de Vigilancia y Control en S.P. para monitorear problemas de salud pública Personal microcentrifugue que incluya rotor para tubos de,5 a 2 ml y para tubos de PCR. Cole Palmer divulgacion de resultados de proyectos de investigacion del RZ Unidad Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo de Micobacterias de la Subdireccion de Investigacion Grupo Micobacterias Doce técnicas o metodologías de investigación adaptadas y estandarizadas en tecnicas moleculares, Histoquimicas, ultraestructurales y cromatograficas. Pfu DNA polymerase Promega Necesario para PCR que requieran sintesis de alta fidelidad M7745 Por 500 Unidades Reactivos SUB. INVESTIGA MISIONAL pues este producto de PCR se va a secuenciar Biologia Celular Doce técnicas o metodologías de investigación adaptadas y estandarizadas en tecnicas moleculares, Histoquimicas, ultraestructurales y cromatograficas. pgem-t vector system II con células termocompetentes JM09 Promega Necesario para la clonación de productos de PCR y la A-360 Kit Por 20 reacciones Reactivos SUB. INVESTIGA MISIONAL obtención de una cantidad adecuada Biologia Celular El vector pgemt Sistema II es ampliamente utilizado para la pgem-t vector system II con células termocompetentes JM09 Promega clonación de fragmentos provenientes de una amplificación por PCR. Su uso se basa en la capacidad de la Taq ADN A-3600 Kit Por 20 reacciones Reactivos SUB. INVESTIGA MISIONAL polimerasa de adicionar un nucleótido de adenina en los Grupo fisiolofia molecular 3 extremos 3? de los fragment Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. pgem-t vector system II con células termocompetentes JM09 Promega que se trabaja en cada uno, para asegurar la reproducibilidad A-360 Kit Por 20 reacciones Reactivos SUB. INVESTIGA MISIONAL Pilas LS 4250; 3.6V Li-SOCl2 Unidad Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL 48 6 Pinzas entomológicas punta fina para trabajo delicado y preciso, longitud de 4 /4" Unidad Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL Pipetas Plásticas De 0 Ml, Caja Por 200 Unidaes Elemento de laboratorio SUB. INVESTIGA MISIONAL Pipetas Plásticas De 5 Ml, Caja Por 200 Unidaes Elemento de laboratorio SUB. INVESTIGA MISIONAL Pipetas serólogicas plásticas, desechables, estériles, individualmente empacadas, no 484 Caja por 500 Unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL pirógenas 0mL Pipetas serólogicas plásticas, desechables, estériles, individualmente empacadas, no 485 Caja por 500 Unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL pirógenas 5mL Esta garantiza las pruebas de susceptibilidad dado que son técnicas estandarizadas con esta de elemento, Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. 2 Pirimetamina Reactivo Sigma para asegurar la reproducibilidad de los procedimientos, de Frasco por 250 mg Reactivos SUB. INVESTIGA MISIONAL cada ensayo de laboratorio estandarizado y la viabilidad de éstos y que son u Grupo Parasitologia Grupo entomologia 5 Grupo entomologia 6 Grupo fisiolofia molecular 5 Grupo fisiolofia molecular 5 Grupo Parasitologia Grupo Parasitologia Grupo Parasitologia 2 El nitrato de plata es una sal inorgánica, que se emplea junto 487 plata nitrato para analisis. Sigma con otras sales para tinción de ácidos nucleicos y proteínas, fraccionadas en geles de poliacrilamida. En el laboratorio S6506 Frasco por 25 gramos Reactivos SUB. INVESTIGA MISIONAL tenemos estandarizada esta tinción empleando el reactivo de Grupo fisiolofia molecular sigma Técnica estandarizada para Realizar la PCR IS60 como Platinum Taq PCR DNA Polimerase Invitrogen ayuda diagnostica de tuberculosis extrapulmonar a las Vial Por 250 racciones Reactivos SUB. INVESTIGA MISIONAL instituciones de salud que lo requieran.apoyar al Sistema de Grupo Micobacterias 3 Salud del pais en el diagnostico molecular de Micobacterias Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. 3 Platinum Taq PCR DNA Polimerase Invitrogen que se trabaja en cada uno, para asegurar la reproducibilidad Vial Por 250 racciones Reactivos SUB. INVESTIGA MISIONAL Grupo Parasitologia 3 Los platos de cultivo celular USA Scientific, están Platos Multipozo Para Cultivo De 24 Pozos Con Tapa. Libres De Rnasa, Dnasa, Pirógenos, Estériles., fondo plano USA Scientific garantizados para cultivo celular. Además están certificados como libres de ADNasas, RNasas, pirógenos, características Caja Por 00 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL que deben ser mantenidas para este tipo de procesos. En el Grupo fisiolofia molecular 2 laboratorio hemos optimi Los platos de cultivo celular USA Scientific, están 49 2 Platos Multipozo Para Cultivo De 48 Pozos Con Tapa. Libres De Rnasa, Dnasa, Pirógenos, Estériles. USA Scientific garantizados para cultivo celular. Además están certificados como libres de ADNasas, RNasas, pirógenos, características Caja Por 00 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL que deben ser mantenidas para este tipo de procesos. En el Grupo fisiolofia molecular 2 laboratorio hemos optimi Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos Poltrona. Estructura fabricada en madera debidamente resortada, abullonadas en caucho espuma Unidad Unidad Muebles SUB. INVESTIGA MISIONAL 493 POP-6 Polymer for the 30 Genetic Analyzer Applied Biosystems Estos reactivos son necesarios para realizar el proceso de secuenciación de ácidos nucleicos. Son compatibles con el Frasco Por 3 ml Reactivos SUB. INVESTIGA MISIONAL equipo disponible en el laboratorio. Grupo fisiolofia molecular Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. POP-6 Polymer for the 30 Genetic Analyzer Applied Biosystems que se trabaja en cada uno, para asegurar la reproducibilidad Frasco Por 3 ml Reactivos SUB. INVESTIGA MISIONAL Grupo Parasitologia

13 495 Potenciometro para mediciòn de ph/mv/temperatura Hach Prefiltro carbon activado de 0" 20 micras Código F Millipore Estandarizar y transferir 2 metodologias de Biologia Molecular en marco de las medidas sanitarias y fitosanitarias 4 Prefiltro de Carbón Activado Granular, Codigo F 20 Micras de Poro Millipore Elemento necesario para procesamiento de las muestras y LPV 2 4T Unidad Unidad Equipo de laboratorio SUB. INVESTIGA MISIONAL realización de estudios en neurociencias que se trabaja en cada uno, para asegurar la reproducibilidad CDFCF020 Unidad Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL estandarizado y validado Reactivo usado para la implementación de metodologías CDFCF020 Unidad Unidad Elemento de laboratorio SUB. INVESTIGA CONPES 3676 diagnósticas Grupo Morfología Celular Laboral 5 Grupo Microbiologia Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos Prestacion del servicio de aseo y ruta sanitaria. Servicio de Aseo SUB. INVESTIGA MISIONAL Primer - Reactivo Invitrogen que se trabaja en cada uno, para asegurar la reproducibilidad 25 NMOLES. PEDIR SECUENCIA paral COORDINADOR escala 200 Reactivos SUB. INVESTIGA MISIONAL Grupo Parasitologia Primers de 24 bases cada uno, en escala de 00 nmoles y libres de sal. IDT - OLIGO Primers Por 24 bases Reactivos SUB. INVESTIGA MISIONAL Biologia Celular Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. 0 Primers de 24 bases cada uno, en escala de 00 nmoles y libres de sal. IDT OLIGO Primers Por 24 bases Reactivos SUB. INVESTIGA MISIONAL Biologia Celular primers Escala 200 nm Invitrogen Proceso adecuado de desalinisacion que aumenta la especificidad de la reacción INVITROGEN Frasco Reactivos SUB. INVESTIGA MISIONAL Grupo Micobacterias Primers para ITS2 (ATCACTCGGCTCGTGGATCG) en concentracion de 00 nmolx 20 bp. Invitrogen que se trabaja en cada uno, para asegurar la reproducibilidad PRIMER CRUZI; PRIMER CRUZI2; Vial PRIMER 2; PRIMER 22; PRIMER PC03; VialPRIMER PC04; PEDIR SECUENCIA Reactivos AL COORDINADOR SUB. INVESTIGA MISIONAL Grupo Parasitologia Protease de streptomyces griseus. > o = a 3.5 unidades / mg solido, bioreagent,polvo, apto Sigma para cultivo de celulas de embrion de raton, > o =3,5 unidades /mg de solidos. Reactivo grado cultivo celular necesario para aislamiento de celulas cardiacas por procedimiento estandarizado en e el Lab de Fisiología Molecular P-88 Frasco por 00 mg Reactivos SUB. INVESTIGA MISIONAL Grupo fisiolofia molecular proteinasa k Promega Reactivo estandarizado para el Desarrollo de técnicas de laboratorio V-302 Frasco por 00 mg Reactivos SUB. INVESTIGA MISIONAL Grupo Microbiologia 3 El inhibidor de ARNasas de esta, es un inhibidor no Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. proteinasa k Sigma competitivo de ARNasas que inhibe ARNasa A, B y C, ademàs es purificado por cromatografia de afinidad, y su P2308-0MG Frasco por 00 mg Reactivos SUB. INVESTIGA MISIONAL Grupo Parasitologia efectividad ha sido garantizada en tècnicas como sintesis de cadn, RT-PCR; traducciòn y Esta enzima la empleamos rutinariamente en el proceso de Proteinasa K Ref. V-302 Invitrogen Unidad Invitrogen disociaciòn enzimàtica para aislar cèlulas cardiacas. Con la enzima de esta se estandarizó el proceso de Unidad por 00 mg Reactivos SUB. INVESTIGA MISIONAL disociación de células y tejidos y obtención de células Grupo fisiolofia molecular 4 cardiacas aisladas de alta pur Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos Publicacion en diarios Unidad Impresos y publicaciones SUB. INVESTIGA MISIONAL Realizar Veinte asesorías y capacitaciones sobre metodologia moleculares, y temas de nutricion, Parasitologia y Salud Ambiental y laboral que contribuyan a la actualización y generación del conocimiento del talento humano involucrado en las á Puerta de corredera de.30 mts x 2.20 mts, en aluminio proyectante Unidad Unidad Muebles SUB. INVESTIGA MISIONAL Grupo Nutricion Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos Puesto en U de,80 x,80 x 2,20, mueble tipo biblioteca en su parte posterior, vidrio templado Unidad Unidad Muebles SUB. INVESTIGA MISIONAL Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos 5 Puesto operativo. Medidas de,35 x,35, con archivador tipo 2x, apoyos metálicos. Unidad Unidad Muebles SUB. INVESTIGA MISIONAL de Investigación Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos 2 Puestos operativos y asesores con almacenamiento Unidad Unidad Muebles SUB. INVESTIGA MISIONAL Grupo Parasitologia 2 53 Puntas 0,-0ul con filtro en bolsa de 000 puntas. Libres de DNAsa y RNAsa USA Scientific que se trabaja en cada uno, para asegurar la reproducibilidad Bolsa Por 000 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Parasitologia 54 Puntas -50 con filtro USA Scientific que se trabaja en cada uno, para asegurar la reproducibilidad Caja por 960 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Parasitologia Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. Puntas -50 con filtro USA Scientific que se trabaja en cada uno, para asegurar la reproducibilidad Caja por 960 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Parasitologia Esta garantiza el cultivo de parásitos dado que son 56 9 Puntas amarillas estandar -200 ul certificadas libres de DNA-Rnase, DNA, pirógenos, libre de nucleasa grado biología molecular USA Scientific técnicas estandarizadas con esta de elemento y un punto crítico son los elementos para la recuperación y Paquete Por 000 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL aislamiento de parásitos, para asegurar la reproducibilidad Grupo Microbiologia 9 de los procedimientos Esta garantiza el cultivo de parásitos dado que son Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. 0 Puntas amarillas estandar -200 ul certificadas libres de DNA-Rnase, DNA, pirógenos, libre de nucleasa grado biología molecular USA Scientific técnicas estandarizadas con esta de elemento y un punto crítico son los elementos para la recuperación y Paquete Por 000 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL aislamiento de parásitos, para asegurar la reproducibilidad Grupo Parasitologia 0 de los procedimientos Puntas adaptables a micropipetas de cualquier ; son Puntas amarillas estandar -200 ul certificadas libres de DNA-Rnase, DNA, pirógenos, libre USA Scientific de nucleasa grado biología molecular más economicas que puntas de su misma clase pero tienen la ventaja de tener presentación en bolsa de seguridad, lo que Paquete Por 000 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL garantiza su esterilidad. Por venir en bolsas, estas puntas se Grupo fisiolofia molecular 20 Grupo Microbiologia 0 pueden incluir e Los insumos de esta están certificados para uso en 59 0 Puntas Azules de 0, 000 ul graduadas, puntas en bolsa de seguridad por 000 unidades, certificadas libres DNAs, Rnas. DNA Pirógenos libres de nucleasa grado biología USA Scientific molecular. Biología Molecular, garantizados como libres de ADNasas, RNasas, pirógenos, características necesarias para trabajar -202 Paquete Por 000 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL en Biología Molecular y cultivos celulares, entre otros. Estas Grupo fisiolofia molecular 0 puntas las emplea Puntas Azules de 0, 000 ul graduadas, puntas en bolsa de seguridad por Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. unidades, certificadas libres DNAs, Rnas. DNA Pirógenos libres de nucleasa grado biología USA Scientific molecular. Puntas Azules de 0, 000 ul graduadas, puntas en bolsa de seguridad por unidades, certificadas libres DNAs, Rnas. DNA Pirógenos libres de nucleasa grado biología USA Scientific molecular Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. Puntas azules para micropipeta de ul Axigen Esta garantiza el cultivo de parásitos dado que son técnicas estandarizadas con esta de elemento y un punto crítico son los elementos para la recuperación y -202 Paquete Por 000 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL aislamiento de parásitos, para asegurar la reproducibilidad de los procedimientos Estas puntas se ajustan a las pipetas con que cuenta el laboratorio. Además son libres de Dnase, Rnase, Pirógenos -202 Paquete Por 000 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL indispensable para los procedimientos. Elemento necesario para realizar ensayos moleculares por T-000B Bolsa Por 000 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL PCR. Grupo Parasitologia Grupo Microbiologia 5 Biologia Celular Puntas adaptables a micropipetas de cualquier ; son Puntas Blancas Standard de ul, punta corta Puntas en bolsa de seguridad USA Scientific certificadas libres DNAse, Rnase, DNA Pirógenos, nucleasas grado biología molecular más economicas que puntas de su misma clase pero tienen la ventaja de tener presentación en bolsa de seguridad, lo que Paquete Por 000 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL garantiza su esterilidad. Por venir en bolsas, estas puntas se Grupo fisiolofia molecular 0 Grupo Microbiologia 6 pueden incluir e Esta garantiza el cultivo de parásitos dado que son Puntas blancas de ul punta fina, genéricas, sirven para pipetas eppendorf y los racks USA Scientific de laboratorio CERTIFICADAS libres de Dnase, Rnase, DNA, pirogenos técnicas estandarizadas con esta de elemento y un punto crítico son los elementos para la recuperación y Bolsa Por 000 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL aislamiento de parásitos, para asegurar la reproducibilidad Grupo Microbiologia 5 de los procedimientos 525 Puntas con barrera antiaerosol libres de DNasa y Rnasa 000u. USA Scientific que se trabaja en cada uno, para asegurar la reproducibilidad Caja Por 0 raks Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Parasitologia Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. Puntas con barrera antiaerosol libres de DNasa y Rnasa 000u. USA Scientific Estandarizar y transferir 2 metodologias de Biologia Molecular en marco de las medidas sanitarias y fitosanitarias 4 Puntas con filtro de ul USA Scientific Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. Puntas con filtro de ul USA Scientific 529 Puntas con filtro de 0 ul (punta larga) QSP Puntas con filtro de ul en rack, caja de 0 rack por 96 certificadas, libres de 530 USA Scientific DNAse, RNAse, DNA, pirógenos Puntas con filtro de ul en rack, caja de 0 rack por 96 certificadas, libres de Estandarizar y transferir 2 metodologias de Biologia Molecular en marco de las medidas sanitarias y fitosanitarias 4 USA Scientific DNAse, RNAse, DNA, pirógenos Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. Puntas de 0,-0µL certificadas, libre DNAse, Rnase, DNA, Pirogenos caja por 0 racks USA Scientific que se trabaja en cada uno, para asegurar la reproducibilidad Caja Por 0 raks Elemento de laboratorio SUB. INVESTIGA MISIONAL Estos insumos garantizan la calidad en los procedimientos de diagnóstico molecular estandarizados bajo lineamiento Caja por 960 unidades Elemento de laboratorio SUB. INVESTIGA CONPES 3676 internacional Estos insumos garantizan la calidad en los procedimientos de diagnóstico molecular estandarizados bajo lineamiento Caja por 960 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL internacional Necesarias para realizar ensayos moleculares en el grupo de FA08-0 Paquete por 960 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Morfologia del Instituto Nacional de Salud Caja Por 0 raks Elemento de laboratorio SUB. INVESTIGA MISIONAL que se trabaja en cada uno, para asegurar la reproducibilidad de los procedimientos Estos insumos garantizan la calidad en los procedimientos de diagnóstico molecular estandarizados bajo lineamiento Caja Por 0 raks Elemento de laboratorio SUB. INVESTIGA CONPES 3676 internacional Estas puntas se ajustan a las pipetas con que cuenta el laboratorio. Además son libres de Dnase, Rnase, Pirógenos Caja Por 96 Unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL indispensable para los procedimientos. Grupo Parasitologia Grupo Microbiologia 4 Grupo Parasitologia Biologia Celular Grupo Microbiologia Grupo Microbiologia 4 Biologia Celular

14 533 Puntas de 00 ul con filtro USA Scientific que se trabaja en cada uno, para asegurar la reproducibilidad Caja por 960 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Parasitologia Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. Puntas de 00 ul con filtro USA Scientific que se trabaja en cada uno, para asegurar la reproducibilidad Caja por 960 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Parasitologia Puntas de -00 ul con filtro, estériles en Racks, certificadas, libre DNASE, Rnase, DNA, USA Scientific Pirogenos. Puntas de -200 ul con filtro, estériles en Racks, certificadas, libre DNASE, Rnase, DNA, USA Scientific Pirogenos Ref USA Scientific Caja Por 0 raks Puntas de -200 ul con filtro, estériles en Racks, certificadas, libre DNASE, Rnase, DNA, Estandarizar y transferir 2 metodologias de Biologia Molecular en marco de las medidas sanitarias y fitosanitarias 2 USA Scientific Pirogenos Ref USA Scientific Caja Por 0 raks Puntas Estériles Con Filtro, Libre De Dnasa Y Rnasa 0.-0µl estériles en Racks, Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. 2 USA Scientific certificadas, libre DNASE, Rnase, DNA, Pirogenos Puntas Estériles Con Filtro, Libre De Dnasa Y Rnasa 0.-0µl estériles en Racks, 539 USA Scientific certificadas, libre DNASE, Rnase, DNA, Pirogenos Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. Puntas Plásticas Amarillas De -200 Ul Axigen que se trabaja en cada uno, para asegurar la reproducibilidad de los procedimientos que se trabaja en cada uno, para asegurar la reproducibilidad de los procedimientos Estos insumos garantizan la calidad en los procedimientos de diagnóstico molecular estandarizados bajo lineamiento internacional Estas puntas se ajustan a las pipetas con que cuenta el laboratorio. Además son libres de Dnase, Rnase, Pirógenos indispensable para los procedimientos. que se trabaja en cada uno, para asegurar la reproducibilidad de los procedimientos Elementos necesarios para realizar ensayos moleculares por PCR. Caja Por 96 Unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Caja Por 96 Unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Caja Por 96 Unidades Elemento de laboratorio SUB. INVESTIGA CONPES 3676 PUNTA EXTENDIDA A-0UL Caja Por 96 Unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Caja Por 96 Unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL TR-222-Y Paquete Por 000 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Microbiologia 4 Grupo Microbiologia Grupo Parasitologia 2 Grupo Microbiologia 2 Biologia Celular 2 Grupo Microbiologia Biologia Celular 54 Puntas sin filtro 0 ul Axigen Elemento necesario para realizar ensayos moleculares por PCR. T-300 Paquete Por 000 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Biologia Celular 542 QIAamp DNA Stool Qiagen Reactivo utilizado para desarrollo de técnicas estandarizadas 5504 Kit por 50 reacciones Reactivos SUB. INVESTIGA MISIONAL para el laboratorio Grupo Microbiologia Estandarizar y transferir 2 metodologias de Biologia Molecular en marco de las medidas sanitarias y fitosanitarias 6 QIAamp DNA Stool Qiagen Reactivo estandarizado para la Implementación de 5504 Kit por 50 reacciones Reactivos SUB. INVESTIGA CONPES 3676 metodologías diagnósticas Grupo Microbiologia Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. 2 QIAamp MinElute Virus Spin kit (50) Ref Qiagen que se trabaja en cada uno, para asegurar la reproducibilidad 5504 Estuche Por 50 unidades Reactivos SUB. INVESTIGA MISIONAL Grupo Parasitologia QIAquick Gel Extraction Kit (250) Cat. No Qiagen Reactivo necesario para la Implementación de metodologías Estuche Por 250 racciones Reactivos SUB. INVESTIGA MISIONAL diagnósticas Grupo Microbiologia Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 4 Radio teléfono portátil motorola EP50, incluye antena, bateria, cargador y click porta radio Unidad Elementos Bioseguridad SUB. INVESTIGA MISIONAL de Investigación rat cardiac myocyte basal medium Lonza Medio de cultivo necesario para celulas cardiacas de rata CC-3275 Frasco Por 200 ml Reactivos SUB. INVESTIGA MISIONAL 548 Rat cardiac Myocyte Growth Medium SQ. Lonza Medio de cultivo necesario para celulas cardiacas de rata CC-456 Kit Unidad Reactivos SUB. INVESTIGA MISIONAL 549 Rat Cardiac Myocytes Growth Med Bul kit. Lonza Medio de cultivo necesario para celulas cardiacas de rata CC-455 Kit Unidad Reactivos SUB. INVESTIGA MISIONAL Estandarizar y transferir 2 metodologias de Biologia Molecular en marco de las medidas sanitarias y fitosanitarias 4 Reacción de secuenciación Kit Reactivos SUB. INVESTIGA CONPES 3676 Grupo fisiolofia molecular 3 Grupo fisiolofia molecular Grupo fisiolofia molecular Grupo Microbiologia Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos Recepción. Puesto de,70 x,50 elaborada en tablex y enchapada en fórmica de distintos calibres, archivador tipo 2 x. Unidad Unidad Muebles SUB. INVESTIGA MISIONAL 552 Restr. endunucl. Bln I 000 es Roche Reactivo necesario para la Vigilancia molecular de bacterias Frasco Por 000 unidades Reactivos SUB. INVESTIGA MISIONAL causantes de EDA, ETA y Brotes Grupo Microbiologia Realizar 4 actividades de apoyo en las areas de Biologia Molecular, Chagas y PECIG (programa de erradicacion de cultivos ilicitos) a la Subdirección de Vigilancia y Control en S.P. para monitorear problemas de salud pública REVERSIBLE MICROCENTrifugue tube racks Cole Palmer divulgacion de resultados de proyectos de investigacion del RZ Kit Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo de Micobacterias de la Subdireccion de Investigacion Grupo Micobacterias Rollo de papel Parafilm M impermeable, pelicula a prueba de humedad que previene la evaporación de la muestra, contaminación rollo de 0 Cm De Ancho. Rollo por 38 mts Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo entomologia 6 Grupo Morfología Celular Doce técnicas o metodologías de investigación adaptadas y estandarizadas en tecnicas moleculares, Histoquimicas, ultraestructurales y cromatograficas. 2 Rotulador portaobjetos Unidad Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Morfología Celular 2 Con la sal de tetrazolium (MTT) se estandarizaron y 556 sal de tetrazolium ( MTT) Sigma optimizaron los ensayos de viabilidad celular mediante la M-5655 Frasco Por gramo Reactivos SUB. INVESTIGA MISIONAL medición de la actividad metabólica del MTT, tanto en células Grupo fisiolofia molecular de melanoma como en células cardiacas. 557 SARCOSNA N-LAURYL BioXtra > 0 ) a 97% (TLC) Sigma Reactivo estandarizado para la Vigilancia molecular de L-5777 Frasco Por 00 gramos Reactivos SUB. INVESTIGA MISIONAL bacterias causantes de EDA, ETA y Brotes Grupo Microbiologia Screw top vial, write on spot Agilen Technologies Necesario para el procesamiento de muestras de todos los Paquete Por 00 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL proyectos de investigacion Laboral Contribuir a la formación de 30 profesionales o investigadores en salud y biomedicina. 7 Screw top vial, write on spot Agilen Technologies Elemento necesario para la ejecución de los proyectos de investigación Paquete Por 00 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Laboral Realizar 4 actividades de apoyo en las areas de Biologia Molecular, Chagas y PECIG (programa de erradicacion de cultivos ilicitos) a la Subdirección de Vigilancia y Control en S.P. para monitorear problemas de salud pública 7 Sds - Sodio dodecil sulfato solución, biologia molecular, 0 en agua 8 megaohmio. Sigma reactivo altamente puro grado biologia molecular para L-4522 Frasco por 00 ml Reactivos SUB. INVESTIGA MISIONAL extraccion de ADN Grupo Micobacterias 7 56 SELENITO CISTINA CALDO? DIFCO Becton Dickinson Reactivo necesario para la implementación de metodologías Frasco Por 500 gramos Reactivos SUB. INVESTIGA MISIONAL diagnósticas Grupo Microbiologia 562 Septa Bleed /Temp optimized non-stick Blister Agilen Technologies Necesario para el procesamiento de muestras de todos los Paquete Por 50 Elemento de laboratorio SUB. INVESTIGA MISIONAL proyectos de investigacion Laboral Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos Servicio de correo puerta a puerta Unidad Correo SUB. INVESTIGA MISIONAL publicar y distribuir 4 numeros y un suplemento de la revista Biomédica a nivel nacional e internacional Servicio de correo puerta a puerta Unidad Correo SUB. INVESTIGA MISIONAL Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos Servicio de Fotocopias Unidad Fotocopias SUB. INVESTIGA MISIONAL publicar y distribuir 4 numeros y un suplemento de la revista Biomédica a nivel nacional e internacional Servicio de hosting y dominio Unidad Equipo y suministros de sistemas SUB. INVESTIGA MISIONAL Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos Servicio de lavanderia Unidad Servicio de Lavanderia SUB. INVESTIGA MISIONAL 568 Servicio de traducción Unidad Servicios personales SUB. INVESTIGA MISIONAL Laboral Someter 4 manuscritos para publicación en revistas indexadas y no indexadas. Servicio de traducción Unidad Servicios personales SUB. INVESTIGA MISIONAL Biologia Celular publicar y distribuir 4 numeros y un suplemento de la revista Biomédica a nivel nacional e internacional Servicio de traducción Unidad Servicios personales SUB. INVESTIGA MISIONAL Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos Servicio de transporte de Muestras Unidad Correo SUB. INVESTIGA MISIONAL 572 servicio de transporte de personas Unidad Unidad Servicio de Transporte SUB. INVESTIGA MISIONAL Laboral 573 Set de 3 cucharas doble en acero inoxidable Cole Palmer Necesario para el procesamiento de muestras de todos los CP Unidad Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL proyectos de investigacion Laboral 574 Set de masas de precisión para calibración. Cole Palmer Necesario para el procesamiento de muestras de todos los SN Unidad Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL proyectos de investigacion Laboral Set de Vidrios para cámara de electroforesis MiniProtean II BIO-RAD Estos elementos de laboratorio se necesitan para realizar los western blots y cuantificar los niveles relativos de exptesión Caja Por 0 Unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL de proteínas. Grupo fisiolofia molecular Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos 6 Silla con brazos. Módulo de asiento tapizado en paño o telas vinílicas, espaldar en malla. Unidad Unidad Muebles SUB. INVESTIGA MISIONAL Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos Silla ejecutiva con brazos. Bastidor tapizado y espaldar en malla negra con marco plástico con cabecero tapizado, apoyo lumbar y graduación de profundidad. Unidad Unidad Muebles SUB. INVESTIGA MISIONAL Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos Silla ejecutiva de contacto permanente sin brazos. Espaldar medio, módulos de asiento y espaldar con carcaza en nylon negras, abullonadas en caucho espuma tapizadas en paño. Unidad Unidad Muebles SUB. INVESTIGA MISIONAL

15 Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos 5 Silla giratoria con brazos fijos, base negra. Unidad Unidad Muebles SUB. INVESTIGA MISIONAL de Investigación Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos 2 Silla interlocutor. Estructura trineo cromo con apoyabrazos en PU. Soporte lumbar regulable. Asiento con espuma inyectada. Lumbar graduable en altura Unidad Unidad Muebles SUB. INVESTIGA MISIONAL de Investigación Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos 2 sillas giratorias Ref. y acarta cob brazos fijos base negra Unidad Unidad Muebles SUB. INVESTIGA MISIONAL SISTEMA DE AIRE ACONDICIONADO 2000 BTU Unidad Equipo de laboratorio SUB. INVESTIGA MISIONAL Grupo fisiolofia molecular 583 sistema de aire acondicionado de BTU Unidad Unidad Equipo de laboratorio SUB. INVESTIGA MISIONAL Grupo fisiolofia molecular 584 SISTEMA DE FILTRACION AL VACIO PARA SOLVENTES ALL-GASS MARCA MILLIPORE, 47 MM DE DIAMTERO, DISEÑADO PARA FILTRACION A VACIO DE Millipore LIQUIDOS CORROSIVOS, CLARIFICACION Y DESGASIFICACION DE DISOLVENTES UTILIZADOS EN CROMATOGRAFIA LIQUIDA. CON EMBUDO DE 300 Necesario para el desarrollo de proyectos de investigación del Grupo de Salud Ambiental de la Subdireccion de XX Unidad Unidad Equipo de laboratorio SUB. INVESTIGA MISIONAL Investigacion Laboral Sistema de inventario: Racks para congelador con criocajas Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Micobacterias Sistema de soporte para tubos Cole Palmer divulgacion de resultados de proyectos de investigacion del Grupo de Micobacterias de la Subdireccion de Investigacion RZ Kit X 4rack Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Micobacterias Skim Milk powder Oxoid Reactivo usado para el desarrollo de técnicas de laboratorio L - 03 Frasco Por 500 gramos Reactivos SUB. INVESTIGA MISIONAL Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. Sodio cloruro. Frasco Por Kg Reactivos SUB. INVESTIGA MISIONAL Grupo Microbiologia 3 Biologia Celular 589 Sodium bicarbonate. Sigma Reactivo utilizado en el proceso de hibridización reversa S6297 Frasco Por Kg Reactivos SUB. INVESTIGA MISIONAL Grupo Micobacterias Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos 2 Sofá de dos puestos. Estructura fabricada en madera resortada, debidamente sellada y tintillada. Asiento y espaldar abullonadas en caucho o espuma de alta densidad forrado en paño. Unidad Unidad Muebles SUB. INVESTIGA MISIONAL de Investigación Sondas por 000 Roche Reactivo necesario para la implementación de metodologías Unidad Unidad Reactivos SUB. INVESTIGA MISIONAL diagnósticas Grupo Microbiologia Estandarizar y transferir 2 metodologias de Biologia Molecular en marco de las medidas sanitarias y fitosanitarias 7 Sondas por 000 Roche Sondas necesarias para la Implementación de metodologías Unidad Unidad Reactivos SUB. INVESTIGA CONPES 3676 diagnósticas Grupo Microbiologia SOPORTE DE MEMBRANA PARA MINIBLOTER MN45 Cushions for MN45 (00-pack) Inmunetics Elemento soporte para el proceso de transferencia durante el MINIBLOTTER MN45 Paquete Por 00 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL proceso de spoligityping Grupo Micobacterias EEl suero bovino fetal de esta ha sido empleado en la Suero fetal bovino Invitrogen estandarización y mantenimiento de cultivos celulares primarios y de las diferentes lineas celulares del Grupo y está Frasco por 500 ml Reactivos SUB. INVESTIGA MISIONAL certificados como libres de DNasas, RNasas, endotoxinas y Grupo fisiolofia molecular 3 pirógenos, caracter Esta garantiza las pruebas de susceptibilidad dado que Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. 2 Sulfadoxina Reactivo Sigma son técnicas estandarizadas con esta de elemento, para asegurar la reproducibilidad de los procedimientos, de 3736 Frasco por 250 mg Reactivos SUB. INVESTIGA MISIONAL Grupo Parasitologia 2 cada ensayo de laboratorio estandarizado y la viabilidad de éstos y que son u 596 Suplemento Fraser - Reactivo Oxoid Implementación de metodologías diagnósticas del grupo de SR096E Unidad Unidad Reactivos SUB. INVESTIGA MISIONAL Microbiologia de la Subdireccion de Investigacion Grupo Microbiologia Esta garantiza el cultivo de parásitos dado que son Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. SYBR GREEN SAFE para teñir geles Invitrogen técnicas estandarizadas con esta de elemento y un punto crítico son los elementos para la recuperación y S7563 Frasco Por 500 ul Reactivos SUB. INVESTIGA MISIONAL Grupo Parasitologia aislamiento de parásitos, para asegurar la reproducibilidad de los procedimientos, d Tapas Planas Ópticas Ultraclaras Para Tubos De 0,2 Ml BIO-RAD 599 Tapas rosca perforadas BIO-RAD Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. 2 Taq DNA polimerasa recombinante Invitrogen Estas tapas son requeridas de esta debido a que son las únicas que tienen el diametro de los tubos de PCR en TCS0803 Caja por 96 tapas Elemento de laboratorio SUB. INVESTIGA MISIONAL tiempo real compatibles con el equipo Chromo 4 disponible en el laboratorio Elemento se ajusta a otros elementos y equipos que se tienen 7037 Paquete Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL de la misma que se trabaja en cada uno, para asegurar la reproducibilidad Vial Vial Reactivos SUB. INVESTIGA MISIONAL Biologia Celular Grupo fisiolofia molecular 6 Grupo Microbiologia Grupo Parasitologia 2 CLa enzima Taq DNA polimerasa es una enzima termoestable que resiste periodos de incubación prolongada 60 3 Taq DNA polimerasa recombinante Invitrogen a temperaturas mayores de 95ºC sin pérdida de su actividad Vial Vial Reactivos SUB. INVESTIGA MISIONAL de manera significativa. A diferencia de otras enzimas de su misma categoría la Invitro Reactivo utilizado para desarrollo de técnicas estandarizadas Taq DNA polimerasa. recombinante Invitrogen Vial por 500 Unidades Reactivos SUB. INVESTIGA MISIONAL para el laboratorio Reactivo usado para la implementación de metodologías Estandarizar y transferir 2 metodologias de Biologia Molecular en marco de las medidas sanitarias y fitosanitarias 3 taq polimerasa recombinante USA Invitrogen Unidad Reactivos SUB. INVESTIGA CONPES 3676 diagnósticas Doce técnicas o metodologías de investigación adaptadas y estandarizadas en tecnicas moleculares, Histoquimicas, ultraestructurales y Termohigrometro Digital 484 Unidad Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL cromatograficas. Grupo fisiolofia molecular 7 Grupo Microbiologia 6 Grupo Microbiologia 3 Grupo Microbiologia 3 Grupo Morfología Celular Termómetro para propósitos generales en rango -20 a 0 grados C. Cole Palmer divulgacion de resultados de proyectos de investigacion del Grupo de Micobacterias de la Subdireccion de Investigacion RZ Unidad Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Micobacterias Timer Digital 5004 Unidad Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Morfología Celular Tiquetes aèreos Tiquetes Aereos SUB. INVESTIGA MISIONAL Laboral 608 Tiquetes aèreos Tiquetes Aereos SUB. INVESTIGA MISIONAL Participar en eventos de divulgación sobre resultados de la investigación desarrollada. Tiquetes aèreos Tiquetes Aereos SUB. INVESTIGA MISIONAL Grupo Nutricion Grupo Morfología Celular Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos Tiquetes aèreos Tiquetes Aereos SUB. INVESTIGA MISIONAL 6 Tiquetes aèreos Tiquetes Aereos SUB. INVESTIGA MISIONAL Biologia Celular Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. Tiquetes aèreos Tiquetes Aereos SUB. INVESTIGA MISIONAL Biologia Celular 63 Tiquetes aèreos Tiquetes Aereos SUB. INVESTIGA MISIONAL Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. Tiquetes aèreos Tiquetes Aereos SUB. INVESTIGA MISIONAL 65 Tiquetes aèreos Tiquetes Aereos SUB. INVESTIGA MISIONAL 66 Tiquetes aèreos Tiquetes Aereos SUB. INVESTIGA MISIONAL 67 Tiquetes aèreos Tiquetes Aereos SUB. INVESTIGA MISIONAL Capacitar en procesos y procedimientos de investigación científica en las areas de epidemiologia basica, metodologia moleculares y manejo de 68 Tiquetes aèreos Tiquetes Aereos SUB. INVESTIGA MISIONAL software especializado a por lo menos cinco funcionarios Participar en eventos de divulgación sobre resultados de la investigación desarrollada. Tiquetes aèreos Tiquetes Aereos SUB. INVESTIGA MISIONAL Grupo entomologia Grupo entomologia Grupo fisiolofia molecular Grupo Parasitologia Grupo Microbiologia Grupo Micobacterias Grupo Micobacterias Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 3 Toner CC364A laser jet p404/p405/p455 Unidad Toner SUB. INVESTIGA MISIONAL de Investigación Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos Toner Q5949A Unidad Toner SUB. INVESTIGA MISIONAL Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 2 Toner lexmark C780hCG c780/782 Unidad Toner SUB. INVESTIGA MISIONAL de Investigación Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 2 Toner lexmark C780hMG c780/782 Unidad Toner SUB. INVESTIGA MISIONAL de Investigación Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos Toner lexmark E260 X 22G Unidad Toner SUB. INVESTIGA MISIONAL Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos 4 Toner lexmark T 642/44 ref 6408hl Unidad Unidad Toner SUB. INVESTIGA MISIONAL de Investigación Realizar el Soporte administrativo de proyectos y actividades de Investigacion con el fin de apoyar el desarrollo de los mismos Toner samsung ml-660 ref. 70D3 Unidad Toner SUB. INVESTIGA MISIONAL Trampa miniatura para insectos de luz incandescente con bolsa colectora y acondicionada con sistema de puerta de aire que se cierra cuando el ventilador esta apagado. Unidad Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo entomologia 0

16 628 En el laboratorio se emplea de manera rutinaria y se 5 Transcriptasa Reversa Superscript II Invitrogen Invitrogen estandarizaron los procesos de síntesis de cadn y RT-PCR, por cuanto garantizan la obtención de ADN complementario en poco tiempo, con buena calidad y de manera reproducible Vial por 2000 Unidades Reactivos SUB. INVESTIGA MISIONAL Grupo fisiolofia molecular 5 La enzima de esta es Trint - Reactivo Invitrogen que se trabaja en cada uno, para asegurar la reproducibilidad 25 NMOLES. PEDIR SECUENCIA Unidad AL COORDINADOR Por 25 nmoles Reactivos SUB. INVESTIGA MISIONAL Grupo Parasitologia Tripticasa de Soya Agar - Difco Becton Dickinson Reactivo necesario para el desarrollo de técnicas de laboratorio 2043 Frasco Por 500 gramos Reactivos SUB. INVESTIGA MISIONAL Grupo Microbiologia 63 4 Tris base Ultrapure Invitrogen Técnica estandarizada con este reactivo para la implementación de metodologías diagnósticas Frasco Por 000 gramos Reactivos SUB. INVESTIGA MISIONAL Grupo Microbiologia Tris base Ultrapure Invitrogen Reactivo utilizado para desarrollo de técnicas estandarizadas para el laboratorio Frasco Por 000 gramos Reactivos SUB. INVESTIGA MISIONAL Grupo Microbiologia 633 Tris HCL Base UltraPure Invitrogen Reactivo estandarizado para la Vigilancia molecular de bacterias causantes de EDA, ETA y Brotes Frasco Por 500 gramos Reactivos SUB. INVESTIGA MISIONAL Grupo Microbiologia 634 Tris-HCl - trisma hidrocloride solucion.00 _0.05 M, ph 8.0 Invitrogen que se trabaja en cada uno, para asegurar la reproducibilidad H525 Frasco por litro Reactivos SUB. INVESTIGA MISIONAL Grupo Parasitologia Esta garantiza el cultivo de parásitos dado que son Trypsin-EDTA 0,25% Ref Gibco Frasco por 00 ml Invitrogen técnicas estandarizadas con esta de elemento y un punto crítico son los elementos para la recuperación y aislamiento de parásitos, para asegurar la reproducibilidad Frasco Por 00 gramos Reactivos SUB. INVESTIGA MISIONAL Grupo Parasitologia 3 de los procedimientos Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. 4 Tubo al vacio tapón lila con aditivo EDTA K2 Becton Dickinson que se trabaja en cada uno, para asegurar la reproducibilidad Caja Por 00 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Parasitologia 4 estandarizado y validado 637 Tubo al vacio tapón lila con aditivo EDTA K2 Becton Dickinson Esta garantiza la adecuada conservación de las muestras de sangre en trabajos de campo, para posterior realización de pruebas moleculares Caja Por 00 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Nutricion 638 Tubo al vacio tapón lila con aditivo EDTA K2 Becton Dickinson Esta garantiza la adecuada conservación de las muestras de sangre en trabajos de campo, para posterior realización de pruebas moleculares Caja Por 00 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Nutricion Tubo al vacio tapón lila con aditivo EDTA K2 Becton Dickinson que se trabaja en cada uno, para asegurar la reproducibilidad ML Caja Por 00 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Parasitologia 5 estandarizado y validado Realizar Veinte asesorías y capacitaciones sobre metodologia moleculares, y temas de nutricion, Parasitologia y Salud Ambiental y laboral que contribuyan a la actualización y generación del conocimiento del talento humano involucrado en las á 6 Tubo al vacio tapón lila con aditivo EDTA K2 Becton Dickinson Esta garantiza la adecuada conservación de las muestras de sangre en trabajos de campo, para posterior realización de pruebas moleculares Caja Por 00 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Nutricion 6 Esta garantiza el cultivo de parásitos dado que son Realizar Veinte asesorías y capacitaciones sobre metodologia moleculares, y temas de nutricion, Parasitologia y Salud Ambiental y laboral que contribuyan a la actualización y generación del conocimiento del talento humano involucrado en las á 54 Tubo al vacio tapón lila con aditivo EDTA K2 por 4ml, con tapón hemogard Becton Dickinson técnicas estandarizadas con esta de elemento y un punto crítico son los elementos para la recuperación y Caja Por 00 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL aislamiento de parásitos, para asegurar la reproducibilidad Grupo Nutricion 54 de los procedimientos Realizar Veinte asesorías y capacitaciones sobre metodologia moleculares, y temas de nutricion, Parasitologia y Salud Ambiental y laboral que contribuyan a la actualización y generación del conocimiento del talento humano involucrado en las á 54 Tubo al Vacio Tapón Verde 72 Usp De Heparina Sodica Becton Dickinson Esta garantiza la adecuada conservación de las muestras de sangre en trabajos de campo, para posterior Caja Por 00 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL realización de pruebas moleculares Grupo Nutricion Tubo eppendorf de 0.5ml USA Scientific Los tubos de 0,5 ml USA Scientific tienen certificación para biología molecular debido a que son libres de ADNasas, Bolsa Por 000 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL ARNasas, DNA, y ATP. Grupo fisiolofia molecular Tubo eppendorf de.5 ml, tapa plana con cierre de seguridad USA Scientific "Grupo de Parasitología Subdirección de Investigación" Bolsa por 500 Unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Microbiologia 0 Grupo Parasitologia Tubos conicos para centrifuga de 50 ml, esteriles, en polipropileno. excelente resistencia quimica y resisten gravedades hasta 6000 RCF y temperaturas extremas desde -40 C a 25 C. Caja por 500 Unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Microbiologia Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. Tubos cónicos Plásticos graduados de 50 ml Centrifuge Tubes 50 ml USA Scientific que se trabaja en cada uno, para asegurar la reproducibilidad Paquete por 500 Unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Parasitologia estandarizado Los tubos de qpcr de BioRad, son certificadas para PCR en Tubos De 0,2 Ml Para Pcr - Tiempo Real (Tiras De 8 Tubos) BIO-RAD tiempo real, en el mercado son los únicos tubos 00% TLS085 Caja Por 96 Unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL compatibles para el equipo Chromo-4 disponible en el Biologia Celular Grupo fisiolofia molecular 6 laboratorio para esta aplicación. Tubos de policarbonato, multifncionales, resistentes para Tubos de 50 ml USA Scientific procesos de centrifugación a latas velocidades y procesos de congelamiento y descongelamiento sin alterar sus Bolsa por 500 Unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL caracteristicas fisicas. Estos tubos son garantizados libres de Grupo fisiolofia molecular 4 ARNasas, ADNasas y piro TUBOS PARA CENTRIFUGA DE 50 ml. CONICOS 649 Tubos de 50 ml USA Scientific GRADUADOS TAPA ROSCA, ESTERILES. CAJA DE 20 BOLSAS x 25u CERTIFICADOS LIBRES DNASE, RNASE, Bolsa Por 500 ul Elemento de laboratorio SUB. INVESTIGA MISIONAL DNA Y PIROGENOS, TAPA ROSCA AZUL. MARCA USA Biologia Celular SCIENTIFIC. Tubos de policarbonato, multifncionales, resistentes para proces Tubos De Khan Pyrex Elemento necesario para el desarrollo de técnicas de Caja Por 72 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL laboratorio Grupo Microbiologia Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. 5 Tubos de PCR de 0.2 ml hechos en polipropileno. Tapa plana. libres de Rnasa y Dnase. color USA Scientific natural. que se trabaja en cada uno, para asegurar la reproducibilidad Paquete Por 000 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Parasitologia 5 estandarizado Tubos de tapón al vacio, tapa lila de 3por00 ml con capacidad para 0 ml Becton Dickinson que se trabaja en cada uno, para asegurar la reproducibilidad Caja Por 00 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Parasitologia 4 estandarizado y validado Esta garantiza el cultivo de parásitos dado que son 653 Tubos de vidrio 3 x 25 mm. Pyrex técnicas estandarizadas con esta de elemento y un punto crítico son los elementos para la recuperación y Unidad Caja x 44 Elemento de laboratorio SUB. INVESTIGA MISIONAL aislamiento de parásitos, para asegurar la reproducibilidad Grupo Parasitologia de los procedimientos, d Esta garantiza el cultivo de parásitos dado que son Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. 2 Tubos eppendorf de.5 ml graduados, certificados, libres de Dnase, Rnase, DNA y ATP USA Scientific técnicas estandarizadas con esta de elemento y un punto crítico son los elementos para la recuperación y Bolsa por 500 Unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Parasitologia 2 aislamiento de parásitos, para asegurar la reproducibilidad de los procedimientos, d Tubos eppendorf de.5 ml graduados, certificados, libres de Dnase, Rnase, DNA y ATP. USA Scientific Esta garantiza que los tubos esten libres de nucleasas Paquete por 500 Unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL y pirógenos, condiciones necesarias para biología molecular Grupo fisiolofia molecular 5 Grupo Microbiologia Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. Tubos eppendorf de.5 ml graduados, certificados, libres de Dnase, Rnase, DNA y ATP. Axigen Elementos necesarios para centrifugación de soluciones MCT-50-C Paquete por 500 Unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Biologia Celular Tubos Falcon De 5 Ml Con Tapa Rosca que resistan centrigugaciones a 300 rpm por hora a 4c Bolsa por 500 Unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Microbiologia Tubos para centrifuga, conicos graduados de 5 ml. en polipropileno. Esteriles. tapa rosca USA Scientific azul. Excelente resistencia quimica y resistenetes hasta 6400 RCF Tubos de policarbonato, multifncionales, resistentes para procesos de centrifugación a latas velocidades y procesos de congelamiento y descongelamiento sin alterar sus Caja por 500 Unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL caracteristicas fisicas. Estos tubos son garantizados libres de Biologia Celular Grupo fisiolofia molecular 0 ARNasas, ADNasas y piro tubos para microcentrifuga capacidad.5 ml en polipropileno esteril USA Scientific que se trabaja en cada uno, para asegurar la reproducibilidad Paquete por 700 viales Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Parasitologia 2 Tubos ultraclaros, de policarbonato, resistentes a procesos Tubos para PCR de 0.2 tapa plana certificados libres DNASE, RNASE, DNA USA Scientific de esterilizaciòn por autoclave a altas temperaturas y presiones, sin alterar sus caracteristicas fisicas. Los tubos Bolsa Por 000 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL de PCR de 0,2 ml USA Scientific, estan certificados Grupo fisiolofia molecular 0 como libres de nucl 66 5 Tubos PCR 0.2 Ml tapa domo libre de RNAasas y DNAasas Fisher Brand Necesarias para llevar a cabo los diferentes procesos y Bolsa Por 000 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL realizar ensayos moleculares Biologia Celular Tubos PCR 0.2 Ml tapa domo libre de RNAasas y DNAasas Fisher Brand Elemento necesario para llevar a cabo los diferentes Bolsa Por 000 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL procesos y realizar ensayos moleculares Biologia Celular Tubos tapa amarilla para adulto para 5 ml - Gradilla Becton Dickinson que se trabaja en cada uno, para asegurar la reproducibilidad Unidad Por 00 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Parasitologia Tubos tapa azul con citrato de sodio para adulto para 4,5 ml - Gradilla Becton Dickinson que se trabaja en cada uno, para asegurar la reproducibilidad Unidad Por 00 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Grupo Parasitologia Tubos tipo eppendorf de 2,0 ml graduados, certificados, libres de Dnase, Rnase, DNA y ATP QSP Elemento necesario para centrifugación de soluciones 508-GRD Paquete por 500 Unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL Bolsa Biologia Celular

17 666 6 Tuerca de columna universal,587 mm hex Paquete Paquete por 2 Elemento de laboratorio SUB. INVESTIGA MISIONAL Laboral Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. 2 UltraPure? 0 mg?ml Ethidium Bromide Invitrogen que se trabaja en cada uno, para asegurar la reproducibilidad Frasco por 0 ml Reactivos SUB. INVESTIGA MISIONAL Grupo Parasitologia Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. UltraPure? Phenol:Chloroform:Isoamyl Alcohol (25:24:) Invitrogen Frasco por 00 ml Reactivos SUB. INVESTIGA MISIONAL que se trabaja en cada uno, para asegurar la reproducibilidad de los procedimientos Unidades de filtración Millipore, tipo Sterivex-GV 0.22 micras de poro membrana durapore Elementos para esterilización de medios de cultivo necesario de baja absorción proteinica con campana de llenado Millipore Caja x 0 unidades Millipore SVGVB00 Unidad Unidad Elemento de laboratorio SUB. INVESTIGA MISIONAL para experimentos de fisiología molecular SVGVB00 Unidades de filtración, 33 mm de diámetro, estériles individuales membrana durapore PVDF Millipore Elemento para esterilizar soluciones sensibles al calor SLGV033RK Unidad Unidad Reactivos SUB. INVESTIGA MISIONAL de 0.22 micras Millipore Caja Por 25 unidades SLGV033RK UPS DE 20 KVA EN LINEA TRIFASICA CON BANCO DE AUTONOMIA FULL CARGA DE 67 Unidad Unidad Equipo de laboratorio SUB. INVESTIGA MISIONAL 5 MINUTOS Y SU REGULADOR RESPECTIVO 672 Vaportape II, tiras con vapona (DDVP) Caja por 50 tiras Caja Elemento de laboratorio SUB. INVESTIGA MISIONAL Viales de vidrio de,8 ml con tapa rosca Paquete Por 200 Unidaes Elemento de laboratorio SUB. INVESTIGA MISIONAL Se requiere esta debido a que estos viales son en Contribuir a la formación de 30 profesionales o investigadores en salud y biomedicina. 6 Viales en vidrio claro, capacidad 2 ml, PTFE/silicona Agilen Technologies Caja Por 00 unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL vidrio tratado para cromatografia Realizar Veinte asesorías y capacitaciones sobre metodologia moleculares, y temas de nutricion, Parasitologia y Salud Ambiental y laboral que Viales transparentes conicos tapa adherida,5 ml Paquete por 500 Unidades Elemento de laboratorio SUB. INVESTIGA MISIONAL contribuyan a la actualización y generación del conocimiento del talento humano involucrado en las á Participar en eventos de divulgación sobre resultados de la investigación desarrollada. viaticos Unidad Unidad Viaticos SUB. INVESTIGA MISIONAL Grupo Parasitologia Grupo fisiolofia molecular 6 Grupo fisiolofia molecular 6 Grupo Nutricion Grupo entomologia Grupo entomologia 2 Laboral 6 Grupo Nutricion 00 Biologia Celular 677 viaticos Unidad Unidad Viaticos SUB. INVESTIGA MISIONAL Laboral Realizar Veinte asesorías y capacitaciones sobre metodologia moleculares, y temas de nutricion, Parasitologia y Salud Ambiental y laboral que 678 viaticos Unidad Unidad Viaticos SUB. INVESTIGA MISIONAL contribuyan a la actualización y generación del conocimiento del talento humano involucrado en las á 679 viaticos Unidad Unidad Viaticos SUB. INVESTIGA MISIONAL 680 viaticos Unidad Unidad Viaticos SUB. INVESTIGA MISIONAL Participar en eventos de divulgación sobre resultados de la investigación desarrollada. viaticos Unidad Unidad Viaticos SUB. INVESTIGA MISIONAL Mantener siete bancos de material biológico disponibles para la formulación y ejecución de investigaciones científicas en desarrollo. viaticos Unidad Unidad Viaticos SUB. INVESTIGA MISIONAL Grupo Nutricion Grupo Nutricion Grupo Nutricion Grupo Morfología Celular Grupo entomologia 683 viaticos Unidad Unidad Viaticos SUB. INVESTIGA MISIONAL Biologia Celular 684 viaticos Unidad Unidad Viaticos SUB. INVESTIGA MISIONAL Grupo fisiolofia molecular 685 viaticos Unidad Unidad Viaticos SUB. INVESTIGA MISIONAL Grupo entomologia Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos viaticos Unidad Unidad Viaticos SUB. INVESTIGA MISIONAL 687 viaticos Unidad Unidad Viaticos SUB. INVESTIGA MISIONAL Participar en eventos de divulgación sobre resultados de la investigación desarrollada. viaticos Unidad Unidad Viaticos SUB. INVESTIGA MISIONAL Grupo Microbiologia Grupo Micobacterias 689 viaticos Unidad Unidad Viaticos SUB. INVESTIGA MISIONAL Grupo Parasitologia 690 viaticos Unidad Unidad Viaticos SUB. INVESTIGA MISIONAL Biologia Celular 69 viaticos Unidad Unidad Viaticos SUB. INVESTIGA MISIONAL Grupo Parasitologia 692 viaticos Unidad Unidad Viaticos SUB. INVESTIGA MISIONAL Grupo Nutricion 693 viaticos Unidad Unidad Viaticos SUB. INVESTIGA MISIONAL Grupo Nutricion 694 viaticos Unidad Unidad Viaticos SUB. INVESTIGA MISIONAL Grupo Microbiologia 695 viaticos Unidad Unidad Viaticos SUB. INVESTIGA MISIONAL Grupo entomologia 696 viaticos Unidad Unidad Viaticos SUB. INVESTIGA MISIONAL Biologia Celular Realizar Veinte asesorías y capacitaciones sobre metodologia moleculares, y temas de nutricion, Parasitologia y Salud Ambiental y laboral que contribuyan a la actualización y generación del conocimiento del talento humano involucrado en las á viaticos Unidad Unidad Viaticos SUB. INVESTIGA MISIONAL Grupo Nutricion Realizar Veinte asesorías y capacitaciones sobre metodologia moleculares, y temas de nutricion, Parasitologia y Salud Ambiental y laboral que contribuyan a la actualización y generación del conocimiento del talento humano involucrado en las á viaticos Unidad Unidad Viaticos SUB. INVESTIGA MISIONAL Grupo Nutricion 699 viaticos Unidad Unidad Viaticos SUB. INVESTIGA MISIONAL Grupo Microbiologia 700 viaticos Unidad Unidad Viaticos SUB. INVESTIGA MISIONAL Grupo entomologia Realizar la Revisión, seguimiento y control de los 29 proyectos de investigación en curso y del 00%de la demanda de evaluacion de proyectos viaticos Unidad Unidad Viaticos SUB. INVESTIGA MISIONAL 702 viaticos Unidad Unidad Viaticos SUB. INVESTIGA MISIONAL Grupo Parasitologia Los procedimientos cuentan con técnicas estandarizadas y Realizar Veinte asesorías y capacitaciones sobre metodologia moleculares, y temas de nutricion, Parasitologia y Salud Ambiental y laboral que contribuyan a la actualización y generación del conocimiento del talento humano involucrado en las á 000 Vitamina B2 para Advia Centaur kit que incluye calibradores y consumibles. Siemens un punto crítico son los reactivos con los que se trabaja en cada uno, para asegurar la reproducibilidad de los Prueba Unidad Reactivos SUB. INVESTIGA MISIONAL Grupo Nutricion 000 procedimientos 704 Wizard Plus SV minipreps DNA purification system - Promega Necesario para la purificación de plásmidos clonados. A-330 Caja por 50 preparaciones Reactivos SUB. INVESTIGA MISIONAL Biologia Celular X-gal Invitrogen que se trabaja en cada uno, para asegurar la reproducibilidad Vial Por gramo Reactivos SUB. INVESTIGA MISIONAL estandarizado Xilacina Frasco por 25 ml Medicamento SUB. INVESTIGA MISIONAL Con esta se tiene estandarizada la técnica para Producir y suministrar 3000 litros de medios de cultivo, agua y soluciones requeridos para el aislamiento e identificación de microorganismos en Acetamida Merck INVIMA en el uso de medios de cultivo en sus Frasco Por Kg Reactivos SUB. PRODUCCIÓN MISIONAL procedimientos Realizar 6000 análisis de control de calidad para asegurar la calidad de los productos de la Subdirección de Producción. Acetonitrilo HPLC (metilo cianuro) para cromatografía en fase liquida. Frasco por 4 litros Reactivos SUB. PRODUCCIÓN MISIONAL Biologia Celular Grupo fisiolofia molecular 2 Grupo entomologia 6 Subgrupo Medios de Cultivo Calidad Realizar 6000 análisis de control de calidad para asegurar la calidad de los productos de la Subdirección de Producción. ACIDO ACETICO (GLACIAL) 00% ANHIDRO PARA ANALISIS ACS,ISO,REAG. PH EUR Frasco Por 2.5 Litros Reactivos SUB. PRODUCCIÓN MISIONAL Calidad Se trata de consumibles de equipos de la Merck y son Producir 0000 viales de antiveneno requerido para el tratamiento del accidente ofídico en el país. 2 ACIDO ACETICO (GLACIAL) 00% ANHIDRO PARA ANALISIS ACS,ISO,REAG. PH EUR Merck Frasco Por 2.5 Litros Reactivos SUB. PRODUCCIÓN MISIONAL requeridos para el cumplimiento de BPM Realizar 6000 análisis de control de calidad para asegurar la calidad de los productos de la Subdirección de Producción. Acido citrico reactivo ACS, > o igual 99.5% Frasco Por 00 gramos Reactivos SUB. PRODUCCIÓN MISIONAL Subgrupo Sueros 2 Calidad Producir y suministrar 3000 litros de medios de cultivo, agua y soluciones requeridos para el aislamiento e identificación de microorganismos en 2 Ácido Clorhidrico Frasco Por 2.5 Litros Reactivos SUB. PRODUCCIÓN MISIONAL Subgrupo Medios de Cultivo Realizar 6000 análisis de control de calidad para asegurar la calidad de los productos de la Subdirección de Producción. 2 Acrilamida electroforesis > 99% Frasco Por 500 gramos Reactivos SUB. PRODUCCIÓN MISIONAL Calidad Desarrollar un () proyecto de investigación, ciencia y tecnología encaminado al fortalecimiento de las capacidades institucionales en la producción y control de calidad de productos de interés para la salud pública del país. Agitador magnetico con calentamiento 6-9 puestos independientes Unidad Unidad Equipo de laboratorio SUB. PRODUCCIÓN MISIONAL Subgrupo Medios de Cultivo La West se requiere para el cumplimiento de BPM en Producir 0000 viales de antiveneno requerido para el tratamiento del accidente ofídico en el país Agrafes de 3 mm Natural lacado WPSB west Unidad Unidad Elemento de laboratorio SUB. PRODUCCIÓN MISIONAL la producción de suero Realizar 6000 análisis de control de calidad para asegurar la calidad de los productos de la Subdirección de Producción. 2 Agua estéril para inyección USP caja por 50 ampolletas plásticas unidosis por 0 ml Caja Por 50 ampolletas Reactivos SUB. PRODUCCIÓN MISIONAL Subgrupo Sueros 2000 Calidad Realizar 6000 análisis de control de calidad para asegurar la calidad de los productos de la Subdirección de Producción. 6 Agua libre de pirógenos. Vial por 50 ml. Pyrotel elemento utilizado en la prueba de LAL, validada con ésta Vial Por 50 ml Reactivos SUB. PRODUCCIÓN MISIONAL Calidad Suministrar 00 litros de hemoderivados requeridos por los diferentes grupos del Instituto en el cumplimiento de sus funciones misionales 0 Aguja Hipodermica esteril 6x /2 pulgada Bd Ajuste a las jeringas utilizadas en el Grupo de la BD Caja Por 00 unidades Elemento de laboratorio SUB. PRODUCCIÓN MISIONAL Serpentario Realizar 6000 análisis de control de calidad para asegurar la calidad de los productos de la Subdirección de Producción. 0 aguja hipodermica esteril 26 X /2 Bd Ajuste a las jeringas utilizadas en el área de Aseguramiento de la Calidad de la BD Caja Por 00 unidades Elemento de laboratorio SUB. PRODUCCIÓN MISIONAL Calidad Realizar 6000 análisis de control de calidad para asegurar la calidad de los productos de la Subdirección de Producción. 2 Albúmina Sérica Bovina. Frasco Por 00 gramos Reactivos SUB. PRODUCCIÓN MISIONAL Calidad Producir y suministrar 3000 litros de medios de cultivo, agua y soluciones requeridos para el aislamiento e identificación de microorganismos en Albúmina Sérica Bovina. Frasco Por 00 gramos Reactivos SUB. PRODUCCIÓN MISIONAL Subgrupo Medios de Cultivo

18 Producir 0000 viales de antiveneno requerido para el tratamiento del accidente ofídico en el país. 500 Alcohol Antiseptico 70% Botella por 750 ml Desinfectantes SUB. PRODUCCIÓN MISIONAL Subgrupo Sueros Realizar 6000 análisis de control de calidad para asegurar la calidad de los productos de la Subdirección de Producción. 00 Alcohol Antiseptico 70% Botella por 750 ml Desinfectantes SUB. PRODUCCIÓN MISIONAL Calidad Realizar la adquisición de suministros de oficina, muebles, elementos de consumo, equipos de protección y bioseguridad y servicios de soporte 6 Alcohol Etilico( Etanol) al 96% puro por 2,5 L Botella Por 2.5 Litros Desinfectantes SUB. PRODUCCIÓN MISIONAL de Producción Suministrar 00 litros de hemoderivados requeridos por los diferentes grupos del Instituto en el cumplimiento de sus funciones misionales 4 Algodón en torundas, blanco, mota absorbente Paquete Por 500 gramos Elemento de laboratorio SUB. PRODUCCIÓN MISIONAL Serpentario Producir y suministrar animales de laboratorio para atender las necesidades de los clientes internos y externos que requieran el uso de 350 alimento autoclavable Bulto por 25 kilos Alimento para animales SUB. PRODUCCIÓN MISIONAL Laboratorio Producir y suministrar animales de laboratorio para atender las necesidades de los clientes internos y externos que requieran el uso de 75 Alimento Concentrado Para Cobayos bulto x 40 kilos Bulto Por 40 Kg Alimento para animales SUB. PRODUCCIÓN MISIONAL Laboratorio Producir y suministrar animales de laboratorio para atender las necesidades de los clientes internos y externos que requieran el uso de 50 Alimento concentrado para conejos bulto x 40 kilos Bulto Por 40 Kg Alimento para animales SUB. PRODUCCIÓN MISIONAL Laboratorio Producir y suministrar animales de laboratorio para atender las necesidades de los clientes internos y externos que requieran el uso de 83 Alimento Concentrado para equinos bulto x 40 kilos Bulto Por 40 Kg Alimento para animales SUB. PRODUCCIÓN MISIONAL Serpentario Suministrar 00 litros de hemoderivados requeridos por los diferentes grupos del Instituto en el cumplimiento de sus funciones misionales 67 Alimento Concentrado para equinos bulto x 40 kilos Bulto Por 40 Kg Alimento para animales SUB. PRODUCCIÓN MISIONAL Serpentario 67 El proceso de fraccionamiento de las inmunoglobulinas se ha realizado con reactivos de la Merck para el Producir 0000 viales de antiveneno requerido para el tratamiento del accidente ofídico en el país. 4 AMONIO SULFATO P.A. ACS,ISO,REAG. PH EUR. Merck Caja Por 50 Kg Reactivos SUB. PRODUCCIÓN MISIONAL cumplimiento de BPM Realizar 6000 análisis de control de calidad para asegurar la calidad de los productos de la Subdirección de Producción. Ampolletas de Stericon Caja Por 00 unidades Reactivos SUB. PRODUCCIÓN MISIONAL Subgrupo Sueros 4 Calidad Realizar 6000 análisis de control de calidad para asegurar la calidad de los productos de la Subdirección de Producción. análisis de calidad para la determinación de Timerosal Unidad Servicios personales SUB. PRODUCCIÓN MISIONAL Calidad Realizar 6000 análisis de control de calidad para asegurar la calidad de los productos de la Subdirección de Producción. API 20 NE (NO FERMENTADORES) Caja Por 25 galerias Reactivos SUB. PRODUCCIÓN MISIONAL Calidad Realizar 6000 análisis de control de calidad para asegurar la calidad de los productos de la Subdirección de Producción. API 20E enterobacterias Caja Por 25 galerias Reactivos SUB. PRODUCCIÓN MISIONAL Calidad La Merck se requiere para el cumplimiento de BPM en Producir 0000 viales de antiveneno requerido para el tratamiento del accidente ofídico en el país. 2 Aquamerk dureza total baja est x 300 det. (-00 ppm). Merck Kit por 300 determinaciones Reactivos SUB. PRODUCCIÓN MISIONAL la producción de suero. La Merck se requiere para el cumplimiento de BPM en Producir 0000 viales de antiveneno requerido para el tratamiento del accidente ofídico en el país. 2 Aquamerk Ph Merck Kit por 400 determinaciones Reactivos SUB. PRODUCCIÓN MISIONAL la producción de suero Producir 0000 viales de antiveneno requerido para el tratamiento del accidente ofídico en el país. Arena prelavada, malla Bulto Por 50 Kg Elemento de laboratorio SUB. PRODUCCIÓN MISIONAL Subgrupo Sueros 2 Subgrupo Sueros 2 Subgrupo Sueros Realizar 6000 análisis de control de calidad para asegurar la calidad de los productos de la Subdirección de Producción. asas plásticas desechables Calibradas a 0uL empacadas individualmente Paquete Por 250 unidades Elemento de laboratorio SUB. PRODUCCIÓN MISIONAL Calidad Producir y suministrar animales de laboratorio para atender las necesidades de los clientes internos y externos que requieran el uso de 3 Azium frasco X 50 ml Frasco Por 50 ml Medicamento SUB. PRODUCCIÓN MISIONAL Serpentario Realizar 6000 análisis de control de calidad para asegurar la calidad de los productos de la Subdirección de Producción. Azul de bromofenol reactivo ACS Frasco por 25 gramos Reactivos SUB. PRODUCCIÓN MISIONAL Calidad Realizar 6000 análisis de control de calidad para asegurar la calidad de los productos de la Subdirección de Producción. Azul de coomasie G-250 Frasco Por 00 gramos Reactivos SUB. PRODUCCIÓN MISIONAL Calidad Realizar 6000 análisis de control de calidad para asegurar la calidad de los productos de la Subdirección de Producción. 2 Azul de Coomassie R-250 Frasco por 25 gramos Reactivos SUB. PRODUCCIÓN MISIONAL Calidad Producir 0000 viales de antiveneno requerido para el tratamiento del accidente ofídico en el país. BALANZA DE PRESICIÓN DE 200g X 0,0 Sartorius Balanzas requeridas para el cumplimiento de Buenas Prácticas de Manufactura en la producción de suero. Unidad Unidad Equipo de laboratorio SUB. PRODUCCIÓN MISIONAL Subgrupo Sueros Producir y suministrar 3000 litros de medios de cultivo, agua y soluciones requeridos para el aislamiento e identificación de microorganismos en 3 Balón aforado de cuello largo, con fondo plano, con cuello esmerilado y capacidad de 6000 ml clase A. Unidad Unidad Elemento de laboratorio SUB. PRODUCCIÓN MISIONAL Subgrupo Medios de Cultivo Realizar 6000 análisis de control de calidad para asegurar la calidad de los productos de la Subdirección de Producción. 2 Balón volimétrico de vidrio transparente con tapón, Clase A de 500 ML certificado por lote Unidad Elemento de laboratorio SUB. PRODUCCIÓN MISIONAL Calidad Producir y suministrar 3000 litros de medios de cultivo, agua y soluciones requeridos para el aislamiento e identificación de microorganismos en 2 Barra magnetica Recogeimanes Unidad Elemento de laboratorio SUB. PRODUCCIÓN MISIONAL Subgrupo Medios de Cultivo Producir y suministrar 3000 litros de medios de cultivo, agua y soluciones requeridos para el aislamiento e identificación de microorganismos en 0 Barras de agitación Magnetica 8X50 Unidad Elemento de laboratorio SUB. PRODUCCIÓN MISIONAL Subgrupo Medios de Cultivo Producir y suministrar 3000 litros de medios de cultivo, agua y soluciones requeridos para el aislamiento e identificación de microorganismos en 0 Barras de agitación Magnetica 70X9 Unidad Elemento de laboratorio SUB. PRODUCCIÓN MISIONAL Subgrupo Medios de Cultivo Realizar la adquisición de suministros de oficina, muebles, elementos de consumo, equipos de protección y bioseguridad y servicios de soporte 00 bayetilla blanca m x m Unidad Equipos y suministros de aseo SUB. PRODUCCIÓN MISIONAL de Producción Producir y suministrar animales de laboratorio para atender las necesidades de los clientes internos y externos que requieran el uso de 3 Baytril inyectable 5% Frasco por 00 ml Medicamento SUB. PRODUCCIÓN MISIONAL Serpentario Producir y suministrar 3000 litros de medios de cultivo, agua y soluciones requeridos para el aislamiento e identificación de microorganismos en 3 Beaker o vaso precipitado en vidrio refractáreo, sin manija, con capacidad de 2000ml Unidad Elemento de laboratorio SUB. PRODUCCIÓN MISIONAL Subgrupo Medios de Cultivo Realizar 6000 análisis de control de calidad para asegurar la calidad de los productos de la Subdirección de Producción. Bicarbonato de sodio (NaHCO3) grado reactivo Frasco por 250 gramos Reactivos SUB. PRODUCCIÓN MISIONAL Calidad Realizar 6000 análisis de control de calidad para asegurar la calidad de los productos de la Subdirección de Producción. biftalato de potasio para analisis alta pureza Frasco Por 00 gramos Reactivos SUB. PRODUCCIÓN MISIONAL Calidad Producir 0000 viales de antiveneno requerido para el tratamiento del accidente ofídico en el país. Bomba Procon, en acero Inoxidable, capacidad de 40 GPH, conexion con pernos. Unidad Equipo de laboratorio SUB. PRODUCCIÓN MISIONAL Subgrupo Sueros Producir y suministrar 3000 litros de medios de cultivo, agua y soluciones requeridos para el aislamiento e identificación de microorganismos en 2 Boquilla Dispensación dispensador cajas Cole Parmer Cole Palmer Los procesos se encuentran estandarizados con elementos de esta Unidad Unidad Elemento de laboratorio SUB. PRODUCCIÓN MISIONAL Subgrupo Medios de Cultivo Producir y suministrar 3000 litros de medios de cultivo, agua y soluciones requeridos para el aislamiento e identificación de microorganismos en 3 Boquilla en acero Inoxidable 36 para manguera de mampreno 3,2mm diametro interno,6 mm espesor de pared Watson-Marlow WATSON MARLON Se trata de un consumible de un equipo de la Unidad Elemento de laboratorio SUB. PRODUCCIÓN MISIONAL Subgrupo Medios de Cultivo Producir y suministrar 3000 litros de medios de cultivo, agua y soluciones requeridos para el aislamiento e identificación de microorganismos en Buffer solucion PH 4 RPE x litro. Carlo Erba Estandarizada para el uso del potenciometro Beckman; Modelo descontinuado Frasco por litro Reactivos SUB. PRODUCCIÓN MISIONAL Subgrupo Medios de Cultivo Producir y suministrar 3000 litros de medios de cultivo, agua y soluciones requeridos para el aislamiento e identificación de microorganismos en Buffer solucion PH 7 RPE Carlo Erba Estandarizada para el uso del potenciometro Beckman; Modelo descontinuado Frasco por litro Reactivos SUB. PRODUCCIÓN MISIONAL Subgrupo Medios de Cultivo Producir y suministrar 3000 litros de medios de cultivo, agua y soluciones requeridos para el aislamiento e identificación de microorganismos en 9 Caja de Petri 00 X5 CON CERTIFICADO DE ANALISIS DE CALIDAD Fisher Brand Se trata de consumibles del equipo dispensador Cole Parmer del área de medios de cultivo Caja por 500 Unidades Elemento de laboratorio SUB. PRODUCCIÓN MISIONAL Subgrupo Medios de Cultivo Realizar el soporte técnico y administrativo de la Subdirección de Producción para garantizar el cumplimiento de los compromisos misionales. 6 Caja de Petri 00 X5 CON CERTIFICADO DE ANALISIS DE CALIDAD Fisher Brand Se trata de consumibles del equipo dispensador Cole Parmer del área de medios de cultivo Caja por 500 Unidades Elemento de laboratorio SUB. PRODUCCIÓN MISIONAL Subgrupo Medios de Cultivo Realizar el soporte técnico y administrativo de la Subdirección de Producción para garantizar el cumplimiento de los compromisos misionales. caja menor Unidad Unidad Caja Menor SUB. PRODUCCIÓN MISIONAL de Producción Realizar el soporte técnico y administrativo de la Subdirección de Producción para garantizar el cumplimiento de los compromisos misionales. caja menor Unidad Unidad Caja Menor SUB. PRODUCCIÓN MISIONAL de Producción Realizar 6000 análisis de control de calidad para asegurar la calidad de los productos de la Subdirección de Producción Cajas De Petri Desechables Estériles de 94X6 Mm. Con certificado de análisis del número del lote que entrega. Unidad Elemento de laboratorio SUB. PRODUCCIÓN MISIONAL Calidad Producir y suministrar 3000 litros de medios de cultivo, agua y soluciones requeridos para el aislamiento e identificación de microorganismos en 5000 Cajas De Petri Desechables Estériles de 94X6 Mm. Con certificado de análisis del número del lote que entrega. Unidad Elemento de laboratorio SUB. PRODUCCIÓN MISIONAL Subgrupo Medios de Cultivo 5000 LICITACION INTERNACIONAL Realizar 6000 análisis de control de calidad para asegurar la calidad de los productos de la Subdirección de Producción. 5 Cajas de petri en poliestireno moldeado, 47 mm de diametro, cierre hermético, estériles con pads Millipore Marca validada para el control microbiológico de aguas Caja Por 50 unidades Elemento de laboratorio SUB. PRODUCCIÓN MISIONAL Calidad Suministrar 00 litros de hemoderivados requeridos por los diferentes grupos del Instituto en el cumplimiento de sus funciones misionales 20 Cajas de plastico con tapa capacidadde 35 Litros transparente multiusos Unidad Unidad Elemento de laboratorio SUB. PRODUCCIÓN MISIONAL Serpentario Producir 0000 viales de antiveneno requerido para el tratamiento del accidente ofídico en el país. 6 Caldo tripticasa Soya con certificado analitico con certificado de calidad Bd Desarrollar un () proyecto de investigación, ciencia y tecnología encaminado al fortalecimiento de las capacidades institucionales en la Calentador electrico para cuarto con deposito de aceite permanentemente sellado para la 63 2 producción y control de calidad de productos de interés para la salud pública del país. transmisión del calor La validación de llenado acértico están validados con la BD Unidad Por Libra Reactivos SUB. PRODUCCIÓN MISIONAL Unidad Unidad Equipo de laboratorio SUB. PRODUCCIÓN MISIONAL Subgrupo Sueros 6 Serpentario Desarrollar un () proyecto de investigación, ciencia y tecnología encaminado al fortalecimiento de las capacidades institucionales en la producción y control de calidad de productos de interés para la salud pública del país. Cámara fotografica digital Unidad Unidad Equipo de laboratorio SUB. PRODUCCIÓN MISIONAL Serpentario Realizar 6000 análisis de control de calidad para asegurar la calidad de los productos de la Subdirección de Producción. Campana de Durham Caja Por 50 unidades Elemento de laboratorio SUB. PRODUCCIÓN MISIONAL Calidad Producir y suministrar 3000 litros de medios de cultivo, agua y soluciones requeridos para el aislamiento e identificación de microorganismos en 2 Campana de Durham Caja Por 50 unidades Elemento de laboratorio SUB. PRODUCCIÓN MISIONAL Subgrupo Medios de Cultivo 2

19 Realizar 6000 análisis de control de calidad para asegurar la calidad de los productos de la Subdirección de Producción. Capacitacion y eventos Unidad Unidad Capacitacion y Eventos SUB. PRODUCCIÓN MISIONAL de Producción Realizar el soporte técnico y administrativo de la Subdirección de Producción para garantizar el cumplimiento de los compromisos misionales. Capacitacion y eventos Unidad Unidad Capacitacion y Eventos SUB. PRODUCCIÓN MISIONAL de Producción Desarrollar un () programa virtual de capacitación para la divulgación del manejo y tratamiento del accidente ofídico y del envenenamiento por animales ponzoñosos Capacitacion virtual Unidad Unidad Capacitacion y Eventos SUB. PRODUCCIÓN MISIONAL de Producción CONCURSO DE MERITOS Producir 0000 viales de antiveneno requerido para el tratamiento del accidente ofídico en el país. 2 Capsula de ultrafiltración 0. micras HF 00 Fiber Flo Producir 0000 viales de antiveneno requerido para el tratamiento del accidente ofídico en el país. 3 Capsula de ultrafiltración 0.2 micras HF 200 Fiber Flo La Fiber Flo se requiere para el cumplimiento de BPM en la producci?n de suero. Se trata de consumibles de equipos de la Fiber Flo y son requeridos para el cumplimiento de BPM Unidad Elemento de laboratorio SUB. PRODUCCIÓN MISIONAL Unidad Elemento de laboratorio SUB. PRODUCCIÓN MISIONAL Subgrupo Sueros 2 Subgrupo Sueros Realizar la adquisición de suministros de oficina, muebles, elementos de consumo, equipos de protección y bioseguridad y servicios de soporte Careta para soldador cara completa Unidad Unidad Elementos Bioseguridad SUB. PRODUCCIÓN MISIONAL de Producción Producir y suministrar 3000 litros de medios de cultivo, agua y soluciones requeridos para el aislamiento e identificación de microorganismos en 3 Carro de laboratorio modelo standar - duty. En acero inoxidable. Soporta hasta 200 lb (9 kg). Unidad Unidad Elemento de laboratorio SUB. PRODUCCIÓN MISIONAL Subgrupo Medios de Cultivo Realizar 6000 análisis de control de calidad para asegurar la calidad de los productos de la Subdirección de Producción. 5 Cartucho Millipore polygard-ct 5 micras 9 3/4 Millipore Consumible de equipos del área de Aseguramiento de la Calidad de Millipore Unidad Unidad Elemento de laboratorio SUB. PRODUCCIÓN MISIONAL Calidad 5 Cartucho millipore tipo vitipore II, medio de filtración en durapore hidrofilico PVDF 0, Producir 0000 viales de antiveneno requerido para el tratamiento del accidente ofídico en el país. Millipore micras de poro 20 CARTUCHO MILLIPORE, TIPO POLYGARD CR, MEDIO DE FILTRACION EN Producir 0000 viales de antiveneno requerido para el tratamiento del accidente ofídico en el país. 2 Millipore POLIPROPILENO, 0.5 MICRAS DE PORO NOMINAL, 0" DE LONGITUD, CODIGO F. CARTUCHO MILLIPORE, TIPO POLYGARD CR, MEDIO DE FILTRACION EN Producir 0000 viales de antiveneno requerido para el tratamiento del accidente ofídico en el país. 2 POLIPROPILENO,.0 MICRAS DE PORO NOMINAL, 0" DE LONGITUD, CODIGO Millipore CERO. CARTUCHO MILLIPORE, TIPO POLYGARD CR, MEDIO DE FILTRACION EN Producir 0000 viales de antiveneno requerido para el tratamiento del accidente ofídico en el país. 2 POLIPROPILENO, 5.0 MICRAS DE PORO NOMINAL, 0" DE LONGITUD, CODIGO Millipore CERO Realizar 6000 análisis de control de calidad para asegurar la calidad de los productos de la Subdirección de Producción. 5 Cartucho polygard-ct micra de poro nominal, en polipropileno dimension 9 3/4 Millipore Se trata de consumibles de equipos de la Millipore y CVBW72PK Unidad Elemento de laboratorio SUB. PRODUCCIÓN MISIONAL son requeridos para el cumplimiento de BPM Se trata de consumibles de equipos de la Millipore y CRA5F006 Unidad Unidad Elemento de laboratorio SUB. PRODUCCIÓN MISIONAL son requeridos para el cumplimiento de BPM Se trata de consumibles de equipos de la Millipore y CR00006 Unidad Unidad Elemento de laboratorio SUB. PRODUCCIÓN MISIONAL son requeridos para el cumplimiento de BPM Se trata de consumibles de equipos de la Millipore y CR Unidad Unidad Elemento de laboratorio SUB. PRODUCCIÓN MISIONAL son requeridos para el cumplimiento de BPM Consumible de equipos del área de Aseguramiento de la Unidad Unidad Elemento de laboratorio SUB. PRODUCCIÓN MISIONAL Calidad de Millipore Subgrupo Sueros Subgrupo Sueros 2 Subgrupo Sueros 2 Subgrupo Sueros 2 Calidad Realizar 6000 análisis de control de calidad para asegurar la calidad de los productos de la Subdirección de Producción. 4 Cartucho Polygard-CT 0 micras 9 3/4 Pulg Millipore Consumible de equipos del área de Aseguramiento de la Calidad de Millipore Unidad Elemento de laboratorio SUB. PRODUCCIÓN MISIONAL Calidad Producir y suministrar animales de laboratorio para atender las necesidades de los clientes internos y externos que requieran el uso de 0 Casilan polvo Frasco por 250 gramos Medicamento SUB. PRODUCCIÓN MISIONAL Serpentario Desarrollar un () proyecto de investigación, ciencia y tecnología encaminado al fortalecimiento de las capacidades institucionales en la producción y control de calidad de productos de interés para la salud pública del país. CENTRÍFUGA DIGITAL VELOCIDAD VARIABLE TEMPORIZADOR DE 60 MIN CON ROTOR PARA 24 HEMATOCRITOS Unidad Unidad Equipo de laboratorio SUB. PRODUCCIÓN MISIONAL Serpentario Realizar la adquisición de suministros de oficina, muebles, elementos de consumo, equipos de protección y bioseguridad y servicios de soporte 2 Chaqueta termica para cuarto frio color oscuro talla XL Unidad Dotación de bioseguridad SUB. PRODUCCIÓN MISIONAL de Producción Realizar la adquisición de suministros de oficina, muebles, elementos de consumo, equipos de protección y bioseguridad y servicios de soporte 25 Churrusco para el lavado de material largo de 40 cms x 0,5 cms con mecha Unidad Equipos y suministros de aseo SUB. PRODUCCIÓN MISIONAL de Producción Realizar la adquisición de suministros de oficina, muebles, elementos de consumo, equipos de protección y bioseguridad y servicios de soporte 35 Churrusco Para Lavar Pipetas Grande 30 cmpor cm Cerda Negra Unidad Unidad Equipos y suministros de aseo SUB. PRODUCCIÓN MISIONAL de Producción Realizar la adquisición de suministros de oficina, muebles, elementos de consumo, equipos de protección y bioseguridad y servicios de soporte 95 Churrusco Para Limpiar Material De Vidrio Diametro 8Cm, Largo 40 Cm. Unidad Unidad Equipos y suministros de aseo SUB. PRODUCCIÓN MISIONAL de Producción Realizar la adquisición de suministros de oficina, muebles, elementos de consumo, equipos de protección y bioseguridad y servicios de soporte 69 Churruscos Para Lavado De Material Largo 2.5 Cmpor2.5 Cm Unidad Unidad Equipos y suministros de aseo SUB. PRODUCCIÓN MISIONAL de Producción Realizar la adquisición de suministros de oficina, muebles, elementos de consumo, equipos de protección y bioseguridad y servicios de soporte 38 Churruscos Para Lavado De Material Largo 2 Cmpor2.0 Cm Unidad Unidad Equipos y suministros de aseo SUB. PRODUCCIÓN MISIONAL de Producción Producir y suministrar 3000 litros de medios de cultivo, agua y soluciones requeridos para el aislamiento e identificación de microorganismos en 50 Cinta control autoclave. Rollo Papeleria y elementos de oficina SUB. PRODUCCIÓN MISIONAL Subgrupo Medios de Cultivo Producir y suministrar 3000 litros de medios de cultivo, agua y soluciones requeridos para el aislamiento e identificación de microorganismos en Citrato de magnesio C6H607mg Merck Con esta se tiene estandarizada la técnica para INVIMA en el uso de medios de cultivo en sus procedimientos. Frasco Por 500 gramos Reactivos SUB. PRODUCCIÓN MISIONAL Subgrupo Medios de Cultivo Producir y suministrar animales de laboratorio para atender las necesidades de los clientes internos y externos que requieran el uso de 20 Clorhexidina Frasco Por 000 ml Frasco Por 000 ml Medicamento SUB. PRODUCCIÓN MISIONAL Serpentario Realizar 6000 análisis de control de calidad para asegurar la calidad de los productos de la Subdirección de Producción. CLOROFORMO PARA ANALISIS EMSURETM ACS,ISO,REAG. PH EUR Frasco Por 2.5 Litros Reactivos SUB. PRODUCCIÓN MISIONAL Calidad Producir 0000 viales de antiveneno requerido para el tratamiento del accidente ofídico en el país. 8 Cloruro de benzalconio al % con certificado analitico Galon por 3.5 litros Desinfectantes SUB. PRODUCCIÓN MISIONAL Subgrupo Sueros Realizar la adquisición de suministros de oficina, muebles, elementos de consumo, equipos de protección y bioseguridad y servicios de soporte 2 cloruro de benzalconio al 0% Galon Por 2.5 Litros Reactivos SUB. PRODUCCIÓN MISIONAL de Producción Producir 0000 viales de antiveneno requerido para el tratamiento del accidente ofídico en el país. 88 Cloruro de sodio USP sin yodo Bolsa Por Kg Reactivos SUB. PRODUCCIÓN MISIONAL Producir 0000 viales de antiveneno requerido para el tratamiento del accidente ofídico en el país. Conductivímetro Multi-rango con Compensación Automática de Tempr Unidad Unidad Equipo de laboratorio SUB. PRODUCCIÓN MISIONAL Subgrupo Sueros 88 Subgrupo Sueros Realizar 6000 análisis de control de calidad para asegurar la calidad de los productos de la Subdirección de Producción. 5 Conejo Blanco Unidad animales SUB. PRODUCCIÓN MISIONAL Calidad Realizar 6000 análisis de control de calidad para asegurar la calidad de los productos de la Subdirección de Producción. Conjugado anti IgG equino, do con peroxidasa con fecha de vigencia superior a 3 años Frasco Por 2 ml Reactivos SUB. PRODUCCIÓN MISIONAL Calidad Producir y suministrar 3000 litros de medios de cultivo, agua y soluciones requeridos para el aislamiento e identificación de microorganismos en Consumible filtro multimedios 6x35 (FMM6X35) EQUIPO ELIX 0 Millipore Se trata de un consumible de un equipo de la Unidad Elemento de laboratorio SUB. PRODUCCIÓN MISIONAL Subgrupo Medios de Cultivo Producir y suministrar 3000 litros de medios de cultivo, agua y soluciones requeridos para el aislamiento e identificación de microorganismos en Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL Subgrupo Medios de Cultivo Elaborar un documento que dé cuenta de las actividades de investigación y desarrollo tendientes a la producción y/o comercialización directa y/o mediante alianzas o asociaciones estratégicas de antivenenos no disponibles en el país Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL de Producción Desarrollar el programa anual de aseguramiento de calidad para medicamentos, medios de cultivo y animales de laboratorio desarrollado para el cumplimiento de Buenas Prácticas de Manufactura en los productos de la Subdirección. Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL Calidad Desarrollar el programa anual de aseguramiento de calidad para medicamentos, medios de cultivo y animales de laboratorio desarrollado para el cumplimiento de Buenas Prácticas de Manufactura en los productos de la Subdirección. Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL Calidad Elaborar un documento que dé cuenta de las estrategias de mercadeo y comercialización de los bienes y servicios de la Subdirección de Producción implementadas Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL de Producción Realizar el soporte técnico y administrativo de la Subdirección de Producción para garantizar el cumplimiento de los compromisos misionales. Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL de Producción Realizar el soporte técnico y administrativo de la Subdirección de Producción para garantizar el cumplimiento de los compromisos misionales. Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL de Producción Realizar el soporte técnico y administrativo de la Subdirección de Producción para garantizar el cumplimiento de los compromisos misionales. Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL de Producción Realizar el soporte técnico y administrativo de la Subdirección de Producción para garantizar el cumplimiento de los compromisos misionales. Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL de Producción Realizar el soporte técnico y administrativo de la Subdirección de Producción para garantizar el cumplimiento de los compromisos misionales. Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL de Producción Realizar el soporte técnico y administrativo de la Subdirección de Producción para garantizar el cumplimiento de los compromisos misionales. Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL de Producción Realizar el soporte técnico y administrativo de la Subdirección de Producción para garantizar el cumplimiento de los compromisos misionales. Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL Calidad

20 Realizar el soporte técnico y administrativo de la Subdirección de Producción para garantizar el cumplimiento de los compromisos misionales. Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL de Producción Realizar el soporte técnico y administrativo de la Subdirección de Producción para garantizar el cumplimiento de los compromisos misionales. Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL de Producción Realizar el soporte técnico y administrativo de la Subdirección de Producción para garantizar el cumplimiento de los compromisos misionales. Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL de Producción Realizar el soporte técnico y administrativo de la Subdirección de Producción para garantizar el cumplimiento de los compromisos misionales. Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL de Producción Realizar el soporte técnico y administrativo de la Subdirección de Producción para garantizar el cumplimiento de los compromisos misionales. Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL de Producción Realizar el soporte técnico y administrativo de la Subdirección de Producción para garantizar el cumplimiento de los compromisos misionales. Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL de Producción Producir y suministrar animales de laboratorio para atender las necesidades de los clientes internos y externos que requieran el uso de Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL Laboratorio Suministrar 00 litros de hemoderivados requeridos por los diferentes grupos del Instituto en el cumplimiento de sus funciones misionales Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL Serpentario Suministrar 00 litros de hemoderivados requeridos por los diferentes grupos del Instituto en el cumplimiento de sus funciones misionales Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL Serpentario Suministrar 00 litros de hemoderivados requeridos por los diferentes grupos del Instituto en el cumplimiento de sus funciones misionales Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL Serpentario Suministrar 00 litros de hemoderivados requeridos por los diferentes grupos del Instituto en el cumplimiento de sus funciones misionales Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL Serpentario Suministrar 00 litros de hemoderivados requeridos por los diferentes grupos del Instituto en el cumplimiento de sus funciones misionales Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL Serpentario Producir 0000 viales de antiveneno requerido para el tratamiento del accidente ofídico en el país. Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL Producir 0000 viales de antiveneno requerido para el tratamiento del accidente ofídico en el país. Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL Producir 0000 viales de antiveneno requerido para el tratamiento del accidente ofídico en el país. Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL Producir 0000 viales de antiveneno requerido para el tratamiento del accidente ofídico en el país. Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL Producir 0000 viales de antiveneno requerido para el tratamiento del accidente ofídico en el país. Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL Producir 0000 viales de antiveneno requerido para el tratamiento del accidente ofídico en el país. Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL Producir 0000 viales de antiveneno requerido para el tratamiento del accidente ofídico en el país. Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL Producir 0000 viales de antiveneno requerido para el tratamiento del accidente ofídico en el país. Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL Producir 0000 viales de antiveneno requerido para el tratamiento del accidente ofídico en el país. Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL Producir 0000 viales de antiveneno requerido para el tratamiento del accidente ofídico en el país. Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL Producir 0000 viales de antiveneno requerido para el tratamiento del accidente ofídico en el país. Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL Producir 0000 viales de antiveneno requerido para el tratamiento del accidente ofídico en el país. Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL Subgrupo Sueros Subgrupo Sueros Subgrupo Sueros Subgrupo Sueros Subgrupo Sueros Subgrupo Sueros Subgrupo Sueros Subgrupo Sueros Subgrupo Sueros Subgrupo Sueros Subgrupo Sueros Subgrupo Sueros Producir y suministrar 3000 litros de medios de cultivo, agua y soluciones requeridos para el aislamiento e identificación de microorganismos en Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL Subgrupo Medios de Cultivo Realizar 6000 análisis de control de calidad para asegurar la calidad de los productos de la Subdirección de Producción. Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL Calidad Realizar 6000 análisis de control de calidad para asegurar la calidad de los productos de la Subdirección de Producción. Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL Calidad Realizar 6000 análisis de control de calidad para asegurar la calidad de los productos de la Subdirección de Producción. Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL Calidad Realizar 6000 análisis de control de calidad para asegurar la calidad de los productos de la Subdirección de Producción. Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL Calidad Realizar 6000 análisis de control de calidad para asegurar la calidad de los productos de la Subdirección de Producción. Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL Calidad Realizar 6000 análisis de control de calidad para asegurar la calidad de los productos de la Subdirección de Producción. Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL Calidad Producir y suministrar animales de laboratorio para atender las necesidades de los clientes internos y externos que requieran el uso de Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL Laboratorio Producir y suministrar 500 animales de laboratorio de status sanitario libres de patógenos específicos requeridos en proyectos de investigación, diagnóstico y pruebas biológicas de control de calidad que demanden su uso Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL Grupo Produccion y Desarrollo Tecnologico Realizar 6000 análisis de control de calidad para asegurar la calidad de los productos de la Subdirección de Producción. Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL Calidad Realizar 6000 análisis de control de calidad para asegurar la calidad de los productos de la Subdirección de Producción. Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL Calidad Producir y suministrar animales de laboratorio para atender las necesidades de los clientes internos y externos que requieran el uso de Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL Laboratorio Producir 0000 viales de antiveneno requerido para el tratamiento del accidente ofídico en el país. Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL Subgrupo Sueros Suministrar 00 litros de hemoderivados requeridos por los diferentes grupos del Instituto en el cumplimiento de sus funciones misionales Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL Serpentario Producir y suministrar 3000 litros de medios de cultivo, agua y soluciones requeridos para el aislamiento e identificación de microorganismos en Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL Subgrupo Medios de Cultivo Realizar el soporte técnico y administrativo de la Subdirección de Producción para garantizar el cumplimiento de los compromisos misionales. Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL de Producción Realizar la adquisición de suministros de oficina, muebles, elementos de consumo, equipos de protección y bioseguridad y servicios de soporte Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL de Producción Realizar 6000 análisis de control de calidad para asegurar la calidad de los productos de la Subdirección de Producción. Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL Calidad Realizar la adquisición de suministros de oficina, muebles, elementos de consumo, equipos de protección y bioseguridad y servicios de soporte Contrato prestación servicios Servicios personales SUB. PRODUCCIÓN MISIONAL de Producción Realizar la adquisición de suministros de oficina, muebles, elementos de consumo, equipos de protección y bioseguridad y servicios de soporte Convenios Interinstitucionales Convenio Interinstitucional SUB. PRODUCCIÓN MISIONAL de Producción Producir y suministrar animales de laboratorio para atender las necesidades de los clientes internos y externos que requieran el uso de Convenios Interinstitucionales Convenio Interinstitucional SUB. PRODUCCIÓN MISIONAL de Producción Producir 0000 viales de antiveneno requerido para el tratamiento del accidente ofídico en el país. Convenios Interinstitucionales Convenio Interinstitucional SUB. PRODUCCIÓN MISIONAL de Producción Suministrar 00 litros de hemoderivados requeridos por los diferentes grupos del Instituto en el cumplimiento de sus funciones misionales 0 Desactivador de agujas Unidad Unidad Elemento de laboratorio SUB. PRODUCCIÓN MISIONAL Serpentario Suministrar 00 litros de hemoderivados requeridos por los diferentes grupos del Instituto en el cumplimiento de sus funciones misionales Desecadores para laboratorio en resina de polimetilmetacrilato dimensiones (WxDxH): 30X30X50 Unidad Unidad Elemento de laboratorio SUB. PRODUCCIÓN MISIONAL Serpentario Realizar 6000 análisis de control de calidad para asegurar la calidad de los productos de la Subdirección de Producción. Dicromato de potasio alta pureza frasco por 00 g. MERCK Merck Técnicas de control de calidad estandarizadas con reactivo Merck Frasco Por 00 gramos Reactivos SUB. PRODUCCIÓN MISIONAL Calidad

((2S)-2-(2-methoxyphenyl)sulfanyl-N-(2-oxo-1,3-dihydrobenzimidazol-5- yl)propanamide) 2 vialesx50mg UORSY PB898624552 Caja 2340000 2340000

((2S)-2-(2-methoxyphenyl)sulfanyl-N-(2-oxo-1,3-dihydrobenzimidazol-5- yl)propanamide) 2 vialesx50mg UORSY PB898624552 Caja 2340000 2340000 1 - Fortalecer la oficina de Sistemas de Información mediante la contratación de recurso humano calificado en la plataforma tecnica del INS, así como en el apoyo de las labores de coordinación

Más detalles



Más detalles



Más detalles


ACCESORIOS DE SEGURIDAD CATÁLOGO ACCESORIOS DE SEGURIDAD CATÁLOGO 2013 LENTES 01 Lentes Protectores Contra Químicos Ventilación Indirecta Material Suave, Flexible y Liviano Lente Duradero de Policarbonato Ideal para Proteger Contra Impacto,

Más detalles

Polig. Ind. A Grela Gambrinus, 38 15008-Coruña Telf. 34 981275707 Fax 34 981272882 www. Email:

Polig. Ind. A Grela Gambrinus, 38 15008-Coruña Telf. 34 981275707 Fax 34 981272882 www. Email: Polig. Ind. A Grela Gambrinus, 38 15008-Coruña Telf. 34 981275707 Fax 34 981272882 www. Email: Polig. Ind. A Grela Gambrinus, 38 15008-Coruña Telf. 34 981275707 Fax 34

Más detalles

Mantenimiento y reparación de tubos

Mantenimiento y reparación de tubos Mantenimiento y reparación de tubos Amplia selección de una fuente única. Diseños duraderos exclusivos. Rendimiento rápido y fiable. Tipo s Página. Bombas de prueba de presión 2 9.2 Congeladores de tubos

Más detalles


ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles


ANEXO N 1 PRIMERA ENTREGA ELEMENTOS DE PAPELERÍA N CANTIDAD DESCRIPCIÓN DEL ELEMENTO ESPECIFICACION TECNICA Almohadilla para sello, de forma rectangular, 1 5 ALMOHADILLA MEDIANA PARA SELLOS dimensiones mayor a 100 x 150 mm, y material de la carcasa en

Más detalles


GRANULADA 1% PAQUETE X 500 GR 443 GRANULADO 22% FRASCO X 1KG 1.651 GRANULADO 22% PAQUETE X 500 GR 17 Nombre de producto Stock a nivel país al 14/10/2013 Forma farmacéutica/ Especificaciones Concentración técnicas Presentación Cantidad 1 ABACAVIR 300 MG COMPRIMIDO BLISTER X 10 7.230 2 ABACAVIR 300 MG COMPRIMIDO

Más detalles

Decenio de las Personas con Discapacidad en el Perú Año de la Integración Nacional y el Reconocimiento de Nuestra Diversidad

Decenio de las Personas con Discapacidad en el Perú Año de la Integración Nacional y el Reconocimiento de Nuestra Diversidad Decenio de las Personas con Discapacidad en el Perú Año de la Integración Nacional y el Reconocimiento de Nuestra Diversidad ESPECIFICACIONES TECNICAS ADQUISICION DE MESAS EDUCATIVAS PARA LA ESCUELA NACIONAL

Más detalles



Más detalles



Más detalles



Más detalles



Más detalles

AGOSTO 2013. CONTENEDOR MIDI de 4 litros sin tapa, para hielo, color negro. CONTENEDOR MIDI de 4 litros con tapa, para hielo, color azul

AGOSTO 2013. CONTENEDOR MIDI de 4 litros sin tapa, para hielo, color negro. CONTENEDOR MIDI de 4 litros con tapa, para hielo, color azul PROMOCIONES VIGENTES Materiales de entrega inmediata a precios reducidos. Disponibilidad salvo venta Precios más flete al interior de Ia república. Venta final. No se aceptan devoluciones o intercambios.

Más detalles


COLECCIÓN DACIA 08.09 COLECCIÓN DACIA 08.09 TEXTIL COLECCIÓN DACIA 08.09 Camiseta azul marino Dacia 100% algodón, serigrafía en el pecho, lado izquierdo. Precio: 6 S : 7711426251 M : 7711426252 L : 7711426253 XL : 7711426254

Más detalles

Se solicita registrar sus precotizaciones a los siguientes contactos: FECHA LÍMITE DE RECEPCION DE PRECOTIZACIONES: 25 DE SEPTIEMBRE DE 2012

Se solicita registrar sus precotizaciones a los siguientes contactos: FECHA LÍMITE DE RECEPCION DE PRECOTIZACIONES: 25 DE SEPTIEMBRE DE 2012 El Servicio Nacional de Aprendizaje SENA, de conformidad con los principios de transparencia para la contratación, convoca públicamente a todos los interesados a participar con sus PRECOTIZACIONES, como

Más detalles

INTRODUCCIÓN A LA METODOLOGÍA MOLECULAR. 2002 `Derechos Reservados Pontificia Universidad Javeriana Instituto de Genética Humana Bogotá COLOMBIA

INTRODUCCIÓN A LA METODOLOGÍA MOLECULAR. 2002 `Derechos Reservados Pontificia Universidad Javeriana Instituto de Genética Humana Bogotá COLOMBIA INTRODUCCIÓN A LA METODOLOGÍA MOLECULAR 2002 `Derechos Reservados Pontificia Universidad Javeriana Instituto de Genética Humana Bogotá COLOMBIA Equipos de Laboratorio Un equipo de laboratorio es un conjunto

Más detalles

IMPLEMENTOS DE LABORATORIO Acidómetro o aerómetro 0-30

IMPLEMENTOS DE LABORATORIO Acidómetro o aerómetro 0-30 IMPLEMENTOS DE LABORATORIO Acidómetro o aerómetro 0-30 Alcoholímetro 1-100 Agitador en vidrio 0.6 x 20 cm Agitador en vidrio 8 Mm x 30 cm Agitador en vidrio 12 Mm x 50 cm Balanza electrónica x 5kl Balanza

Más detalles


EUROTUBO DELTALAB 4. PLACAS Y ASAS 81 82 Placa Petri 90 x 14 mm Fabricadas en poliestireno. Con tres vientos. Presentadas en bolsas cerradas por calor de 20 unidades. Código 200200 aséptico. Código 200209 estéril por radiación. Aptas para

Más detalles


MODELO INTEGRADO DE PLANEACIÓN Y GESTIÓN 2014 MODELO INTEGRADO DE PLANEACIÓN Y GESTIÓN 204 Política: GESTIÓN MISIONAL Y DE GOBIERNO Formulación Plan de Acción Plan de acción Plan de acción aprobado ene-4 ene-4 Indicadores y metas de Gobierno (3) Publicar

Más detalles


CONSEJO DE SALUBRIDAD GENERAL (Primera Sección) DIARIO OFICIAL Jueves 27 de agosto de 2015 CONSEJO DE SALUBRIDAD GENERAL TERCERA Actualización de la Edición 2014 del Cuadro Básico y Catálogo de Auxiliares de Diagnóstico. Al margen

Más detalles


SOLICITUD DE INFORMACION PARA LA ELABORACIÓN DEL ESTUDIO DE MERCADO. y SOLICITUD DE INFORMACION PARA LA ELABORACIÓN DEL ESTUDIO DE MERCADO El Centro Nacional de Hoteleria, Turismo y Alimentos - SENA, de conformidad con los principios de transparencia para la contratación,

Más detalles


ESPECIFICACIONES GENERALES DE MOBILIARIO BANCOLDEX ESPECIFICACIONES GENERALES DE MOBILIARIO BANCOLDEX GENERALIDADES Los productos requeridos deberán ser modulares, funcionales, prácticos y apropiados para el ambiente de oficina a que estarán destinados.

Más detalles

Sistema único de habilitación en los Servicios de toma de muestra y laboratorios clínico SOGCSSS Resolución 1441 de 2013

Sistema único de habilitación en los Servicios de toma de muestra y laboratorios clínico SOGCSSS Resolución 1441 de 2013 DADIS Dirección Operativa Vigilancia y Control Sistema único de habilitación en los Servicios de toma de muestra y laboratorios clínico SOGCSSS Resolución 1441 de 2013 Cesar Meza Rojas - Bacteriólogo Especialista

Más detalles


MALLAS Y PLÁSTICOS 2015 MALLAS Y PLÁSTICOS 2015 Especial OTOÑO 2015 Avda. de Gijón, 73-75, 47009 Valladolid 983 350 382 619 372 573 @ 28/09/2015 INDICE INDICE 2 MALLAS Y JARDINERIA 4 MALLA ANTIHIERBA 4 GEOTEXTIL ANTIHIERBA PLANTEX

Más detalles

11.1- Descripción breve de los laboratorios especializados del Posgrado en Ciencias (Ciencias Biológicas).

11.1- Descripción breve de los laboratorios especializados del Posgrado en Ciencias (Ciencias Biológicas). 11.1- Descripción breve de los laboratorios especializados del Posgrado en Ciencias (Ciencias Biológicas). UNIDAD DE BIOQUÍMICA Y BIOLOGÍA MOLECULAR DE PLANTAS ESPACIOS Y EQUIPOS COMUNES La Unidad de Bioquímica

Más detalles

Parte II. Requisitos de los Bienes y Servicios, Sección VII. Lista de Requisitos

Parte II. Requisitos de los Bienes y Servicios, Sección VII. Lista de Requisitos ENMIENDA No. 1 Para: Oferentes Interesados SS-PICSC-LPI-031-2015 No. de Páginas: 07 Fecha: 03 de Agosto de 2015 Unidad Coordinadora de Programa Programa de Apoyo a la Implementación de la Política Integral

Más detalles

Llaveros Masivos Llaveros Corporativos Herramientas Jarras y tazas Variedad

Llaveros Masivos Llaveros Corporativos Herramientas Jarras y tazas Variedad Llaveros Masivos Llaveros Corporativos Herramientas Jarras y tazas Variedad CREATIVAS PRODUCIENDO!!! LLAVERO FLEXIGOMA FABRICADO EN VARIAS FORMAS AMG 1123 LLAVERO EN FORMA DE CAUCHO CON CINTA METRICA 1MTS

Más detalles


LABNOVA DISTRIBUCIONES, S.L. Productos químicos de uso alimentario. Análisis instrumental. Consumibles para técnicas instrumentales. Papel de filtro para laboratorio. Membranas filtrantes. Sistemas de filtración. Fungible para biología

Más detalles



Más detalles

Plaza de Armas No. 1 / Col. Centro / C.P. 74200 / Tel. (244) 44 5 00 28 y 44 5 02 81

Plaza de Armas No. 1 / Col. Centro / C.P. 74200 / Tel. (244) 44 5 00 28 y 44 5 02 81 SMA COMUNICACIONES, S.A. DE C.V. PRESENTE. El que suscribe Ing. Raúl López Zitle, Secretario Técnico del Comité Municipal de Adjudicaciones del H. Ayuntamiento de Atlixco, Puebla, por este medio y con

Más detalles

DIGESTORES RAPIDOS. Características y Beneficios

DIGESTORES RAPIDOS. Características y Beneficios DIGESTORES RAPIDOS Características y Beneficios El controlador de estado sólido está calibrado de fábrica con control de temperatura progresivo desde temperatura de ambiente hasta 450º C. El control triac

Más detalles



Más detalles



Más detalles



Más detalles

-50 bandejas plásticas resistentes a ácidos y álcalis de 45x50 x 10 cm de altura

-50 bandejas plásticas resistentes a ácidos y álcalis de 45x50 x 10 cm de altura República Argentina Préstamo BID 1950/OC-AR Programa de Gestión de la Sanidad y Calidad Agroalimentaria Contratante: Servicio Nacional de Sanidad y Calidad Agroalimentaria (SENASA) CONCURSO DE PRECIOS

Más detalles



Más detalles



Más detalles



Más detalles

Aseguramiento de la Calidad en Equipos de Laboratorio. Temas Selectos de Calidad en Serología BIO-RAD

Aseguramiento de la Calidad en Equipos de Laboratorio. Temas Selectos de Calidad en Serología BIO-RAD Aseguramiento de la Calidad en Equipos de Laboratorio Temas Selectos de Calidad en Serología BIO-RAD México, DF. 09-dic-2009 Enfoque Integral de un Sistema de Gestión n de Calidad. SGC PLANEAR el SGC mediante:

Más detalles

COLOMBIA EMPACK SAS. Película Stretch Film, Termoencogibles, extensibles de alimentos,

COLOMBIA EMPACK SAS. Película Stretch Film, Termoencogibles, extensibles de alimentos, QUIENES SOMOS? COLOMBIA EMPACK SAS., es una empresa, dedicada a distribuir la Película Stretch Film, Termoencogibles, extensibles de alimentos, y demás productos afines para empaque y embalaje, ofreciendo

Más detalles


PLAN OPERATIVO ANUAL DE INVERSIONES PLAN DE ACCIÓN : Formular planes sectoriales a corto, mediano y largo plazo. ACTUALIZACION PLANEAMIENTO INTEGRAL DEL SECTOR MINERO COLOMBIANO NACIONAL Caracterización de escalas de minería por tipo de mineral como insumo

Más detalles



Más detalles

ALCALDÍA MAYOR DE BOGOTÁ, DISTRITO CAPITAL Banco Distrital de Programas y Proyectos

ALCALDÍA MAYOR DE BOGOTÁ, DISTRITO CAPITAL Banco Distrital de Programas y Proyectos Plan de Desarrollo Eje estratégico Programa VERÓN FORMATO FICHA EBI: 03 Banco Distrital de Programas y s 1. Banco BDPP-ACEP (ADMINISTRACION CENTRAL Y ESTABLECIMIENTOS PUBLICOS) Estado INSCRITO el 14-Julio-2009,

Más detalles


CUBETAS DE ELECTROFORESIS HORIZONTAL CUBETAS DE ELECTROFORESIS HORIZONTAL Las cubetas horizontales Scie-Plas disponen de tapa de seguridad con desconexión automática de apertura y tanque transparente al UV para visualizar los geles. Serie

Más detalles



Más detalles



Más detalles


EQUIPOS LUBRICACION Y ENGRASE EQUIPOS LUBRICACION Y ENGRASE BOMBA MANUAL Bomba de trasvase manual rotativa para todo tipo de líquidos (en especial para lubricantes de alta viscosidad). Caudal: 40 litros por minuto. BO-MA02 BOMBA MANUAL

Más detalles


5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN 5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN Materiales - Eppendorf de 1,5 ml estériles - Eppendorf de pared fina para PCR - Puntas de pipeta estériles desechables - Guantes

Más detalles

A continuación se relacionan las referencias del mobiliario de acuerdo, al cuadro de cantidades de los términos de referencia 003 de 2015.

A continuación se relacionan las referencias del mobiliario de acuerdo, al cuadro de cantidades de los términos de referencia 003 de 2015. ADENDA #PROCESO LICITATORIO SUMINISTRO DE MOBILIARIO TERMINOS DE REFERENCIA 003 DE 2015. A continuación se relacionan las referencias del mobiliario de acuerdo, al cuadro de cantidades de los términos

Más detalles



Más detalles

COMUNICADO No.01 Bogotá, 12 de marzo de 2009


Más detalles



Más detalles



Más detalles

Reglamento de uso y consideraciones generales del laboratorio de cultivo de células animales (Aprobado por CoDep DBBE e IFIByNE; Septiembre 2009)

Reglamento de uso y consideraciones generales del laboratorio de cultivo de células animales (Aprobado por CoDep DBBE e IFIByNE; Septiembre 2009) Reglamento de uso y consideraciones generales del laboratorio de cultivo de células animales (Aprobado por CoDep DBBE e IFIByNE; Septiembre 2009) Departamento de Biodiversidad y Biología Experimental (DBBE)

Más detalles


PROCEDIMIENTO GESTIÓN TICS . OBJETIVO Asesorar, preservar y mantener toda la infraestructura en tecnologías de la información y de comunicaciones en equipos de programas informáticos y medios de comunicación para reunir, almacenar,

Más detalles

Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala

Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala IICA/Red SICTA-CIAT INFORME DE AVANCE Gerardo Gallego - Harold

Más detalles


PROCEDIMIENTO VERSION: 01 ADMINISTRACIÓN DE HARDWARE, SOFTWARE Y COMUNICACIONES INFORMÁTICAS PROCESO GESTION DE LA EDUCACIÓN PROCESO GESTION DE LA EDUCACIÓN PAGINA: 1 de 9 1 OBJETIVO Planear, desarrollar y controlar las actividades relacionadas con los recursos físicos de tecnología e informática para brindar el correcto, oportuno

Más detalles



Más detalles

ANEXO I. Inmunofenotipificación Celular por Citometría de Flujo

ANEXO I. Inmunofenotipificación Celular por Citometría de Flujo ANEXO I Inmunofenotipificación Celular por Citometría de Flujo Reactivos Anticuerpos monoclonales fluoromarcados (BD Bioscience Pharmingen) Medio DMEM con 0.02% de azida de sodio Paraformaldehido (PFA)

Más detalles



Más detalles


PRACTICA N 1 RECONOCIMIENTO DEL EQUIPO DE LABORATORIO PRACTICA N 1 RECONOCIMIENTO DEL EQUIPO DE LABORATORIO Objetivo: Conocer detalladamente cada instrumento utilizado en las prácticas de microbiología (forma, uso, material con el que está elaborado etc.).

Más detalles


DOTACIONES INDUSTRIALES DOTACIONES INDUSTRIALES Overoles Jean Blusa y camisa en Oxford Vigilancia Camisetas Tipo Polo y T-Shirt Calzado y Seguridad Industrial Cra. 96 J No. 23 A -22 Teléfono: 5409012 Celular: (317) 6552091 -

Más detalles

Estándares generales para Bancos de Sangre

Estándares generales para Bancos de Sangre Régimen de Garantías Explícitas en Salud Garantía de Calidad Estándares mínimos de acreditación para los prestadores institucionales autorizados: Estándares generales para Bancos de Sangre Ministerio de

Más detalles

Congelador biológico CM-2000

Congelador biológico CM-2000 Congelador biológico CM-2000 El proceso de criopreservación La criopreservación permite preservar células a largo plazo y su almacenamiento por periodos muy largos. Sin embargo, el mecanismo de congelación

Más detalles



Más detalles



Más detalles

Administrar los procesos, actividades y recursos de las áreas y sistemas de informática y desarrollo tecnológico;

Administrar los procesos, actividades y recursos de las áreas y sistemas de informática y desarrollo tecnológico; A. Funciones: Dirección de Tecnologías de la Información: es la dependencia responsable de administrar los recursos y sistemas del Ministerio y de las entidades con las que éste comparte recursos informáticos,

Más detalles



Más detalles


DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082 Página 1 de 5 1. OBJETIVO Detectar la presencia de Campylobacter jejuni en hamburguesa de pollo mediante técnica de PCR. 2. CAMPO DE APLICACIÓN Y ALCANCE Aplicar este procedimiento a muestras de hamburguesa

Más detalles


LOS PRODUCTOS DE ALDO LOS PRODUCTOS DE ALDO MATERIAL CIENTIFICO CATÁLOGO Nº 2 LOS ÚNICOS S VÁLIDOS SON LOS QUE APARECEN EN LA WEB Oferta válida desde 26-09-11 hasta 1-01-13 Y además Ahorre el 15% adicional en muchos de nuestros

Más detalles


FORMATO RECURSOS FÍSICOS E INVENTARIOS 1. INVENTARIO DE BIENES MUEBLES FORMATO RECURSOS FÍSICOS E INVENTARIOS 1. INVENTARIO DE BIENES MUEBLES Bienes muebles asignados Dependencia y Servidor publico responsable No. de identificación del bien Fecha de adquisición Precio de

Más detalles

Sistema Milliflex Quantum Sistema de detección microbiológica rápida por tinción fluorescente, no destructivo y fácil de usar

Sistema Milliflex Quantum Sistema de detección microbiológica rápida por tinción fluorescente, no destructivo y fácil de usar Data Sheet Ficha técnica Sistema Milliflex Quantum Sistema de detección microbiológica rápida por tinción fluorescente, no destructivo y fácil de usar Método no destructivo que permite la identificación

Más detalles



Más detalles

Cantidad [Maximo 10 digitos] Valor Presupuestado

Cantidad [Maximo 10 digitos] Valor Presupuestado 6 12 12 24000 ALMOHADILLA DACTILAR 6 12 12 28800 ALMOHADILLA PARA SELLOS MEDIANAS 6 12 12 17844 BORRADOR PARA TABLERO ACRILICO 6 12 1000 925000 CARPETA ARCHIVO

Más detalles



Más detalles

Nº de Oficio Fecha Importe con I.V.A. Programa REPSS/DA/SRF/138/2012 19-Marzo-2012 $3,581,000.00 Seguro Popular


Más detalles



Más detalles


GUÍA RÁPIDA STERRAD 100S GUÍA RÁPIDA STERRAD 100S TECNOLOGÍA GAS PLASMA El esterilizador Sterrad 100S esteriliza productos sanitarios por difusión de peróxido de hidrógeno dentro de la cámara y por estimulación electromagnética

Más detalles

Regional Distrito Capital

Regional Distrito Capital El Centro de Formación en Actividad Física y Cultura del Servicio Nacional de Aprendizaje SENA, de conformidad con los principios de transparencia para la contratación, convoca públicamente a todos los

Más detalles



Más detalles


ESTUDIO DE MERCADO Y ANÁLISIS ECONOMICO DEL SECTOR (CAPITULO VI Artículo 15 del Decreto 1510 de 2013) ESTUDIO DE MERCADO Y ANÁLISIS ECONOMICO DEL SECTOR (CAPITULO VI Artículo 15 del Decreto 1510 de 2013) El Servicio Nacional de Aprendizaje SENA, de conformidad con los principios de transparencia para la

Más detalles

Plan de Compras Vigencia 2005

Plan de Compras Vigencia 2005 Plan de Compras Vigencia 2005 1.1 Objetivos El objeto general del Plan de Compras de la Contaduría General de la Nación es el de satisfacer oportunamente las necesidades logísticas de las áreas misionales

Más detalles


PLIEGO DE PRESCRIPCIONES TECNICAS PLIEGO DE PRESCRIPCIONES TECNICAS ASTILLERO DE REPARACIONES Página: 1/16 1. ALCANCE DE LA OBRA: Reemplazo de las redes de fluidos en el Astillero de Navantia Reparaciones Cádiz, por razones de gran deterioro

Más detalles

Proyecto No: 000000001642 (Formulación Detallada)

Proyecto No: 000000001642 (Formulación Detallada) Proyecto No: 000000001642 (Formulación Detallada) (Sin Definir) 6-CONSOLIDAR CAPACITACIONES... Proyecto Padre Empresa Nombre SOSTENIBILIDAD DE LA INFRAESTRUCTURA FÍSICA DE LA SEDE AMAZONIA AMAZONÍA Identificación

Más detalles


1.8 TECNOLOGÍA DE LA INFORMACIÓN Objetivo General: 1.8 TECNOLOGÍA DE LA INFORMACIÓN Establecer una infraestructura y plataforma tecnológica y de sistemas de información, y definir las políticas, estrategias y directrices para su implantación

Más detalles


CATALOGO ROPA LABORAL Y EPI S CATALOGO ROPA LABORAL Y EPI S Buzo Trabajo Poliéster/Algodón Buzo con cremallera de nylon y tapeta, cuello camisero, un bolsillo de pecho con cremallera, media cintura con goma embutida dos bolsillos de

Más detalles



Más detalles



Más detalles


AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO E l estudio del genoma de los seres vivos a sido uno d los principales objetivos de la Biología. Desde los trabajos de Mendel (1866),

Más detalles


FICHA TECNICA DE ESPECIFICACIONES NOMBRE DEL ELEMENTO: BATIDORA CODIGO: HOJA No. 1 DE 1 Desarrollo de actividades en procesos de chocolatería y confitería en el marco de proyectos de innovación y ejecución de formación profesional. Capacidad

Más detalles

Sección I - Códigos de Uso Frecuente

Sección I - Códigos de Uso Frecuente Sección I - Códigos de Uso Frecuente Bonos (Medio de Pago) 80140000 Comercialización y Distribución 80141700 Distribución 80141706 Servicio de Intermediación de Productos Call Center (Público & Privado)

Más detalles

Modalidad de selección. Fuente de los recursos Valor total estimado

Modalidad de selección. Fuente de los recursos Valor total estimado PLAN ANUAL DE ADQUISICIONES A. INFORMACIÓN GENERAL DE LA ENTIDAD Nombre FONDO DEPREVISION SOCIAL DEL CONGRESO DE LA REPUBLICA - FONPRECON Dirección CARRERA 10 Nº 24-55 PISO 2 Y 3 Teléfono 3445166 Página

Más detalles

En la práctica odontológica puede ser:

En la práctica odontológica puede ser: PROCEDIMIENTOS DE ESTERILIZACIÓN Envasado Controles -Trazabilidad INFECCIÓN CRUZADA En la práctica odontológica puede ser: Paciente a personal sanitario Personal sanitario a paciente Paciente a paciente

Más detalles



Más detalles



Más detalles



Más detalles

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a Introducción Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a los investigadores verificar la expresión de una proteína, determinar la cantidad relativa

Más detalles

Comisión Honoraria para la Lucha Antituberculosa y Enfermedades Prevalentes CHLA-EP

Comisión Honoraria para la Lucha Antituberculosa y Enfermedades Prevalentes CHLA-EP Comisión Honoraria para la Lucha Antituberculosa y Enfermedades Prevalentes CHLA-EP Programa Nacional de Control de la Tuberculosis Montevideo - Uruguay CHLA - EP Sistema Centralizado de Bacteriología

Más detalles