Resistències emergents en malalties infeccioses : HIV

Tamaño: px
Comenzar la demostración a partir de la página:

Download "Resistències emergents en malalties infeccioses : HIV"


1 Resistències emergents en malalties infeccioses : HIV Bacelona, 15 de Gener del 201 José Luis Blanco Hospital Clinic. Barcelona

2 Agenda Conceptos generales de resistencia Situación de las resistencias primarias Indicaciones de un test de resistencias Paciente sin tratamiento previo Paciente en fracaso

3 Resistance: General concept Overall of mechanism that a microorganism can develop to evade the action of the drug. Changes in targets not compromising target function but impeding drug linking

4 Key of Adaptation Genetic Evolution Mutation rate (1 mutation/genome/cycle) Recombination (9 events/cycle) HIGH VARIABILITY Generation rate (~ virus/day) Hypermutagenesis (APOBEC3G)

5 Factores relacionados con el virus RESISTENCIAS Naturales Transmitidas Factores relacionados con el huesped y el tratamiento. Problemas de adherencia Farmacocinética/fármacodinámica Falta de potencia Otros??? RESISENCIAS PRIMARIAS Replicación Viral Persistente (en presencia del fármaco) RESISTENCIAS SEUNDARIAS Desarrollo de Resistencias Farmacológicas Fracaso Terapéutico


7 Métodos Fenotípicos. VIRCO PATIENT PLASMA (³ 200 µl) extraction RT PCR total RNA cdna PR/RT GENES D viral genotypes Deletion of protease (PR)- reverse transcriptase (RT) gene Viral PR/RT gene isolation Gene transfer/ electroporation HIV genome of lab. virus HIV genome minus PR/RT gene linearized genome CD4+ T- cells (MT4) Intracellular, homologous recombination ANTIVIROGRAM Susceptibility Assay Virus titration Infectious HIV D viral genotypes


9 Nomenclatura de las Mutaciones Codon #184 AAT - CTG. AAC - AUG aa 1 aa 2 aa 183 aa 184 Si suponemos que la base A muta a G: AAT- CTG. AAC - GUA aa 1 aa 2 aa 183 aa 184 Nomenclatura Mutación: M184V AUG = Metionina (M) GUA = Valina (V) Code A C D E F G H I K L Code M N P Q R S T V W Y Amino acids alanine cysteine aspartate glutamate phenyalanine glycine histidine isoleucine lysine leucine Amino acids methionine asparagine proline glutamine arginine serine threonine valine trytophan tyrosine

10 Nº Identificación Muestra: 4002 Fecha: 1/11/2000 CV: 8000 cp/ml Hospital: HCP Médico Solicitante: Dr Blanco Sistema de Genotipado: PE Biosystems Cepa de Referencia: pnl-4 Fecha del Informe: 12/11/00 Mutaciones para los Inhibidores Nucleósidos de la Retrotranscriptasa: M184V R211K Zidovudina No evidencia de Resistencia Didanosina Resistencia parcial Zalcitabina RESULTADOS NO Resistencia SUPERIORES parcial A METODOS Lamivudina GENOTIPICOS Resistencia Estavudina Abacavir Adefovir No evidencia de Resistencia Resistencia parcial No evidencia de Resistencia Mutaciones para los Inhibidores No Nucleósidos de la Retrotranscriptasa: K103N Nevirapina Delavirdina Efavirenz FENOTIPO frente a GENOTIPO CARO (más de 1000 $) COMPLEJO (tiempo de elaboración 2-4 semanas) POCOS LABORATORIOS (Virco, Virologic, VIRalliance) IMPORTANTE EN FARMACOS NUEVOS AYUDA EN SECUENCIAS COMPLEJAS Resistencia Resistencia Resistencia

11 Agenda Conceptos generales de resistencia Situación de las resistencias primarias Indicaciones de un test de resistencias Paciente sin tratamiento previo Paciente tras un primer fracaso Paciente de rescate avanzado




15 Agenda Conceptos generales de resistencia Técnicas de detección de resistencia Indicaciones de un test de resistencias Paciente naive Paciente en fracaso

16 Indicaciones del test de resistencias IAS-USA [1] DHHS [2] European [3] Primary/acute Recommend Recommend Recommend Postexposure prophylaxis Chronic, Rx naive Recommend Recommend* Recommend Strongly consider* Failure Recommend Recommend Recommend Pregnancy Recommend Recommend Recommend Pediatric Recommend Recommend Recommend *If prevalence of drug resistance in untreated patients 5% (European: 10%); should be considered if the prevalence is unknown or if exposure to someone receiving antiretroviral drugs is likely. Resistance testing should also be considered if the HIV VL suppression achieved with a new antiretroviral regimen is not optimal. 1. Hammer SM, et al. JAMA. 2006;296: DHHS guidelines, May Available at: 3. Vandamme AM, et al. Antivir Ther. 2004;9:

17 Paciente sin tratamiento previo PLJ. Varón 35 años. HMX Disgnóstico en 2005 a raíz de analítica por diagnóstico de secundarismo luético Ultima serología 2 años antes negativa Analítica: CV copias/ml; CD4: 650 cel/mm 3 No comorbilidades

18 Resistencias en el pacientes naïve: cuando hacerlas 2002 Nuevo Dx 2005 CD4: Sigue naive 2008 CD4: 340

19 The New York City Department of Health Report of a Super Strain of HIV

20 Rescate tras fracaso: no sólo resistencias ANITI ANNITI IPs AZT ddi ddc d4t FTC 3TC ABC TDF NVP EFV SQV/r LOP/r FosAPV/r ATV/r NFV Mal adherente Fracasos a AZT,d4T,3TC,ddI NEV,IDV/r, 5 logs copies/ml 220 CD4+/mm /- RT: 41L,44D,210W,215Y,118I, 190A, 103R PR: 10V,46I, 63P,7IV,84V,90M

21 Carga viral Cuál es el mejor momento del cambio? Primer tratamiento gundo tratamiento Acúmulo de mutaciones Intermedio Tardío Temprano Tiempo

22 Standard Sanger Sequencing Detects the Most Common Circulating HIV-1 Variants

23 TOOLS TO STUDY MINORITY VARIANTS Concept Standard Cloning Analysis of single CFUs with indiviual clones Allele-specific PCR Differential amplification of mutants vs WT in real-time PCR Parallel Allele- Specific Sequencing (PASS) Single-base allele sequencing of polonies fixed to an acrylamide surface Single Genome sequencing Massive sequencing of single genome molecules Ultra deep sequencing (454 life sciences/roche) Massively parallel microfluidic solidsurface sequencing of single molecules (10 5 reads) Sensitivity > 10% % 0.1% 2% 0.5 1% # mutations Linked mutations Labor Intensity multiple 1 1 per round (up to 22 rounds) Multiple within 300 bp Yes No Yes Yes Yes Cost Best Experience, PPV S, PPV, NPV, Affordable Worst S, NPV Only 1 mutant, Sp, effect of polymorphisms, S, linkage of muts Linkage Linkage, Accuracy, S, NPV, Labor intensity, Rapidity of results Cost, Labor intensity Cost, time and labor consuming Short sequence, background noise, Sp

24 Riesgo de Fracaso virológico en función de la presencia de resistencias primarias en bulk Descamps D. HIV Clin Trial 2009; 10(6):

25 FV???

26 Conclusiones El VIH tiene una capacidad extraordinaria de generar resistencias al TARV La prevalencia de resistencias primaria varia entre países y está estable en España en torno al 10% La determinación de resistencias tras el fracaso virológico es importante a la hora de diseñar el tratamiento de rescate La importancia de la determinación de resistencias en poblaciones minoritarias está aún por definir

Aplicabilitat clínica dels estudis de resistències del VIH

Aplicabilitat clínica dels estudis de resistències del VIH JORNADAS DE LA SOCIETAT CATALANA DE MALALTIES INFECCIOSES I MICROBIOLOGIA CLÍNICA Aplicabilitat clínica dels estudis de resistències del VIH Lleida, 4 y 5 de Noviembre del 2011 José Luis Blanco Servicio

Más detalles


PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH Blga. Gisely Hijar Guerra Coordinación del Laboratorio de Biotecnología y Biología Molecular. Responsable de los Procesos de la Prueba

Más detalles

Blga. Gisely Hijar Guerra. Responsable de los Procesos de la Prueba de Genotipificación de VIH Centro Nacional de Salud Publica

Blga. Gisely Hijar Guerra. Responsable de los Procesos de la Prueba de Genotipificación de VIH Centro Nacional de Salud Publica Genotipificación de VIH en el INS: técnica local y técnicas convencionales Blga. Gisely Hijar Guerra Coordinación del Laboratorio de Biotecnología y Biología Molecular. lar Responsable de los Procesos

Más detalles


INSTRUCTIVO PARA GESTION DE MEDICACIÓN ESPECIAL: 20 Manual para Procedimientos, Dispositivos y Medicación SUR Form. C.1.1.1. Se informa a Ud. que, con el fin de realizar la solicitud de Efavirenz (EFV) / Nevirapina (NVP) / Abacavir (ABC) / Lamivudina

Más detalles

Información general MX HIV 0 0 0 0 0 ID CAPASITS. ID Nacional. Sexo: Masc Fem Edad al Dx de HIV / SIDA: mm/aa. Etnicidad: Mez Ext Ind Indique:

Información general MX HIV 0 0 0 0 0 ID CAPASITS. ID Nacional. Sexo: Masc Fem Edad al Dx de HIV / SIDA: mm/aa. Etnicidad: Mez Ext Ind Indique: Información general Sexo: Masc Fem Edad al Dx de HIV / SIDA: mm/aa Etnicidad: Mez Ext Ind Indique: Clase: Pediatrico Adulto Embarazada Preso Fecha de nacimiento: Estadio CDC Fecha de ingreso a MGDC Fecha

Más detalles

Codificación CIE 10 B24.X enfermedad por virus de la inmunodeficiencia humana (VIH), sin otra especificación

Codificación CIE 10 B24.X enfermedad por virus de la inmunodeficiencia humana (VIH), sin otra especificación Título: SINDROME DE INMUNODEFICIENCIA ADQUIRIDA (VIH) Codificación CIE 10 B24.X enfermedad por virus de la inmunodeficiencia humana (VIH), sin otra especificación Problema: Defecto adquirido de inmunidad

Más detalles

Caracterización por Real-Time PCR: algunas aplicaciones en genética animal. Dr. Ruben Pérez

Caracterización por Real-Time PCR: algunas aplicaciones en genética animal. Dr. Ruben Pérez Caracterización por Real-Time PCR: algunas aplicaciones en genética animal Dr. Ruben Pérez CARACTERIZACIÓN POR REAL-TIME PCR DIAGNÓSTICO: PRESENCIA/AUSENCIA AMPLICÓN Real Time PCR CARACTERIZACIÓN DEL AMPLICÓN

Más detalles

Resistencias del VIH-1 a los antirretrovirales en la Comunidad Valenciana: mutaciones y sensibilidades. J.M. Molina, J. Córdoba y M.

Resistencias del VIH-1 a los antirretrovirales en la Comunidad Valenciana: mutaciones y sensibilidades. J.M. Molina, J. Córdoba y M. Rev Esp Quimioterap, Septiembre 2003; Vol.16 (Nº 3): 308-312 2003 Prous Science, S.A.- Sociedad Española de Quimioterapia Original Resistencias del VIH-1 a los antirretrovirales en la Comunidad Valenciana:

Más detalles

Tratamiento de la infección por el VIH

Tratamiento de la infección por el VIH Tratamiento de la infección por el VIH i ii Tratamiento de la infección por el VIH Bernardino Roca Unidad de Enfermedades Infecciosas Servicio de Medicina Interna Hospital General de Castellón Adaptado

Más detalles

Tratamiento Antirretroviral TAR Inicio/cambio

Tratamiento Antirretroviral TAR Inicio/cambio Diagnóstico precoz y atención integral del paciente con infección por VIH: Implicación del personal sanitario hospitalario y de atención primaria Tratamiento Antirretroviral TAR Inicio/cambio Mª Jesús

Más detalles

Pruebas de bajo costo para el seguimiento al tratamiento de VIH

Pruebas de bajo costo para el seguimiento al tratamiento de VIH Pruebas de bajo costo para el seguimiento al tratamiento de VIH (Economical assays for monitoring HIV-1 treatment) Lisa Frenkel Profesora de Pediatria y Medicina del Laboratorio Marzo 2010 Uso de pruebas

Más detalles

2.1 Medicamentos Antirretrovirales

2.1 Medicamentos Antirretrovirales 2.1 Medicamentos Antirretrovirales Existen grupos de medicamentos antirretrovirales que poseen diferentes mecanismos de acción en la terapéutica de la infección por VIH: FAMILIA Inhibidores de la transcriptasa

Más detalles

NUMERO DE CONFERENCIA : Llamada Libre 1-888-670-3525 Otro 720-389-1212 CÓDIGO: 5801776856. Facilitador de Hoy


Más detalles

8 Congreso Argentino de Salud Integral del Adolescente. Dr. Eduardo Rubinstein. Hospital Francisco J. Muñiz Adolescencia

8 Congreso Argentino de Salud Integral del Adolescente. Dr. Eduardo Rubinstein. Hospital Francisco J. Muñiz Adolescencia 8 Congreso Argentino de Salud Integral del Adolescente Dr. Eduardo Rubinstein Hospital Francisco J. Muñiz Adolescencia VIH EN ADOLESCENTES: QUE HAY DE NUEVO? En diagnóstico de infección por VIH En seguimiento

Más detalles

Intervenciones. Vacunas y medicamentos

Intervenciones. Vacunas y medicamentos Intervenciones Vacunas y medicamentos TERAPIA ANTIRETROVIRAL RECOMENDACIONES 2008 OBJETIVOS Y BENEFICIOS DE LA TERAPIA ARV Control de la Replicacion viral y reduccion de la carga viral. Reduccion de la

Más detalles

Atención y tratamiento en VIH/sida Parte 2


Más detalles


SITUACIÓN ACTUAL Y MANEJO DEL VIH-SIDA SITUACIÓN ACTUAL Y MANEJO DEL VIH-SIDA Augusto G. Escalante Candia Médico Infectólogo Hospital Regional Docente de Medicina Tropical Pedro Ortiz Cabanillas VIH SIDA: OMS 2014 35 millones de personas

Más detalles

Servicio de Enfermedades Infecciosas. Hospital Clínic - IDIBAPS. Universidad de Barcelona. Barcelona

Servicio de Enfermedades Infecciosas. Hospital Clínic - IDIBAPS. Universidad de Barcelona. Barcelona Infección aguda por VIH, tratamiento antirretroviral inicial, paradas del tratamiento antirretroviral, terapias inmunomediadas y profilaxis postexposición accidental Título corto: Tratamiento antirretroviral

Más detalles

Herramientas para el diagnóstico, seguimiento y tratamiento en Hepatitis B. Fabián Fay CIBIC Rosario Argentina

Herramientas para el diagnóstico, seguimiento y tratamiento en Hepatitis B. Fabián Fay CIBIC Rosario Argentina Herramientas para el diagnóstico, seguimiento y tratamiento en Hepatitis B Fabián Fay CIBIC Rosario Argentina HBV - Marcadores Serológicos HBsAg: Antígeno de Superficie Anti-HBc (total):

Más detalles

Perinatal Transmisión al bebé, durante el embarazo, parto o lactancia.

Perinatal Transmisión al bebé, durante el embarazo, parto o lactancia. Dr. Horacio Salomón Investigador Principal del CONICET Director del INBIRS (Ex-CNRSIDA) UBA-CONICET Contacto sexual Relaciones sexuales sin protección por contacto directo con fluidos corporales como secreciones

Más detalles



Más detalles

Estudio prospectivo de niños con diagnóstico reciente de HIV-1: evaluación de parámetros virológicos, clínicos e inmunológicos.

Estudio prospectivo de niños con diagnóstico reciente de HIV-1: evaluación de parámetros virológicos, clínicos e inmunológicos. TÍTULO Estudio prospectivo de niños con diagnóstico reciente de HIV-1: evaluación de parámetros virológicos, clínicos e inmunológicos. Título corto: Estudio prospectivo de niños con HIV-1 1 RESUMEN El

Más detalles


MANUAL DE OPERACIÓN VIH. FALLA VIROLÓGICA INMUNOLÓGICA Versión Vigente: 2 Página 1 de 5 FALLA VIROLÓGICA INMUNOLÓGICA Versión Vigente: 2 1. Objetivo: Detectar con toda oportunidad rebote en el RNA del VIH en suero, debido a resistencia a agentes antirretrovirales provocando

Más detalles

Aspectos Clínicos en el Monitoreo de VIH-SIDA

Aspectos Clínicos en el Monitoreo de VIH-SIDA Aspectos Clínicos en el Monitoreo de VIH-SIDA Dra. Rosa Elena Morales Diplomado Centroamericano Monitoreo Y Evaluación para la Gestión de Políticas y Programas de VIH SIDA Febrero 2012 1 Evaluación Inicial

Más detalles

Hepatitis virales. Juan Carlos Rodríguez Díaz S. Microbiología Hospital General Universitario de Elche

Hepatitis virales. Juan Carlos Rodríguez Díaz S. Microbiología Hospital General Universitario de Elche Hepatitis virales Juan Carlos Rodríguez Díaz S. Microbiología Hospital General Universitario de Elche Hepatitis Características generales Es un proceso asociado a muchas causas, tanto infecciosas como

Más detalles

APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR. Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina

APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR. Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina BiologÍa Molecular: es una disciplina que se enfoca principalmente en el estudio

Más detalles

Enero-Marzo 2009 1/8. Estimados amigos:

Enero-Marzo 2009 1/8. Estimados amigos: Estimados amigos: Siguiendo las normas de gestión de la Plataforma de Resistencias de la RIS, nos ponemos en contacto con vosotros para haceros llegar un nuevo INFORME TRIMESTRAL, correspondiente al periodo

Más detalles

Julio-Septiembre 2009 1/8. Estimados amigos:

Julio-Septiembre 2009 1/8. Estimados amigos: Estimados amigos: Una vez más y siguiendo las normas de gestión de la Plataforma de Resistencias de la RIS, nos ponemos en contacto con vosotros para haceros llegar un nuevo INFORME TRIMESTRAL, correspondiente

Más detalles

CONVENIO 036 de 2012

CONVENIO 036 de 2012 CONVENIO 036 de 2012 Guía de Práctica Clínica basada en la evidencia científica para la atención integral del VIH/Sida en niñas y niños. Guía de práctica clínica basada en la evidencia científica para

Más detalles



Más detalles


PROTOCOLO DE PROFILAXIS POST-EXPOSICIÓN FRENTE A VIH PROTOCOLO DE PROFILAXIS POST-EXPOSICIÓN FRENTE A VIH Ante paciente que acude por posible contacto con VIH, o personal sanitario en contacto potencial con el virus, se recomienda seguir el siguiente algoritmo

Más detalles



Más detalles

Estrategia utilizada

Estrategia utilizada Estrategia utilizada 1) Extracción HIV RNA V3 7114 7218 2) One Step RT-PCR (x triplicado) 3) 2 nd PCR (A1 A2 A3) A1 A2 A3 4) Secuencuiación A1 A2 A3 TGTACAAGACCCAACAACAATACAAGAAAAAGTATACATGTAGGACG AGGGAGATCAATTTATGCAACAGAAAAAATAATAGGAGATACAAAAC

Más detalles



Más detalles


EVIDENCIAS A FAVOR Y EN CONTRA DE CADA OPCIÓN. Julio Diz Arén TAR: MEDICAMENTOS DE MARCA vs. GENÉRICOS EVIDENCIAS A FAVOR Y EN CONTRA DE CADA OPCIÓN Julio Diz Arén El valor de los medicamentos Los medicamentos han logrado mejorar la esperanza de vida de la especie

Más detalles

Adaptación para América Latina y El Caribe

Adaptación para América Latina y El Caribe Tratamiento antirretroviral de la infección por el VIH en adultos y adolescentes Recomendaciones para un enfoque de salud pública Adaptación para América Latina y El Caribe 2010 Índice 1. Introducción...

Más detalles

La hipertensión arterial en el 2013: las nuevas guías de la ESH/ESC. Alejandro de la Sierra Hospital Mutua Terrassa

La hipertensión arterial en el 2013: las nuevas guías de la ESH/ESC. Alejandro de la Sierra Hospital Mutua Terrassa La hipertensión arterial en el 2013: las nuevas guías de la ESH/ESC Alejandro de la Sierra Hospital Mutua Terrassa Universidad de Barcelona J Hypertens 2013; 31: 1281-1357 Eur Heart J 2013; 34: 2159-2219

Más detalles

CURSO ONLINE SOGAISIDA-UNIVADIS. BASES DEL TAR: Replicación vírica Mecanismo de acción de los ARV Descripción somera de familias de ARV

CURSO ONLINE SOGAISIDA-UNIVADIS. BASES DEL TAR: Replicación vírica Mecanismo de acción de los ARV Descripción somera de familias de ARV CURSO ONLINE SOGAISIDA-UNIVADIS BASES DEL TAR: Replicación vírica Mecanismo de acción de los ARV Descripción somera de familias de ARV REPLICACIÓN VÍRICA Estructura del VIH REPLICACIÓN VÍRICA Genoma del

Más detalles

Terapias de rescate Nuevos tratamientos. Dra. Cristina Cortés Lletget 13 de Noviembre de 2007

Terapias de rescate Nuevos tratamientos. Dra. Cristina Cortés Lletget 13 de Noviembre de 2007 Terapias de rescate Nuevos tratamientos Dra. Cristina Cortés Lletget 13 de Noviembre de 2007 EL Virus RNA (Retrovirus) Infecta células del sistema inmune integrándose en el genoma celular ..y NOSOTROS

Más detalles

SIDA EN AFRICA. África Holguín 5 Abril 2016


Más detalles


III CONGRESO NACIONAL DE ATENCIÓN FARMACÉUTICA Adherencia a la terapia antirretroviral en pacientes infectados con el virus de la inmunodeficiencia humana que asisten a una clínica universitaria de enfermedades infecciosas en Venezuela. III CONGRESO

Más detalles

Carlos Yábar V 1, Pedro Chávez H 2, Zoila Varas H 3, Rafael Rodríguez B 3

Carlos Yábar V 1, Pedro Chávez H 2, Zoila Varas H 3, Rafael Rodríguez B 3 artículo original IDENTIFICACIÓN MOLECULAR DE MUTACIONES PUNTUALES RELACIONADAS CON RESISTENCIA A DROGAS EN VIH-1 DE PACIENTES PERUANOS Carlos Yábar V 1, Pedro Chávez H 2, Zoila Varas H 3, Rafael Rodríguez

Más detalles

VIH/SIDA, tratamiento antiretroviral

VIH/SIDA, tratamiento antiretroviral VIH/SIDA, tratamiento antiretroviral Dr. Samuel Navarro Alvarez, MSP Medico Internista e Infectólogo Objetivos de aprendizaje Mostrar los beneficios del tratamiento anti retroviral Describir cuales son

Más detalles

Diagnóstico Prenatal No invasivo (NIPD)

Diagnóstico Prenatal No invasivo (NIPD) Dra. Derly Liseth Castro Rojas, MD Especialista en Genética Clínica - IGH PUJ / UNAB Directora Dto. Genética Clínica FOSCAL- Lab. Higuera Escalante Docente Asociado Facultad de Medicina UNAB Medicina fetal

Más detalles



Más detalles

PCR Punto de No Retorno de la Biología Molecular

PCR Punto de No Retorno de la Biología Molecular TÉCNICAS DE ANÁLISIS EN BIOLOGÍA MOLECULAR CURSO DE BIOTECNOLOGÍA ELEMENTAL Biotechnology Explorer Julio 2012 PCR Punto de No Retorno de la Biología Molecular Qué es un gen Técnicas de aislamiento y estudio

Más detalles

A PERSONAS VIVIENDO CON VIH/ SIDA. Marisel Colautti Área Farmacia Asistencial FBIOyF.UNR

A PERSONAS VIVIENDO CON VIH/ SIDA. Marisel Colautti Área Farmacia Asistencial FBIOyF.UNR ATENCIÓN N FARMACÉUTICA A PERSONAS VIVIENDO CON VIH/ SIDA Marisel Colautti Área Farmacia Asistencial FBIOyF.UNR Cuál l es el rol del farmacéutico? 1. Gestionar los insumos para promoción, prevención y

Más detalles

Pablo Galindo Orrego. Residente Medicina Interna. Universidad de La Sabana, Bogotá 2012.


Más detalles

Tasa de mutaciones genotípicas y resistencia a antirretrovirales en un hospital general

Tasa de mutaciones genotípicas y resistencia a antirretrovirales en un hospital general Farm Hosp. 2011;35(4):191 196 ORIGINAL BREVE Tasa de mutaciones genotípicas y resistencia a antirretrovirales en un hospital general L.C. Fernández Lisón a,, L.M. Fernández Pereira

Más detalles

AUTORIDADES. Jesús Mantilla. Ministro del Poder Popular para la Salud. Dra. Nancy Pérez. Vice Ministra de Salud Colectiva.

AUTORIDADES. Jesús Mantilla. Ministro del Poder Popular para la Salud. Dra. Nancy Pérez. Vice Ministra de Salud Colectiva. AUTORIDADES Jesús Mantilla. Ministro del Poder Popular para la Salud. Dra. Nancy Pérez. Vice Ministra de Salud Colectiva. Dra. Aleida Rivas. Directora General de Programas de Salud. Dra. Deisy Matos. Coordinadora

Más detalles

Cribado prenatal no invasivo

Cribado prenatal no invasivo Cribado prenatal no invasivo Detección T13, T18, T21, monosomía X y sexo fetal en sangre materna. Dra. Blanca Bermejo Barrera, Directora Desarrollo Área Molecular Evolución del cribado prenatal 1960 s

Más detalles

Colombia Médica Vol. 34 Nº 3, 2003

Colombia Médica Vol. 34 Nº 3, 2003 La genotipificación y fenotipificación de la resistencia del virus de la inmunodeficiencia humana tipo 1 (VIH-1) a los fármacos antirretrovirales Felipe García-Vallejo, Ph.D. 1, Martha C. Domínguez, M.Sc.

Más detalles

Utilización de los nuevos fármacos en el tratamiento antirretroviral

Utilización de los nuevos fármacos en el tratamiento antirretroviral Utilización de los nuevos fármacos en el tratamiento antirretroviral Informe elaborado por Antonio Rivero Román Jefe Sección de Unidad Clínica de Enfermedades Infecciosas Hospital Universitario Reina Sofía

Más detalles


TERAPIA ANTIRRETROVIRAL ADHERENCIA O FRACASO TERAPIA ANTIRRETROVIRAL ADHERENCIA O FRACASO Dr. Rolando A. Cedillos Jefe del Servicio de Infectología y del Programa de Atención Integral de ITS/VIH/SIDA Hospital Nacional Rosales TAR: Respuesta clínica

Más detalles

MUTAGÉNESIS LETAL COMO NUEVA ESTRATEGIA ANTIVIRAL. Investigador principal: Miguel Ángel Martínez de la Sierra. Centro: Fundació irsicaixa

MUTAGÉNESIS LETAL COMO NUEVA ESTRATEGIA ANTIVIRAL. Investigador principal: Miguel Ángel Martínez de la Sierra. Centro: Fundació irsicaixa MUTAGÉNESIS LETAL COMO NUEVA ESTRATEGIA ANTIVIRAL Investigador principal: Miguel Ángel Martínez de la Sierra Centro: Fundació irsicaixa Duration: 3 years MEMORIA FINAL 1. Resumen del proyecto La variabilidad

Más detalles

Juan Miguel Pascale B. Instituto Conmemorativo Gorgas de Estudios de la Salud Departamento de Genómica

Juan Miguel Pascale B. Instituto Conmemorativo Gorgas de Estudios de la Salud Departamento de Genómica Resistencia Transmitida en Panamá Juan Miguel Pascale B. Instituto Conmemorativo Gorgas de Estudios de la Salud Departamento de Genómica Cuálesla situaciónde VIH en Panamá? VIH en Panamá Panamá tiene 3.5

Más detalles

La oferta universal de tratamiento anti-retroviral

La oferta universal de tratamiento anti-retroviral Artículo Original VIH/SIDA Perfil de resistencia del VIH-1 a anti-retrovirales en pacientes con fallo virológico. Hospital Roosevelt-Guatemala 2008-2012 Ricardo Mendizábal-Burastero, Amalia C. Girón-Callejas,

Más detalles

Octubre-Diciembre 2008 1/7. Estimados amigos:

Octubre-Diciembre 2008 1/7. Estimados amigos: Estimados amigos: Siguiendo las normas de gestión de la Plataforma de Resistencias de la RIS, nos ponemos en contacto con vosotros para haceros llegar un nuevo INFORME TRIMESTRAL, correspondiente al periodo

Más detalles


BIBLIOGRAFÍA INTERNACIONAL BIBLIOGRAFÍA INTERNACIONAL Antiviral Therapy Predicted effect of direct acting antivirals in the current HIV HCV coinfected Predicción del efecto de los agentes antivirales de acción directa en la población

Más detalles

Tratamiento antirretroviral de la infección por el VIH

Tratamiento antirretroviral de la infección por el VIH Enferm Infecc Microbiol Clin. 2011;29(6):455 465 Formación médica continuada: Infección por el VIH en el adulto Tratamiento antirretroviral de la infección por el VIH Fernando Lozano

Más detalles



Más detalles

Principios para la utilización de Fármacos en el Tratamiento de las Infecciones Víricas

Principios para la utilización de Fármacos en el Tratamiento de las Infecciones Víricas FARMACOLOGÍA CINICA Principios para la utilización de Fármacos en el Tratamiento de las Infecciones Víricas 2005-2006 Ciclo de replicación de un DNA virus Goodman-Gilman 9th edition Ciclo de replicación

Más detalles


DR. JORGE VARGAS GUZMAN. Asesor salud CONAVIHSIDA SIDA Y EMBARAZO DR. JORGE VARGAS GUZMAN Asesor salud CONAVIHSIDA Porqué ITS son un problema médico y de salud pública? 1. Muchas de ellas son Enfermedades Prevenibles 2. Presencia de algunas implica sexo

Más detalles



Más detalles

Lic. Julio Carrión, Químico Farmacéutico Licda. Mircea Romero, Química Farmacéutica Dr. Carlos Mejía, Infectólogo

Lic. Julio Carrión, Químico Farmacéutico Licda. Mircea Romero, Química Farmacéutica Dr. Carlos Mejía, Infectólogo Monitoreo de efectos adversos asociados al Tratamiento Antirretroviral (TAR) de tercera línea en pacientes VIH Positivos de la Clínica de Enfermedades Infecciosas del Hospital Roosevelt Lic. Julio Carrión,

Más detalles

Más allá de las técnicas analíticas en los Laboratorios Clínicos: la dimensión científica y académica

Más allá de las técnicas analíticas en los Laboratorios Clínicos: la dimensión científica y académica Más allá de las técnicas analíticas en los Laboratorios Clínicos: la dimensión científica y académica Alberto Gómez Gutiérrez, PhD Profesor Titular Instituto de Genética Humana Facultad de Medicina Pontificia

Más detalles

Herramientas de laboratorio aplicadas al diagnóstico y el monitoreo del tratamiento de la infección por VIH (Virus

Herramientas de laboratorio aplicadas al diagnóstico y el monitoreo del tratamiento de la infección por VIH (Virus Herramientas de laboratorio aplicadas al diagnóstico y el monitoreo del tratamiento de la infección por VIH (Virus Inmunodeficiencia Humana) Fabián Fay CIBIC. Rosario. Argentina Test de laboratorio para

Más detalles

Guía clínica. Recomendaciones para el uso de la terapia antirretroviral en infección por el virus de la inmunodeficiencia humana en Costa Rica

Guía clínica. Recomendaciones para el uso de la terapia antirretroviral en infección por el virus de la inmunodeficiencia humana en Costa Rica ISSN 0001-6012/2012/54/4/262-268 Acta Médica Costarricense, 2012 Colegio de Médicos y Cirujanos de Costa Rica Guía clínica Recomendaciones para el uso de la terapia antirretroviral en infección por el

Más detalles

ACTUALIZACION EN SIDA INFANTIL. Antonio Bascuñana Quirell Hospital Virgen del Camino Octubre 2009

ACTUALIZACION EN SIDA INFANTIL. Antonio Bascuñana Quirell Hospital Virgen del Camino Octubre 2009 ACTUALIZACION EN SIDA INFANTIL Antonio Bascuñana Quirell Hospital Virgen del Camino Octubre 2009 CONTENIDO Importancia del problema En el mundo En España Transmisión materno-fetal Tratamiento/profilaxis

Más detalles


TRABAJO FIN DE MASTER MASTER UNIVERSITARIO EN INVESTIGACIÓN EN CIENCIAS DE LA SALUD. Codirector: Dr. Ramón San Miguel Elcano Análisis de pacientes candidatos a simplificación del tratamiento antirretroviral de gran actividad a monoterapia con inhibidores de la proteasa potenciados TRABAJO FIN DE MASTER MASTER UNIVERSITARIO EN

Más detalles

Directrices unificadas sobre el uso de antirretrovirales para el tratamiento y prevención de infección por el VIH

Directrices unificadas sobre el uso de antirretrovirales para el tratamiento y prevención de infección por el VIH Directrices unificadas sobre el uso de antirretrovirales para el tratamiento y prevención de infección por el VIH Dr. Massimo Ghidinelli Unidad de VIH, Hepatitis, Tuberculosis e ITS Metas Ambiciosas para

Más detalles

Anexo II. El riesgo de adquirir la infección por VIH, VHB o VHC a través de la exposición ocupacional, varía dependiendo de los siguientes factores:

Anexo II. El riesgo de adquirir la infección por VIH, VHB o VHC a través de la exposición ocupacional, varía dependiendo de los siguientes factores: Anexo II EXPOSICIÓN OCUPACIONAL AL VIH EN TRABAJADORES DE LA SALUD: PREVENCIÓN Y PROFILAXIS POST-EXPOSICIÓN En estudios prospectivos de trabajadores de la salud, el riesgo promedio de adquisición de la

Más detalles

Guía de Referencia Rápida. Prevención, Diagnóstico y Tratamiento en el binomio madre-hijo con Infección por el VIH

Guía de Referencia Rápida. Prevención, Diagnóstico y Tratamiento en el binomio madre-hijo con Infección por el VIH Guía de Referencia Rápida Prevención, Diagnóstico y Tratamiento en el binomio madre-hijo con Infección por el VIH Guía de Práctica Clínica GPC Catálogo maestro de guías de práctica clínica: IMSS-246-12

Más detalles

Controversias en hepatitis Viral II

Controversias en hepatitis Viral II Controversias en hepatitis Viral II Dra. Ángeles Castro Iglesias Servicio de Medicina Interna B Hospital Universitario de A Coruña VI Curso de Biología Molecular para Clínicos Vigo, 3-4 de Febrero de 2012

Más detalles

Terapia antirretroviral, acceso, costos, tendencias,riesgos y desafíos.

Terapia antirretroviral, acceso, costos, tendencias,riesgos y desafíos. Terapia antirretroviral, acceso, costos, tendencias,riesgos y desafíos. COSTA RICA Setiembre 2010 Dra. Zahira Tinoco M. Costa Rica ACCESO A LA TERAPIA CCSS Costa Rica MEDICAMENTOS ANTIRETROVIRALES Costa

Más detalles

Utilidad de la Biología Molecular en el Diagnóstico y Vigilancia del Dengue

Utilidad de la Biología Molecular en el Diagnóstico y Vigilancia del Dengue Utilidad de la Biología Molecular en el Diagnóstico y Vigilancia del Dengue José Usme Ciro Unidad de Secuenciación y Análisis Genómico Grupo de Virología Instituto Nacional de Salud Virus dengue (DENV)

Más detalles

Avances recientes en VIH/SIDA: Terapia antiretroviral.

Avances recientes en VIH/SIDA: Terapia antiretroviral. Avances recientes en VIH/SIDA: Terapia antiretroviral. Recent advances in HIV/AIDS: Antiretroviral therapy. SCERPELLA Ernesto G., M.D.* y CAMPO Rafael el E. D.M.* * Departamento de Medicina y Programa

Más detalles

HIV. Curso de Salud Internacional. Máster en Ciencias de la Salud: Salud Pública. Curso 2007-2008

HIV. Curso de Salud Internacional. Máster en Ciencias de la Salud: Salud Pública. Curso 2007-2008 HIV Curso de Salud Internacional Máster en Ciencias de la Salud: Salud Pública Curso 2007-2008 Virus de Inmunodeficiencia Humana - HIV Infección por HIV y progresión hacia el SIDA Problema: Por qué hay

Más detalles

La Epidemiología Molecular de las Enfermedades Infecciosas Dr. Pere Coll Hospital de Sant Pau. Barcelona

La Epidemiología Molecular de las Enfermedades Infecciosas Dr. Pere Coll Hospital de Sant Pau. Barcelona La Epidemiología Molecular de las Enfermedades Infecciosas Dr. Pere Coll Hospital de Sant Pau. Barcelona VIII Taller Internacional sobre Tuberculosis. UITB. Noviembre 2004. Índice 1. Definición clonalidad.

Más detalles


UNIVERSIDAD PEDRO DE VALDIVIA ASIGNATURA :FARMACOLOGIA Docente : Susana Rivera Itte RETROVIRALES UNIVERSIDAD PEDRO DE VALDIVIA ASIGNATURA :FARMACOLOGIA Docente : Susana Rivera Itte RETROVIRALES INTRODUCCIÓN El virus de inmunodeficiencia humana forma parte del género Lentivirus. Estos constituyen un

Más detalles

Análisis de utilización de fármacos antirretrovirales en Argentina

Análisis de utilización de fármacos antirretrovirales en Argentina 1 2 Análisis de utilización de fármacos antirretrovirales en Argentina Trabajo realizado durante el período junio/diciembre 2010 3 4 Este trabajo es fruto de un proyecto de investigación realizado por

Más detalles

Directrices unificadas sobre el uso de medicamentos antirretrovíricos para el tratamiento y la prevención de la infección por el VIH Sinopsis de las

Directrices unificadas sobre el uso de medicamentos antirretrovíricos para el tratamiento y la prevención de la infección por el VIH Sinopsis de las DIRECTRICES UNIFICADAS Directrices unificadas sobre el uso de medicamentos para el tratamiento y la prevención de la infección por el VIH Sinopsis de las características y recomendaciones principales JUNIO

Más detalles


INTERACCIONES MEDICAMENTOSAS DE LOS ANTIRRETROVIRALES INTERACCIONES MEDICAMENTOSAS DE LOS ANTIRRETROVIRALES Prof.Adj. Dra. Leticia Cuñetti Dpto.Farmacología y Terapéutica Facultad de Medicina UDELAR Junio 2008 Introducción 1981 se describen primeros casos

Más detalles



Más detalles


PROFILAXIS POSTEXPOSICION ACCIDENTAL CASOS CLINICOS PROFILAXIS POSTEXPOSICION ACCIDENTAL Dra. Cristina García Yubero Servicio de Farmacia. Hospital Príncipe de Asturias. Alcalá de Henares. Madrid Dra. Rosario Santolaya Perrín Servicio de

Más detalles

Hospital General Universitario Valle Hebron

Hospital General Universitario Valle Hebron TRATAMIENTO DE LA S HEPATITIS VIRALES Maria Buti. Servicio de Hepatología- Medicina Interna Hospital General Universitario Valle de Hebrón. Barcelona. Dirección. Dra Maria Buti Servicio de Hepatología

Más detalles

Situación actual y perspectivas futuras de la biterapia

Situación actual y perspectivas futuras de la biterapia Situación actual y perspectivas futuras de la biterapia Autor Dr. Esteban Ribera Pascuet Servicio de Enfermedades Infecciosas Hospital Universitari Vall d Hebron Barcelona 2 Autor Dr. Esteban Ribera Pascuet

Más detalles

CONVENIO 036 de 2012

CONVENIO 036 de 2012 CONVENIO 036 de 2012 Guía de Práctica Clínica basada en la evidencia científica para la atención integral del VIH/Sida en niñas y niños. Guía de práctica clínica basada en la evidencia científica para

Más detalles

Situación del VIH/Sida en Nicaragua. Dr. Carlos Quant Durán Hospital Escuela Dr. Roberto Calderón G. Hospital Bautista quantcj@yahoo.

Situación del VIH/Sida en Nicaragua. Dr. Carlos Quant Durán Hospital Escuela Dr. Roberto Calderón G. Hospital Bautista quantcj@yahoo. Situación del VIH/Sida en Nicaragua Dr. Carlos Quant Durán Hospital Escuela Dr. Roberto Calderón G. Hospital Bautista Agosto 2012 Resumen global de la epidemia por VIH/Sida, 2010 OMS,

Más detalles

del VIH a los medicamentos

del VIH a los medicamentos Información, Inspiración y Defensa de la Gente con HIV/AIDS Un buen número de medicamentos se encuentran ahora disponibles Pruebas de para el tratamiento de la infección del VIH. Con más medicamentos para

Más detalles



Más detalles

Meningitis Tuberculosa y su Tratamiento Santiago Moreno Hospital Ramón y Cajal. IRYCIS. Madrid

Meningitis Tuberculosa y su Tratamiento Santiago Moreno Hospital Ramón y Cajal. IRYCIS. Madrid Taller UITB 2012 Barcelona, 19-20 de Noviembre de 2012 Meningitis Tuberculosa y su Tratamiento Santiago Moreno Hospital Ramón y Cajal. IRYCIS. Madrid Meningitis tuberculosa Importancia Presentación clínica

Más detalles


AVANCES EN LA INFECCIÓN VIH EN PEDIATRIA AVANCES EN LA INFECCIÓN VIH EN PEDIATRIA Juncal Echeverria Lecuona Neonatologia. Hospital Donostia En la tercera decada de la infección VIH, las nuevas terapias antirretrovirales han transformado la enfermedad

Más detalles

GPC. Guía de Referencia Rápida. Tratamiento Antirretroviral del Paciente Pediátrico con Infección por el VIH. Guía de Práctica Clínica

GPC. Guía de Referencia Rápida. Tratamiento Antirretroviral del Paciente Pediátrico con Infección por el VIH. Guía de Práctica Clínica Guía de Referencia Rápida Tratamiento Antirretroviral del Paciente Pediátrico con Infección por el VIH GPC Guía de Práctica Clínica Número de Registro: IMSS-196-10 Guía de Referencia Rápida CIE-10: 1-13

Más detalles


BIBLIOGRAFÍA INTERNACIONAL BIBLIOGRAFÍA INTERNACIONAL Clinical infectious diseases HIV infection is associated with decreased thrombin generation La infección por VIH se asocia con disminución de la generación de trombina Hsue PY

Más detalles


INFORME N 11 2011 INFORME TÉCNICO DE MEDICAMENTOS ANTIRETROVIRALES. Darunavir 150mg tableta INFORME N 11 2011 INFORME TÉCNICO DE MEDICAMENTOS ANTIRETROVIRALES I. DATOS DEL MEDICAMENTO Medicamento solicitado Darunavir 150mg tableta Indicación clínica Tratamiento del Virus de Inmunodeficiencia

Más detalles



Más detalles

Análisis de la coestimulación vía CD28 en células linfoides de pacientes infectados. con el virus de la Hepatitis C RESUMEN

Análisis de la coestimulación vía CD28 en células linfoides de pacientes infectados. con el virus de la Hepatitis C RESUMEN Análisis de la coestimulación vía CD28 en células linfoides de pacientes infectados con el virus de la Hepatitis C RESUMEN La infección por el virus de la hepatitis C (VHC) afecta a más de 170 millones

Más detalles

El futuro del uso de harinas y aceites de pescado

El futuro del uso de harinas y aceites de pescado LOTA PROTEIN S.A. FEEDNEWS 2011 El futuro del uso de harinas y aceites de pescado : EL FUTURO DEL USO DE HARINAS Y ACEITES DE PESCADO El mercado, oferta y demanda El producto harina y aceite de pescado

Más detalles

Aplicaciones y Tendencias en secuenciación de ADN

Aplicaciones y Tendencias en secuenciación de ADN Aplicaciones y Tendencias en secuenciación de ADN Agus%n Arasanz Duque Unidad de Genómica Centres Cien%fics i Tecnològics Universidad de Barcelona Aplicaciones y Tendencias en secuenciación de ADN Introducción

Más detalles