Héctor Rocha L. Principios de Medicina Molecular

Tamaño: px
Comenzar la demostración a partir de la página:

Download "Héctor Rocha L. Principios de Medicina Molecular"

Transcripción

1

2 796

3 GENES 1 1) HERRAMIENTAS DE LA BIOLOGÍA CELULAR 800 a) EMPLEO DE ALGUNAS ENZIMAS 802 b) AMPLIFICACIÓN POR CLONACIÓN 803 c) BIBLIOTECAS DE GENES 806 d) ANÁLISIS DE LOS PRODUCTOS CLONADOS 806 e) AMPLIFICACIÓN POR REACCIÓN EN CADENA DE LA POLIMERASA (PCR) 808 f) SECUENCIACIÓN DEL DNA 813 2) MARCADORES MOLECULARES QUE NO SON GENES 814 a) RFLP (Restriction Fragment Length Polymorphism) o Polimorfismo en el Largo del Fragmento de Restricción 815 b) VNTR (Variable Number Tandem Repeats) o Reticiones en Tandem (una tras otra) de Número Variable 816 c) RAPD (Random Amplified Polymorphic DNA) o DNA Polimórfico Amplificado al Azar 818 d) AFLP ( Amplified Fragment Length Polymorphism ) Polimorfismo en el Largo del Fragmento Amplificado 818 e) STS (Sequence Tagged Site) o Sitio Marcado por la Secuencia 819 f) EST por Expresed Sequence Tag o Expresión de la secuencia marcadora 819 g) MARCADORES MICROSATÉLITES

4 GENES 2 3) APLICACIONES EN LA MEDICINA MOLECULAR 823 a) MUTACIONES 825 b) CARIOTIPO 828 c) EL PROYECTO GENOMA HUMANO 829 d) MAPEO DE LOS GENES 829 e) MAPEO LIGADO A MARCADORES 830 f) EMPLEO DE RFLP POR RESTRICTION FRAGMENT POLYMORPHISM O POLIMORFISMO EN EL LARGO DE LOS FRAGMENTOS 831 g) MAPEO DE UN GEN 833 h) EMPLEO DE VNTRS POR VARIABLE NUMBER TANDEM REPEATS O REPETICIONES EN TANDEM DE NUMERO VARIABLE 834 i) MAPAS FISICOS O MAPAS DE ADN 837 j) MAPA CITOGENETICO 837 k) LA HIBRIDACIÓN IN SITU 838 l) FISH POR FLUORESCENCE IN SITU HYBRIDIZATION 839 m) MAPEO TOP-DOWN 840 n) MAPEO BOTTOM-UP 841 4) GLOSARIO

5 799

6 1) HERRAMIENTAS DE LA BIOLOGÍA MOLECULAR La Medicina Molecular se caracteriza por estudiar las enfermedades y su curación a nivel molecular. Para ello emplea las herramientas de la Biología Molecular y la Bioquímica aplicadas tanto en el estudio de las Proteínas como de los Ácidos Nucleicos. Entre estas herramientas podemos empezar por aquellas enzimas denominadas Endonucleasas de Restricción. Estas enzimas son originalmente empleadas por las bacterias para defenderse de las infecciones causadas por Fagos, es decir las bacterias restringen a los Fagos. Eco R1 5 G A A T T C 3 3 C T T A A G 5 Hae III 5 G G C C 3 3 C C G G 5 Hind III 5 A A G C T T 3 3 T T C G A A 5 Bam H1 5 G G A T C C 3 3 C C T A G G 5 : Sitios de corte Fig Secuencias de corte reconocidas por distintas Endonucleasas de Restricción. Así, cuando aparecen secuencias de DNA que el fago ha introducido en la bacteria, se produce el corte de estas mientras que las secuencias similares, propias de la bacteria se metilan para no ser reconocidas por la misma enzima. A su vez los sitios de corte, se caracterizan por estar flanqueados por secuencias cortas de simetría bicatenaria. Una vez ocurrido el corte, ambos extremos pueden formar lados asimétricos o cohesivos. Sin embargo, otras enzimas de restricción cortan en el mismo sector en ambas hebras quedando ambos lados romos. 800

7 Las Endonucleasas de Restricción son más de 400 y reconocen y cortan cerca de 100 sitios diferentes. Algunos de estos sitios, se encuentran frecuentemente o cada unos cuantos cientos de pares de bases, mientras que otros se hallan esporádicamente, cada pb Vector cortado por Hind III Fragmento cortado por Hind III DNA del Vector Unión entre DNA del vector y fragmento Empleando la enzima Ligasa Molécula de DNA Recombinante Recombinante introducido a la bacteria DNA Recombinante Cromosoma Bacteriano Fig Concepto de DNA recombinante destinado a ser amplificado por clonación. 801

8 En promedio las enzimas de restricción cortan en sitios reconocidos que tienen 4, 6 y 8 pares de bases (fig. 1 16), produciendo segmentos sucesivos de 256, 4000 y bases de largo en el genoma humano. Las endonucleasas de restricción hicieron posible la tecnología del DNA recombinante (fig. 2 16), ya que con estas enzimas se pueden cortar segmentos de DNA que tengan distintos orígenes y posteriormente juntarlos y proceder a ligarlos, empleando una enzima denominada Ligasa, que produce la unión 3, 5 Fosfato o en otras palabras, forma el Fosfodiester. Posteriormente, bajo las condiciones adecuadas (alta concentración de CaCl 2, etc) las moléculas de DNA recombinante pueden entrar a las bacterias y replicarse, autónomamente o bien pueden integrarse al cromosoma celular. Volver al inicio a) EMPLEO DE ALGUNAS ENZIMAS Algunas enzimas de E.Coli se emplean para el manejo de los fragmentos de DNA con que se trabaja en la Medicina-Molecular. Así tenemos que el DNA puede ser sometido a varios tratamientos, se puede marcar con grupos Fosfatos como P 32 (así se lo ubica en una radioautografía), se puede amplificar con los cebadores adecuados (para aumentar Tabla 1-16 Enzima Actividad Uso Transcriptasa Inversa DNA polimerasa RNA dependiente de origen viral Se emplea para convertir RNAm en su copia complementaria de DNAc DNA Ligasa Une covalentemente la unión Fosfodiester 5 Fosfato al grupo 3 Hidroxilo Fosfatasa Alcalina Elimina fosfatos del extremo 5 del DNA Polinucleótido kinasa Introduce el γ Fosfato de ATP en el extremo 5 del DNA Tac (Thermophylus DNA polimerasa termoestable Acuaticus) DNA que resiste los cambios de polimerasa temperatura para abrir (desaparear ambas hebras) y cerrar (aparear hebras complementarias) el DNA Endonucleasas de Restricción Reconocen sitios de simetría bicatenaria de 4, 6 y 8 pbs cortan dejando lados cohesivos y romos continuo Se emplea en los procedimientos donde se requiere DNA recombinante Se emplea para reemplazar el fosfato 5 por otro radiactivo Técnica PCR (Polymerase Chain Reaction) Amplifica ambas hebras de un segmento de DNA, a partir de unos cebadores sintéticos (de secuencia conocida) que se aparean con su parte complementaria. Al repetir el proceso en ciclos de frío (apareamiento) y calor (desapareamiento) de las hebras DNA recombinante, mapeo, etc. 802

9 su número de copias), transcribir desde RNA a DNA (se emplea una Transcriptasa Inversa de un retrovirus) o se puede cortar en lugares específicos (con Endonucleasas de Restricción). Algunas de estas enzimas se observan en la Tabla b) AMPLIFICACION POR CLONACION Volver al inicio Uno de los vectores (fig. 3 16), que se emplea para introducir DNA exógeno o foráneo a la bacteria es el Plásmido, mientras que el DNA foráneo puede ser DNAc (Ver Glosario al final), obtenido de un RNAm (por Transcriptasa Inversa) o DNA genómico (fragmentos de DNA al azar de un organismo). Es posible aquí sintetizar una segunda hebra al DNAc con una DNA pol I y luego se pueden insertar ambas hebras en un Plásmido o un vector Lambda, para ser posteriormente amplificado por clonación. La clonación se lleva a cabo en vectores contenidos en levaduras, bacterias y partículas virales. El empleo de uno u otro dependerá del tamaño del fragmento a clonar. El Plásmido (fig. 3 16), es normalmente conocido por ser un DNA doble hebra circular extracromosómico y autoreplicante de la bacteria, es distinto al genoma normal y no es esencial para la sobrevivencia de la célula. Son conocidos por conferir ventajas selectivas a la bacteria (resistencia a antibióticos). Ori C Vector pbr322 Resistencia a la Ampicilina PLASMIDO Resistencia a la Tetrac iclina Fig Características del vector pbr322 Los Plásmidos pueden ser transferidos de célula en célula y algunos de ellos se pueden integrar al genoma de la bacteria. Una célula huésped puede tener muchas copias de un plásmido. En la actualidad existe una serie de plásmidos artificialmente construidos, que cuentan con sitios específicos para cargar DNA foráneo y se pueden seleccionar al entregar a la bacteria resistencia a algún antibiótico. Esto permite separar aquellas bacterias que han adquirido el Plásmido de las otras que no. Algunos de estos plásmidos, pueden también ser replicados en levaduras. Otros Plásmidos constituyen lanzaderas que son capaces de replicar tanto en E. Coli como en levaduras y son conocidos por las siglas YIP o Yeast Integrating Plasmid, YRP por Yeast Replicating Plasmid, YEP por Yeast Expression Plasmid y aún por el nombre 803

10 de YCP por Yeast Centromer Plasmid. El uso de cualquiera de ellos depende del tamaño del segmento de DNA que se quiera amplificar. Mediante los plásmidos se puede crear una biblioteca genómica o colección no ordenada de clonos formada por fragmentos superpuestos de DNA amplificado, perteneciente a un organismo cualquiera. La relación de unos con otros de los fragmentos se puede establecer posteriormente por mapeo físico, hasta poner orden en la biblioteca, es decir tener una colección de fragmentos amplificados, pero contiguos. Esto significa que donde termina la secuencia de uno empieza la del otro. Esta colección debe corresponder en total, a un sector específico de un gen. Los clonos individuales (fragmentos amplificados) se colocan en placas de microtitulación en dos dimensiones con múltiples pocillos en el plano, donde la ubicación de cada uno es conocida por el número de la fila y columna, fig Otro vector a emplear, puede ser una partícula viral o un bacteriófago como el fago Lambda que contiene 40kb de DNA doble hebra (fig. 4 16). A este se puede integrar DNA humano de un tamaño que bordea las 15 a 25kb. Esto se logra por acción de la misma endonucleasa de restricción y posterior unión mediante la enzima Ligasa. Posteriormente al infectar una bacteria y entrar en la etapa lítica se generan nuevas copias del fago que se amplificará junto con el DNA humano, produciendo tantas copias como partículas virales existan. Otro bacteriófago, es el conocido como P1, que puede acomodar más DNA que el Lambda y constituye el tipo P1- PAC por P1- Plasmid Artificial Chromosome o cromosoma artificial de plásmido. Forma lineal Bacteriópfasgo Lambda Cos: Lados Cohesivos Cos: Lados Cohesivos. La hebra es complementaria al otro extremo RS: Lísis del huesped OP: Sints. DNA Secuencia de cabeza y cola Región b2. Genes No esencial Rec. para Implica sobreviven dos en cia recombi nación Secuencia de cabeza y cola Forma circular del Bacteriófago Lambda Genes de Regulación RS OP Lados Cohesivos RS OP Genes de Regulación son genes que inician y terminan el proceso Fig Caracteríosticas del fago Lambda. Región b2 no esencial para la sobrevivencia Genes Rec. Implicados en Recombinación 804

11 Un vector aún, de mayor capacidad que los anteriores se denomina Cósmido, y se encuentra construido artificialmente de forma quimérica o mixta con genes del plásmido, para resistencia a antibióticos y otros del Fago Lambda como transportador. Contiene el gen cos (Cohesivo) del fago, cuya actividad promueve el empaquetamiento del DNA foráneo en la partícula viral para posteriormente infectar una bacteria tipo E. Coli, lo que permite la replicación del DNA foráneo con fragmentos de 30 Kb a 45 Kb de largo. Continuando con la descripción de los vectores, tenemos a los YAC, por Yeast Artificial Chromosome (fig. 5 16) o cromosoma artificial de levadura. Contiene todos los elementos que un DNA necesita para funcionar como cromosoma en el organismo huésped y se puede cargar con uno de los mayores fragmentos de 400 Kb a 500 Kb. Se encuentra construido con un fragmento telomérico, que entrega los extremos necesarios para la replicación, más fragmentos centroméricos y las secuencias correspondientes, que indican y promueven el sitio de origen de la replicación que es necesario en la levadura (YCP + Telómeros). También contienen genes que se emplean en la selección de las levaduras que sí han tomado el vector. A fin de propagar estos vectores en E. Coli antes de cargarlos con DNA, se les ha incorporado un sitio denominado Ori C o de inicio u origen de la replicación bacteriana y un gen que les entrega resistencia a la Ampicilina. Este último se emplea para seleccionar las bacterias que han tomado el YAC. SECUENCIA DE REPLICACION AUTÓNOMA Sitio Ori de plasmido y gen Amp CENTROMERO Eco R1 Marcador de Selección Telomerasa Telomerasa Bam H1 Fig Características del YAC. Bam H1 En general una vez que se tiene el DNA humano integrado, mediante el empleo de las Endonucleasas de Restricción y Ligasas en un vector, se procede a amplificarlo mediante la Clonación, proceso por el cual se producen múltiples copias exactas de un solo gen u otro segmento del DNA para así obtener suficiente material de estudio. El resultado de esta amplificación en distintos segmentos de DNA genera una biblioteca de clonos o colección de clonos hechos de una serie de fragmentos de DNA que se superponen representando el genoma entero del organismo. 805

12 Otro tipo de clonación ocurre cuando se divide una célula haciendo múltiples copias de sí misma y este es el caso de la conocida oveja Dolly. En este caso se recurrió a la clonación produciendo animales genéticamente idénticos a la oveja donadora de los núcleos de células mamarias, los que fueron posteriormente implantados en oocitos fecundados. Volver al inicio c) BIBLIOTECAS DE GENES. El objetivo de la clonación, fuera de amplificar copias del DNA sirve para aislar genes, expresar genes y generar clonos que se emplean como sondas para el análisis genómico. Por lo tanto, para reponer los clonos se debe echar mano a la biblioteca. Durante el procedimiento de aislar genes se debe seleccionar un clono de los muchos presentes en una biblioteca, empleando para ello una sonda formada por un polinucleótido de DNA o bien un anticuerpo. Una vez que se ha aislado un gen se debe estudiar su expresión mediante un vector de expresión, que consiste en la acción de un promotor específico para este gen y sus condiciones de cultivo en alguna célula huésped. Cuando se emplean clonos como sondas para el análisis genómico es posible determinar el número de copias de un gen en el genoma, sus relaciones taxonómicas y la construcción de mapas por ligación de caracteres. Biblioteca Genómica: Se produce cuando todo el DNA genómico se digiere y los fragmentos sé clonan dentro de un vector apropiado. De esta manera es posible disponer de muestras de todo el genoma del organismo representando a las secuencias que codifican y no codifican. En el caso de que se busque un gen se empleará un vector de inserción que permite amplificar un gran segmento (YAC). En otro caso cuando se necesita una fuente de sondas para mapeo por ligación se necesitaran inserciones menores en vectores (plásmidos). Idealmente una biblioteca de este tipo debe disponer de muchas copias de cada gen. Biblioteca DNAc: Esta biblioteca se genera a partir de RNAm y Transcriptasa Inversa, de tal manera que solo se representarán los genes que solo se expresan y no aquellos que permanecen silenciosos o aquellos segmentos que separan los genes y constituyen la mayor cantidad de DNA. Por lo tanto el número de genes de que se disponga dependerá del tejido que se esté considerando y el estado de desarrollo en que este se encuentre. Volver al inicio d) ANÁLISIS DE LOS PRODUCTOS CLONADOS. Un gen puede ser identificado mediante el empleo del DNAc (DNA complementario, sin intrones) obtenido desde su propio RNAm. De esta forma se pueden identificar los segmentos de DNA que portan sus características e incluso a cual de todos los cromosomas corresponde. Con este fin se emplea la técnica denominada Southern 806

13 Blotting y Northern Blotting. La primera de ellas consiste en separar los fragmentos de distinto tamaño producto de una digestión con Endonucleasas de Restricción en un gel de Agarosa (fig. 6 16). Luego se trata el gel con NaOH para denaturar el DNA (separar ambas hebras), se neutraliza este y el DNA es transferido a un filtro de nitrocelulosa o a un papel filtro de nylon, mediante difusión capilar o bajo corriente eléctrica (fig. 7 16). Posteriormente, se fija el DNA al papel filtro por tratamiento con UV o baking. El mismo papel filtro se pone luego en contacto con la sonda radioactiva o fluorescente que al reconocer su secuencia complementaria hibridiza, identificando a la hebra que después de una radioautografía (si la sonda es marcada radiactivamente), mostrará las bandas correspondientes a los segmentos del gen o exones que se encuentran presentes. En el caso del Northern blotting, se separa RNA por electroforésis (fig. 6 16), el que luego es transferido al papel filtro de nitrocelulosa, para ponerlo en contacto con una sonda DNAc y proceder a visualizarlo como se describió anteriormente. Existe otro desarrollo aún, de este mismo tipo y que se denomina Western blot, en el cual se separan ahora, proteínas por electroforésis con una mezcla: detergente (Sodio Dodecil Sulfato: SDS) en un polímero de separación (Acrilamida) denominada SDS- Poliacrilamida. Las proteínas separadas por peso molecular se transfieren electroforéticamente a papeles filtros de nitrocelulosa. Luego, se detectan mediante una reacción con anticuerpos marcados con Yodo 131 o con Fluoresceína. Gel Suministro de energía a los electrodos Hendiduras donde se pone la muestra Buffer Fig Serparación de ácidos nucleicos mediante electroforésis Buffer Capas de adsorbentes de toallas de papel Gel de Agarosa Hoja de Nitrocelulosa Hoja adsorbente Fig Técnica de traspaso o Southern Blotting. Los ácidos nucleicos son arrastrados por las toallas absorbentes. Volver al inicio 807

14 e) AMPLIFICACIÓN POR REACCIÓN EN CADENA DE LA POLIMERASA O PCR (POLYMERASE CHAIN REACTION). El análisis de los genes responsables de una enfermedad puede ser llevado a cabo en muestras extremadamente pequeñas como son los fibroblastos fetales extraídos del líquido amniótico. De esta manera se pesquisan posibles enfermedades genéticas antes del nacimiento, así mismo se puede detectar la identidad del DNA perteneciente a cualquier tejido, pelos, piel, sangre, semen dejado en la escena de algún crimen. Esta técnica es capaz de amplificar secuencias específicas de DNA, circunscrito a tan solo un determinado sector millones de veces, no se requiere de todo el genoma intacto. Incluso modificaciones a la misma técnica permiten detectar mutaciones puntuales de una sola base y niveles de expresión de los genes en muestras muy pequeñas de tejidos CEBADOR UN SOLO CICLO DE REPLICACIÓ CEBADOR DNA Pol + dnct + Mg HEBRA NUEVA HEBRA NUEVA Fig Amplificación por medio de cebadores La técnica presenta un solo inconveniente comparada con la amplificación por clonación, que siempre es necesaria en los trabajos preliminares y consiste en la síntesis in vitro de un segmento de oligonucleótidos complementario al segmento de DNA a amplificar. Este segmento constituye el cebador o extremo 3 para la enzima DNA Polimerasa, que genera las hebras complementarias (fig. 8 16). De esta manera subiendo la temperatura la doble hebra se desune, separándose. A continuación al bajar la temperatura, esta vez se aparea con los cebadores o primers, dejando estos el extremo 3 para que la DNA pol de Thermophylus Aquaticus (resistente a los cambios cíclicos de temperatura), empiece la replicación del segmento a amplificar. Posteriormente se repite el ciclo produciéndose nuevas copias cada vez que los cebadores se unen a sus respectivas secuencias complementarias. En 5 ciclos el segmento original de DNA se puede amplificar 2, 4, 16, 256, veces. 808

15 El producto amplificado se puede analizar mediante electroforésis en Agarosa, seguido de tinción con Bromuro de Etidio, que se intercala entre las bases del DNA y lo hace visible a la luz UV. Por otro lado, también se puede marcar el producto con nucleótidos radioactivos en la posición γ P 32, de esta manera el P 32 se incorpora en los productos y estos pueden ser visualizados por radioautografía después de separarse por electroforésis en Agarosa.. Variaciones de esta técnica se logran aplicándola al producto de la enzima Transcriptasa Inversa o RT-PCR, es decir a partir del RNA total producido por una célula del tejido, la enzima Transcriptasa inversa produce DNAc, el cual es un segmento continuo de solo exones. Posteriormente al agregarse los cebadores adecuados que aparean con los extremos del DNAc, es posible amplificarlo. De esta manera se puede distinguir el producto de tan solo un gen entre cientos de ellos que se encuentran expresados en un cierto tejido, en otras palabras se dice que se abre una ventana. GEN β-globina NORMAL GEN β-globina MUTADO CCTGAGGAG CCTGTGGAG GGACTCCTC GGACACCTC Amplificación por medio de cebadores CCTGAGGAG CCTGTGGAG GGACTCCTC Material amplificado, muchas copias a electroforésis GGACACCTC MIGRACION NORMAL GEN β-globina Una sola hebra MIGRACIÓN ANORMAL GEN β-globina Una sola hebra Fig Comparación entre gen normal y mutado por PCR- SSCP. La migración anormal de una sola hebra se debe a la mutación Otra variación de estas técnicas, donde se puede aplicar PCR, es posible cuando se reconocen mutaciones puntuales en genes ya descritos o caracterizados. Esta técnica se denomina PCR-SSCP por PCR - Single Strand Conformation Polymorphism o Reacción en cadena de la Polimerasa con Polimorfismo en la Conformación de una Sola Hebra (Fig. 9 16), y consiste en explotar el cambio conformacional que se produce en una sola hebra entre el segmento del DNA que posee un gen mutado comparado al segmento normal sin mutación. Para ello se amplifica una secuencia de 809

16 100 a 200 pb de un gen mutado y uno normal, empleando los cebadores que circunscriben el sector de la mutación. Posteriormente sobre el producto amplificado, se lleva a cabo la separación de ambas hebras y la electroforésis en Poliacrilamida (medio poroso de mayor resolución que la Agarosa), se discrimina aquí la forma de las GEN β -GLOBINA NORMAL GEN β -GLOBINA MUTADO Apareo correcto CCTGAGGAG T A GGACTCCTC CCTGAGGAG GGACTCCTC Oligonucleó tidos Ligasa termoestable Oligonucleótidos Ligados U nión 5, 3 CCTGT GGAG T Apareo incorrecto A GGACA CCTC CCTGT GGAG Oligonucleó - tidos No ligados GGACA CCTC N O R M AL AN EM IA F ALC IFO R M E Nuevos Oligonucleótidos No Ligados Oligonucleótidos Ligados Fig Reacción en cadena de la Ligasa. hebras observándose una diferencia en la migración de ambas, la normal y la que posee la mutación. Otra técnica más empleada para detectar mutaciones puntuales en genes ya conocidos y secuenciados en pacientes con alto riesgo de poseer un alelo mutante, se denomina Ligase Chain Reaction (LCR) por Reacción en Cadena de la Ligasa (Fig ). Consiste en emplear una Ligasa termoestable que une dos Oligonucleótidos adyacentes siempre que estos hibridicen totalmente con la hebra complementaria. Si la hebra complementaria es la original o wild type, la hibridación es de 100% y ambos oligonuclótidos son ligados por la enzima, es decir se produce la unión 3 OH con el 5 Fosfato formando el Fosfodiester. Ahora, en el gen mutante si ambos oligonucleótidos aparean con el resto de su longitud, pero no en el extremo 3 de cada Oligonucleótido donde se encuentra precisamente la mutación puntual, ya que las bases normales del oligonucleótido no corresponden a las complementarias en el DNA de cada hebra mutada. Se produce aquí una joroba que impide a la Ligasa unir los extremos de los oligonucleótidos adyacentes. Por lo tanto, solo los correctos correspondientes al wild type serán amplificados y no los que no se unieron. De esta manera examinando el número de copias de ambos genes original y mutante se conoce si el paciente lleva la enfermedad 810

17 La Transgénesis (fig ), es una técnica que consiste en introducir genes foráneos para su estudio en la línea germinal de algunos animales. Una de las primeras experiencias se llevó a cabo al introducir en ratones el gen de la hormona del crecimiento, obteniéndose individuos con doble tamaño que el normal. Enzima de restricción que corta parcialmente Fragmentos superpuestos DNA vector cortada con la misma enzima de restricción Unuión de los fragmentos usando la enzima Ligasa Fig Transgénesis. Para ello se emplean vectores preparados con genes que codifican factores de transcripción, que promuevan la expresión del gen necesario y se inyectan en el núcleo de huevos fertilizados. 811

18 datp datp datp datp dgtp dgtp dgtp dgtp dctp dctp dctp dctp dttp dttp dttp dttp ddatp ddgtp ddttp ddctp Posillos donde se separan los fragm entos replicados con las mezclas de Nucleótidos que se observan más arriba Fig Separación por electroforésis de la hebra replicada en presencia de los 4 dntps más un ddntp Los huevos a su vez, se trasplantan al útero de las hembras receptoras para el desarrollo de las crías transgénicas. El DNA de las crías se emplea luego para detectar la presencia del gen activo. Si el transgene posee herencia Mendeliana significa que se transfiere en la línea germinal. Esta técnica se emplea en plantas y animales de campo para introducir resistencia a enfermedades e infecciones, así como también para producir hormonas y proteínas humanas presentes en la leche animal. Un desarrollo de esta última técnica es la Terapia Génica practicada en humanos, sin embargo, existen barreras éticas que impiden su aplicación hasta ahora. En el futuro se pretende reemplazar de esta manera genes enfermos por los correctos. Si se introducen los genes en células somáticas y no en la línea germinal se impedirá el traspaso del gen hacia los descendientes. Se ha practicado esta técnica en la médula de los huesos, fibroblastos y hepatocitos. Los vectores que se emplean en estos casos son derivados de retrovirus, que cuentan solo con las regiones promotoras transcripcionales, como LTRs (Long Terminal Repeats) para manejar la expresión del gen de interés. Se ha logrado éxito solo en células en cultivo y aún no se ha pasado totalmente a la etapa en humanos. Volver al inicio 812

19 f) SECUENCIACIÓN DEL DNA Para establecer que dos clonos específicos son adyacentes en el genoma se deben construir bibliotecas de clonos con fragmentos que se superpongan parcialmente. Estas bibliotecas de clonos se ordenan dividiendo los incertos en pequeños fragmentos y determinando que clonos tienen secuencias comunes. Uno de los métodos tradicionales que aún perdura es el de Sanger y consiste en el empleo de un dideoxinucleótido trifosfato (ddntp) durante la replicación del DNA mediante la DNA pol I. Este nucleótido carece del grupo 3 -OH por lo que la enzima se detiene después que lo adiciona por su lado 5 al extremo 3 del Deoxiribonucleótido anterior y no puede continuar replicando en base a la hebra molde (figs. 12 y 13 16). De esta manera si se agrega un ddgtp junto a un dgtp se producirá una competencia entre ellos por ocupar un lugar en la hebra naciente. Cuando la hebra madre tiene SECUENCIA DE 3 TCGATCGATCGATCGATCGA 5 LA HEBRA MADRE: SECUENCIA DE LA HEBRA HIJA: 5 AGCTAGCTAGCTAGCTAGCT3 FRAGMENTOS EN CADA POSILLO ddatp ddgtp ddctp ddttp dda AddG AGddC AGCddT AGCTddA AGCTAddG AGCTAGddC AGCTAGCddT AGCTAGCTddA AGCTAGCTAddG AGCTAGCAGddC AGCTAGCTAGCddT AGCTAGCTAGCTddA Fig Secuencia de los fragmentos que se encuentran en cada pocillo del gel Citosina en su secuencia, la hebra hija adicionará dgtp y una fracción adicionará ddgtp para detenerse produciendo una población de fragmentos que se detienen o siguen cada vez que en la hebra madre aparece una Citosina. Por lo tanto si contamos con cuatro mezclas de los cuatro dntps, más cada uno de ellos con ddntp distinto, tendremos una población de hebras hijas o hebras nacientes que se detendrán cada vez que aparezca la base complementaria a la que tienen como ddntp. Por lo tanto se dispondrá de una población de fragmentos de distintos tamaños que se pueden separar por electroforésis ocupando cuatro pocillos, cada uno correspondiente al nucleótido que se encuentra como ddntp. 813

20 5 Marcador que flanquea el gen GEN SECUENCIADO Marcador que flanquea el gen 3 CEBADOR 5 3 CEBADOR CEBADOR CEBADOR CEBADOR Fig Técnica de Chromosome Walking Otra técnica empleada para llenar huecos durante la secuenciación es la denominada Chromosome walking (fig ) o caminar sobre el cromosoma. Mediante esta, sé hibridiza un cebador de secuencia conocida a un clono al azar de una biblioteca genética y se sintetiza la hebra complementaria, posteriormente esta se aísla y su secuencia terminal 3, se emplea como cebador para continuar replicando la hebra complementaria o continuar caminando sobre el cromosoma. Sin embargo, debido a que los cebadores deben ser sintetizados químicamente el gran número de cebadores que se necesita para avanzar presenta una desventaja. Volver al inicio. 2) MARCADORES MOLECULARES QUE NO SON GENES. Se encuentran constituidos por distintas secuencias que no son parte de los genes y entre ellas tenemos: a) sitios específicos de corte para las enzimas de restricción. b) secuencias repetidas en tandem de 8 a 16 pares de bases c) secuencias repetidas en tandem de 4 a 6 pares de bases 814

21 Todas estas secuencias se heredan según la genética Mendeliana, así tenemos que mientras más relacionadas se encuentren dos personas, compartirán un número mayor de fragmentos de igual tamaño como producto de las enzimas de restricción. Esta técnica es la más antigua y se llama RFLP por Restriction Fragment Length Polymorphism o Polimorfismo en el Largo del Fragmento de Restricción. a) RFLP ( RESTRICTION FRAGMENT LENGTH POLYMORPHISM) O POLIMORFISMO DEL FRAGMENTO DE RESTRICCIÓN Esta técnica se basa en los polimorfismos que existen en la secuencia de los cromosomas, es decir, el mismo cromosoma en dos personas distintas, presenta una variación cada 200 a 500 pb en la secuencia. Esta variación crea o hace desaparecer un sitio de restricción y se alterará con ello el tamaño de los fragmentos. No requiere de secuenciación, pero sí de una biblioteca creada a partir de fragmentos de DNA clonados en un vector. Luego se emplea una sonda basada en DNA genómico o DNAc. Se debe emplear una separación electroforética en geles de Agarosa. El DNA del organismo que interesa se digiere con endonucleasa de restricción y luego es sondeado con una biblioteca de DNA clonado. Los apareamientos de la sonda con el DNA se observan por radioautografía o fluorescencia. Se puede detectar siempre el mismo sitio y sirve para mapeos. Los polimorfismos se detectan como diferencias en pesos moleculares manifestado por la migración en el gel de Agarosa de los fragmentos del DNA del huésped. SITIOS DE CORTE POR LA ENZIMA DE RESTRICCIÓN ALELO A ALELO B ALELO A ALELO B * * * SONDA MARCADA Fig Los fragmentos producidos por los sitios de corte por la enzima de restricción se visualizan mediante un Southern Blot con su respectiva sonda. Volver al inicio 815

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas ELEMENTOS BÁSICOS DE LA INVESTIGACIÓN EN GENES Análisis

Más detalles

Tema 11. Herramientas de la genética molecular

Tema 11. Herramientas de la genética molecular Tema 11. Herramientas de la genética molecular Genética CC. Mar 2004-05 Objetivos Técnicas de clonación Construcción de genotecas e identificación de secuencias Mapas de restricción Amplificación (PCR)

Más detalles

Tecnología de DNA recombinante I

Tecnología de DNA recombinante I Tecnología de DNA recombinante I Base: capacidad de manipular moléculas de DNA en un tubo de ensayo Enzimas: Purificadas, con actividades conocidas y controladas DNA polimerasas Síntesis de DNA Nucleasas

Más detalles

Técnicas de Biología Molecular

Técnicas de Biología Molecular Técnicas de Biología Molecular DNA I. Enzimas de restricción Análisis Las enzimas de restricción fueron aisladas de bacterias; su función natural es proteger contra DNA extraño II. Separación electroforética

Más detalles

Clonación molecular. Clonar significa hacer copias idénticas

Clonación molecular. Clonar significa hacer copias idénticas INGENIERÍA GENÉTICA Clonación molecular Clonar significa hacer copias idénticas Este término originalmente fue aplicado al procedimiento de aislar una célula y permitirle reproducirse creando una población

Más detalles

Análisis en Genética 1

Análisis en Genética 1 Análisis en Genética 1 Análisis Genético FUNCION BIOLOGICA Gen o genes implicados Localización Cartografiado Función Interacciones TIPOS DE MUTACIÓN MUTACIÓN GÉNICA -El alelo de un gen sufre un cambio,

Más detalles

Reacción en cadena de la polimerasa (PCR)

Reacción en cadena de la polimerasa (PCR) Dr. Alejandro Leal Reacción en cadena de la polimerasa (PCR) La reacción en cadena de la polimerasa (PCR, por sus siglas en inglés de "polymerase chain reaction") es un método de amplificación in vitro

Más detalles

Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares. Técnicas Moleculares. Técnicas Moleculares 8/13/13

Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares. Técnicas Moleculares. Técnicas Moleculares 8/13/13 8/13/13 Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares CAF516 O Recursos Genéticos y Biotecnología 14 Agosto 2013 Técnicas Moleculares Aplicaciones en muchas disciplinas Generan

Más detalles

TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO

TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO TEST de PATERNIDAD Este experimento introduce a los alumnos en el uso del ADN y la PCR para simular una determinación de paternidad. Los estudiantes

Más detalles

QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA. Julio A. Carrasco Vallejo Julio 2014

QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA. Julio A. Carrasco Vallejo Julio 2014 QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA Julio A. Carrasco Vallejo Julio 2014 Definiciones Biología Molecular: Estudio de los flujos de información genética en una célula Biotecnología: Uso de sistemas

Más detalles

Investigación en genes. Tecnología del ADN recombinante

Investigación en genes. Tecnología del ADN recombinante Investigación en genes Tecnología del ADN recombinante Tecnología del ADN recombinante 1º parte: Conocimientos básicos que posibilitaron su desarrollo 2º parte: Instrumentos básicos 3º parte Ejemplos Conocimientos

Más detalles

Enzimas de restricción

Enzimas de restricción BIOTECNOLOGIA Enzimas de restricción Endonucleasas que reconocen dianas específicas en el ADN Protegen a cada cepa de bacterias de otro ADN que no pertenece al sistema El ADN propio está protegido porque

Más detalles

Práctico: Genética bacteriana 2007.

Práctico: Genética bacteriana 2007. Práctico: Genética bacteriana 2007. Actividad integrada Departamento de Genética Departamento de Bacteriología y Virología. OBJETIVOS Objetivos generales El estudiante al terminar la actividad práctica

Más detalles

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante BIOTECNOLOGÍA 1.- Ingeniería Genética, ADN recombinante Técnica del ADN recombinante: es la más usada en ingeniería genética, esta basada en el uso de las enzimas de restricción o endonucleasas de restricción

Más detalles

EDUCACION CONTINUADA. Introducción. Caso clínico nº 1

EDUCACION CONTINUADA. Introducción. Caso clínico nº 1 EDUCACION CONTINUADA L. Castaño, J.R. Bilbao, I. Urrutia An Esp Pediatr 1997;46:513-518. Introducción a la biología molecular y aplicación a la pediatría (5): Casos clínicos. Alteraciones genéticas en

Más detalles

BIOTECNOLOGÍA Y GENÉTICA MOLECULAR

BIOTECNOLOGÍA Y GENÉTICA MOLECULAR BIOTECNOLOGÍA Y GENÉTICA MOLECULAR Conceptos de biotecnología y genética molecular. Importancia y beneficios de la biotecnología. Genética y Tecnología del DNA recombinante: estrategias de clonación. Enzimas

Más detalles

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri OBJETIVO Desarrollar un banco de datos a partir de plantas de origen indudable y del uso

Más detalles

Técnicas de Biología Molecular. Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO

Técnicas de Biología Molecular. Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO Técnicas de Biología Molecular Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO 2004 Extracción de ácidos nucleicos o o DNA RNA Tipos de Muestras Sangre total (EDTA) Saliva Líquido Amniótico Bulbo

Más detalles

Mapeo genómico: Determinación de la localización de elementos en un genoma, con respecto de marcadores identificados

Mapeo genómico: Determinación de la localización de elementos en un genoma, con respecto de marcadores identificados Mapeo genómico: Determinación de la localización de elementos en un genoma, con respecto de marcadores identificados Tipos de mapas: MAPAS FISICOS (de restricción, citogenéticos, de híbridos de radiación...)

Más detalles

Cultura Cientí fica 1 Bachillerato

Cultura Cientí fica 1 Bachillerato Cultura Cientí fica 1 Bachillerato 3. La revolución genética: biotecnología Actividades de consolidación 1. Cualquier molécula de ADN formada por la unión de segmentos de ADN de origen diferente es: a)

Más detalles

Soluciones de la serie de ejercicios 4 (Curso 7.012)

Soluciones de la serie de ejercicios 4 (Curso 7.012) Pregunta 1 Soluciones de la serie de ejercicios 4 (Curso 7.012) Usted está estudiando la síntesis del aminoácido triptófano en las bacterias. Las enzimas TrpA, TrpB, TrpC, TrpD, TrpE and AroH son necesarias

Más detalles

Practica la genética Ficha didáctica del profesorado Bachillerato

Practica la genética Ficha didáctica del profesorado Bachillerato Ficha didáctica del profesorado Bachillerato www.eurekamuseoa.es Extracción de ADN Cuál es la función de cada uno de los ingredientes utilizados para realizar la disolución tampón para la visualización

Más detalles

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras METODOLOGIA DEL PCR Lic. Jorge Mato Luis Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras Desnaturalización del DNA 5 A G G T T A G T G G A C C C T T G A T 3 3 T C C A

Más detalles

7.012 Serie de ejercicios 5

7.012 Serie de ejercicios 5 Nombre Grupo 7.012 Serie de ejercicios 5 Pregunta 1 Al estudiar los problemas de esterilidad, usted intenta aislar un hipotético gen de conejo que explique la prolífica reproducción de estos animales.

Más detalles

GENES Y MANIPULACIÓN GENÉTICA

GENES Y MANIPULACIÓN GENÉTICA GENES Y MANIPULACIÓN GENÉTICA El ADN, material de los genes La información que controla la aparición de los caracteres hereditarios se localiza en el interior del núcleo celular y se transmite de célula

Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015

CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 DEFINICIÓN PCR: Constituye la técnica más importante para amplificar ácidos nucleicos in vitro. Ambas hebras del DNA de interés son replicadas

Más detalles

OLIMPÍADA ARGENTINA DE BIOLOGÍA APEB ÁREA DE ACTUALIZACIÓN Y PERFECCIONAMIENTO EN LA ENSEÑANZA DE LA BIOLOGÍA CONTINUIDAD Y CAMBIO DE LAS ESPECIES I:

OLIMPÍADA ARGENTINA DE BIOLOGÍA APEB ÁREA DE ACTUALIZACIÓN Y PERFECCIONAMIENTO EN LA ENSEÑANZA DE LA BIOLOGÍA CONTINUIDAD Y CAMBIO DE LAS ESPECIES I: MINISTERIO DE EDUCACIÓN, CIENCIA Y TECNOLOGIA UNIVERSIDAD NACIONAL DE RIO CUARTO FACULTAD DE CIENCIAS EXACTAS, FÍSICO - QUÍMICAS Y NATURALES DEPARTAMENTO DE CIENCIAS NATURALES OLIMPÍADA ARGENTINA DE BIOLOGÍA

Más detalles

7/13/2009. Breve introducción a la biología molecular y sus aplicaciones. Victoria koala. Queensland koala. Morfología vs. ADN? Phascolarctus cinereus

7/13/2009. Breve introducción a la biología molecular y sus aplicaciones. Victoria koala. Queensland koala. Morfología vs. ADN? Phascolarctus cinereus Morfología vs. ADN? Phascolarctus cinereus Queensland koala Victoria koala New South Wales koala 3 subespecies Morfológicamente: Diferencias en tamaño y color principalmente Molecularmente: Un grupo dividido

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

VECTORES Y CLONADO Martín Monte, viernes 27 de Marzo, 2009

VECTORES Y CLONADO Martín Monte, viernes 27 de Marzo, 2009 VECTORES Y CLONADO Martín Monte, viernes 27 de Marzo, 2009 Caracterización y estudio de la función de un gen (Tb podría ser un fragmento de DNA genómico para el estudio de splicing o del promotor de un

Más detalles

Name Date Class. [Comienzo de Sección 11-1] Por favor pasa a la página 226 para empezar la Sección 11-1, La Ingeniería Genética.

Name Date Class. [Comienzo de Sección 11-1] Por favor pasa a la página 226 para empezar la Sección 11-1, La Ingeniería Genética. [Introducción] Por favor abre tu libro en la página 225. Capítulo 11: La Tecnología de Genes Los científicos trabajan día a día en búsqueda de nuevas formas para el uso de la tecnología genética en beneficio

Más detalles

Técnicas moleculares.

Técnicas moleculares. Técnicas moleculares. DMTV Carolina Acevedo Curso de Microbiología 2015 SÍNTESIS IN VITRO DE UNA GRAN CANTIDAD DE COPIAS DE UN SEGMENTO DE ADN EXISTENTE EN UNA MUESTRA. O sea. Amplificamos en forma exponencial

Más detalles

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now.

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now. Unidad Curricular: Virología y Micología Veterinaria 1 TRABAJO PRÁCTICO No. 3 AMPLIFICACIÓN DE GENES VIRALES Reacción en Cadena de la Polimerasa, conocida como PCR (por sus siglas en inglés: Polimerase

Más detalles

CATEDRA DE BIOQUIMICA FACULTAD DE MEDICINA UNIVERSIDAD NACIONAL DEL NORDESTE AÑO 2007

CATEDRA DE BIOQUIMICA FACULTAD DE MEDICINA UNIVERSIDAD NACIONAL DEL NORDESTE AÑO 2007 CATEDRA DE BIOQUIMICA FACULTAD DE MEDICINA UNIVERSIDAD NACIONAL DEL NORDESTE TECNOLOGIA DEL DNA RECOMBINANTE AÑO 2007 Autores Dr. Gustavo Agolti. Profesor Adjunto por Concurso. Cátedra de Bioquímica. Facultad

Más detalles

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática.

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Departamento de Bioquímica Médica y Biología Molecular Práctica 3 Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Curso 1 Medicina (Abril) 2012 BIOQUÍMICA

Más detalles

Técnicas de ADN recombinante: la manipulación genética

Técnicas de ADN recombinante: la manipulación genética Técnicas de ADN recombinante: la manipulación genética A partir de los años 70 se desarrollaron las herramientas de la biología molecular o la ingeniería genética o lo que se ha llamado técnicas del ADN

Más detalles

Fisiogenética Vegetal

Fisiogenética Vegetal Fisiogenética Vegetal USO DE MARCADORES MOLECULARES, aplicaciones y ejemplos Cecilia Baginsky - Tradicionalmente los marcadores moleculares utilizados en estudios genéticos y de mejoramiento eran aquellos

Más detalles

Enfermedades genéticas

Enfermedades genéticas Enfermedades genéticas Desórdenes genéticos Mutaciones Rearreglos genómicos Variación en número de cromosomas Monogenéticas, heredables en forma mendeliana. Enfermedades genéticas Poligenéticas o complejas,

Más detalles

EL ADN y la INGENIERÍA GENÉTICA

EL ADN y la INGENIERÍA GENÉTICA IES LAS VIÑAS MANILVA. MÁLAGA. CMC. Susana Serradilla EL ADN y la INGENIERÍA GENÉTICA EL GENOMA HUMANO GENOMA: Conjunto de genes de un ser vivo. GENOMA HUMANO: Conjunto de genes de la especie humana PROYECTO

Más detalles

FISIOLOGÍA GENERAL Jesús Merino Pérez y María José Noriega Borge

FISIOLOGÍA GENERAL Jesús Merino Pérez y María José Noriega Borge REPLICACIÓN DEL ADN INTRODUCCIÓN La unidad básica de información en los seres vivos es el gen, definido en células eucariotas como un segmento de ADN que lleva la información necesaria para la síntesis

Más detalles

TEMA 4 CMC BIOTECNOLOGÍA

TEMA 4 CMC BIOTECNOLOGÍA Conceptos Tema 4 TEMA 4 CMC BIOTECNOLOGÍA Células eucariotas: Células con núcleo. Núcleo: Un compartimento en el interior de la célula que alberga el material genético. Citoplasma: En una célula eucariota,

Más detalles

INGENIERÍA GENÉTICA 5 GAATTC 3 3 CTTAAG 5

INGENIERÍA GENÉTICA 5 GAATTC 3 3 CTTAAG 5 INGENIERÍA GENÉTICA 1. Fundamentos básicos de la ingeniería genética 2. Desnaturalización e hibridación del ADN 3. Reacción en cadena de la polimerasa (PCR) 4. Nuevas disciplinas surgidas de la ingeniería

Más detalles

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada La PCR La Reacción en Cadena de la Polimerasa es la herramienta más utilizada PCR- Ventajas y Usos Amplificación ilimitada de secuencias de interés. Rápida, Sencilla y Eficaz. Técnica altamente sensible

Más detalles

Técnicas descritas en el curso 7.28

Técnicas descritas en el curso 7.28 Técnicas descritas en el curso 7.28 Técnica: Clase 1 Experimento de incorporación de dntps Ensayo de extensión del cebador Ensayo de unión en filtro Electroforesis en gel Análisis de ADN Helicasa Polaridad

Más detalles

DIAGNÓSTICO GENÉTICO DEL CÁNCER HEREDITARIO Ref.PCRCAN(4 prácticas)

DIAGNÓSTICO GENÉTICO DEL CÁNCER HEREDITARIO Ref.PCRCAN(4 prácticas) DIAGNÓSTICO GENÉTICO DEL CÁNCER HEREDITARIO Ref.PCRCAN(4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción

Más detalles

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles

ELECTROFORESIS. Agarosa. Poliacrilamida

ELECTROFORESIS. Agarosa. Poliacrilamida ELECTROFORESIS DE ADN ELECTROFORESIS Agarosa Poliacrilamida Finalidad de la electroforesis Separar Identificar Purificar 1 2 3 4 5 Tinción del ADN Bromuro de etidio Absorbancia a 302 y 366 y emisión a

Más detalles

DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino

DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino DIAGNOSTICO VIROLOGICO MOLECULAR Dr. Gerardo Andino DIAGNÓSTICO MOLECULAR La tecnología empleada para la detección de genomas virales mediante la amplificación de secuencias específicas (PCR y reacciones

Más detalles

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica TÉCNICAS GENÓMICAS Utilidad/Objetivos: 1) Detección de microorganismos directamente en muestras clínicas identificando un fragmento específico del genoma del microorganismo concreto 2) Cuantificación del

Más detalles

Oferta tecnológica: Método para detectar inserciones de espaciadores en estructuras CRISPR

Oferta tecnológica: Método para detectar inserciones de espaciadores en estructuras CRISPR Oferta tecnológica: Método para detectar inserciones de espaciadores en estructuras CRISPR Oferta tecnológica: Método para detectar inserciones de espaciadores en estructuras CRISPR. RESUMEN Las repeticiones

Más detalles

4Genética forense 1. QUÉ ES LA GENÉTICA FORENSE? tema

4Genética forense 1. QUÉ ES LA GENÉTICA FORENSE? tema tema 4Genética forense 1. QUÉ ES LA GENÉTICA FORENSE? Con la denominación de genética forense se define el uso de ciertas técnicas empleadas en genética para la identificación de los individuos en base

Más detalles

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA BIOLOGIA MOLECULAR Hemos elaborado un programa en 3 niveles, en función del tipo de estudiante y las posibilidades del centro educativo: 1. NIVEL BASICO 2. NIVEL MEDIO DANAEXTRACTOR KIT Práctica que constituye

Más detalles

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR)

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) Centro de de Microscopía Electrónica Facultad de de Ciencias Médicas Universidad Nacional de de Córdoba

Más detalles

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa?

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa? 2º BIOQUÍMICA CUESTIONES 1. Por qué la PCR convencional no es cuantitativa? En la PCR convencional, la cuantificación del ADN de la muestra es complicada debido a que la eficacia de amplificación va disminuyendo

Más detalles

DIAGNÓSTICO GENÉTICO DE LA HIPERCOLESTEROLEMIA FAMILIAR POR RFLP Ref.PCRCOLEST(4 prácticas)

DIAGNÓSTICO GENÉTICO DE LA HIPERCOLESTEROLEMIA FAMILIAR POR RFLP Ref.PCRCOLEST(4 prácticas) DIAGNÓSTICO GENÉTICO DE LA HIPERCOLESTEROLEMIA FAMILIAR POR RFLP Ref.PCRCOLEST(4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios

Más detalles

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml)

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml) PCR SIMULADA Ref.PCR Simulada (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

Tema 12. Estructura genética de las poblaciones. Genética CC.MM.

Tema 12. Estructura genética de las poblaciones. Genética CC.MM. Tema 12. Estructura genética de las poblaciones Genética CC.MM. Contenidos Estructura genética de las poblaciones Cuantificación de la variabilidad genética en las poblaciones Equilibrio Hardy-Weinberg

Más detalles

CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA. Grado en Medicina

CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA. Grado en Medicina DEPARTAMENTO DE BIOQUÍMICA Y BIOLOGÍA MOLECULAR III FACULTAD DE MEDICINA UNIVERSIDAD COMPLUTENSE DE MADRID CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA Grado en Medicina CURSO ACADÉMICO 2014/2015 INDICE

Más detalles

Ingeniería Genética II

Ingeniería Genética II Ingeniería Genética II Expresión de proteínas recombinantes Vectores de expresión Características adicionales: - Promotor regulable - Terminador de la transcripción - Sitio de reconocimiento por el ribosoma

Más detalles

Reacción en cadena de la Polimerasa (PCR)

Reacción en cadena de la Polimerasa (PCR) Explicación de TP Nº 2 Reacción en cadena de la Polimerasa (PCR) Química Biológica Patológica Dra. Mariana L. Ferramola Dra. Gabriela Lacoste 2015 Definición de PCR Es la amplificación enzimática de un

Más detalles

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles

MEMORIA DE PRÁCTICAS SILVIA PÉREZ SOLANA

MEMORIA DE PRÁCTICAS SILVIA PÉREZ SOLANA MEMORIA DE PRÁCTICAS SILVIA PÉREZ SOLANA DATOS DE LA EMPRESA Instituto de Biotecnología y Biomedicina de Cantabria (CSIC-UC- SODERCAN), Avda. Herrera Oria s/n. Santander. El tutor CSIC fue Raúl Fernández

Más detalles

CURSO ACADÉMICO 2012-2013

CURSO ACADÉMICO 2012-2013 TITULACIÓN: BIOLOGÍA CURSO ACADÉMICO 2012-2013 GENÉTICA APLICADA CÓDIGO: 200810419 Departamento de adscripción: Parasitología, ecología y Genética Área de conocimiento: Genética Ciclo:2º Curso: 4º Tipo:

Más detalles

3.- TECNOLOGIA EN EL DIAGNOSTICO MOLECULAR

3.- TECNOLOGIA EN EL DIAGNOSTICO MOLECULAR 3.- TECNOLOGIA EN EL DIAGNOSTICO MOLECULAR 3.1.- INTRODUCCIÓN Pocas áreas de la Biología Molecular han permanecido inalteradas con la aparición de una serie de técnicas englobadas dentro del término genérico

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

DETERMINACIÓN DEL FACTOR Rh por PCR

DETERMINACIÓN DEL FACTOR Rh por PCR Ref.PCRRh DETERMINACIÓN DEL FACTOR Rh por PCR 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

Metodologías basadas en la identificación del ADN: PCR, hibridación, secuenciación y análisis de secuencias.

Metodologías basadas en la identificación del ADN: PCR, hibridación, secuenciación y análisis de secuencias. Metodologías basadas en la identificación del ADN: PCR, hibridación, secuenciación y análisis de secuencias. Dra. Sonia Arduino Dep. de Clínica Estomatología Facultad de Postgrado en Ciencias de la Salud

Más detalles

Jesús G.C. Colegio Claret Segovia

Jesús G.C. Colegio Claret Segovia 1 UNIDAD 8 Documento elaborado por del de LA R E VO LU CI Ó N G EN É TI CA 1.- El ADN La célula es la unidad morfológica, funcional y genética de todos los seres vivos Todos los seres vivos están formados

Más detalles

FACULTAD REGIONAL ROSARIO

FACULTAD REGIONAL ROSARIO FACULTAD REGIONAL ROSARIO CATEDRA BIOTECNOLOGIA ROFESOR: Ing. Eduardo Santambrosio JTP: Ing. Marta Ortega AUX 1ª : Ing. Pablo Garibaldi PCR (Polymerase chain reaction) Reacción en cadena de la polimerasa

Más detalles

CIENCIA Y VIDA COTIDIANA

CIENCIA Y VIDA COTIDIANA CIENCIA Y VIDA COTIDIANA La clonación, el ADN y cosas de la genética Santiago Torres Martínez Departamento Genética y Microbiología Universidad de Murcia Murcia 25 febrero y 3 marzo, 2008 . Genética. Gen.

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles

Soluciones de la serie de ejercicios 3 (Curso 7.012)

Soluciones de la serie de ejercicios 3 (Curso 7.012) Soluciones de la serie de ejercicios 3 (Curso 7.012) Stardate 7.012.10.4.00 Diario personal del Médico militar del USS Hackerprise Al regresar de una misión en Europa, su compañero de tripulación, Noslen,

Más detalles

Bases moleculares y estudios genéticos

Bases moleculares y estudios genéticos II Jornada Genética Clínica para Médicos de Familia Bases moleculares y estudios genéticos María García-Barcina Unidad de Genética del H. Universitario de Basurto Osakidetza Sede SVMFIC Valencia, 2 de

Más detalles

Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez

Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez 1 Objetivos Entender la técnica: Reacción de Polimerasa en Cadena (PCR por sus siglas en inglés)

Más detalles

ADN ARN Proteínas. La información genética es portada por el ADN y se hereda con él.

ADN ARN Proteínas. La información genética es portada por el ADN y se hereda con él. Todos los organismos contienen información que les permite coordinar sus procesos. Esta información, a fin de poder ser transferida a la descendencia, esta asentada en una molécula capaz de replicarse,

Más detalles

Genética, Medicina y Sociedad (Síntesis).

Genética, Medicina y Sociedad (Síntesis). Genética, Medicina y Sociedad (Síntesis). Biología. Curtis, et al. (2008). Editorial Médica Interamericana. 7ª Ed. Cap. 16. Por lo general, los principios de la genética son los mismos para cualquier ser

Más detalles

Curs de genètica aplicada a Medicina Fetal

Curs de genètica aplicada a Medicina Fetal Curs de genètica aplicada a Medicina Fetal MA Sánchez Durán Diciembre 2015 Introducción Detección de defectos congénitos Desarrollo Genética 2 7 7 Infecciones Monogénicos 55 25 Cromosómicos Poligénico

Más detalles

Facultad de Ciencias Bioquímicas y Farmacéuticas Suipacha 531 - S2002LRK Rosario - Argentina +54 (0) 341-4804592/3 www.fbioyf.unr.edu.

Facultad de Ciencias Bioquímicas y Farmacéuticas Suipacha 531 - S2002LRK Rosario - Argentina +54 (0) 341-4804592/3 www.fbioyf.unr.edu. Expediente Nº 6075/363 Rosario, 07 de agosto de 2014 VISTO el presente expediente, mediante el cual la Directora Académica del Área Biología Molecular, Dra. Elena Orellano eleva el programa analítico de

Más detalles

I.S.P.I. N 9009 San Juan Bautista de La Salle INTRODUCCIÓN A LA BIOTECNOLOGÍA Y TECNOLOGÍAS ESPECÍFICAS

I.S.P.I. N 9009 San Juan Bautista de La Salle INTRODUCCIÓN A LA BIOTECNOLOGÍA Y TECNOLOGÍAS ESPECÍFICAS I.S.P.I. N 9009 San Juan Bautista de La Salle INTRODUCCIÓN A LA BIOTECNOLOGÍA Y TECNOLOGÍAS ESPECÍFICAS Asignatura: Frecuencia: Docente a cargo: Destinatarios: Anual 5 horas por semana Lic. César R. Olsina

Más detalles

Mejoramiento del diagnóstico molecular de la distrofia miotónica tipo 1 mediante el estudio del mosaicismo somático

Mejoramiento del diagnóstico molecular de la distrofia miotónica tipo 1 mediante el estudio del mosaicismo somático Mejoramiento del diagnóstico molecular de la distrofia miotónica tipo 1 mediante el estudio del mosaicismo somático Investigadora principal desde julio 2007 hasta marzo del 2009 Patricia Eugenia Cuenca

Más detalles

Tecnología del ADN recombinante y sus aplicaciones en la Medicina. Los instrumentos básicos de la investigación de genes.

Tecnología del ADN recombinante y sus aplicaciones en la Medicina. Los instrumentos básicos de la investigación de genes. Tecnología del ADN recombinante y sus aplicaciones en la Medicina. Objetivos de aprendizaje -Conocer y familiarizarse con los principios básicos de la biología molecular. -Aprender fundamentos de las técnicas

Más detalles

Reacción en cadena de la polymerasa (PCR)

Reacción en cadena de la polymerasa (PCR) Reacción en cadena de la polymerasa (PCR) 1 PCR Que es? Es una técnica in vitro diseñada para amplificar una región específica de DNA. Es extremadamente sensible, con la capacidad de amplificar millones

Más detalles

Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional

Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional BIOQ. LILIANA DI TULLIO BUDASSI FAC. CS.BIOQUÍMICAS Y FARMACÉUTICAS UNIVERSIDAD NACIONAL DE ROSARIO lilianadt2003@yahoo.com.ar

Más detalles

Conceptos básicos relacionados con la mutación

Conceptos básicos relacionados con la mutación SINOPSIS Conceptos básicos relacionados con la mutación Polimorfismo Genético Tipos de mutación Origen de las mutaciones Mecanismo de las mutaciones Consecuencia de las mutaciones SINOPSIS Conceptos básicos

Más detalles

REPARACIÓN DE LESIONES EN EL MATERIAL GENÉTICO

REPARACIÓN DE LESIONES EN EL MATERIAL GENÉTICO El ININ hoy REPARACIÓN DE LESIONES EN EL MATERIAL GENÉTICO Por Jorge Serment Guerrero, Departamento de Biología (josg@nuclear.inin.mx) Como sabemos, los seres vivos tienen la capacidad de transmitir sus

Más detalles

GENÉTICA MENDELIANA EL GEN. El gen Mendeliano es una unidad de función, estructura, transmisión, mutación y evolución, que se distribuye ordenada y linealmente en los cromosomas. A nivel genético el gen

Más detalles

Terapia Génica. Dra. Lizbeth Salazar-Sànchez Escuela de Medicina Universidad de Costa Rica

Terapia Génica. Dra. Lizbeth Salazar-Sànchez Escuela de Medicina Universidad de Costa Rica Terapia Génica Dra. Lizbeth Salazar-Sànchez Escuela de Medicina Universidad de Costa Rica 5/8/2015 Gen Esta en un cromosoma Es la unidad base de la Herencia Codificación, proteína DNA RNA proteins Proteínas,

Más detalles

Microbiología General 2006-2007. Tema 5: Transmisión de la información genética

Microbiología General 2006-2007. Tema 5: Transmisión de la información genética Microbiología General 2006-2007 Tema 5: Transmisión de la información genética Transmisión de la información genética Reparto del material genético en procariontes y eucariontes. Transferencia horizontal

Más detalles

II.-Capítulo 3. Herramientas básicas de ingeniería genética

II.-Capítulo 3. Herramientas básicas de ingeniería genética II.-Capítulo 3 Herramientas básicas de ingeniería genética Gómez, Marisa; Echenique, Viviana 1 Introducción Hasta aproximadamente 1970 el ADN era la molécula de la célula que planteaba más dificultades

Más detalles

Miguel Dita (1) Einar Martínez de la Parte (2) Monica Blanco (3)

Miguel Dita (1) Einar Martínez de la Parte (2) Monica Blanco (3) Generalidades de la PCR: MÉTODO DE DIAGNÓSTICO MOLECULAR DE Foc RT4 Miguel Dita (1) Einar Martínez de la Parte (2) Monica Blanco (3) 1) Bioversity International, Costa Rica 2) INISAV Cuba. 3) Universidad

Más detalles

1. Cuáles son las diferencias en los componentes químicos del ADN y ARN?

1. Cuáles son las diferencias en los componentes químicos del ADN y ARN? ACTIVIDADES TEMA 4 - BIOTECNOLOGÍA 1. Cuáles son las diferencias en los componentes químicos del ADN y ARN? Las cadenas de ADN están formadas por fosfato y desoxirribosa y la del ARN por fosfato y ribosa.

Más detalles

Tipos de Muestras. Técnicas de Biología Molecular. Extracción de ácidos nucleicos. Extracción de DNA genómico. Muestra de sangre en papel filtro

Tipos de Muestras. Técnicas de Biología Molecular. Extracción de ácidos nucleicos. Extracción de DNA genómico. Muestra de sangre en papel filtro Técnicas de Biología Molecular Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO 2004 Tipos de Muestras Extracción de ácidos nucleicos o DNA o RNA Sangre total (EDTA) Saliva Líquido Amniótico Bulbo

Más detalles

Métodos de análisis biomédicos

Métodos de análisis biomédicos Métodos de análisis biomédicos 1 Métodos de análisis biomédicos Comprenden métodos de análisis a nivel de DNA, RNA y proteínas que permitan tener un mayor conocimiento de una enfermedad dada, que puedan

Más detalles

Actualización en nuevas técnicas de diagnóstico genético molecular disponibles en Chile

Actualización en nuevas técnicas de diagnóstico genético molecular disponibles en Chile Actualización en nuevas técnicas de diagnóstico genético molecular disponibles en Chile Dra. Teresa Aravena Clínica INDISA Hospital Clínico de la Universidad de Chile Hospital Dr. Sótero del Río Exámenes

Más detalles

GENES Y GENOMAS INTRODUCCIÓN.

GENES Y GENOMAS INTRODUCCIÓN. GENES Y GENOMAS INTRODUCCIÓN. El ADN que forma el genoma de los organismos está organizado de acuerdo a la complejidad de la estructura del propio organismo. Los virus, las bacterias, las mitocondrias

Más detalles

LA BIOTECNOLOGÍA HACE TU VIDA MEJOR Y MÁS FÁCIL

LA BIOTECNOLOGÍA HACE TU VIDA MEJOR Y MÁS FÁCIL LA BIOTECNOLOGÍA HACE TU VIDA MEJOR Y MÁS FÁCIL BIOTECNOLOGÍA APLICADA A LA SALUD La Biotecnología está presente en la Medicina y en la Salud animal, ya que participa en el diagnóstico y en el tratamiento

Más detalles

LA INGENIERÍA GENÉTICA

LA INGENIERÍA GENÉTICA LA INGENIERÍA GENÉTICA Todo organismo, aún el más simple, contiene una enorme cantidad de información. Esa información se repite en cada una de sus células organizada en unidades llamadas genes, los cuales

Más detalles

UD 3. La Revolución Genética

UD 3. La Revolución Genética UD 3. La Revolución Genética 1. INTRODUCCIÓN: El ADN, la genética. 2. La ingeniería genética 3. Para qué sirve la ingeniería genética? Aplicaciones 4. Transgénicos 5.El Proyecto Genoma Humano (PGH) 6.

Más detalles

Métodos de análisis biomédicos

Métodos de análisis biomédicos Métodos de análisis biomédicos 1 Aplicación de la biología molecular en medicina *Estudio y diagnóstico de enfermedades producidas por alteraciones genéticas (hereditarias ó somáticas) y aquellas producidas

Más detalles