Tamaño: px
Comenzar la demostración a partir de la página:




2 INFORME FINAL PROYECTO FONDECYT REGULAR AÑO ETAPA: 2009 DURACIÓN: 3 añs N PROYECTO: TÍTULO PROYECTO: NEURAL DIFFERENTIATION AND PLASTICITY IN THE OLFACTORY SENSORY SYSTEM OF THE ZEBRAFISH BIOLOGIA CELULAR DISCIPLINA PRINCIPAL: GRUPO DE ESTUDIO: BIOLOGIA 2 INVESTIGADOR(A) RESPONSABLE: KATHLEEN ELIZABETH WHITLOCK LEANING DIRECCIÓN: COMUNA: Playa Ancha CIUDAD: Valparais REGIÓN: V REGION FONO: INFORME OBJETIVOS Cumplimient de dm11idzina N 2 Objetivs planteads en el Pryect. Recuerde que ls bjetivs de] pryect n se refieren a listar actividades lei.z nhiptivcs drrnl12t1ns ls 2 OBJETIVOS CUMPLIMIENTO FUNDAMENTO Aa) T determine the phentypes that result frm gene knck-dwn f the patterning genes imprtant t setting aside the precursrs f the lfactry placde and cranial neural crest. This includes describing the phentype f the existing dg-eared (eyal) mutant. TOTAL Ab) T visualize the effects n cells mvements that may result frm the knck-dwn/lss f gene functin. Wc will visualize the celis mvement using GFP unes and marking celis f interest with fluresceinated caged dextrans PARCIAL Wc characterized the phentype f the dg-eared (eyal) mutant and realized that it is nt useful fr ur gals j.c. it reduces but des nt eliminate the lfactry placde. T date we have fund n bvius defects in the lfactry rgans f the dysseus (cxcr4b: Knaut et. al., 2003) and medusa (cxcr7: Valentin ci al., 2007)) mutants. Thus we have cncentrated n the aspects f ur prject invlving the frmatin f the placde thrugh ccli migratin. we used the sx lo::gfp une t visualize cranial neural crest cells (CNCCs) and labeled the placde dmain with Dii (see previus reprt). but were never able t btain clean labeling with Dii. Therefre we successfully generated a six4. 1: :mcherry une that expresses mcherry in the lfactry placdes. This line is extremely useful fr the ther experiments in this bjective (see beiw) Using sxlø::gfp and six4.1::mcherry reprter lines we are currently visual izing the mvements f CNCCs and OPCs in living embrys. Because t date nne f the chemkines mutants shw an bvius lfactry placde defect we have nt made the crsses t intrduce the reprter Unes int the chemkine mutant backgrunds.

3 3 A.c) T determine whether any f the effects TOTAL Using sxiø::gfp reprter une t visuatize the bserved in the gene knck-dwnliss are mvements f CNCCs in living embrys. Our phencpied by expsure f the early develping mst in depth anaiysis is with zebrafish embry t man-made chemicais knwn t be embrys expsed t aichi and pisc. Zebrafish present in the envirnment specificaily embrys incubated with Ethanl r Pisc shwed anti-fungai agents reduced expressin f chemkine cxcii 2a and its receptr cxcr4b. Our results suggest that alchl affects OP prgenitr rganizatin, CNC migratin, and enhances celi death. The studies we carried ut n the effects f anti-fungais were nt vaiid because the dsage necessary t bserve an effect in neurai crest migratin was utside the wrking cncentratin usuaily detected in the envirnment. We have ais anaiyzed a class f rganphsphate pesticides used in the aquacuiture industry t cmbat sea tice L determine whether they affect develpment f vertebrate embrys. These substances (Ivermectin) have a prnunced effect n the neurmuscuiar system resulting in permanent paralysis f the embrys, a phentype nt f interest t ur studies. 4 Objective B.a: T deveip ur methds fr PARCIAL Using ur new system fr analysis f zebrafish assaying behavir in the develping and adult behavir (Viewpint Life Sciences) we have zebrafish. Specificaiiy t determine the drs t tested the ability f the sftware t track multiple which a zebrafish will imprint, thus giving us fish in a behavir trial. Our initial experiments behavir assays fr dr t which we can then shw that we can track dr preferences in grups (thereticaliy) assign a genmic respnse. f fish vertime. Our preiiminary data demnstrate a strng crreiatin between lfactry sensry behavirs and activatin f the immediate early gene c-fs in the lfactry epitheiium and hypthalamus. We are cntinuing these studies. 5 Objective B.b: Our secnd gal f sectin "B" is PARCLkL Of the apprximately 160 ifactry receptrs we t take advantage f the recent reprt f the identified 34 that fit the specified criteria fr tx2 sequences f the ifactry receptrs in the binding sites. Currently we are cncentrating n zebrafish and use this genmic infnnatin t fur ifactry receptrs that we have cnfirmed determine whether the ifactry receptr are expressed in the ifactry epithelium using in expressin is affected by the envirnment. situ hybridizatin. Base n new dala that Because f the way we have designed these zebrafish are strngiy attracted t teststerne we experiments (L islate RNA frm animals after have identified a small subset f ifactry recrding their behavirai respnse) we wili be receptrs that have ARE binding sites in the abie t crreiate these genmic data with a upstream regin suggesting that their expressin functinally reievant event. may be reguiated by teststerne.we have shwn that the expressin f immediate early gene (IEG) c-fs in the lfactry epithelium is mdulated by teststerne, GnRI-I, natural drs f mate and female fish, and amin acids.we are cntinuing analysis by QT-RT-PCR. Otr(s) aspect(s) que Ud. cnsidere imprtante(s) en la evaluación del cumplimient de bjetivs planteads en la prpuesta riginal en las mdificacines autrizadas pr ls Cnsejs.

4 fl

5 Kathleen Whitlck IRESULTADOS OBTENIDOS Objective A.a: T determine the phentypes thaf result frm gene knck-dwn f fhe patterning genes imprtanf f setting aside the precursrs f the lfactry placde and cranial neural crest. This includes describing the phentype f the existing dg-eared (eya 1) mutant. We characterized the phentype f the dg-eared (eyal) mutant and realized that it is nt useful fr ur gals i.e. it reduces but des nt eliminate the lfactry placde. T date we have fund n bvius defects in the lfactry rgans f the Odysseus (cxcr4b: Knaut et. al., 2003) and medusa (cxcr7: Valentin et. al., 2007)) mutants. Thus we have cncentrated n the aspects f ur prject invlving the frmatin f the placde thrugh celi migratin. In rder t understand the cellular mvements and interactins that take place during lfactry placde develpment, we used the sx10::gfp line t visualize cranial neural crest cells (CNCCs) and labeled the placde dmain with Oil (see previus reprt). but were never able t btain clean labeling with Dii. Thus we wrked t generate a transgenic line t visualize lfactry precursrs celis (OPCs). Previus wrk in ur lab shwed that the six4. 1 gene is expressed in OPCs in a dmain partially verlapping with dlx3 (Harden & Whitlck, unpublished). Because f the mre restricted expressin pattern f six4.1 we fcused n this gene t generate a transgenic reprter line expressing mcherry in the O POs. Figure 1: A) Frntal view f 36 hpf six4.1::mcherry embry with mcherry expressin (red) in the develping lfactry rgans. 8) CelIs expressing sxlü::gfp in the lfactry rgan f the5 day pst-fertilizatin zebrafish. The labeling f the cilia (red) des nt c- lcalize with the prcesses f these cells suggestirig they are nt ciliated lfactry neurns and may be glial cells. Initial attempts t generate this line using 4, 6 kb upstream as well as BAC cristructs were unsuccessful. Thus we identified cnserved sequences, upstream and dwnstream f six4. 1 gene, by philgenetic ftprinting and clned in a transpsable expressin vectr. The six4.1::mcherry embrys express mcherry in the lfactry placdes (Fig. la) as well as in restricted ppulatins f cells in the ear and lateral Une. We are using this line, in cmbinatin with the sx10::gfp line, t analyze the celi mvements f OPCs and CNCCs during early smitgenesis. In ur preliminary analysis f CNCC differentiatin we describe a restricted ppulatin f sxl0::gfp expressing cells in the lfactry rgan at 5dpf (Fig. IB). This maintained expressin suggests they may be gua cells. In cntrast t ther cranial nerves where the gua are crest derived, the gima f the lfactry sensry system are thught t arise frm the lfactry placde. Thus the pssibility that these cells crrespnd t glial cells and arise frm CNCCs wuld make the lfactry sensry system mre similar t ther cranial nerves. This wrk was carried ut by pst-dc Luisa Pereir. Related øublicatins: Paul, T. A., Rvnak, J., Quackenbush, S. L., Whitlck, K. E,, Zhan, H., Gng, Z., Spitsbergen, J., Paul R. Bwser, P. R., and Casey, J. W. (2010) Transgenic expressin f Walleye Dermal Sarcma accessry genes in zebra fish des rit result in fissue prliferatin. Marine Bitechnlgy, in press. Objective A.b: Te visualize fha effects n ce/ls mvements that may result frm the knck-dwn4ss f gene functin. We will visualize the cells mvement using GFP lines and marking ce/ls f inferest wifh fluresceinated cagad dextrans.

6 Kathieen Whitlck Using sxlo::gfp and six4.1::mcherry reprter unes we are currently visualizing the mvements f CNCCs and OPCs in living embrys. Because t date nne f the chemkines mutants shw an bvius lfactry placde defect we have nt made the crsses t intrduce the reprter unes int the chemkine mutant backgrunds. Figure 2. Frntal view f zebrafish embry expressing sxlo::gfp and a rhdamine marked actin t visualize celi structures. The reslutin f the actin labeling was t pr t c-lcalize the red flurescence with filpdia f the migrating crest cells. This pht wn an award in the cmpetitin at Ceil Bilgy Meeting in Pucn. Wrk f graduate student Katica Bric. Objective A.c: T determine whether any f the effects bseried in the gene knck-dwn4ss are phencpied by expsure f the early develping embry f man-made chemicais knwn f be presenf in the envirnmenf specifically anfi-fungal agents. We have expanded ur analysis f alchl effects n deveipment thrugh analysis f ceil death, migratin and quantitative analysis n the alchl cncentratin in the embry. We have shwn in agreement with ther published wrk (Tanguay and Reimers, 2008), that alchl increases the level f cell death abye reprted backgrund (Sanders and Whitlck, 2003). In additin we have analyzed the mrphlgical abnrmalities as well as effects n celi migratin as assayed thrugh time lapse in living embrys (Fig. 2, 3) and gene expressin f receptr ligand cmplex. This wrk is being prepared as a manuscript. The studies we carried ut n the effects f anti-fungals were nt valid because the dsage necessary t bserve an effect in neural crest migratin was utside the wrking cncentratin usually detected in the envirnment. We have als anatyzed a class f rgariphsphate pesticides used in the aquaculture industry t cmbat sea tice t determine whether they affect develpment f vertebrate embrys. These substances (Ivermectin) have a prnunced effect n the neurmuscular system resulting in permanent paralysis f the embrys Figure 3: Still images cllected frm time lapse z-stacks (spinning disc) f living sxlo-gfp embrys. Drsal view f sxlü-gfp embrys at 6-14 smites A) Celis initiate migratin anterir at 6-8 smites with anterir brder mving alng neural tube (arrwheads). B) As develpment prceeds the cranial rieural crest cells becme travel further anterir mving alng edge f neural tube (14 smites, arrwheads). C) Cntrl embry at 10 smites..d) Embry treated with 200mM ethanl shws accumulated celis that mve anterirly as a dispersed grup. Frm manuscript in preparatin: Katica Bric & K.E. Whitlck. We are studying the effects f envirnmentally induced disruptins iri the nervus system develpment using zebrafish (Dani ren) as a mdel. Alchl is an envirnmental teratgen that, when cnsurned c

7 Kathleen Whitlck during pregnancy, causes cranifacial malfrmatins as well as a spectrum f neurlgical and behaviral disrders, knwn as Fetal Alchl Syndrme (FAS). Cranifacial structures arise frm cranial neural crest(cnc) and is well accepted that these cells are affected by alchl; nevertheless hw alchl exerts its effects n them is nt well understd. Pre-migratry CNCs share a cmmn brder with the celis f the lfactry placde (OP) fleld, therefre we prpsed that alchl may affect the differentiatin f these prgenitrs as well. In additin we prpsed that OP and CNC prgenitr migratin is disrupted by expsure t alchl. Zebraflsh embrys incubated with Ethanl r Pisc and analyzed fr expressin f chemkine cxcll2a and its receptr cxcr4b, genes esseritial in OP develpment shwed reduced expressin in animals expsed t Ethanl/Pisc. We are adding additinal data at this time by analyzing the chemkine cxcll2b and its receptr cxcr4a, which are expressed in CNC. Using sxlo::gfp embrys we fllwed CNC migratin in living embrys (Figs. 2, 3). E analyzed mrphlgy, mrtality, structural malfrmatins, and cell death in cntrl and treated embrys. lmprtantly we measured the cncentratin f ethanl in the tissue at the end f the incubatin perid. Our results suggest that alchl affects OP prgenitr rganizatin, CNC migratin, and enhances celi death. Als, alchl prduces cranifacial abnrmalities very similar t the malfrmatins seen in FAS patients. Recently we have started examining the structure f primary cilia f CNCs. We are interested in this ceil structure because it has been shwn that in certain syndrmes shwing cranifacial dysmrphlgy similar t FAS patients have altered cilia. Furthermre recent data suggest that snic hedgehg signaling is transduced thrugh cilia, thus explaining the link between shh pathway mutant phentypes and cilia malfrmatins. Cnsequently, we hypthesize that alchl may als disrupt CNC's primary cilia mrphlgy. Finally, we think this research will allw us t develp an EcDev" system mdel fr assessing hw teratgens affect develpment f the early embry. Objective B.a: T develp ur methds fr assaying behavir in the develping and adult zebra fish. Specifically t determine the drs f which a zebra fish will imprint, thus giving us behavir assays fr dr f which we can then (theretically) assign a genmic respnse. While waiting fr ur behavir system t arrive and be installed we cllabrated with the Darwin Initiative (based in England, Chilean representatin: University de Ls Lags) n a prject n lfactry learning in puye (Galaxias maculatus), a native Chilean fish. We have shwn using puye ppulatins, allpatric and simpatric with brwn trut, that native flsh (puye) grwing up in rivers where trut and salmn are dcumented shw an avidance respnse t the scent f these predatrs. Puye frm streams lacking predatrs shw n fear respnse t the scent f predatrs. Thus we have shwn that the puye appear t learn the drs f predatrs (invasive salmnids). This wrk was carried ut by Paul Hwes with the help f Jessica Stephensn (bth British students). Jessica"s prject was t test whether puye respnded t alarm phermne, she wrked as a vlunteer carrying ut this wrk and surprisingly the puye shw n respnse t alarm phermne, suggesting, as reprted in the literature that there is a strng learned cmpnent in this respnse (Stephensn et al submitted). Jessica returned t d her Masters Thesis with me and used zebrafish t shw that lfactry cues mdulate visual sensitivity in zebraflsh (tested as individuals). Using ur new system fr analysis f zebrafish behavir (Viewpint Life Sciences) we have tested the ability f the sftware t track multiple fish in a behavir trial. This mdule f the sftware is new, develped in part using data we prvided Viewpint Life Sciences. Our initial experiments shw that we can track dr preferences in grups f fish vertime (Fig. 4). With these type f data we are starting t develp crrelatins between behavirs and changes in gene expressin within the lfactry sensry system. We knw that the dr f male flsh induces expressin f c-fs in the lfactry epithelium and hypthalamus f develping zebraflsh (see belw Maturana Masters thesis). Thus there is a strng crrelatin between lfactry sensry behavirs (Fig. 4) and activatin f the immediate early gene c-fs in the lfactry epithelium and hypthalamus (Fig. 6). Related øublicatins/theses: Hwes, P.N Predatr recgnitin f invasive salmnids by native galaxiids. MSc thesis. Swansea Universily, loop.) Whitlck c-tutr Sfephensn, J. Yung, K, and Whitlck, KE (2010)" Testing fr alarm cue respnse in a circumplar galaxlld, Galaxias macula tus" Fisheries Management and Eclgy in revisin. Sfephensn, J. (2010)Olfactry cue mdulatin f visual sensitivify in the zebra fish Dani ren. MSc Thesis, Bristl University in revisin.

8 Kathleen Whitlck Whit/ck, K.E. (2010). Olfactry Behavir in Zebra fish: Making Scents f a Changing Wrld. IN: Zebra fish mdeis in Neurbehaviral Research, Humana Press, in press. Figure 4. Upper graph depicts mvement f fish acrss three defined areas in presence f cntrl water. The fish shw n preference fr any given regin (Arealyellw; Area2-green, Area3-red). In cntrast the lwer graph shws a clear preference fr Area 3 (yellw) after the dr f male fish was added (arrw). Area 3 is the regin where the drant was intrduced t the testing tank. In these trials fish were tested fr 90 secnds. Adult, wild type zebrafish f the strain NWT and Crnell were used. This wrk is being carried ut by Alejandra Pnce, a dctrate student in (he lab. Objective B.b: Our secnd gal f sectin B" is f take advanfage f fha recent reprt f the sequences f the /fact,y recepfrs in the zebra flsh and use fhis genmic infrmatin f determine whether the lfacfry receptr expressin is affected by the envirnment. Becaus f fha way we have designad fhese experiments (f s/ate RNA frm animais after recrding their behaviral respnse) we wi// be ab/e f crre/ate these genmic dafa with a funtinaily re/e vant evenf. With (he purpse f identifying specific dwnstream targets f tx2. (transcriptin factr: see ur wrk in Harden et al 2006), we usad a biinfrmatics apprach t lk fr tx2 binding sites in regins upstream f the lfactry receptr genes. Of the apprximately 160 lfactry receptrs we identified 34 (Fig. 5A) that fit the specified criteria fr tx2 binding sites. Currently we are cncentrating n fur lfactry receptrs (Fig. 5B) that we haya cnfirmed are expressed in the lfactry epithelium using in situ hybridizatin. Fliwing up n the findings that zebrafish are strngly attracted t teststerne (used as an dr, Alejandra Pnce, dctrate student unpublished data) we have identified a small subset f lfactry receptrs that have ARE binding sites in the upstream regin suggesting that their expressin may be regulated by teststerne. This wrk is being carried ut by Cristian Calfun, undergraduate thesis student and a new technician Pabl Castill. Figure 5. A) Olfactry receptrs cntaining fx2 binding sites in upstream regins. Of these 34 genes we have chsen fur (B) t use as diagnstics fr QT-RT-PCR after cnfirmirig the expressin in the develping lfactry epithelium by in situ hybridizatin (see previus reprt). A B 0R102-1, 0R102-3, 0R R OP , 0R103-2, 0R R106-8, 0R OR11I-8, ORII1-il: 0R TAT'rGTAMCGTTTACTAATGCAGGGTTT'TA R115-1, 0R115-5, 0R R OR R R121-1, 0R125-1, 0R125-2, 0R R126-5, 0R128-1, 0R128-6, ACCACA CAGGTGCATGCCTTTACCAATTTCT R128-10, 0R132-1, 0R R133-1, OR13-5, 0R133-9, 0R R R R137-3, 0R GCCCCT TGCAGATG(3ACGCATCAGATGTGGG OP GGGTTA rgactgtcattt3tatgtgacmatg c

9 Kathieen Whitlck We have shwn that the expressin f immediate early gene (IEG) c-fs in the lfactry epithelium is mdulated by a variety f drs including frms f prgesterne and prstaglandin (MacKenzie and Whitlck unpublished), and nw teststerne, GnRH, natural drs f male and female fish (Fig. 6), and amnin acids (Maturana and Whitlck, unpublished). Maturana, C (2010) Efect del mediambienfe sbre la expresin de c-fs en pez cebra (Dani ren). Universidad de Valparaís, Magíster en Ciencias Bilógicas Mención Neurciencia Figure 6. Embrys expsed te water cntaining adult male fish dr increases c-fs expressin in the lfactry epithelium and hypthalamus. Ventral View with anterir tward the tp. (A) Head f 48h embry shwing celis in lfactry rgans (B) higher magnificatin view f hypthalamic c-fs expressin (C) high magnificatin view f ene lfactry rgan shwn in (A). (D) Head f 48h embry shwing celis in lfactry rgans f embrys expsed t water with drants f adult male fish. (E) Hypthalamic regin shwing increase in c-fs expressin (see cntrl B). (E) High magnificatin view f ne lfactry rgan shwn in (D). One bserves iricreased expressin f c-fs in the lfactry epithelium (arrwhead) and hypthalamus (arrws) when the juveniles are expsed t water cntaining adult male fish. Scale Bar: A, D=35pm;B, E=25pm;C,F=2Opm. References Harden MV, Newtn LA, Llyd RC, and Whitlck KE. (2006). Olfactry imprinting is crrelated with changes in gene expressin in the lfactry epithelia f the zebrafish. J Neurbil., Nv;66(13): Knaut H, Werz C, Geisler R, Nüsslein-Vlhard C; Tübingen 2000 Screen Cnsrtium. (2003). A zebrafish hmlgue f the chemkine receptr Cxcr4 is a germ-cell guidance receptr. Nature. Jan 1 6;421 (6920): Miyasaka N, Knaut H, and Yshihara Y. (2007). Cxcl12/Cxcr4 chemkine signaling is required fr placde assembly and serisry axn pathfinding in the zebrafish lfactry system. Develpment., Jul;1 34(1 3): Sanders LH, and Whitlck KE. (2003). Phentype f the zebrafish masterblind (mbl) mutant is dependent n genetic backgrund. Dey Dyn., Jun;227(2): Tanguay RL, and Reimers MJ. (2008). Analysis f ethanl develpmental txicity in zebrafish. Methds Ml Bici. 447: Valentin G, Haas P, and Gilmur D. (2007). The chemkine SDFIa crdinates tissue migratin thrugh the spatially restricted activatin f Cxcr7 and Cxcr4b. Curr Bil. Jun 19;17(12): Whitlck KE. (2006). The sense f scents: lfactry behavirs in the zebrafish. Zebrafish. 3(2):

10 OTHER ACHIEVEMENTS OF THE PROJECT: - Research visit(s) t ther institutin(s). - Outreach activities related t the prject's main tpic. - Any ther cntributin, nt addressed elsewhere, that yu cnsider imprtant. - Frmación de recurss humans exceptuand tesistas ya infrmads. - Actividades de difusión yi extensión en la temática del pryect. - Cualquier tr lgr n cntemplad en ls ítem anterires y que Ud. quiera destacar. The maximum Iength fr this sectin 1$ 1 page. (Anal r Verdana, fnt size 10). Frmación de recurss humans excetuand tesistas va infrmads. 1, like ther research scientists, participate in the frmatin f "capital human" thugh the training f peple in my lab including undergraduate students (1), graduate students (4), and technicians (3). 1 have trained ali f my technicians in the techniques f fish care, micrscpy and imaging, and develpment f early embrys. Theses cmpleted: Hwes, P.N Predatr recgnitin f invasive salmnids by native galaxiids. MSc thesis. Swansea University, 100 p.) Whitlck c-tutr Stephensn, J. (2010)Olfactry cue mdulatiri f visual sensitivity in the zebrafish Dani ren. MSc Thesis, Bristl University in revisin. Whitlck c-tutr Maturana, C (2010)Efect del mediambiente sbre la expresin de c-fs en pez cebra (Dani reni). Universidad de Valparaís, Magíster en Ciencias Bilógicas Mención Neurciencia. Whitlck tutr Actividades de difusión v/ extensión en la temática del prvect. KE Whitlck, Directr de Prgrama Ciencia al Tir. Fr this utreach prgram we develp science wrkshps that are taught nce weekly at the lcal schl Escuela Republica Arabe Siria in Valparais, ne f the wrst public schls in Chile as judged by results n the SIMCE (natinal evaluatin) test. This prject was funded by: Pryección al Medi Extern (Outreach). Iniciativa Cientifica Mileni (Millenium Science Initative). Talleres Cientificas (Science Wrkshps). Rle: Principal Investigatr/Directr - Any ther cntributin, nt addressed elsewhere, that vu cnsider imrtant. 1. 3rd Strategic Cnference f Zebrafish lnvestigatrs, This meeting is a cmpetetive meeting where ne must submit a Curriculum. 1 was accepted and attended this meeting January 2009, Asilmar, Califrnia, USA. 2. Crdinadr: Simpsi:"Efects del medi ambiente sbre el desarrll"xx Reunin Anual Sciedad Chilena de Reprduccin y desarrll, La Serena, Chile Presentacin: Efects de mediambiente en el desarrll del embrines de pez cebra: lres, alchl, y pesticidas K. E. Whitlck 1, K Bnic, M. V. Harden, M. G. McKenzie and C. Maturana Septiembre 2009, La Serena Chile 3. Organizer and Instructr, Internatinal Curse in Develpmental Bilgy, CIMARQ, Universidad Andres Bell, Quintay Chile January 2010

11 PR03ECT SUMMARY: Usirig nri-specialist language, prvide a precise and brief descriptin f the prject gals, bjectives and results btained. This summary may be published in CONICYT's web page. The maximum Iength fr this sectin is 1 page. (Anal r Verdana, fnt size 10). The develping peripheral nervus system s initially rganized thrugh ceil migratin with the neural precursrs aggregating t frm the placdes frm which the sensry neurns will differentiate. Fr example we have demnstrated that the lfactry placde f the zebraflsh arises frm a fleld f cells in (he anterlateral edge f (he neural plate and des s in the absence f celi divisin (Whitlck & Westerfield 2000; Whitlck, 2004a, b), and that there appears t be little mixing f the lfactry placde precursrs with the adjacent migrating cranial neural crest (Harden and Whitlck, unpublished). The lfactry system is unique amng the sensry systems in that it generates neurns thrughut the life f the animal and these new neurns are generated frm a basal celi ppulatin within the lfactry epithelium. The generatin f a differen(iated lfactry sensry neurns (OSNs) is mre cmplex than many ther sensry systems because each sensry neurns will express ne f 160 (fish) t 1,000 (muse) lfactry receptrs. The mechanisms cntrlling (he differentiatin f OSNs are nt well understd. We have shwn that in additinal t internal, pre-prgrammed mechanisms the envirnment can als affect the differentiatin f neurnal precursrs within (he develping lfactry sensry system (Harden et al 2006). Strikingly we discvered that a transcriptin factr, tx2, is up-regulated when the zebrafish are raised in a specific dr envirnmen( but nt when raised in dr envirnments we previusly described (amin acids: Vitebsky et al 2005). These finding cupled with ur recent analysis indicates that (his highly cnserved transcriptin factr plays a rle in cn(rlling neurgenesis in bth the central and peripheral nervus system. We have identified genes cding fr lfactry receptrs that are ptential targets fr regulatin by tx2 (ranscriptin factr. Furthermre we have shwn that drs elici( specific respnses in zebrafish, fr example scial cues such as drs f ther fish are attrac(ive, and that expsure t (hese drs triggers changes in immediate early gene expressin (c-fs) in the nervus system. Thus we are piecing tgether the pa(hways by which envirnment signals, in (his case drants, elicit changes in gene expressin that allw greater plas(ici(y in gene expressin during develpment f the animal. Cupled with ur analysis f the envirnment affects n gene regulatin in the lfactry epithelium we have als analyzed (he celi mvements that cntribute t the frmatin f the lfactry sensry system and surrunding facial structures. Thrugh this analysis we have shwn that alchl affec(s the migratin f (he cranial neural crest cells and lfactry placde precursrs by reducing expressin f specific genes and causing celi death. Thus we have speciflc tls t explre (he cell defects caused by ther teratgenic agents, in particular thse tha( cause defrmities f the cranial facial structures and underlying nervus system. References Whitlck KE, Westerfield M. The lfactry placdes f the zebrafish frm by cnvergence f cellular fields at (he edge f (he neural plate. Develpment Sep;1 27(17): Whitlck KE, Wlf CD, Byce ML. (2003) Gnadtrpin-releasing hrmne (GnRH) cells arise frm cranial neural crest and adenhypphyseal regins f the neural plate in (he zebrafish, Dani ren. Dey Bil. May 1 ;257(1): Whi(lck, KE (2004a) Making Scents: Develpmen( and Functin f the Olfactry Sensry System. In: Fish Develpmental Bilgy and Genetics, Mlecular Aspects in Fish and Marine Bilgy. Zhiyuan Gng & Vladimir Krzh, Wrld Scientific, Singapre Whi(lck KE. (2004b). A new mdel fr lfac(ry placde develpment. Brain Behav Evl. 64(3): Review. Vi(ebsky A, Reyes R, Sandersn MJ, Michel WC, Whi(lck KE. (2005). Islatin and characterizatin f (he laure lfactry behaviral mutant in (he zebrafish, Dani ren. Dey Dyn. Sep;234(1 ): Harden MV, Newtn LA, Llyd RC, Whitlck KE. (2006) Olfactry imprinting is crrela(ed with changes in gene expressin in the lfactry epi(helia f the zebrafish. J Neurbil. Nv;66(13): Whitlck, K.E. (2008). Develping a sense f scen(s: Plasticity in lfac(ry placde frmatin. Brain Res Buli. Mar 1 8;75(2-4):340-7.

12 PRODUCTOS ARTÍCULOS Para trabajs en Prensa/ Aceptads/Enviads adjunte cpia de carta de aceptación de recepción. N : 1 Autr (a)(es/as): Kathleen Whitlck, Hannah Kim, Carla Maturana, Jaquin Letelier Nmbre Cmplet de la Revista: Mechanisms f Develpment Títul (Idima riginal): Disrupted patterning f the hypthalamus results in Kallmann Syndrme like defects in the zebrafish Indexación: ISI ISSN: Añ: 2009 Vl.: 126 N : Suppl Páginas: S124 Estad de la publicación a la fecha: Publicada Otras Fuentes de financiamient, si las hay: NIH/NICH DRO 1HD Envía dcument en papel: Archiv Asciad al artícul: n Whitlck_ISDB_Published_abstract.pdf N : 2 Autr (a)(es/as): Katica Bric, Kathleen Whitlck Nmbre Cmplet de la Revista: Mechanisms f Develpment Títul (Idima riginal): Effects f teratgenic agents n zebrafish (Dani ren) nervus system develpment Indexación: ISI ISSN: Añ: 2009 Vl.: 126 N : Suppl Páginas: S131 Estad de la publicación a la fecha: Publicada Otras Fuentes de financiamient, si las hay: 11CM P ` Envía dcument en papel: Archiv Asciad al artícul: n Bric_Published_Abstract.pdf N : 3 Autr (a)(es/as): Jaquín Letelier, Kathleen Whitlck Nmbre Cmplet de la Revista: Mechanisms f Develpment Títul (Idima riginal) : Effect f the disruptin f prkineticm2 system in the develpment f zebrafish

13 hypthalamic GnRH celis Indexación: ISI ISSN: Añ: 2009 Vl.: 126 N : Suppl Páginas: S330 Estad de la publicación a la fecha : Publicada Otras Fuentes de financiamient, si las hay: 1 NIH/NICHD R01HD Envía dcument en papel: Archiv Asciad al artícul: n Letelier_Published_Abstract.pdf 1) ) / N : 4 Autr (a)(es/as): T. A. Paul, J. Rvnak, S. L. Quackenbush, K. Whitlck, H. Zhan, Z. Gng, J. Spitsbergen, P. R. Bwser and J. W. C asey * Nmbre Cmplet de la Revista: Marine Bitechnlgy Títul (Idima riginal): TRANSGENIC EXPRESSION OF WALLEYE DERMAL SARCOMA VIRUS ACCESSORY GENES IN ZEBRAFISH DOES NOT RESULT IN TISSUE PROLIFERATION Indexación: SI ISSN: Añ: 2010 Vl.: N : Páginas: Estad de la publicación a la fecha: Aceptada Otras Fuentes de financiamient, si las hay: R01HD Envía dcument en papel: Archiv Asciad al artícul: n Casey_Manuscript.pdf /2009/8766/ OTRAS PUBLICACIONES N : Autr (a)(es/as): Kathleen Whitlck Títul (Idima riginal) : Olfactry Behavir in Zebrafish: Making Scents f a Changing Wrld Tip de publicación prduct: Capítul de Libr ISBN: nne yet Editr (es) (Libr Capitul de librs) :Dr. Allan Kalueff Nmbre de la editrial /Organización: Humana Press/Springer Science and Business Media, LLC ESTADOS UNIDOS DE AMERICA New Yrk

14 Fecha: Nviembre Añ: Vl.: N : Páginas: Otras Fuentes de financiamient, si las hay: This bk will suppsedly be published in time fr the Sciety fr Neurscience Meeting in the FaIl (in the Nrthern Hemisphere). Envía dcument en papel: Archiv Asciad al artícul: n Whitlck_Olfactry_Behav_Chapt.pdf 107 IP_ / CONGRESOS N : 1 Autr (a)(es/as): Cristian Calfún, Juanita Astudill y Kathleen Whitlck Títul (Idima riginal): Efects del Medi Ambiente sbre la expresión de Genes de Receptres Olfatris en Pez Cebra Nmbre del Cngres: Sciedad de Bilgia Celular de Chile CHILE pucn Fecha Inici: 01/ Fecha Términ: Nmbre Publicación: Añ: Vl.: N : Páginas: Envía dcument en papel: Archiv Asciad: n Calfun_Resumen_Pucn.pdf 1071/ / N : 2 Autr (a)(es/as): Bric, K. & Whitlck, K Títul (Idima riginal): EFECTOS TERATOCiÉNICOS DEL ALCOHOL EN PEZ CEBRA (Dani ren): UN MODELO DE SÍNDROME FETAL ALCOHÓLICO Nmbre del Cngres: Sciedad de Bilgia Celular de Chile CHILE pucn Fechalnici: Fecha Términ: Nmbre Publicación: Añ:

15 Vl.: N : Páginas: Envía dcument en papel: Archiv Asciad: n AbstractScBiKB.pdf 3328/ N : 3 Autr (a)(es/as) ). Pereir, Li, Valdivia, L.2, Allende, M.2, Ramialisn, M.3, Wittbrdt, J.3, Whitlck, K. 1 Títul (Idima riginal) : Marcaje in viv de células de la placda lfatria mediante transgénesis en el pez cebra (in viv labeling f lfactry placde cells in transgenic zebrafish Nmbre del Cngres: Sciedad de Bilgia Celular de Chile CHILE pucn Fecha Inici: Fecha Términ: Nmbre Publicación: Añ: Vl.: Páginas: Envía dcument en papel: Archiv Asciad: n resumenluisa09editkw.pdf hnp:// php/investigadr/f4_cngresüs/descargaj / /2009/11329/ N : 4 Autr (a)(es/as): Carla Maturanal, Melissa MacKenzie2, Maegan Rivard2 and Kathleen Whitlckl. Títul (Idima riginal) : Efect del medi ambiente sbre la expresión de c-fs en pez cebra, (Effect f envirnment n the expressin f c-fs in zebrafish). Nmbre del Cngres: Sciedad de Bilgia Celular de Chile CHILE pucn Fecha Inici: Fecha Términ: Nmbre Publicación: Añ: Vl.: N : Páginas: Envía dcument en papel: Archiv Asciad: n Maturana_Resumen_Pucn_2009.pdf (

16 TESIS/MEMORIAS N : 1 Títul de Tesis : Estudi del Origen y Desarrll de las Células Hiptalámicas Prductras de Hrmna Liberadra de Gnadtrpinas (GnRH 1). Nmbre y Apellids del(de la) Alumn(a) : Jaquín Letelier Undurraga Nmbre y Apellids del(de la) Tutr(a) : Títul Grad: Institución: Kathleen Whitlck Dctrad Universidad de Valparais CHILE Valparais Estad de Tesis: En Ejecución Fecha Inici: Fecha Términ: Envía dcument en papel: n Archiv Asciad: JaquinAvance_1-1,pdf 07 07I/ / N : 2 Títul de Tesis : Estudi de ls efects de agentes teratgénics sbre el desarrll del pez cebra (Dani ren) Nmbre y Apellids del(de la) Alumn(a): Katica Bric Brenet Nmbre y Apellids del(de la) Tutr(a) : Títul Grad: Institución: Kathleen Whitlck Dctrad Universidad de Valparais CHILE Valparais Estad de Tesis: En Ejecución Fecha Inici: Fecha Términ: 31/12/2011 Envía dcument en papel: n Archiv Asciad: Tesis_KaticaA.pdf 1071/2009/6843/ N : 3 Títul de Tesis : Analisis de cnducta y frmación de la memria en pez cebra Nmbre y Apellids del(de la) Alumn(a) : Alejandra Pnce Nmbre y Apellids del(de la) Tutr(a) : Kathleen Whitlck Títul Grad: Dctrad Institución: Universidad de Valparais CHILE Valparais Estad de Tesis: En Ejecución Fecha Inici: Fecha Términ: Envía dcument en papel: n Archiv Asciad: Alejandra_Resultads_últims_exp.pdf /2009/68441

17 N : 4 Títul de Tesis: EFECTO DEL MEDIO AMBIENTE SOBRE LA EXPRESIÓN de c-fs EN PEZ CEBRA Nmbre y Apellids del(de la) Alumn(a): CAROLA JEANNETI'E MATURANA FOURNIEL Nmbre y Apellids del(de la) Tutr(a) : Kathleen Whitlck Títul Grad: Institución: Magister Universidad de Valparais CHILE Valparais Estad de Tesis: Terminada Fecha Inici: 01/ Fecha Términ: Envía dcument en papel: n Archiv Asciad: Maturana_Tesis_.pdf htlp://cvaicvt.cnicyt.cifinfrrneacadernic/inde. php/iiv tigadr/f4_esi_memrias/descargaj /l07l07 L N : 5 Títul de Tesis : Predatr recgnitin f invasive salmnids by native galaxiids Nmbre y Apellids del(de la) Alumn(a) : Paul N. Hwes Nmbre y Apellids del(de la) Tutr(a): Carls Garcia de Leaniz Títul Grad: Magister Institución: Swansea University REINO UNIDO DE GB E IRLANDA DEL NORTE Swansea Estad de Tesis: Terminada Fecha Inici: 01/03/2008 Fecha Términ: 27/02/2009 tnvia acumern en papel: n Archiv Asciad: Hwes_thesis.pdf N : 6 Títul de Tesis : Olfactry cue mdulatin f visual sensitivity in the zebrafish Dani ren. Nmbre y Apellids del(de la) Alumn(a) : Jessica Stephensn Nmbre y Apellids del(de la) Tutr(a): Títul Grad: Institución: Estad de Tesis: Fecha Inici: Fecha Términ: Envía dcument en papel: Archiv Asciad: Julian C. Partridge Magister University f Bristl REINO UNIDO DE GB E IRLANDA DEL NORTE Bristl Terminada 01/03/ /02/2010 n Jess_Thesis.pdf c

18 ANEXOS N : 1 Archiv Asciad: Casey_manuscript_acceptance.pdf 1071/2009/12434/ A cntinuación se detallan ls anexs físics/papel que n se incluyen en el infrme en frmat PDF. frm Jim Casey crrespnding authr fr Marine Bitechnlgy manuscript saying that it is accepted. 1 am nt the crrespnding authr, thus 1 d nt have a cpy f this letter. ' ' '



Más detalles

AÑO/ URTEA (20xx): 2014/2015. Autor(Apellidos, Nombre)/ Egilea(Deiturak, izena):amalia Floristán Castillejo

AÑO/ URTEA (20xx): 2014/2015. Autor(Apellidos, Nombre)/ Egilea(Deiturak, izena):amalia Floristán Castillejo AÑO/ URTEA (20xx): 2014/2015 Camps OBLIGATORIOS/NAHITAEZ betebeharrekeremuak Trabaj Fin de Grad (TFG) / GraduAmaierak Lana (GAL) x Trabaj Fin de Máster (TFM) / Master Amaierak Lana ( MAL) Títul del TFG/TFM/

Más detalles

How to Use the Online Resources

How to Use the Online Resources Hw t Use the Online Resurces Online Resurces Dcument 1. Duble-click n the Online Resurces fr Learning English icn n the desktp. There are websites specifically fr learning Grammar and Prnunciatin and ther

Más detalles

Lengua adicional al español IV

Lengua adicional al español IV Lengua adicional al español IV Topic 11 Life little lessons Introduction In this lesson you will study: Time clauses are independent clauses. These are the clauses that tell you the specific time when

Más detalles

From e-pedagogies to activity planners. How can it help a teacher?

From e-pedagogies to activity planners. How can it help a teacher? From e-pedagogies to activity planners. How can it help a teacher? Elena de Miguel, Covadonga López, Ana Fernández-Pampillón & Maria Matesanz Universidad Complutense de Madrid ABSTRACT Within the framework

Más detalles

VASD 3rd Grade WINTER and SPRING and 4th Grade FALL Math Screener Name: Date:

VASD 3rd Grade WINTER and SPRING and 4th Grade FALL Math Screener Name: Date: VASD 3rd Grade WINTER and SPRING and 4th Grade FALL Math Screener Name: Date: Number Wrds and Numerals (NWN) Scre /10 Multiplicatin and Divisin (M/D) Scre /6 Additin and Subtractin (A/S) and Place Value

Más detalles

Los ensayos que se van a desarrollar son los siguientes:

Los ensayos que se van a desarrollar son los siguientes: I Resumen El objetivo principal del proyecto es desarrollar un software que permita analizar unos datos correspondientes a una serie de ensayos militares. Con este objetivo en mente, se ha decidido desarrollar

Más detalles

Agustiniano Ciudad Salitre School Computer Science Support Guide - 2015 Second grade First term

Agustiniano Ciudad Salitre School Computer Science Support Guide - 2015 Second grade First term Agustiniano Ciudad Salitre School Computer Science Support Guide - 2015 Second grade First term UNIDAD TEMATICA: INTERFAZ DE WINDOWS LOGRO: Reconoce la interfaz de Windows para ubicar y acceder a los programas,

Más detalles


ADAPTACIÓN DE REAL TIME WORKSHOP AL SISTEMA OPERATIVO LINUX ADAPTACIÓN DE REAL TIME WORKSHOP AL SISTEMA OPERATIVO LINUX Autor: Tomás Murillo, Fernando. Director: Muñoz Frías, José Daniel. Coordinador: Contreras Bárcena, David Entidad Colaboradora: ICAI Universidad

Más detalles


SCADA BASADO EN LABVIEW PARA EL LABORATORIO DE CONTROL DE ICAI SCADA BASADO EN LABVIEW PARA EL LABORATORIO DE CONTROL DE ICAI Autor: Otín Marcos, Ana. Directores: Rodríguez Pecharromán, Ramón. Rodríguez Mondéjar, José Antonio. Entidad Colaboradora: ICAI Universidad

Más detalles

Sistemas de impresión y tamaños mínimos Printing Systems and minimum sizes

Sistemas de impresión y tamaños mínimos Printing Systems and minimum sizes Sistemas de impresión y tamaños mínimos Printing Systems and minimum sizes Para la reproducción del Logotipo, deberán seguirse los lineamientos que se presentan a continuación y que servirán como guía

Más detalles


GUIDE FOR PARENT TEACHER CONFERENCES GUIDE FOR PARENT TEACHER CONFERENCES A parent-teacher conference is a chance for you and your child s teacher to talk. You can talk about how your child is learning at home and at school. This list will

Más detalles

manual de servicio nissan murano z51

manual de servicio nissan murano z51 manual de servicio nissan murano z51 Reference Manual To understand featuring to use and how to totally exploit manual de servicio nissan murano z51 to your great advantage, there are several sources of

Más detalles

Creating your Single Sign-On Account for the PowerSchool Parent Portal

Creating your Single Sign-On Account for the PowerSchool Parent Portal Creating your Single Sign-On Account for the PowerSchool Parent Portal Welcome to the Parent Single Sign-On. What does that mean? Parent Single Sign-On offers a number of benefits, including access to

Más detalles

Art Studio. Did you know...?

Art Studio. Did you know...? Art Studio Did you know...? Did you know...? In our Art Studio, we encourage children to use the materials in any way they wish. We provide ideas that they may use to begin work but do not expect copies

Más detalles

Connection from School to Home Science Grade 5 Unit 1 Living Systems

Connection from School to Home Science Grade 5 Unit 1 Living Systems Connection from School to Home Science Grade 5 Unit 1 Living Systems Here is an activity to help your child understand human body systems. Here is what you do: 1. Look at the pictures of the systems that

Más detalles

Diseño de un directorio Web de diseñadores gráficos, ilustradores y fotógrafos.

Diseño de un directorio Web de diseñadores gráficos, ilustradores y fotógrafos. Universidad Nueva Esparta Facultad de Ciencias Administrativas Escuela de Administración de Diseño de un directorio Web de diseñadores gráficos, ilustradores y fotógrafos. Tutor: Lic. Beaujon, María Beatriz

Más detalles

MANUAL EASYCHAIR. A) Ingresar su nombre de usuario y password, si ya tiene una cuenta registrada Ó

MANUAL EASYCHAIR. A) Ingresar su nombre de usuario y password, si ya tiene una cuenta registrada Ó MANUAL EASYCHAIR La URL para enviar su propuesta a la convocatoria es: Donde aparece la siguiente pantalla: Se encuentran dos opciones: A) Ingresar

Más detalles


IRS DATA RETRIEVAL NOTIFICATION DEPENDENT STUDENT ESTIMATOR IRS DATA RETRIEVAL NOTIFICATION DEPENDENT STUDENT ESTIMATOR Subject: Important Updates Needed for Your FAFSA Dear [Applicant], When you completed your 2012-2013 Free Application for Federal Student Aid

Más detalles

Pages: 205. Authors: Dr. Carmen Bestué, Ph. D. Dr. Mariana Orozco Jutoran, Ph. D. Chapters: 6

Pages: 205. Authors: Dr. Carmen Bestué, Ph. D. Dr. Mariana Orozco Jutoran, Ph. D. Chapters: 6 Pages: 205 Authors: Dr. Carmen Bestué, Ph. D. Dr. Mariana Orozco Jutoran, Ph. D. Chapters: 6 1 Course Description and Objectives The aim of this course is to provide an in depth analysis and intensive

Más detalles

Introduction. SER is one of three verbs in Spanish that mean to be. SER has a variety of uses and meanings. SER has an irregular conjugation.

Introduction. SER is one of three verbs in Spanish that mean to be. SER has a variety of uses and meanings. SER has an irregular conjugation. SER To be Introduction SER is one of three verbs in Spanish that mean to be SER has a variety of uses and meanings. SER has an irregular conjugation. Conjugation and Translation SER= to be 1st (yo) Soy

Más detalles

TIPS: Understanding Overspray

TIPS: Understanding Overspray TIPS: Understanding Overspray In any pneumatic spray application, overspray is an area of concern that should be addressed early on. Fortunately if it does occur, it s easily remedied through the use of

Más detalles

Learning Masters. Fluent: States of Matter

Learning Masters. Fluent: States of Matter Learning Masters Fluent: States of Matter What I Learned List the three most important things you learned in this theme. Tell why you listed each one. 1. 2. 3. 22 States of Matter Learning Masters How

Más detalles

A rough guide through the wilderness of the RyC on-line application forms!

A rough guide through the wilderness of the RyC on-line application forms! ! A rough guide through the wilderness of the RyC on-line application forms!! First, go to!!! Next, click on! Solicitud. Convocatoria 2014! in order to unfold a menu. You will see a

Más detalles

Análisis de la coestimulación vía CD28 en células linfoides de pacientes infectados. con el virus de la Hepatitis C RESUMEN

Análisis de la coestimulación vía CD28 en células linfoides de pacientes infectados. con el virus de la Hepatitis C RESUMEN Análisis de la coestimulación vía CD28 en células linfoides de pacientes infectados con el virus de la Hepatitis C RESUMEN La infección por el virus de la hepatitis C (VHC) afecta a más de 170 millones

Más detalles


PROBLEMAS PARA LA CLASE DEL 20 DE FEBRERO DEL 2008 PROBLEMAS PARA LA CLASE DEL 20 DE FEBRERO DEL 2008 Problema 1 Marketing estimates that a new instrument for the analysis of soil samples will be very successful, moderately successful, or unsuccessful,

Más detalles

Contents. Introduction. Aims. Software architecture. Tools. Example

Contents. Introduction. Aims. Software architecture. Tools. Example ED@CON Control Results Management Software Control with Remote Sensing Contents Introduction Aims Software architecture Tools Example Introduction Control results management software (Ed@con) is a computer

Más detalles

Plan de negocio para la explotación de un sistema de alquiler de bicicletas en la Comunidad de Madrid

Plan de negocio para la explotación de un sistema de alquiler de bicicletas en la Comunidad de Madrid Plan de negocio para la explotación de un sistema de alquiler de bicicletas en la Comunidad de Madrid Autor: Directores: Lago Vázquez, Óscar. Ortíz Marcos, Susana. Entidad Colaboradora: ICAI-Universidad

Más detalles


DONACION DE OLD TIME FOUNDATION A NIKAO MAORI SCHOOL RAROTONGA ISLAS COOK OCTUBRE 2007 DONACION DE OLD TIME FOUNDATION A NIKAO MAORI SCHOOL RAROTONGA ISLAS COOK OCTUBRE 2007 La escuela primaria Nikao Maori School fue fundada en 1955. Es una escuela pública y tiene actualmente 123 alumnos.

Más detalles

Certificado de Asistente de Oficina

Certificado de Asistente de Oficina Certificado de Asistente de Oficina Los estudiantes interesados en obtener este Certificado deben cumplir con los siguientes requisitos: Ser estudiante activo en la Facultad de Administración de Empresas,

Más detalles

Daly Elementary. Family Back to School Questionnaire

Daly Elementary. Family Back to School Questionnaire Daly Elementary Family Back to School Questionnaire Dear Parent(s)/Guardian(s), As I stated in the welcome letter you received before the beginning of the school year, I would be sending a questionnaire

Más detalles

Notes for teachers: Length of podcast: 7:59

Notes for teachers: Length of podcast: 7:59 : Technology Enhanced Elementary Spanish Program Lesson Plan: # 50 Story: # 1 Level 4 Objective(s) & Progress Indicator(s): 1a: Express simple descriptions 1b: Answer simple questions 1d: Identify visual

Más detalles

School Preference through the Infinite Campus Parent Portal

School Preference through the Infinite Campus Parent Portal School Preference through the Infinite Campus Parent Portal Welcome New and Returning Families! Enrollment for new families or families returning to RUSD after being gone longer than one year is easy.

Más detalles



Más detalles

Condiciones y Reglas de la presentación de Declaración Sumaria de Salida (EXS)

Condiciones y Reglas de la presentación de Declaración Sumaria de Salida (EXS) C/ Santa María Magdalena 16, 28016 Madrid ECS Sistema de Control de Exportaciones Condiciones y Reglas de la presentación de Declaración Sumaria de Salida (EXS) Autor: S.G.A.A Fecha: 06/06/2011 Versión:

Más detalles

Autor: Arrieta Martínez, Gonzalo. RESUMEN DEL PROYECTO


Más detalles


PROGRAMA. Operaciones de Banca y Bolsa SYLLABUS BANKING AND STOCK MARKET OPERATIONS PROGRAMA 4º Curso. Grado en Administración y Dirección SYLLABUS BANKING AND STOCK MARKET OPERATIONS 4 rd year. Pág. 1 / 8 Colegio Universitario de Estudios Financieros Leonardo Prieto Castro, 2 Tel. +34

Más detalles

PEMEX E&P South Region OMC 2015

PEMEX E&P South Region OMC 2015 PEMEX E&P South Region OMC 2015 Austin, TX. USA Por: Mario Alejandro Mosqueda Thompson (PEMEX) Juan D. Osorio Monsalve (OVS GROUP MEXICO) The system is based on integrating databases and capture of different

Más detalles



Más detalles

iclef-2002 at Universities of Alicante and Jaen University of Alicante (Spain)

iclef-2002 at Universities of Alicante and Jaen University of Alicante (Spain) iclef-2002 at Universities of Alicante and Jaen University of Alicante (Spain) ! Introduction! Passage Retrieval Systems! IR-n system! IR-n system at iclef-2002! Conclusions and Future works ! Introduction!

Más detalles

Learning Masters. Fluent: Wind, Water, and Sunlight

Learning Masters. Fluent: Wind, Water, and Sunlight Learning Masters Fluent: Wind, Water, and Sunlight What I Learned List the three most important things you learned in this theme. Tell why you listed each one. 1. 2. 3. 22 Wind, Water, and Sunlight Learning

Más detalles

Note: The following information is needed to assist in processing your complaint. Name: Address: City/State/Zip Code: Email Address:

Note: The following information is needed to assist in processing your complaint. Name: Address: City/State/Zip Code: Email Address: Title VI Cmplaint Frm Nte: The fllwing infrmatin is needed t assist in prcessing yur cmplaint. A. Cmplainant s infrmatin: Name: Address: City/State/Zip Cde: Telephne Number (Hme): Telephne Number (Wrk):

Más detalles

Edgar Quiñones. HHRR: Common Sense Does Not Mean Business. Objective

Edgar Quiñones. HHRR: Common Sense Does Not Mean Business. Objective Edgar Quiñones HHRR: Common Sense Does Not Mean Business Objective Share experiences & insight gained in the last two decades in the management consulting business regarding why Common Sense Does Not Mean

Más detalles

Este proyecto tiene como finalidad la creación de una aplicación para la gestión y explotación de los teléfonos de los empleados de una gran compañía.

Este proyecto tiene como finalidad la creación de una aplicación para la gestión y explotación de los teléfonos de los empleados de una gran compañía. SISTEMA DE GESTIÓN DE MÓVILES Autor: Holgado Oca, Luis Miguel. Director: Mañueco, MªLuisa. Entidad Colaboradora: Eli & Lilly Company. RESUMEN DEL PROYECTO Este proyecto tiene como finalidad la creación

Más detalles

Migrant. Learners Today LEADERS Tomorrow!

Migrant. Learners Today LEADERS Tomorrow! Migrant Learners Today LEADERS Tomorrow! 2014 Migrant Summer Program Language Enrichment for English Language Learners Through Science Themes Students will enhance English language acquisition through

Más detalles

TEESP: Technology Enhanced Elementary Spanish Program Lesson Planner. Title: Qué pasa con su corazón?

TEESP: Technology Enhanced Elementary Spanish Program Lesson Planner. Title: Qué pasa con su corazón? : Technology Enhanced Elementary Spanish Program Lesson Plan #: 60 Story #: 2 Level 6 Resources used: Title: Qué pasa con su corazón? Pages/URL/etc.: Cuéntame! Pages 167-174 Objective(s) & Progress Indicator(s):

Más detalles

RFID TEMPERATURE SENSOR. Autor: Polo Tascón, David. Director: Kramer, Kathleen. Entidad colaboradora: Advantageous Systems LLC.

RFID TEMPERATURE SENSOR. Autor: Polo Tascón, David. Director: Kramer, Kathleen. Entidad colaboradora: Advantageous Systems LLC. RFID TEMPERATURE SENSOR. Autor: Polo Tascón, David. Director: Kramer, Kathleen. Entidad colaboradora: Advantageous Systems LLC. RESUMEN DEL PROYECTO Existen casos en la industria de la tecnología, medicina,

Más detalles

WLAB SISTEMA DE CONTROL REMOTO EN TIEMPO REAL DE EQUIPOS DE LABORARIO. Directores: Rodríguez Pecharromán, Ramón. Palacios Hielscher, Rafael.

WLAB SISTEMA DE CONTROL REMOTO EN TIEMPO REAL DE EQUIPOS DE LABORARIO. Directores: Rodríguez Pecharromán, Ramón. Palacios Hielscher, Rafael. WLAB SISTEMA DE CONTROL REMOTO EN TIEMPO REAL DE EQUIPOS DE LABORARIO. Autor: Rodríguez de la Rosa, Alicia. Directores: Rodríguez Pecharromán, Ramón. Palacios Hielscher, Rafael. Entidad Colaboradora: ICAI

Más detalles

Notes for teachers: Length of podcast: 14:38

Notes for teachers: Length of podcast: 14:38 : Technology Enhanced Elementary Spanish Program Lesson Plan: # 55 Story: # 2 Level 5 Objective(s) & Progress Indicator(s): 1a: Express simple descriptions 1b: Answer simple questions 1d: Identify visual

Más detalles

An explanation by Sr. Jordan

An explanation by Sr. Jordan & An explanation by Sr. Jdan direct object pronouns We usually use Direct Object Pronouns to substitute f it them in a sentence when the it them follows the verb. Because of gender, him and her could also

Más detalles



Más detalles


INSTRUCCIONES PARA ENVIAR SU PELICULA PARA LA VIDEOLIBRERIA For English version, please scroll down to page 11 (eleven) INSTRUCCIONES PARA ENVIAR SU PELICULA PARA LA VIDEOLIBRERIA Especificaciones técnicas Container format:.mp4 / tamaño de archivo no superior a

Más detalles

Entrevista: el medio ambiente. A la caza de vocabulario: come se dice en español?

Entrevista: el medio ambiente. A la caza de vocabulario: come se dice en español? A la caza de vocabulario: come se dice en español? Entrevista: el medio ambiente 1. There are a lot of factories 2. The destruction of the ozone layer 3. In our city there is a lot of rubbish 4. Endangered

Más detalles

The 10 Building Blocks of Primary Care

The 10 Building Blocks of Primary Care The 10 Building Blocks of Primary Care My Action Plan Background and Description The Action Plan is a tool used to engage patients in behavior-change discussion with a clinician or health coach. Using

Más detalles

Mi ciudad interesante

Mi ciudad interesante Mi ciudad interesante A WebQuest for 5th Grade Spanish Designed by Jacob Vuiller Introducción Tarea Proceso Evaluación Conclusión Créditos Introducción Bienvenidos! Eres alcalde de una

Más detalles


PERFORMANCE EVALUATION THE PEDS SM LOG IN HELP Lgging Int PEDS Spanish Lgging Int PEDS The fllwing PEDS lg in screen will pen: 1. UserID: Lg in using yur Windws ID which is typically yur first initial last name with n spaces. Chris Wright = cwright

Más detalles



Más detalles



Más detalles

Propiedades del Mineral en Molinos SAG y AG Ahorrando tiempo y dinero con MetSMART: Probando y Simulando la Dureza del Mineral

Propiedades del Mineral en Molinos SAG y AG Ahorrando tiempo y dinero con MetSMART: Probando y Simulando la Dureza del Mineral Propiedades del Mineral en Molinos SAG y AG Ahorrando tiempo y dinero con MetSMART: Probando y Simulando la Dureza del Mineral Ore Properties in AG/SAG Mill Saving Time and Money with MetSMART: Testing

Más detalles

Adobe Acrobat Reader X: Manual to Verify the Digital Certification of a Document

Adobe Acrobat Reader X: Manual to Verify the Digital Certification of a Document dobe crobat Reader X: Manual de verificación de Certificación Digital de un documento dobe crobat Reader X: Manual to Verify the Digital Certification of a Document Desarrollado por:

Más detalles

KNXLogger v.1.0. KNXLogger V.1.0. 1.- English Version. 2.- Versión en Español. /

KNXLogger v.1.0. KNXLogger V.1.0. 1.- English Version. 2.- Versión en Español. / KNXLgger V.1.0 1.- English Versin 2.- Versión en Españl / English Versin What is KNXLgger? KNXLgger is a prgram that allws recrding the values f sensrs in a KNX. The recrd made

Más detalles


GENERAL INFORMATION Project Description RESULTADOS! GENERAL INFORMATION Project Description The campaign "Adopt a car " had as its main objective to position Autoplaza, the main automotive selling point of Chile, as a new car sales location

Más detalles

Learning Masters. Early: Force and Motion

Learning Masters. Early: Force and Motion Learning Masters Early: Force and Motion WhatILearned What important things did you learn in this theme? I learned that I learned that I learned that 22 Force and Motion Learning Masters How I Learned

Más detalles

Instructor: Do you remember how to say the verb "to speak"? Instructor: How do you ask a friend Do you speak Spanish?

Instructor: Do you remember how to say the verb to speak? Instructor: How do you ask a friend Do you speak Spanish? Learning Spanish Like Crazy Spoken Spanish Lección Dos. Listen to the following conversation: Male: Hablas inglés? Female: Sí, hablo inglés porque practico todos los días. Male: Dónde? Female: Practico

Más detalles

Lista 1. Nombre. Lista 5. Lista 4 Lista 3 Lista 2. Lista 1. Lista 10. Lista 9. Lista 8. Lista 7. Lista 6

Lista 1. Nombre. Lista 5. Lista 4 Lista 3 Lista 2. Lista 1. Lista 10. Lista 9. Lista 8. Lista 7. Lista 6 Nombre Lista 1 Lista 10 Lista 9 Lista 8 Lista 7 Lista 6 Lista 5 Lista 4 Lista 3 Lista 2 Lista 1 Yo (I) Y (and) Un (a, an) Una (a-for female) Veo (I see) Mi (my) Tu (you) A (to) Al (to) Así (like this)

Más detalles

1 Hola! Soy Jaime y quiero contarles mi historia. Vivo con mi mamá y mi papá, Mila y Jimmy, y mis dos hermanos: Gabriel y Diego. Me gusta jugar béisbol y tenis, así como nadar. Hi! I m Jaime and I want

Más detalles

Curso Taller Certified Software Developer Professional (CSDP)

Curso Taller Certified Software Developer Professional (CSDP) Curs Taller Certified Sftware Develper Prfessinal (CSDP) Justificación: La industria del sftware requiere de prfesinales capaces de adptar las mejres prácticas mundiales en un mercad exigente y cambiante.

Más detalles

Estudio y analisis en el diseño de una canal de comunicaciones para el desarrollo de la interactividad en la televisión digital RESUMEN

Estudio y analisis en el diseño de una canal de comunicaciones para el desarrollo de la interactividad en la televisión digital RESUMEN Estudio y analisis en el diseño de una canal de comunicaciones para el desarrollo de la interactividad en la televisión digital Autor: Alberto Cuesta Gómez Director: Dr. Sadot Alexandres Fernández RESUMEN

Más detalles


WEB DIRECCIÓN ADRESS Villa de Madrid, 60 46988 Paterna TELÉFONO TELEPHONE FAX. E-MAIL EDITORIAL ECIR Ecir se dedica a la publicación de materiales para el mundo educativo desde 1942. La incorporación de una nueva línea para educación infantil nos ha permitido ampliar nuestro ámbito de actua

Más detalles

Wisdom Creek Homeowners Association

Wisdom Creek Homeowners Association Essex Assciatin Management, L.P., Carrlltn, TX 75006 (972) 428-2030 December 1, 2015 Dear Wisdm Creek Hmewner(s): Ntice f Annual Meeting Recnvene December 16, 2015 As manager fr Wisdm Creek Hmewners Assciatin,

Más detalles

MEDIA : 72.14 PASS RATE: 60.6%

MEDIA : 72.14 PASS RATE: 60.6% 12 Examen I 10 8 Frecuencia (%) 6 4 2 0 96 94 92 90 88 84 82 80 78 76 74 72 70 68 66 64 62 60 58 56 54 52 50 42 38 Puntuación (100) MEDIA : 72.14 PASS RATE: 60.6% 12 Examen I 10 Frecuencia (%) 8 6 4 ESTIMADO

Más detalles

Lengua adicional al español IV

Lengua adicional al español IV Lengua adicional al español IV Topic 7 Introduction In this module you will reinforce the use of the present passive voice, but now with the continuous form. Remember in this structure the doer of the

Más detalles

Learning Masters. Fluent: Animal Habitats

Learning Masters. Fluent: Animal Habitats Learning Masters Fluent: Animal Habitats What I Learned List the three most important things you learned in this theme. Tell why you listed each one. 1. 2. 3. 22 Animal Habitats Learning Masters How I

Más detalles

SPANISH ORAL LANGUAGE ASSESSMENT. Jill Jegerski Department of Modern Languages April 8, 2011

SPANISH ORAL LANGUAGE ASSESSMENT. Jill Jegerski Department of Modern Languages April 8, 2011 SPANISH ORAL LANGUAGE ASSESSMENT Jill Jegerski Department of Modern Languages April 8, 2011 INTRODUCTION Basic Spanish program at CSI Three-course Gen. Ed. sequence: SPN 113, 114, 213 Approximately 800

Más detalles



Más detalles

Reducción de Riesgos En Deep Web

Reducción de Riesgos En Deep Web Reducción de Riesgos En Deep Web Puesta en Marcha 1. Antecedentes: Dr.X 2. Justificación: 1. Outreach virtual RdR: allá donde están las personas usuarias 2. Conocimiento directo, real e inmediato de nuevas

Más detalles



Más detalles

Disfruten su verano! Hola estudiantes,

Disfruten su verano! Hola estudiantes, Hola estudiantes, We hope that your experience during Spanish 1 was enjoyable and that you are looking forward to improving your ability to communicate in Spanish. As we all know, it is very difficult

Más detalles


SEMINAR 3: COMPOSITION SEMINAR 3: FORMAL LETTER COMPOSITION 1 Lengua C I (Inglés) Código 00EM Imagine you were selected as an Erasmus student and you wanted to write to your host university to ask them for information about

Más detalles

Tiempo de esterilización (Valor F o )

Tiempo de esterilización (Valor F o ) iemp de esterilización (Valr F ) Impact f experimental parameter variability n thermal fd prcessing decisins based n micrbial safety bjectives # 153 Definitins Prcessr must estimate prcess time ( ) inactivating

Más detalles


UNIVERSIDAD SAN FRANCISCO DE QUITO. Colegio de Postgrados i UNIVERSIDAD SAN FRANCISCO DE QUITO Colegio de Postgrados Análisis comparativo del Sistema de Gestión de Seguridad y Salud ocupacional Modelo Ecuador con los sistemas de Gestión internacionales y, sistematización

Más detalles

1) Yo/ asistir. 2) Yo / ser. 3) Yo / tener. 4) Yo / lograr. 5) Yo / trabajar. Some questions to consider: Future Tense:

1) Yo/ asistir. 2) Yo / ser. 3) Yo / tener. 4) Yo / lograr. 5) Yo / trabajar. Some questions to consider: Future Tense: Nombre: Clase: Fecha: REPASO (Examen Final ESCRIBIR) TASK 1: Felicidades! You have been accepted into the university of your dreams! Tomorrow, you will have to meet with an admissions officer. Before your

Más detalles

Puede pagar facturas y gastos periódicos como el alquiler, el gas, la electricidad, el agua y el teléfono y también otros gastos del hogar.

Puede pagar facturas y gastos periódicos como el alquiler, el gas, la electricidad, el agua y el teléfono y también otros gastos del hogar. SPANISH Centrepay Qué es Centrepay? Centrepay es la manera sencilla de pagar sus facturas y gastos. Centrepay es un servicio de pago de facturas voluntario y gratuito para clientes de Centrelink. Utilice

Más detalles

ETS APPs 26.10.2012 MATELEC 2012. Nuevas Funciones para ETS. Madrid. Casto Cañavate KNX Association International

ETS APPs 26.10.2012 MATELEC 2012. Nuevas Funciones para ETS. Madrid. Casto Cañavate KNX Association International ETS APPs Nuevas Funciones para ETS 26.10.2012 MATELEC 2012 Madrid Casto Cañavate KNX Association International KNX Association International Page No. 2 Introducción Diversidad de Proyectos Viviendas Oficinas

Más detalles

Steps to Understand Your Child s Behavior. Customizing the Flyer

Steps to Understand Your Child s Behavior. Customizing the Flyer Steps to Understand Your Child s Behavior Customizing the Flyer Hello! Here is the PDF Form Template for use in advertising Steps to Understanding Your Child s Behavior (HDS Behavior Level 1B). Because

Más detalles

Qué viva la Gráfica de Cien!

Qué viva la Gráfica de Cien! Qué viva la Gráfica de Cien! La gráfica de cien consiste en números del 1 al 100 ordenados en cuadrilones de diez números en hileras. El resultado es que los estudiantes que utilizan estás gráficas pueden

Más detalles

Real Time Systems. Part 2: Cyclic schedulers. Real Time Systems. Francisco Martín Rico. URJC. 2011

Real Time Systems. Part 2: Cyclic schedulers. Real Time Systems. Francisco Martín Rico. URJC. 2011 Real Time Systems Part 2: Cyclic schedulers Scheduling To organise the use resources to guarantee the temporal requirements A scheduling method is composed by: An scheduling algorithm that calculates the

Más detalles


PRINTING INSTRUCTIONS PRINTING INSTRUCTIONS 1. Print the Petition form on 8½ X 11inch paper. 2. The second page (instructions for circulator) must be copied on the reverse side of the petition Instructions to print the PDF

Más detalles


VALE LA PENA INVERTIR EN TECNOLOGÍAS RENOVABLES? Palabras Clave Conservar renovable invertir proceder maximizar!!! Únete al debate nacional! VALE LA PENA INVERTIR EN TECNOLOGÍAS RENOVABLES? WORD GENERATION Unidad 2.15 Lectura Semanal! El!BigBelly!es!una!papelera!(o!basurero)!

Más detalles


BILINGUAL MUSIC I MÚSICA I BILINGÜE ACTIVITY BOOK UNIT 1. THE ART OF SOUND BILINGUAL MÚSICA I BILINGÜE UNIT 1. THE ART OF SOUND VOCABULARY 1. Translate 2. Listen to the sound and identify the pitch, intensity, duration and timbre in the table below. SOUND 1 SOUND 2 SOUND 3 SOUND

Más detalles

Thank you. US English US Spanish. Australia-English Canada-English Ireland-English New Zealand-English Taiwan-English United Kingdom-English

Thank you. US English US Spanish. Australia-English Canada-English Ireland-English New Zealand-English Taiwan-English United Kingdom-English Dear Healthcare Provider, Included in this PDF are recruitment brochures in several languages to be used in MM Bone study (Protocol No.: 20090482). Kindly note these brochures have been updated according

Más detalles

MÍNIMO Mobiliario modular para hogares pequeños AUTOR SILVANA PABÓN OCHOA


Más detalles


CONTROLADORA PARA PIXELS CONPIX The LedEdit Software Instructions 1, Install the software to PC and open English version: When we installed The LedEdit Software, on the desktop we can see following icon: Please Double-click it, then

Más detalles

Karina Ocaña Izquierdo

Karina Ocaña Izquierdo Estudié Ingeniería en Sistemas Computacionales (1997) y una Maestría en Ingeniería de Cómputo con especialidad en Sistemas Digitales (2000), ambas en el Instituto Politécnico Nacional (México). En el 2003,

Más detalles

TEACHER TOOLS: Teaching Kids Spanish Vocabulary. An Activity in 4 Steps

TEACHER TOOLS: Teaching Kids Spanish Vocabulary. An Activity in 4 Steps TEACHER TOOLS: Teaching Kids Spanish Vocabulary An Activity in 4 Steps Teaching Kids Spanish Vocabulary Lesson for Spanish Teachers Learning new vocabulary words in Spanish is an important element in the

Más detalles


DISEÑO DE UN CRONOTERMOSTATO PARA CALEFACCIÓN SOBRE TELÉFONOS MÓVILES. Entidad Colaboradora: ICAI Universidad Pontificia Comillas. DISEÑO DE UN CRONOTERMOSTATO PARA CALEFACCIÓN SOBRE TELÉFONOS MÓVILES Autor: Sánchez Gómez, Estefanía Dolores. Directores: Pilo de la Fuente, Eduardo. Egido Cortés, Ignacio. Entidad Colaboradora: ICAI

Más detalles

Learning Masters. Early: Animal Bodies

Learning Masters. Early: Animal Bodies Learning Masters Early: Animal Bodies WhatILearned What important things did you learn in this theme? I learned that I learned that I learned that 22 Animal Bodies Learning Masters How I Learned Good readers

Más detalles

Universidad de Guadalajara

Universidad de Guadalajara Universidad de Guadalajara Centro Universitario de Ciencias Económico-Administrativas Maestría en Tecnologías de Información Ante-proyecto de Tésis Selection of a lightweight virtualization framework to

Más detalles

EXPAND HORIZONS. When you gaze out at the horizon, what do you see? You see where one vista ends and another one begins. You think POSSIBILITIES

EXPAND HORIZONS. When you gaze out at the horizon, what do you see? You see where one vista ends and another one begins. You think POSSIBILITIES EXPANDING HORIZONS EXPAND HORIZONS IS WHAT PAUL CUFFEE SCHOOL DOES. When you gaze out at the horizon, what do you see? You see where one vista ends and another one begins. You think POSSIBILITIES Selected

Más detalles

Vermont Mini-Lessons: Leaving A Voicemail

Vermont Mini-Lessons: Leaving A Voicemail Vermont Mini-Lessons: Leaving A Voicemail Leaving a Voice Mail Message Learning Objective 1) When to leave a message 2) How to leave a message Materials: 1) Voice Mail Template blanks & samples 2) Phone

Más detalles