KARIN DENISE ALEGRIA FLANDEZ

Tamaño: px
Comenzar la demostración a partir de la página:

Download "KARIN DENISE ALEGRIA FLANDEZ"

Transcripción

1 Profesor Patrocinante Dr. Rafael Burgos A. Instituto de Farmacología y Morfofisiología Facultad de Ciencias Veterinarias Profesor Co-Patrocinante Dra. M. Angélica Hidalgo G. Instituto de Farmacología y Morfofisiología Facultad de Ciencias Veterinarias EFECTO DE ANDROGRAFOLIDO SOBRE LAS VIAS DE SEÑALIZACION CELULAR MAPK Y PI3K, Y SOBRE MARCADORES OSTEOGENICOS EN CELULAS OSTEOBLASTICAS DE RATON Tesis de Grado presentada como parte de los requisitos para optar al grado de Licenciado en Bioquímica y Título Profesional de Bioquímico KARIN DENISE ALEGRIA FLANDEZ VALDIVIA CHILE 2010

2 Nunca consideres el estudio como una obligación, sino como una oportunidad para penetrar en el bello y maravilloso mundo del saber. Albert Einstein. A mi familia, en especial a mi hijo, por ser el motor y la luz de mis días.

3 Agradecimientos. Al Dr. Rafael Burgos por ser una excelente persona tanto en lo personal como en lo profesional, por ser generoso con toda su enseñanza, por su dedicación, paciencia y apoyo durante todo el periodo que estuve en el laboratorio. A la Dra. Angélica Hidalgo, por sus palabras críticas y objetivas a la hora de dar un consejo y por ser un apoyo constante durante mi formación. A mis amigos y compañeros de laboratorio, Loretto, Daniella (Danny), Pablo, Jano, Iván, Evelyn (Eve), Kathy y Luis, por llenar de risa los espacios vacíos y por todos los momentos agradables tanto dentro como fuera del laboratorio. A mis amigas, más que amigas hermanas, Pía, Faby y Sara, por ser incondicionales, por su apoyo y sus consejos en los momentos difíciles, por sus sonrisas y alegrías en todos los momentos que vivimos y por estar ahí, aun cuando las palabras no eran necesarias. A mi familia, abuelitos, tíos y primos, por ser comprensivos ante las dificultades vividas, por el apoyo brindado durante todas las etapas de mi formación profesional, por la exigencia en mis horas de flaqueza y en especial a mi mamá por ser incondicional en todo momento. A mi hijo, que sin sus sonrisas, abrazos, besos y todas sus muestras de cariño todo hubiera sido más difícil. Esta tesis fue realizada gracias al apoyo del proyecto FONDEF DO4I1240.

4 i ÍNDICE DE CONTENIDOS. Página 1. RESUMEN. 1 SUMMARY INTRODUCCIÓN MATERIALES Y MÉTODOS Materiales Material Biológico Reactivos Químicos Métodos Cultivo de la línea celular osteoblástica de ratón MC3T3-E Viabilidad de la línea celular osteoblástica MC3T3-E1 mediante 31 citometría de flujo Determinación del efecto de andrografólido sobre las vías de 31 señalización MAPK en la línea celular osteoblástica MC3T3-E Determinación del rol de la vía MAPK en el aumento de la 32 proteína COX-2 en la línea celular osteoblástica MC3T3-E Determinación del efecto de andrografólido sobre la expresión 32 del RNAm de COX-2 en presencia de inhibidores.

5 ii Determinación de la producción de fosfatasa alcalina en la 33 línea celular osteoblástica MC3T3-E Determinación de la mineralización en la línea celular 33 osteoblástica MC3T3-E1 mediante la tinción rojo alizarina Análisis del efecto de andrografólido sobre los factores de 34 transcripción NF-ĸB y AP-1 en la línea celular osteoblástica MC3T3- E Extracción de proteínas totales Separación electroforética de proteínas Electrotransferencia Análisis de Western blot Inmunofluorescencia Transcripción reversa - reacción en cadena de la polimerasa 38 en tiempo real (RT-PCR) Análisis estadísticos RESULTADOS Viabilidad Celular de la línea osteoblástica MC3T3-E1 en 40 presencia de andrografólido. 4.2 Determinación del efecto de andrografólido sobre las vías de 43 señalización MAPK en la línea celular osteoblástica MC3T3-E Determinación del rol de las vías MAPK en el aumento de COX-2. 47

6 iii 4.4 Efecto de andrografólido en marcadores osteogénicos Efecto de andrografólido en los factores de trascripción AP-1 y NFκB Análisis de inmunodetección de IκBα y del factor NF-κB Análisis de inmunodetección para la proteína c-fos, 65 componente de la proteína AP DISCUSIÓN BIBLIOGRAFÍA. 81

7 iv INDICE DE FIGURAS Página Figura 1 Grupo de osteoclastos reabsorbiendo hueso. 6 Figura 2 Osteocito en el interior de una laguna. 8 Figura 3 Vía de señalización de Smad al núcleo. 14 Figura 4 Vías de activación de las MAPKs. 17 Figura 5 Síntesis de prostaglandinas a partir de la liberación de ácido araquidónico desde los fosfolípidos de la membrana. 20 Figura 6 Vías de señalización que median la inducción de COX Figura 7 Viabilidad celular de la línea osteoblástica MC3T3-E1. 41 Figura 8 Figura 9 Figura 10 Figura 11 Análisis de Western blot para la fosforilación de Akt en presencia de andrografólido. Análisis de Western blot para la fosforilación de p38 en presencia de andrografólido. Análisis de Western blot para la fosforilación de ERK 1/2 en presencia de andrografólido. Efecto de andrografólido en la vía de señalización MAPK ERK 1/2, en presencia de los inhibidores UO126, SB y LY

8 v Figura 12 Efecto de andrografólido en la expresión de COX-2, en presencia de los inhibidores UO126, SB y LY Figura 13 Análisis de RT-PCR en tiempo real para COX-2 53 Figura 14 Figura 15 Figura 16 Viabilidad celular de la línea osteoblástica MC3T3-E1 a las 24 hrs. Viabilidad celular de la línea osteoblástica MC3T3-E1 a los 2 días. Viabilidad celular de la línea osteoblástica MC3T3-E1 a los 10 días Figura 17 Actividad de fosfatasa alcalina. 60 Figura 18 Figura 19 Figura 20 Figura 21 Figura 22 Efecto de andrografólido en la mineralización de las células MC3T3-E1. Efecto de andrografólido sobre la proteína IκBα en las células osteoblásticas MC3T3-E1. Efecto de andrografólido sobre la localización subcelular de p65/nf-κb en células MC3T3-E1. Efecto de andrografólido sobre la proteína IκBα en las células osteoblásticas MC3T3-E1. Esquema propuesto para el aumento de COX-2 en las células MC3T3-E1 por andrografólido

9 vi LISTA DE ABREVIATURAS ALP : Actividad de fosfatasa alcalina AMP : 2-amino-2-metil-1 propanol AP : Andrografólido AP-1 : Proteína Activadora 1 ATF : Factor activante de transcripción BMP : Proteína morfogenética de hueso BSA : Albúmina sérica de bovino CFU-F : Unidad formadora de colonias de fibroblastos. CFU-MG : Unidad formadora de colonias granulocito-macrófago COX-1 : Ciclooxigenasa-1 COX-2 : Ciclooxigenasa-2 EGF : Factor de crecimiento epidermal ERK1/2 : Quinasas reguladas por señales extracelulares fmlp : N-formilmetionina-leucil-fenilalanina GAPDH : Gliceraldehído 3 fosfato deshidrogenasa GDFs : Factores de crecimiento y diferenciación IGF-1 : Factor de crecimiento de insulina 1 IL-1 : Interleuquina-1 IL-6 : Interleuquina-6 IL-11 : Interleuquina-11 inos : Oxido nitrico sintasa inducible

10 vii JNK : Quinasas N-terminales de c-jun LPS : Lipopolisacáridos M-CSF : Factor estimulante colonia macrófago MAPK : Proteínas quinasas activadas por mitógeno MEK : Quinasa extracelular mitógena (MAPK/ERK quinasa) NFAT : Factor nuclear de células T activadas NF-IL6 : Factor nuclear para interleuquina 6 NF-κB : Factor Nuclear kappa B OC : Osteocalcina OPN : Osteopontina PAF : Factor activador de plaquetas PBS : Tampón fosfato salino PCR : Reacción en cadena de la polimerasa PEA3 : Factor de transcripción de la familia Ets PG : Prostaglandina PGA2 : Prostaglandina A2 PGD2 : Prostaglandina D2 PGE2 : Prostaglandina E2 PGF2α : Prostaglandina F2α PI3K : Fosfatidil inositol 3 quinasa PMSF : Fenilmetilsulfonil fluoruro pnpp : p-nitrofenilfosfato R-SMAD : recetor activador de SMAD

11 viii SBE : Elementos de unión SMAD SDS-PAGE : Electroforesis en gel poliacrilamida en condiciones denaturantes TEMED : N, N, N, N - tetrametilendiamina TGF-β : Factor de crecimiento transformante β TNF : Factor de necrosis tumoral Tris : Tris-(hidroximetil)-aminometano VEGF : Factor de crecimiento vascular endotelial

12 1 1. Resumen. Andrografólido ha sido usado para aliviar enfermedades inflamatorias, lo cual ha incentivado su estudio para lograr entender su mecanismo de acción. Datos del laboratorio sugieren que el uso de este compuesto, en la línea celular osteoblástica MC3T3-E1 aumenta la expresión de COX-2 inducida por TNF-α y TGF-β. Ante esto, nos planteamos la hipótesis que andrografólido vía MAPK aumenta la expresión de COX-2 favoreciendo la mineralización en la línea celular MC3T3-E1. Utilizando técnicas de Western blot, se demostró que andrografólido aumenta la fosforilación de la vía ERK1/2, no así de las vías p38 y Akt. Mediante Western blot y PCR en tiempo real, se analizó el efecto de los inhibidores UO126, SB y LY sobre la expresión de COX-2 mostrando en el Western blot una inhibición estadísticamente significativa sólo para el inhibidor SB comparado con andrografólido, no así en el análisis de PCR en tiempo real, en donde los tres inhibidores presentaron diferencias significativas. Se analizó además la presencia de la proteína IkBα mediante Western blot mostrando una disminución a los 30 minutos y se analizó también el factor de transcripción NF-κB mediante inmunocitoquímica mostrando su presencia en el núcleo a las 2 horas de estimulación. Andrografólido produjo una disminución dosis dependiente de la actividad de fosfatasa alcalina y del grado de mineralización. Concluimos de esta manera que andrografólido mediante la vía ERK1/2 aumentó la expresión de COX-2, dejando entre ver la posible participación de otras vías como p38 y Akt. Además, se observó una disminución dosis dependiente de marcadores osteogénicos como ALP, posiblemente atribuible a un efecto pro-apoptótico.

13 2 1.1 Summary Andrographolide has been used to relieve inflammatory diseases, which has encouraged their study in order to understand its mechanism of action. It has been suggested that the use of this compound, in the osteoblastic cell line MC3T3-E1, increases the expression of COX-2 induced TNF-α and TGF-β. For this reason, we proposed that andrographolide via MAPK pathway, increases expression of COX-2 favoring mineralization in MC3T3-E1 cell line. Using Western blot techniques, show that andrographolides increased the ERK1 / 2 phosphorylation, but not affected p38 and Akt pathways. Using Western blot and real time PCR, we examined the effect of the inhibitors UO126, SB and LY on the expression of COX-2 induced by andrographolide. A statistically significant inhibition of COX-2 expression using SB it compared with andrographolide, was observed. UO126, SB and LY significantly reduced the COX-2 mrna. We demonstrated by using inmunoblot that IkBα was reduced at 30 minutes of incubation with andrographolide. The transcription factor NF-κB was observed by immunocytochemistry in the nucleus after 2 hours of stimulation with andrographolide. The alkaline phosphatase (ALP) activity and mineralization showed a dose dependant inhibition. Thus, we conclude that andrographolide via ERK1/2 MAPK increases the expression of COX-2, however we did not discard a role of p38 MAPK and Akt. Andrographolide, caused a decrease on osteogenic markers such as ALP, possibly induced by a pro-apoptotic effect.

14 3 2. Introducción El hueso es un órgano firme, duro y resistente. Es el principal tejido esquelético de los vertebrados, proporciona soporte mecánico a las articulaciones, tendones y ligamentos, protege órganos vitales y actúa como reservorio de iones en especial calcio y fosfatos para la mantención normal de la homeostasis mineral (Stuart H, 2005). Es un tejido vivo y en crecimiento. Posee una estructura mineralizada porosa, hecha de células, vasos, cristales de compuestos cálcicos (hidroxiapatita), cuya proporción varia de acuerdo al tipo de hueso y región (Serrano, 1998). Los huesos del esqueleto presentan formas y tamaños diferentes pero poseen una estructura común: una corteza de hueso compacto (80% del volumen total del hueso) que por su superficie interna se halla en continuidad con un hueso de aspecto esponjoso o trabecular (20% del volumen total del hueso) (Gurley y Roth, 1992). Más del 99% en volumen de la matriz ósea se halla mineralizado (hueso cortical: 99.9%; hueso esponjoso 99.2%) por lo que posee un componente orgánico y otro inorgánico. El componente orgánico se halla integrado por colágeno tipo 1 (85-90%) y una pequeña porción de otras proteínas (10-15%), como proteoglicanos (biglicano, decorita), proteínas implicadas en la adhesión celular (trombospondina, osteonectina, sialoproteína ósea), osteocalcina y factores de crecimiento. El componente inorgánico de la matriz ósea está constituido en su mayor parte por fosfato cálcico en forma de cristales de hidroxiapatita (Serrano, 1998; Gartner et al., 2007; Jadlowiec et al., 2004).

15 4 El tejido óseo está compuesto por células metabólicamente activas, las cuales permiten, dentro de otras cosas, la remodelación ósea de forma continua. Estas células son: las células precursoras osteogénicas, osteoclastos, osteocitos y osteoblastos (Filvaroff et al., 1999). Las células precursoras osteogénicas están presentes en todas las superficies no resortivas del hueso, y ellas forman la capa profunda del periostio, que a su vez conforma la capa externa del hueso, y el endostio el cual se encuentra en la superficie medular interna (Kalfas, 2001). Los osteoclastos son células especializadas cuya actividad biológica es, en conjunto con los osteoblastos, la homeostasis del tejido óseo (Mikán y Oliveros, 2007). Los osteoclastos son células multinucleadas, de citoplasma acidófilo y ricas en anhidrasa carbónica y fosfatasa ácida resistente al tartrato (TRAP) (Serrano, 1998; Raggatt y Partridge, 2010). Esta característica bioquímica está dada por la capacidad que tienen de crear medios ácidos sobre la superficie a la cual se adhieren, en donde liberan enzimas hidrolíticas capaces de degradar tejido calcificado (Mikán y Oliveros, 2007). Los osteoclastos derivan de la célula madre hematopoyética a través de células formadoras de granulocitos y macrófagos (CFU-GM). La proliferación de estas células es activada por el factor estimulante de colonias de macrófagos (M-CSF) (Takahashi et al., 1999). El reclutamiento de los preosteoclastos a partir de las CFU-GM parece ser promovido por la IL-1, IL6 e IL11. Los preosteoclastos son células dotadas de un solo

16 5 núcleo que se adhieren a las superficies óseas y al fusionarse entre sí dan lugar a los osteoclastos (Figura 1) (Serrano, 1998). En conjunto con los osteoblastos, los osteoclastos se encargan de mantener la homeostasis de iones fosfato y calcio, al precipitar (osteoblastos) o liberar (osteoclastos) al medio extracelular los componentes de la matriz ósea (Mikán y Oliveros, 2007).

17 6 Figura 1. Grupo de osteoclastos reabsorbiendo hueso. Obsérvese, la multinucleación de estas células y el aspecto ondulado que, por acción de los osteoclastos, adquiere la superficie ósea adyacente (Tricrómico de Goldner x 500). 1 1 Imagen obtenida en el sitio web

18 7 Los osteocitos (Figura 2), el tercer tipo de célula ósea, son el estado terminal diferenciado de los osteoblastos que están embebidos en la matriz mineralizada, residiendo individualmente en cuevas llamadas lagunas osteocitarias (Aarden et al., 1994; Tatsumi et al., 2007). Los osteocitos se hallan en contacto entre sí y con las células de la superficie (células de revestimiento, osteoblastos) mediante finas prolongaciones tubulares de su citoplasma que recorren la matriz ósea en diversas direcciones (Boyce et al., 2009; Bonewald, 2007). La laguna osteocitaria se prolonga como una red a través de los diminutos canalículos que albergan sus prolongaciones citoplásmicas que reciben el nombre de conductos calcóforos (Serrano, 1998; Burger y Klein-Nulend, 1999). El estudio ultraestructural de los osteocitos revela que presentan un aparato de Golgi y un retículo endoplásmico rugoso menos desarrollado que los osteoblastos. Estas organelas se concentran en el cuerpo celular donde se disponen alrededor del núcleo. En los puntos de contacto entre las prolongaciones citoplásmicas se observan uniones tipo "gap" (gap junctions) (Palumbo et al., 2001). En estas uniones existen pequeños canales intercelulares con un diámetro interno de 1.5 nm. Estos canales permiten el paso directo de una a otra célula de iones inorgánicos y pequeñas moléculas hidrosolubles (aminoácidos, azúcares, nucleótidos y vitaminas) por lo que posibilitan una comunicación química y eléctrica (Serrano, 1998).

19 8 Figura 2. Osteocito en el interior de una laguna. La matriz ósea mineralizada es de color negro y en el margen superior izquierdo de la imagen, se observa cómo una prolongación osteocitaria penetra en el interior de un conducto calcóforo. El citoplasma del osteocito contiene retículo endoplásmico rugoso que es especialmente visible en el segmento superior derecho de la imagen (Microscopía electrónica x 5700). 2 2 Imagen obtenida en el sitio web

20 9 Los osteocitos son células con una escasa actividad metabólica pero su preservación parece necesaria para que el tejido óseo mantenga sus propiedades biomecánicas. La situación de los osteocitos es teóricamente ideal para detectar el estrés mecánico y las microlesiones de la matriz. Estas células podrían transmitir señales a las células de revestimiento que utilizarían la información recibida para modular localmente el remodelado. Durante años se ha discutido acerca de si los osteocitos son o no capaces de inducir la osteólisis de la matriz que los rodea al ser estimulados por la hormona paratiroidea, PTH (osteólisis osteocitaria) (Serrano, 1998). Los preosteoblastos son células de aspecto fibroblástico cercanos a las superficies óseas pero separados de éstos por otros tipos celulares (células del endostio, osteoblastos). Los preosteoblastos son difíciles de identificar en condiciones normales, pero pueden observarse con facilidad si sufren una hiperplasia como por ejemplo en el hiperparatiroidismo. Los preosteoblastos derivan de una célula madre del estroma medular (CFU-F: Unidad Formadora de Colonias de Fibroblastos) y en condiciones normales constituyen el compartimiento proliferativo del linaje osteoblástico (Serrano, 1998). Los osteoblastos son las células que se encuentran en la superficie del hueso que son responsables de la formación ósea (Mackie, 2003). Los osteoblastos maduran desde sus osteoprogenitores que residen en la medula ósea (Hu et al., 2003). Son células de forma cúbica, con núcleo redondo, usualmente encontrado en una capa simple adherida a la superficie del periostio o del endostio en el hueso (Marks y Odgren, 2002). La principal función de los osteoblastos es la secreción de un complejo mixto de

21 10 proteínas a la matriz del hueso (conocida como osteoide), los osteoblastos tienen un predominante complejo de Golgi y abundante retículo endoplásmico rugoso (Mackie, 2003). Los osteoblastos juegan un rol central en la creación y mantención de la arquitectura esqueletal y lo hace de dos maneras: primero, es la responsable del depósito en la matriz ósea y segundo, regula la diferenciación y actividad de los osteoclastos en la reabsorción del hueso. Como consecuencia a su habilidad de regular la actividad osteoclástica, el osteoblasto indirectamente juega un importante rol en la homeostasis de calcio (Mackie, 2003). Los osteoblastos expresan varios tipos de marcadores como el aumento en la actividad de la fosfatasa alcalina, también procesa el pro colágeno a colágeno depositándolo en la matriz junto a proteínas adicionales (por ejemplo osteopontina, sialoproteína ósea y osteocalcina) en el sustrato, el cual es subsecuentemente mineralizado (Suh et al., 2007; Peterson, 1987; Yamaguchi et al., 2000). Tanto in vivo como in vitro los osteoblastos pasan sucesivamente por tres estadios funcionales: a) proliferación celular y síntesis de los componente orgánicos de la matriz ósea, b) maduración de la matriz ósea (cambios en la composición y organización de la matriz que la hacen competente para ser mineralizada) y c) depósito de mineral. In vitro se ha comprobado que estos estadios coinciden con la activación sucesiva de una serie de genes: c-fos, c-jun, histona H4, colágeno tipo I, fibronectina y factor TGF-β (proliferación y síntesis de los componente orgánicos de la matriz ósea); fosfatasa alcalina (maduración de la matriz); sialoproteína ósea, osteopontina y osteocalcina (depósito de mineral) (Serrano, 1998).

22 11 La formación del hueso in vivo ocurre por dos grandes procesos, osificación intramembranosa y endocondral (Gori et al., 2001; Mackie, 2003). La formación de hueso intramembranosa, se originan en el arco-branquial y da lugar a los huesos del cráneo y de la cara (Rodan y Harada, 1997). Las células mesenquimatosas se condensan y directamente se diferencian en células formadoras de hueso, los osteoblastos (Kobayashi y Kronenberg, 2005). En cambio, el resto del esqueleto se basa en la osificación endocondral, donde las células mesenquimatosas se condensan y se convierten en condrocitos. Este molde de cartílago es reemplazado en un largo proceso, donde la invasión vascular es seguida por el depósito de hueso mineralizado formando hueso maduro (Kobayashi y Kronenberg, 2005; Rodan y Harada, 1997). Por otra parte las lesiones óseas, como fracturas, muestran en su caracterización histológica, la participación de ambos procesos de osificación en su recuperación, la intramembranosa y la endocondral con la subsiguiente formación de un callo (Einhorn, 1998; Dimitriou et al, 2005). Aunque la formación de hueso endocondral in vivo e in vitro ha sido foco de varios estudios, las señales moleculares que controlan estos procesos aún no se definen. La familia del factor de crecimiento transformante β (TGF-β) juega un rol central en la regulación de un amplio espectro de respuestas celulares incluyendo crecimiento celular y diferenciación (Attisano y Lee-Hoeflich, 2001). Miembros de esta familia incluye TGF-βs, activinas, proteínas morfogenéticas del hueso (BPMs) y otros factores relacionados. Las BPMs fueron originalmente identificadas como moléculas que inducen la formación de hueso y cartílago cuando se implantan en sitios ectópicos en

23 12 ratas. Según estos efectos in vivo, las BMPs regulan el crecimiento y diferenciación de condroblastos y células de la línea celular osteoblástica in vitro y es la responsable de inducir a las células mesenquimales en fenotipos osteoblástico/condrocito. La acción de TGF-β en la formación de hueso tiene partes confusas porque efectos divergentes han sido reportados en ambos in vivo e in vitro dependiendo de las condiciones experimentales, las células empleadas y su estado de maduración. TGF-β1 ha sido demostrada tanto para estimular como para inhibir la formación de hueso, y afectar diferencialmente distintos marcadores osteoblásticos in vitro (Spinella-Jaegle et al., 2001). La superfamilia del factor de crecimiento transformante beta (TGF-β) agrupa a más de 30 miembros relacionados estructuralmente, e incluye dos subfamilias principales: 1) la familia de los TGF-βs y las activinas; y 2) la familia de las proteínas morfogenéticas de hueso (BMPs) y los factores de crecimiento y diferenciación (GDFs) (Janssens et al., 2005; de Caestecker, 2004). El TGF-β es una familia de citoquinas multifuncionales que regulan el crecimiento, diferenciación, apoptosis y acumulación de matriz de variadas células (Miyazono et al 2004). Este factor es más abundante en la matriz ósea comparada con otros tejidos, y es activado en el microambiente del hueso (Miyazono et al, 2004; Ghayor et al., 2005; Selvamurugan et al., 2004).

24 13 La señalización intracelular mediada por TGF-β se inicia con la formación de heterocomplejos del ligando con dos tipos principales de receptores, ambos con actividad de quinasa en residuos de serinas y treoninas, que al ser fosforilados activan a la familia de factores transcripcionales, las proteínas Smads (Ghayor et al., 2005). Los Smad activado por receptor (R-Smads), al ser fosforilados activan la vía de señalización canónica Smad, resultando en la translocación nuclear del complejo R- Smad/Smad4. Este regula respuestas transcripcionales a través de interacción directa con ambos tipos de elementos activadores cis y trans, asociados con una variedad de genes blancos (Sowa et al., 2002). Los dos principales grupos de R-Smads son activados por un set de receptores TGF- β tipo I y activan distintas respuestas río abajo de la cascada de señalización; el receptor BMP activa las proteínas Smad1, Smad5 y Smad8, y el receptor TGFβ/Activina activa Smad2 y Smad3 (Figura 3) (Janssens et al., 2005; de Caestecker, 2004; Ogasawara et al., 2004).

25 14 Figura 3. Vía de señalización de Smad al núcleo. Las proteínas Smads pueden ser fosforiladas por receptores de TGF-β/Activina o BMP. Una vez fosforiladas, el receptor específico de Smads (R-Smads) se junta con Smad-4 formando un complejo hetero-trimerico y se transloca al núcleo. Una vez en el núcleo, Smads forman diversas asociaciones con cofactores y elementos de unión sitio específico Smad (SBE). Smad-2 y -3 (Smad-2/3) es activado con señales desde el ligando TGF-β/Activin, mientras que Smad-1, -5, y -8 (Smad-1/5/8) son activados desde el ligando BMP. Para cada grupo R-Smad, se haya un inhibidor Smad (I-Smad): Smad- 6 preferentemente inhibe a Smad-1/5/8 y Smad-7 preferentemente inhibe Smad-2/ Owens P. et al, 2008

26 15 No obstante, hay estudios que demuestran la activación de vías alternativas a Smad. Estas señales podrían mediar y/o posiblemente aumentar su efecto haciendo sinergia o podrían también activar distintas respuestas dependiendo del tipo celular. Las vías alternativas activadas por TGF-β corresponden a la vía de señalización de las proteínas quinasa activada por mitógenos (MAPK) (de Caestecker, 2004; Mulder, 2000), la fosforilación de miembros Jun, Fos y la familia de factores de trascripción ATF, las cuales homo y heterodimerizan para formar la proteína activada 1 (AP-1) (de Caestecker, 2004), en una amplia variedad de células como por ejemplo células epiteliales intestinales, de pulmón, de carcinoma humano de colon, osteoblásticas, etc. En células de mamíferos, la familia de las proteínas activadas por mitógenos (MAPK) proporciona un link entre los receptores unidos a la membrana y los cambios en el patrón de expresión génica. Las MAPK son activadas río abajo de diferentes tipos de receptores incluyendo receptores tirosina quinasa, receptores de citoquinas y receptores acoplados a proteína G (Symone et al., 2005). La familia MAPK está compuesta por las proteínas ERK1/2, p38 MAPK y JNK. Las proteínas ERK1/2 son activadas upstream o río arriba por las proteínas MEK1/2 (Roux y Blenis, 2004), y se expresan ampliamente en todos los tejidos. ERK1/2 son activadas por variados estímulos, como por ejemplo factores de crecimiento, ésteres de forbol, ligandos de receptores acoplados a proteína G, estrés, etc. (Roux y Blenis 2004).

27 16 La fosforilación de ERK 1/2 regula la expresión y fosforilación de factores de transcripción de las familias fos y jun, los cuales conforman la proteína activante 1 (AP- 1) que controlan la transcripción río abajo de genes con promotores que contienen sitios de unión AP-1, así como la fosforilación de Runx2/Cbfa1 (Xiao et al., 2002; Xiao et al., 2000). p38 MAPK, es activada por fosforilación dual en residuos Tyr y Thr en el motivo Thr-Gly-Tyr por las proteínas MAP quinasa quinasa 3/6 (MKK3/6) (Garrington y Johnson, 1999). p38 MAPK es activada principalmente en respuesta a condiciones de estrés y participa en diversos tipos de células en arresto del ciclo celular e inducción de apoptosis, mientras que en otras induce diferenciación y proliferación (Roux y Blenis, 2004). Las proteínas JNK están implicadas en respuestas de estrés celular y participan en expresión génica, supervivencia, proliferación y apoptosis en respuesta a citoquinas y factores de crecimiento (Figura 4). La señal extracelular regulada por quinasa (ERK), un miembro de la cascada de las MAPK, transmite información sobre el medio extracelular al núcleo y desempeña un papel crítico en la diferenciación de los osteoblastos y el desarrollo del esqueleto (Khatiwala et al., 2009; Lai et al., 2001).

28 17 Estímulos Factores de crecimiento Citoquinas Estrés Celular Kinasas río arriba Ras Raf MEK MEKKs MKKs MAP Kinasa ERK JNK/p38 Respuesta Proliferación Diferenciación Supervivencia celular Inflamación Muerte celular Figura 4. Vías de activación de las MAPKs. 4 4 Adaptado de: Cooper G The cell. Amolecular Approach. Second Edition. Ed Sinauer Associates Inc. Sunderland, MA

29 18 In vivo, se ha demostrado, que TGF-β está mayormente en la matriz ósea, almacenado en forma inactiva liberándose desde la matriz y activándose con el microambiente óseo, (Ghayor et al., 2005; Centrella et al., 1994; Jennings y Mohan, 1990; Sowa et al., 2002) producto de esto, y de la seguidilla de eventos ya mencionados, se produce la activación de factores de trascripción como Runx2/Cbfa1 y/o osterix, llevando a un aumento en la expresión de genes específicos de osteoblastos como son la fosfatasa alcalina (ALP), osteocalcina (OC), sialoproteína ósea y osteopontina (OPN) (Chung-Fang y Cheng, 2002; Murray, 1994; Logothetis y Lin, 2005; Tsiridis y Giannoudis, 2006). También se sabe que Ras es un efector río arriba de fos y MAPK, y que elementos de respuesta a AP-1 están presentes en el promotor de la mayoría de las proteínas óseas como colágeno tipo I, osteocalcina, osteopontina y fibronectina (Lai y Cheng, 2002). Por otra parte, también hay datos que sugieren que las prostaglandinas, juegan un rol importante en la reparación por lesión en el hueso, siendo fundamental para la síntesis de éste, la enzima ciclo-oxigenasa 2 más conocida como COX-2 (Einhorn, 2002).

30 19 Ciclo-oxigenasa 2 (COX-2) Ciclo-oxigenasa (COX) también conocida como prostaglandina sintasa, es la enzima clave en la síntesis de prostaglandinas (Wadleigh y Herschman, 1999). La síntesis de prostaglandinas (PG) es iniciada con la liberación de ácido araquidónico desde la membrana de los fosfolípidos. La subsiguiente conversión de ácido araquidónico a prostaglandina H2 es catalizada en dos pasos por la ciclo-oxigenasa. Enzimas sintasa entonces convierten PGH2 a prostaglandinas especificas como son PGD2, PGE2, PGF2α, prostaciclina y tromboxano (Figura 5) (Einhorn T., 2002; Smith y Song, 2002). Dos distintas ciclo-oxigenasas han sido identificadas, las cuales son codificadas por genes separados. COX-1 es expresada constitutivamente en muchos tejidos. Por el contrario, más recientemente se ha identificado que el mensajero de COX-2 es expresado en niveles basales muy bajos en muchos tejidos, pero es rápidamente y transientemente inducida por una amplia variedad de mitógenos, hormonas y otros ligandos, estando también involucrada en la producción de PG en la inflamación y en otras respuestas agudas (Wadleigh y Herschman, 1999; Herschman et al., 1995; Xu et al., 2007). COX-2 es inducida por una diversidad de estímulos, incluyendo inflamación, lesión y estrés mecánico (Einhorn, 2002; Topper et al., 1996; Muscara et al., 2000).

31 20 Figura 5. Síntesis de prostaglandinas a partir de la liberación de ácido araquidónico desde los fosfolípidos de la membrana. La fosfolipasa A2 libera desde la membrana celular al ácido araquidónico, el cual por medio de las enzimas COX-1 y COX-2 es transformado a prostaglandinas, tromboxano A2 y prostaciclina (PGI 2 ).

32 21 La región promotora del gen de COX-2 de ratón, rata, y humano han sido clonados y secuenciados. A pesar de las especies animales estas regiones promotoras contienen una caja TATA canónica y varios elementos regulatorios transcripcionales putativos, como CRE, NF-IL6 (C/EBPß), AP2, SP1, NF-ĸB y caja GATA (Figura 6) (Yamamoto et al., 1995; Chun y Surth, 2004; Hinz y Brune, 2002). NF-κB es el nombre colectivo de factores de transcripción diméricos de la familia de proteínas Rel que incluye RelA (p65), c-rel, RelB, NF-κB1 (p50), and NF-κB2 (p52). La forma más abundante encontrada en células estimuladas es el heterodímero RelA/NF-κB1 (p65/p50), más a menudo referido como el clásico NF-κB (Brown et al., 2008; Jimi et al., 1998). En células no estimuladas, NF-κB reside en el citoplasma en forma latente, y debe translocarse al núcleo para su función. La retención citoplasmática de NF-κB es mantenida por interacción con proteínas inhibitorias conocidas como IκB. La estimulación lleva a la fosforilación y posterior degradación proteosomal de IκB, permitiendo a la forma activa NF-κB entrar al núcleo e iniciar la transcripción (Makarov, 2001; Siebenlist et al., 1994; Baldwin, 1996). El rol de COX-2 en la reparación de hueso, ha tomado auge, porque se ha visto que drogas que inhiben la producción de prostaglandinas también inhiben la recuperación de las fracturas. Los antiinflamatorios no esteroidales serían uno de los medicamentos involucrados, no así los no antiinflamatorios no esteroidales (Einhorn, 2002; Simon et al., 2002; Simon y O'Connor, 2007).

33 22 Figura 6. Vías de señalización que median la inducción de COX-2. Distintos set de quinasas, incluyendo MAPKs pueden activar distintos factores de trascripción (NF-kB, AP-1, C/EBP, etc.), que a su vez llevan a la inducción positiva de COX Tomado de Signal transduction pathways regulating cyclooxygenase-2 expression: potential molecular targets for chemoprevention K.-S. Chun, Y.-J. Surh / Biochemical Pharmacology 68 (2004)

34 23 Andrografólido El uso de hierbas medicinales para el tratamiento de diversas enfermedades es uno de los focos actuales de la medicina moderna por las distintas propiedades que presentan y por la disminución de los efectos secundarios con respecto a los medicamentos usados en la medicina tradicional. Las plantas herbales han sido ampliamente usadas como remedios caseros, por ejemplo, en Asia, se han utilizado por más de dos milenios. Hasta el día de hoy, algunos de ellos aún no pierden popularidad como por ejemplo, la planta Andrographis (Andrographis paniculata) que ha sido usada largamente como remedio casero para aliviar los desordenes inflamatorios en China, India, Corea y Japón. Es prescrita para tratamientos de laringitis, diarrea, artritis reumatoide, cólicos, fiebre, resfríos, hepatitis virales y dolor de colon entre otras. (Xia et al., 2004; Tsai et al., 2004; Puri et al., 1993; Batkhuu et al., 2002) El extracto de Andrographis paniculata es conocido por contener dipertenoides, flavonoides y esteroides (Siripong et al., 1992). Los principales componentes de Andrographis paniculata son las lactonas diterpénicas de las cuales el andrografólido es el mayor componente y constituye el 70% de la fracción de los extractos de la planta (Siripong et al., 1992). Andrografólido (AP) es aislado desde las partes aéreas de la planta (hojas y tallos) y el extracto etílico, como los purificados, estimulan la respuesta inmune específica y la no específica en ratones (Kumar et al., 2004).

35 24 Estudios revelan que andrografólido es capaz de disminuir la glucosa en ratas diabéticas inducidas con estreptozotocina (Yu et al., 2003); es capaz de disminuir la producción de óxido nítrico estimulado con LPS en macrófagos (Batkhuu et al., 2002) y la supresión de óxido nítrico sintasa inducido (inos) en células RAW (Chiou et al., 2000); inhibiría la agregación plaquetaria inhibiendo la fosforilación de la MAPK ERK 1/2 (Thisoda et al., 2006), también inhibiría la producción de TNF-α por la inhibición de la vía ERK 1/2 no así las vías JNK, p38 (Qin et al., 2006). Asimismo, hay estudios que indican que andrografólido reduce la activación de NF-κB y la expresión de COX-2 inducido por PAF y fmlp en HL-60/neutrófilos (Hidalgo et al., 2005). Sin embargo, estudios preliminares de nuestro laboratorio indican que en la línea celular osteoblástica MC3T3-E1, andrografólido aumenta la expresión de COX-2 inducida por TNF-α y TGF-β. Datos bibliográficos expresados anteriormente, muestran que la vía MAPK está involucrada en la síntesis de COX-2 y en una amplia variedad de respuestas celulares, sugiriendo además para COX-2 una participación relevante en el proceso de regeneración ósea causada por algún traumatismo. Ante esto se ha planteado la siguiente hipótesis de trabajo Andrografólido, vía la activación de MAPK, provoca un aumento de la expresión de COX-2 favoreciendo la diferenciación osteoblástica de la línea celular MC3T3-E1. Por lo tanto los objetivos específicos de la presente tesis son:

36 25 Determinar si la estimulación de las células MC3T3-E1 con andrografólido induce una estimulación de las vías MAPK. Determinar el rol de la vía MAPK en el aumento de COX-2 Determinar si hay un aumento en la producción de fosfatasa alcalina (ALP) y en la mineralización de las células osteoblásticas. Determinar si andrografólido estimula factores de trascripción como NF-kB y AP-1.

37 26 3. Materiales y Métodos 3.1 Materiales Material Biológico: Línea celular osteoblástica de ratón MC3T3-E1 subclon 4 de la ATCC, número de catálogo CRL-2593 TM Reactivos Químicos: De AMRESCO Life Science Research Products & Biochemicals (Solon, Oho, USA) se obtuvo albumina de suero bovino (BSA). De BD Biosciences Pharmingen TM (San Diego, california, USA) se obtuvo el kit FITC Annexin V Apoptosis Detection Kit I. De Calbiochem (La Jolla, California, USA) se obtuvo lo siguiente: p-nitrofenilfosfato y ortovanadato de sodio (Na 3 VO 4 ). De Cayman Chemical (Michigan, USA) se obtuvo el anticuerpo anti COX-2 murino. De Cell Signaling (Boston, MA, USA) se obtuvieron los siguientes anticuerpos: anticuerpos anti-p-erk1/2, anti-p-p38, anti-p38, anti-pakt, anti-akt. De Gibco Laboratories Life Technologies, Inc. (Rockville, MD, USA) se obtuvo el medio minimo esencial alfa (α-mem).

38 27 De Invitrogen (Grand Island, NY, USA) se adquirieron los siguientes reactivos: TEMED, anticuerpo anti-igg de ratón conjugado a Alexa fluor 488 (verde), ioduro de propidio, soluciones dctp, datp, dtto, dgtp. De MBI Fermentas (Hanover, Maryland (MD), USA), se obtuvo el estándar de peso molecular preteñido para geles de poliacrilamida-sds. De Merck & Co, Inc. (Darmstadt, Germany), fueron adquiridos los siguientes reactivos: Persulfato de sodio, Fluoruro de sodio, PMSF, azul de bromofenol, Etanol grado biología molecular, cloruro de sodio (NaCl), cloruro de potasio (KCl), hidróxido de sodio (NaOH), glicerol, cloruro de magnesio (MgCl 2 ), fosfato hidrógeno de disodio (Na 2 HPO 4 ), fosfato dihidrogeno de sodio (NaH 2 PO 4 ), fosfato dihidrógeno de potasio (KH 2 PO 4 ). De Perkin Elmer Life and analitical Science (Massachusetts, USA) se obtuvo el kit de quimioluminiscencia para Western blot, Western Lightning ECL, Enhanced Chemiluminescence. De PlusOne Pharmacia Biotech (USA) se obtuvo el Triton X-100. De Promega (Madison, WI, USA) se obtuvieron los siguientes reactivos: Tampón de lisis pasivo, acrilamida, UO126, LY294002, SB203580, oligo-dt 15 primer, tampón M- MLV RT 5X, transcriptasa reversa M-MLV. De QIAGEN USA (Hilden, Germany) se obtuvo el kit QIAGEN RNAeasy plus. De Roche Diagnostic (Indianápolis, IN, USA) se obtuvo lo siguiente: leupeptin, aprotinin y pepstatin.

39 28 De Santa Cruz Biotechnology (Santa Cruz, California, USA) se obtuvieron los anticuerpos anti-erk1/2 (sc-94), anti-ikbα, Anti NF-ĸB p65, anti-igg rabbit unido a peroxidasa y anti-igg mouse unido a peroxidasa. De Sigma-Aldrich Co (St. Louis, MO, USA) se obtuvieron los siguientes reactivos: Nonidet P-40 (IGEPAL), piruvato de sodio, Tween-20, ß-mercaptoetanol, dimetilsulfóxido (DMSO), ß-glicerofosfato, Alizarin Red S, Hexadecylpyridinium Chloride monohydrate, 2-amino-2-metil-1-propanol (AMP), Histochoice, anticuerpo anti ß-actina, partidores para COX- 2 y GAPDH. De Stratagene (La Jolla, CA, USA) se obtuvo el kit para PCR en tiempo real QPCR Master Mix Brilliant II SYBR Green. De TCL Ltda. (Santiago, Chile). Se obtuvo el etanol y metanol. De Thermo Scientific Hyclone (Madrid, España), fueron obtenidos los siguientes reactivos: suero fetal bovino, glutamina, tripsina 0.25% (1X) y penicilina/estreptomicina. De US Biological (Massachussets, USA) se obtuvieron los siguientes reactivos: Tris- Base, EDTA, glicina y SDS. De Vector Laboraties (California, USA) se obtuvo el medio de montaje para fluorescencia (VECTASHIELD Mounting Medium). De Winkler (Santiago, Chile) se obtuvo el reactivo de Bradford 5X.

40 29 Los equipos utilizados para el desarrollo de la parte experimental fueron los siguientes: Centrífuga Eppendorf 5702, centrífuga Mikro 22RE, baño termorregulado Memmert, Balanza analítica Scientech, Espectrofotometro UV-1700 Pharma Spec (Shimadzu), Lector de microplacas Tecan Sunrise, sistema de electroforesis Mini Protean III y sistema de transferencia Mini Trans Blot de Bio Rad, microscopio Olympus BX51, Incubador de CO 2 (Sanyo), Gabinete de Flujo laminar (ESCO Global), cámara de Neubauer, Microscopio Olympus CKX41, Shaker Lab Companion SI-600, Orbital Shaker SO3 Stuart Scientific, Citómetro de flujo BS FACSCANTO TM II, phmetro HANNA, Vortex MAXI-MIX II Barnstead thernoline, MICROSON TM ultrasonic cell disruptor misonix, fuente de poder Bio-Rad Power PAC 200, Equipo para PCR en tiempo real MX 3000p (Stratagene), equipo para PCR convencional Gene Amp PCR System 2400 (Perkin Elmer), NanoDrop 2000.

41 Métodos: Cultivo de la línea celular osteoblástica de ratón MC3T3-E1 Las células osteoblásticas fueron mantenidas con medio esencial mínimo alfa (α MEM) con ribonucleótidos y desoxirribonucleótidos (GIBCO No. Catálogo ), 2mM de L- glutamina, piruvato de sodio 1mM, suero fetal bovino al 10% y penicilina/estreptomicina al 1%, a una temperatura de 37º C y con un porcentaje de dióxido de carbono del 5%. Para el subcultivo celular, el medio fue removido y las células fueron lavadas con PBS 0.1M (1X) estéril, se adicionó tripsina al 0.25%, una vez sueltas las células, la tripsina fue neutralizada con medio completo (α MEM). Las células eran centrifugadas a 2000 g por 6 minutos descartando el sobrenadante y resuspendiendo el pellet en medio completo para su conteo bajo un microscopio invertido. En una placa de 60 mm se dejaba una cantidad de células hasta que alcanzaran aproximadamente un 70% de confluencia. Una vez logrado esto, el medio fue cambiado por medio completo con suero fetal bovino al 2%, a una temperatura de 37º C y 5% de CO 2, 16 a 18 horas antes de realizar el experimento.

42 Viabilidad de la línea celular osteoblástica MC3T3-E1 mediante citometría de flujo. Las células fueron crecidas a confluencia, se les cambio el medio horas antes del experimento y se estimularon con andrografólido 10, 50 y 100 µm respectivamente por 1, 2 y 10 días. Las células fueron tripzinizadas, contadas y resuspendidas en tampón de unión a una concentración de 2 mill/ml, siguiendo posteriormente el protocolo de marcaje (con ioduro de propidio y Anexina V) del kit Determinación del efecto de andrografólido sobre las vías de señalización MAPK en la línea celular osteoblástica MC3T3-E x 10 5 células fueron incubadas con andrografólido 50 µm a distintos tiempos (0, 15, 30, 60, 120 y 180 minutos) o con vehículo (0.2% DMSO). Posteriormente, las células fueron lavadas con PBS 1X, lisadas con tampón de lisis y los extractos proteicos fueron sometidos a Western blot, utilizando los anticuerpos fosfo ERK 42/44, fosfo p38 y fosfo Akt (Ser473). Como control de carga se utilizaron los respectivos anticuerpos anti ERK1 total, p38 total, y β-actina post stripping.

43 Determinación del rol de la vía MAPK en el aumento de la proteína COX-2 en la línea celular osteoblástica MC3T3-E x 10 5 células fueron preincubadas con los inhibidores U0126 (inhibidor de la vía MEK1 y MEK2), (inhibidor de la vía p38 MAP quinasa) y LY (inhibidor de la vía PI3K) por 30 minutos y posteriormente con andrografólido 50 µm o con vehículo (0.2% DMSO) por 9 horas para determinar si hay aumento en la expresión de COX-2. Posteriormente, las células fueron lavadas con PBS 1X, lisadas con tampón de lisis y los extractos proteicos fueron sometidos a Western blot, utilizando el anticuerpo policlonal COX-2 (murino). Como control de carga se utilizó el anticuerpo β-actina post stripping Determinación del efecto de andrografólido sobre la expresión del RNAm de COX-2 en presencia de inhibidores. 2.5 x 10 5 de osteoblastos fueron preincubados por 30 minutos con vehículo (0.2% DMSO) o con los inhibidores UO126, SB o LY y posteriormente estimulados con andrografólido 50 µm durante 6 horas. Posteriormente, se aisló el mrna de las células, con el kit Quiagen, para el análisis de la expresión de COX-2 mediante PCR en tiempo real (RT-PCR). Como control se utilizó gliceraldehido-3-fosfato deshidrogenada (GAPDH).

44 Determinación de la producción de fosfatasa alcalina en la línea celular osteoblástica MC3T3-E1. Las células fueron crecidas a confluencia y estimuladas con andrografólido 10 y 50 µm o con vehículo (0.2% DMSO) durante 14 días. Una vez pasado este tiempo, las células fueron lavadas con PBS 1X frío y lisadas usando tampón de lisis pasivo Promega durante 5 minutos en hielo. El lisado fue homogeneizado y sonicado por 20 segundos a 4ºC. En una placa de 96 posillos se colocó 100 µl de la muestra, 50 µl de la solución tampón 2-amino-2-metil-1-propanol (AMP) 0.5M a ph 10.3 con MgCl 2 2mM y 50 µl de la solución sustrato p-nitrofenil-fosfato 10 mm. Se incubó a 37ºC por 30 minutos, se detuvo la reacción con 100 µl de NaOH 3M y se leyó la absorbancia en el lector de placas a 405 nm Determinación de la mineralización en la línea celular osteoblástica MC3T3- E1 mediante la tinción rojo alizarina. Las células fueron crecidas en placas de 6 posillos. Una vez alcanzada la confluencia, se les suplementó el medio de cultivo con β-glicerofosfato 10 mm y posteriormente fueron estimuladas con andrografólido 10 µm, 50 µm o con vehículo (0.2% DMSO) respectivamente durante 14 días. Después de este tiempo, las células fueron fijadas con etanol frío al 70% por 1 hora, teñidas con rojo alizarina 40 mm a ph 4.2 por 10 minutos y lavadas con PBS 1X para eliminar el exceso. Para liberar el rojo alizarina se

45 34 incubó con cloruro de cetilpiridinio al 10% en fosfato de sodio 10 mm a ph 7.0 por 15 minutos. La absorbancia fue leída a 562 nm Análisis del efecto de andrografólido sobre los factores de transcripción NFĸB y AP-1 en la línea celular osteoblástica MC3T3-E x 10 5 células fueron preincubadas con andrografólido 50 µm a distintos tiempos (0, 15, 30, 60 y 120 minutos) o con vehículo (0.2% DMSO). Posteriormente, las células fueron lavadas, lisadas con tampón de lisis y los extractos proteicos fueron sometidos a Western blot, utilizando los anticuerpos anti IĸB-α y anti c-fos. Como control de carga se utilizó el anticuerpo anti ERK1 total, post stripping Extracción de proteínas totales Las células fueron lavadas con PBS 1X y se le agregó 80 µl de tampón de lisis (tris HCl 50 mm a ph 7.4, EDTA 1 mm, NaF 10 mm, Na3VO4 1 mm, PMSF 1 mm, Nonidet P-40 al 0.5%, KCl 100 mm, y 10 ug/ml de inhibidores de proteasas: leupeptin, aprotinin, pepstatin), siendo mantenidas en hielo durante 5 minutos. La placa fue raspada con un rastrillo estéril, y el contenido fue colocado en un tubo Eppendorf por 15 minutos en hielo. Para su homogeneización final, el tubo fue vortexeado y sometido a centrifugación a x g por 20 minutos a 4º C. El sobrenadante fue rescatado y cuantificado por el método de Bradford.

46 Separación electroforética de proteínas La separación electroforética de proteínas se realizó en geles de poliacrilamida en condiciones denaturantes (SDS-PAGE), en el sistema de electroforesis Mini Protean III (BIO RAD ). El gel separador y espaciador de 1,5 mm de grosor, se prepararon a partir de una solución de acrilamida-bisacrilamida 30%-0,8%. Los geles se prepararon de acuerdo al tamaño de proteína a detectar, utilizando geles a una concentración final de poliacrilamida del 12%. El gel separador contenía, Tris-HCl 375 mm (ph 8.8), SDS 0.1 %, persulfato de amonio 0.03% y TEMED 0,03%. El gel espaciador se preparó a una concentración del 4 % de acrilamida incluyendo Tris 125 mm (ph 6.8), SDS 0.1%, persulfato de amonio 1% y TEMED 0.04%. A las muestras de proteínas totales se les agregó SDS 20%, β-mercaptoetanol y tampón muestra 5X (SDS 5%, glicerol 50%, azul de bromofenol 0.05% y Tris-HCl M ph 6.8). Luego éstas fueron cargadas en el gel, realizándose la electroforesis en tampón de corrida (Tris base 25 mm, glicina 190 mm y SDS 0.1%) a un voltaje constante de 80 V por aproximadamente 2 horas Electrotransferencia Una vez terminada la electroforesis, las proteínas fueron transferidas a una membrana de nitrocelulosa. Para esto, sobre una esponja embebida en tampón de transferencia (Tris base 25 mm, glicina 200 mm y metanol 20%) se depositaron secuencialmente: un trozo de papel filtro, la membrana de nitrocelulosa, el gel a transferir y luego otro papel filtro, todo lo cual se cubrió con otra esponja embebida en la misma solución. Esto se

47 36 colocó en una cámara de electrotransferencia conteniendo el tampón mencionado y se aplicó una intensidad de corriente de 200 ma por 2 horas. Transcurrido este tiempo, la membrana se utilizó para análisis de Western blot Análisis de Western blot La membrana fue incubada con 7 ml de solución de bloqueo (TBS 1x, 0.1% Tween-20 con 5% p/v de leche descremada) por una hora con agitación constante, luego fue incubada con los anticuerpos primarios correspondientes y a la dilución adecuada por toda la noche a 4 ºC con agitación constante. Al día siguiente la membrana fue lavada 3 veces con TBS-T (TBS 1X, 0.1% Tween-20) durante 5 minutos a temperatura ambiente con agitación y por último se incubó con el anticuerpo secundario conjugado a peroxidasa, IgG anti-conejo o IgG anti-ratón según corresponda por una hora y media. Concluida la incubación con el anticuerpo secundario la membrana fue lavada 3 veces con TBS-T durante 5 minutos a temperatura ambiente con agitación. El revelado se efectuó por quimioluminiscencia (ECL), el cual se basa en la emisión de luz no radiactiva. Este método detecta antígenos inmovilizados unidos directa o indirectamente con anticuerpos conjugados con peroxidasa. El resultado se obtiene al mezclar partes iguales de dos reactivos, obteniéndose una solución de peróxido de hidrógeno y luminol que se vierte sobre las membranas, dejándose actuar por 1 minuto y secando el exceso con papel filtro. Luego se expone en un film el resultado de la excitación del luminol. Finalmente, se detiene la reacción al retirar la película de la membrana, procediendo a su revelado con reactivo D72 y su fijación con reactivo U3.

48 37 Para estandarizar los resultados que se obtuvieron de este procedimiento, las mismas membranas se utilizaron para detectar las proteínas totales (ERK, Akt y p38) o β-actina. Para ello previamente se incubaron con solución stripping (2-mercaptoetanol 100 mm, SDS 2%, tris-hcl 62.5 mm a ph 6.7) durante 1 hora a 50ºC con agitación constante. Después se lavó la membrana con TBS-T cada 10 minutos por 1 hora hasta eliminar el β-mercaptoetanol. Luego, se siguió el procedimiento utilizado para el primer anticuerpo. Las señales obtenidas en el film, son escaneadas y analizadas densitométricamente Inmunofluorescencia Las células previas al tratamiento fueron colocadas sobre covers de vidrio de 18 mm de diámetro. Posterior al tratamiento, estas fueron fijadas con Histochoice (diluido 4:1 con etanol 100%) sobre portaobjetos de vidrio durante 10 minutos, lavadas 3 veces en PBS 1X, y permeabilizadas durante 15 minutos con Tritón X-100 al 0,3% en PBS 1X, de manera de facilitar el acceso a antígenos intracelulares. Luego de 3 lavados en PBS 1X los preparados celulares fueron incubados durante 1 hora a temperatura ambiente con solución de bloqueo (BSA 1% y leche descremada 5% en PBS 1X). En esta misma solución fueron incubadas las muestras con el anticuerpo primario de NF-κB/p65 a una dilución 1:200 durante toda la noche a 4ºC. Posteriormente los covers fueron lavados 3 veces en PBS 1X e incubados durante dos horas con un anticuerpo secundario antiratón conjugado a Alexa Fluor 488 a una dilución 1:500 en solución de bloqueo a temperatura ambiente en oscuridad. Los núcleos fueron teñidos con ioduro de propidio

49 µg/ml durante 2 minutos. Las muestras fueron montadas con medio de montaje para fluorescencia y visualizadas utilizando un Microscopio Olympus BX Transcripción reversa - reacción en cadena de la polimerasa en tiempo real (RT-PCR) Se analizó la expresión de los mrnas de COX- 2 y GAPDH para lo cual se aisló RNA total de osteoblastos preincubados con los inhibidores UO126, SB y LY y tratados con andrografólido (50 µm). El RNA fue aislado utilizando el kit RNeasy plus Mini Kit de QIAGEN, según el procedimiento recomendado por el fabricante. Posteriormente se cuantificó el RNA a 260 nm, y la pureza fue analizada determinando la razón 260/280 nm, con el instrumento NanoDrop La síntesis de cdna se realizó a partir de 1 µg de RNA total, 0.5 µg de oligo-dt, siendo esto preincubado por 5 minutos a 70 C, se sacó la muestra, se dejó enfriar en hielo, se adicionó 4 µl tampón 5X, dntps 1 mm, 200 unidades de transcriptasa reversa y se completó con agua nanopura a un volumen final de 20 µl. La reacción de amplificación fue 10 segundos a 25 C, 50 minutos a 42 C y 15 minutos a 70 C. Posteriormente, la reacción de PCR se realizó con 2 µl de cdna, 5 µm (2µl) de cada partidor, 6 µl de agua y 10 µl de Master Mix 2X (Stratagene). Los partidores COX-2 utilizados fueron: COX-2 sense 5 TGGAAAAGGTTCTTCTACGGA 3 y antisense 5 TGAACCCAGGTCCTCGCT 3.

50 39 La conducción del PCR en tiempo real fue 95 C por 10 minutos por 1 ciclo, 95 C por 15 segundos y 57 C por 15 segundos, y 72 C por 20 segu ndos por 40 ciclos, y 95 C por 10 segundos, 70 C por 1 segundo y 95 C por 1 segund o por 1 ciclo. Como control interno se utilizó la amplificación de gliceraldehído-3-fosfato deshidrogenasa (GAPDH) de ratón con los partidores: GAPDH sense 5 -GACAACTTTGGCATTGTGG -3, y GADPH antisense 5 - ATGCAGGGATGATGTTCTG Análisis estadísticos Los resultados fueron expresados en gráficos de barras como promedio ± error estándar. El análisis de los datos porcentuales, se efectuaron utilizando la transformación arcoseno, análisis de varianza (ANDEVA) y un test de comparaciones múltiples de Dunnet. En el caso de los datos expresados como razón estos fueron analizados por ANDEVA y un test de comparaciones de Dunnet. En ambos casos se utilizó un nivel de significancia del 5 %. Todos los análisis fueron realizados con el software GraphPad Prism versión 3.00 para Windows, GraphPad Software TM (San Diego California, USA).

51 40 4. Resultados. 4.1 Viabilidad Celular de la línea osteoblástica MC3T3-E1 en presencia de andrografólido. Para analizar el efecto citotóxico de andrografólido se realizó un marcaje con Anexina V-FITC y ioduro de propidio, el cual hace posible diferenciar las células apoptóticas (V+/IP-) de las necróticas (V+/IP+ doble positivo) y esto se analizó por citometría de flujo. Las células fueron incubadas con andrografólido 10, 50 y 100 µm durante 6 horas usando como control positivo ácido butírico 10 mm. Los resultados mostraron que en las células control (Figura 7 A) hay un 93.7% de células vivas, un 1.6% de células apoptóticas y un 4.9% de células necróticas; las células tratadas con ácido butírico (Figura 7 B) mostraron que hay 94.6% de células vivas, un 1.9% de células apoptóticas y un 3.6% de células necróticas, mientras que en los tratamientos con andrografólido se observó lo siguiente: con andrografólido 10 µm (Figura 7 C) presentó un 92% de células vivas, un 0.9% de células apoptóticas y un 7.3 % de células necróticas, con andrografólido 50 µm (Figura 7 D) presentó un 94.1% de células vivas, un 0.9 % de células apoptóticas y un 7.8% de células necróticas, con andrografólido 100 µm (Figura 7 E) presentó un 94.9% de células vivas, un 1.2% de células apoptóticas y un 4% de células necróticas. Estos resultados dan cuenta que la viabilidad celular no se ve afectada en presencia de andrografólido 10, 50 y 100 µm por un tiempo de 6 horas.

52 41 A. B. 4.9% 3.6% 93.7% 94.6% 1.6% 1.9% C. D. 7.3% 7.8% 92% 91.4% 0.9% 0.9%

53 42 4% 94.9% 1.2% E. Figura 7. Viabilidad celular de la línea osteoblástica MC3T3-E1. La viabilidad se midió mediante citometría de flujo, en el cual por un tiempo de 6 horas, las células fueron incubadas en presencia de andrografólido. A) Control tratado con DMSO al 0.2%. B) Control positivo con ácido butírico 10 mm. C) Andrografólido 10 um. D) Andrografólido 50 um. E) Andrografólido 100 um. (Rojo: células vivas; verde: células apoptóticas: azul: células necróticas).

54 Determinación del efecto de andrografólido sobre las vías de señalización MAPK en la línea celular osteoblástica MC3T3-E1. Para determinar si andrografólido producía algún efecto en la vía de Akt (proteína quinasa B) y las vías MAPK, específicamente ERK 1/2 y p38, se realizó una cinética de fosforilación en donde las células fueron incubadas con andrografólido 50 µm a distintos tiempos (0, 15, 30, 60, 120, 180 y 360 minutos). Posteriormente se extrajeron proteínas para realizar la electroforesis y análisis de Western blot respectivamente, tal como se describió en materiales y métodos. Como se aprecia en la Figura 8, la cinética de fosforilación de Akt, en la cual se usó como control de carga Akt total, no presenta cambios estadísticamente significativos a los distintos tiempos analizados. En la cinética de fosforilación de p38 (Figura 9), en la cual se utilizó como control de carga β-actina, tampoco se aprecian cambios estadísticamente significativos con respecto al control (tiempo 0), mientras que en la Figura 10, en donde se analizó la fosforilación de ERK 1/2, usando como control de carga ERK total, se puede apreciar que andrografólido, a los 15 minutos de estímulo, presenta un incremento estadísticamente significativo (p<0.05) con respecto al control.

55 44 A.) M in u t o s B.) p-akt Akt Minutos Figura 8. Análisis de Western blot para la fosforilación de Akt en presencia de andrografólido. Las células MC3T3-E1 fueron incubadas con vehículo DMSO (0.2%) o con andrografólido 50 µm a distintos tiempos (0, 5, 15, 30, 60, 120, 180, 360 minutos, respectivamente). A.) Gráfico de la cinética de fosforilación de Akt en presencia de andrografólido 50 µm a distintos tiempos utilizando como control de carga Akt total. Promedio ± e.e, n= 2 B.) Western blot representativo de lo graficado anteriormente.

56 45 A.) 4 p38/β-actina Minutos B.) p-p38 β-actina Minutos Figura 9. Análisis de Western blot para la fosforilación de p38 en presencia de andrografólido. Las células MC3T3-E1 fueron incubadas con vehículo DMSO (0.2%) o con andrografólido 50 µm a distintos tiempos (0, 5, 15, 30, 60, 120, 180, 360 minutos, respectivamente). A.) Gráfico de la cinética de fosforilación de p38 en presencia de andrografólido 50 µm a distintos tiempos utilizando como control de carga β-actina. Promedio ± e.e, n= 2. B.) Western blot representativo de lo graficado anteriormente.

57 46 A.) 2.0 p-erk/ Erk 1/ * 0.0 T O T 5 T 15 T 30 T 1 T2 T3 B.) ERK 1/2 ERK Total Minutos Figura 10. Análisis de Western blot para la fosforilación de ERK 1/2 en presencia de andrografólido. Las células MC3T3-E1 fueron incubadas con vehículo DMSO (0.2%) o con andrografólido 50 µm a distintos tiempos (0, 5, 15, 30, 60, 120, 180 minutos, respectivamente). A.) Gráfico de la cinética de fosforilación de ERK 1/2 en presencia de andrografólido 50 µm a distintos tiempos utilizando como control de carga ERK total. Promedio ± e.e, n= 3, * p< B.) Western blot representativo de lo graficado anteriormente.

58 Determinación del rol de las vías MAPK en el aumento de COX-2 Para ver el efecto de las vías MAPK en el aumento de COX-2, primero se realizó un Western blot, tal como se describió en materiales y métodos. Se analizó la fosforilación de la vía ERK 1/2 en presencia de andrografólido 50 µm y de los inhibidores UO126, SB y LY Los inhibidores fueron preincubados durante 30 minutos y estimulados durante un tiempo de 15 minutos, el cual fue escogido por ser el tiempo en el cual se vió mayor fosforilación en la cinética realizada anteriormente (Figura 10). Se puede apreciar en la Figura 11 que andrografólido provoca el aumento esperado con respecto al control y que el inhibidor SB presenta por sí solo un aumento en la estimulación de las células osteoblásticas el cual es estadísticamente significativo (p<0.01). En paralelo también se puede apreciar que andrografólido, en presencia del inhibidor UO126 y del inhibidor LY presenta una disminución estadísticamente significativa (p<0.01). El inhibidor SB203580, sin embargo no presenta tal disminución, la cual se puede deber al aumento que presenta por sí solo, provocando un enmascaramiento de su real efecto. De estos resultados se puede abstraer principalmente que la vía ERK 1/2 tiene una participación relevante en el aumento de COX-2 y sugiere que la vía de señalización Akt podría estar participando de una manera no conocida.

59 48 A. 2 p-erk/erk total 1 ** ** ** 0 A P 5 0 µm U O µm S B µm L Y µm B. AP 50 µm UO µm SB µm LY µm

60 49 Figura 11. Efecto de andrografólido en la vía de señalización MAPK ERK 1/2, en presencia de los inhibidores UO126, SB y LY Las células MC3T3-E1 fueron preincubadas con los inhibidores durante 30 minutos y posteriormente incubadas con andrografólido 50 µm durante 15 minutos, tal como se describió en materiales y métodos. Las proteínas fueron separadas por SDS-PAGE e inmunodetectadas utilizando un anticuerpo específico para p-erk 1/2. Como control de carga se utilizó ERK total. (A) El gráfico muestra el análisis densitométrico de las bandas correspondientes a p-erk y ERK total expresado como razón más el promedio ± e.e, n= 4, ** p < (B) Análisis de Western blot de la fosforilación de p-erk 1/2 en presencia de los inhibidores UO126, SB y LY

61 50 Por otra parte se analizó, mediante Western blot, la expresión de COX-2 en presencia de los inhibidores antes mencionados (Figura 12) y se puede apreciar que con el inhibidor UO126 y LY hay una disminución, pero se observó que con el inhibidor SB hay una disminución estadísticamente significativa (p<0.01) con respecto a AP. Ante esto se procedió a realizar un PCR en tiempo real, tal como se describió en materiales y métodos. Como se puede apreciar en la Figura 13, las células osteoblásticas al ser incubadas con los inhibidores UO126, SB y LY en presencia de andrografólido, presentan una disminución estadísticamente significativa (p<0.05, p<0.01 y p<0.01, respectivamente) con respecto a andrografólido 50 µm.

62 51 A. 1.5 Cox-2/β-actina AP 50 µm UO µm SB µm LY µm B. AP 50 µm UO µm SB µm LY µm

63 52 Figura 12. Efecto de andrografólido en la expresión de COX-2, en presencia de los inhibidores UO126, SB y LY Las células MC3T3-E1 fueron preincubadas con los inhibidores durante 30 minutos y posteriormente incubadas con andrografólido 50 µm durante 9 horas, tal como se describió en materiales y métodos. Las proteínas fueron separadas por SDS-PAGE e inmunodetectadas utilizando un anticuerpo específico para COX-2. Como control de carga se utilizo β-actina. (A) Análisis de Western blot de la expresión de COX-2 en presencia de los inhibidores UO126, SB y LY Promedio ± e.e, n= 3, ** p<0.01. (B) El gráfico muestra el análisis densitométrico de las bandas correspondientes a COX-2 y β-actina expresado como razón.

64 53 15 cantidad relativa 10 5 * ** * * 0 AP 50 µm UO µm SB µm LY µm Figura 13. Análisis de RT-PCR en tiempo real para COX-2. Las células MC3T3-E1 fueron preincubadas con los inhibidores UO126, SB y LY durante 30 minutos y posteriormente incubadas con andrografólido 50 µm o vehículo por 6 horas. La expresión de COX-2 fue analizada por medio de RT-PCR en tiempo real usando Brilliant II Sybr Green (Stratagene). El gen GAPDH fue usado como control. El gráfico muestra la cuantificación relativa de 3 experimentos independientes. Promedio ± e.e. *p< 0,05, **p< 0,01 comparado con AP 50 µm.

65 Efecto de andrografólido en marcadores osteogénicos. Las células osteoblásticas mientras alcanzan su nivel de maduración, van expresando marcadores moleculares también conocidos como marcadores osteogénicos. Los marcadores osteogénicos van a depender del estado en el que se encuentra la célula. En estados tempranos se encuentran factores de trascripción como RUNX2 y osterix, mientras que en estados tardíos se encuentran proteínas como sialoproteína ósea, osteopontina, osteonectina, fostasa alcalina entre otras. También se empieza a depositar el calcio en forma de fosfato una vez que la matriz empieza su proceso de mineralización. Por todos estos datos se procedió a determinar la actividad de fosfatasa alcalina y a determinar si el fitofármaco produce o no mineralización en el cultivo celular. Primero, se realizó un análisis de viabilidad celular por un periodo de 10 días. Las células fueron incubadas con andrografólido 50 µm, contadas en cámara de Neubauer, resuspendidas a una concentración de cel/ml y posteriormente examinadas en el citómetro tal como se describe en materiales y métodos. Las células fueron analizadas a los días 1, 2 y 10, respectivamente. Los resultados muestran en el día 1 (Figura 14) que en el control (Figura 14 A) hay un 87.1% de células vivas, un 1.2% de células apoptóticas y un 11.8% de células necróticas, mientras que en los tratamientos con andrografólido se observó lo siguiente: con andrografólido 10 µm (Figura 14 B) presentó un 91.6% de células vivas, un 2.8% de células apoptóticas y un 5.6 % de células necróticas, con andrografólido 50 µm (Figura 14 C) presentó un 92.7% de células vivas, un 2.2% de células apoptóticas y un 5.2% de células necróticas, con andrografólido 100 µm (Figura 14 D) presentó un 93.6% de células vivas, un 1.6% de

66 55 A) B) 11.8% 5.6% 87.1% 91.6% 1.2% 2.8% C) D) 5.2% 4.9% 92.7% 93.6% 2.2% 1.6% Figura 14. Viabilidad celular de la línea osteoblástica MC3T3-E1 a las 24 hrs. Las células fueron incubadas con andrografólido a distintas concentraciones durante 1 día y analizadas posteriormente mediante citometria de flujo. A) Control con vehículo DMSO. B) Andrografólido 10 um. C) Andrografólido 50 um. D) Andrografólido 100 um. (Rojo: células vivas; verde: células apoptóticas: azul: células necróticas)

67 56 células apoptóticas y un 4.9% de células necróticas. Los resultados del día 2 (Figura 15) muestran que en el control (Figura 15 A) hay un 90.8% de células vivas, un 0.5% de células apoptóticas y un 8.8% de células necróticas, mientras que en los tratamientos con andrografólido se observó lo siguiente: con andrografólido 10 µm (Figura 15 B) presentó un 90.7% de células vivas, un 1% de células apoptóticas y un 8.3% de células necróticas, con andrografólido 50 µm (Figura 15 C) presentó un 91.9% de células vivas, un 2.5% de células apoptóticas y un 5.8% de células necróticas, con andrografólido 100 µm (Figura 15 D) presentó un 90.2% de células vivas, un 1.5% de células apoptóticas y un 8.4% de células necróticas. Los resultados del día 10 (Figura 16) muestran que en el control (Figura 16 A) hay un 90.9% de células vivas, un 1% de células apoptóticas y un 8.2% de células necróticas, mientras que en los tratamientos con andrografólido se observó lo siguiente: con andrografólido 10 µm (Figura 16 B) presentó un 75% de células vivas, un 0.3% de células apoptóticas y un 24.8% de células necróticas, con andrografólido 50 µm (Figura 16 C) presentó un 85.9% de células vivas, un 1.2% de células apoptóticas y un 13.1% de células necróticas, con andrografólido 100 µm (Figura 16 D) presentó un 88% de células vivas, un 5.1% de células apoptóticas y un 7.2% de células necróticas. Con todos estos datos podemos concluir que al día 10 las células que fueron tratadas con andrografólido 10 µm, 50 µm y 100 µm presentan una cantidad más elevada de células necróticas comparadas con el día 1, pero aun así, la diferencia no es significativa.

68 57 A) B) 8.8% 8.3% 90.8% 90.7% 0.5% 1% C) D) 5.8% 8.4% 91.9% 90.2% 2.5% 1.5% Figura 15. Viabilidad celular de la línea osteoblástica MC3T3-E1 a los 2 días. Las células fueron incubadas con andrografólido a distintas concentraciones durante 2 días y analizadas posteriormente mediante citometria de flujo. A) Control con vehículo DMSO. B) Andrografólido 10 um. C) Andrografólido 50 um. D) Andrografólido 100 um. (Rojo: células vivas; verde: células apoptóticas: azul: células necróticas)

69 58 A) B) 8.2% 24.8% 90.9% 75% 1% 0.3% C) D) 13.1% 7.2% 85.9% 88% 1.2% 5.1% Figura 16. Viabilidad celular de la línea osteoblástica MC3T3-E1 a los 10 días. Las células fueron incubadas con andrografólido a distintas concentraciones durante 10 días y analizadas posteriormente mediante citometria de flujo. A) Control con vehículo DMSO. B) Andrografólido 10 um. C) Andrografólido 50 um. D) Andrografólido 100 um. (Rojo: células vivas; verde: células apoptóticas: azul: células necróticas)

70 59 Una vez realizado el ensayo de viabilidad se procedió a analizar la actividad de la fosfatasa alcalina en la línea celular osteoblástica en presencia de andrografólido durante 10 días, tal como se describió en materiales y métodos. En la Figura 17 se puede observar que a medida que se aumenta la concentración de andrografólido, la actividad de la fostasa alcalina va disminuyendo proporcionalmente. En paralelo a este experimento se realizó el estudio de mineralización (Figura 18), tal cual como se describe en materiales y métodos, y se pudo corroborar que a medida que aumenta la concentración de andrografólido, la mineralización disminuye proporcionalmente.

71 60 % respecto al control *** *** µm AP Figura 17. Actividad de fosfatasa alcalina. Las células MC3T3-E1 fueron incubadas durante 10 días con vehículo (DMSO 0.2%) o andrografólido 10 y 50 µm. La actividad fue analizada en el lisado celular y fue medida la hidrólisis de p-nitrofenil fosfato a p-nitrofenol, tal como se describe en materiales y métodos, midiendo la absorbancia a 405 nm. Promedio ± e.e, n=6. *** p<0.01 comparado con el control.

72 61 Veces del control *** *** µm 50µM AP Figura 18. Efecto de andrografólido en la mineralización de las células MC3T3-E1. Las células MC3T3-E1 fueron crecidas a confluencia e incubadas durante 10 días con vehículo (DMSO 0.2%) o andrografólido 10 y 50 µm, fijadas con etanol frío al 70% y teñidas con rojo alizarina. La tinción adherida a las células fue removida y se midió la absorbancia a 562 nm, tal como se describe en materiales y métodos. Promedio ± e.e, n=4. *** p<0.01 comparado con el control.

73 Efecto de andrografólido en los factores de trascripción AP-1 y NF-κB Análisis de inmunodetección de IκBα y del factor NF-κB NF-κB es un homo o heterodímero, el cual cuando se encuentra activo transloca al núcleo para unirse a sitios específicos del DNA y así activar genes involucrados en distintos tipos de respuesta según sea el caso (estrés, supervivencia, etc). En células no estimuladas los dímeros de NF-κB son secuestrados en el citoplasma por una familia de inhibidores llamada IκBs (Inhibitor of κb), siendo la más estudiada la proteína IκBα. Cuando NF-κB es activado se inicia el proceso de degradación de las proteínas IκB, las cuales son fosforiladas y degradadas vía ubiquitina-proteosoma (Zhang et al., 2005). Para evaluar el efecto de andrografólido sobre el factor de transcripción NF-κB, se analizó la proteína IκBα, realizándose una cinética a los tiempos 0, 15, 30, 60 y 120 minutos mediante Western blot. Se observa en la Figura 19 que la proteína IκBα entre los tiempos 0, 15, 30 y 60 minutos no presenta grandes cambios, mientras que a las dos horas su presencia no es tan notoria lo cual sugiere que esta ha sido degradada. Para verificar que el factor NF-κB esta siendo activado se estudió la proteína p65 la cual fue detectada mediante inmunofluorescencia. Las células fueron incubadas con andrografólido 50 µm durante los siguientes tiempos: 0, 1 y 2 horas. Se utilizó un anticuerpo primario anti-p65/nf-κb y como anticuerpo secundario se utilizó anti-igg de conejo conjugado a Alexa 488. En la Figura 20 se muestra la inmunodetección positiva

74 63 A. 3.0 IκBα /Erk Total Minutos B. IκBα Erk total Minutos Figura 19. Efecto de andrografólido sobre la proteína IκBα en las células osteoblásticas MC3T3-E1. Las células fueron estimuladas con andrografólido 50 µm y analizadas a distintos intervalos de tiempo (0, 15, 30, 60 y 120 minutos, respectivamente) y analizadas mediante Western blot como se describe en materiales y métodos. A) Análisis densitométrico de IκBα usando como control de carga ERK total. n=3 B) Análisis de Western blot en extractos totales.

75 64 Ioduro de P65/NF-κB Propidio Superposición T 0 T 1 T 2 Figura 20. Efecto de andrografólido sobre la localización subcelular de p65/nf-κb en células MC3T3-E1. Las células MC3T3-E1 fueron incubadas con andrografólido por 0, 1 y 2 horas. La proteína p65/nf-κb fue detectada por inmunocitoquímica y análisis por microscopia de epifluorescencia utilizando un anticuerpo anti-p65/nf-κb y como segundo anticuerpo Alexa 488 (verde). Los núcleos fueron teñidos con ioduro de propidio (rojo). Aumento utilizado 40X.

76 65 (verde) para p65/nf-κb, mostrando que estas proteínas se encuentran localizadas en el área citoplasmática cuando se encuentran en un estado de reposo (control). En las células tratadas con andrografólido se observó que hasta los 60 minutos p65/ NF-κB se distribuyó en el citoplasma, sin embargo, a los 120 minutos este factor se localizó mayoritariamente dentro del núcleo. Como control negativo se agregó solución de bloqueo sin primer anticuerpo, no observándose inmunoreacción positiva en las células. Este resultado se correlaciona con la Figura 19, en la cual la proteína IκBα se encuentra disminuida a las 2 horas Análisis de inmunodetección para la proteína c-fos, componente de la proteína AP-1. La proteína activadora 1 (AP-1) es un factor de transcripción heterodimérico que juega un importante rol en el desarrollo y mantención esqueletal. AP-1 consiste en dímeros formados por miembros proteícos de las familias Fos, Jun y ATF. Las proteínas Fos (c-fos, FosB, Fra-1, Fra-2) son sólo capaces de heterodimerizarse con miembros de la familia Jun, mientras las proteínas Jun (c-jun, JunB, JunD) pueden homo y/o heterodimerizarse con proteínas Fos para formar complejos transcripcionales activos. (Wagner, 2002; Naito et al., 2004). Varios complejos son expresados diferencialmente durante la maduración de osteoblastos in vitro siendo altamente expresadas todas las proteínas Fos y Jun en sus comienzos. Subsecuentemente, durante el periodo de producción de matriz extracelular y mineralización, sus niveles van decayendo y Fra-2 y

77 66 JunD se convierten en los principales componentes del complejo AP-1 en los osteoblastos totalmente diferenciados. (Wagner, 2002) Para estudiar el efecto de andrografólido sobre la expresión de este dímero se realizó un análisis de inmunodetección, tal como se describe en materiales y métodos. Como se puede apreciar en la Figura 21, se realizó una cinética para evaluar la expresión de la proteína c-fos, en presencia de andrografólido 50 µm mostrando un aumento estadísticamente significativo (p<0.01) a los 30 minutos comparado con el control a tiempo cero.

78 67 A. 4 *** c-fos/erk Total B Minutos c-fos ERK total Minutos Figura 21. Efecto de andrografólido sobre la proteína c-fos en las células osteoblásticas MC3T3-E1. Las células fueron estimuladas con andrografólido 50 µm y analizadas a distintos intervalos de tiempo (0, 15, 30, 60 y 120 minutos respectivamente) y analizadas mediante Western blot como se describe en materiales y métodos. A) Análisis densitométrico de c-fos usando como control de carga ERK total. Promedio ± e.e, n=4 (***p<0.01 comparado con el control) B) Análisis de Western blot en extractos totales.

79 68 5. Discusión El esqueleto, formado por los huesos, es el principal sustento de los organismos vertebrados, jugando un rol primordial para el soporte del cuerpo y para la protección de órganos vitales. Los huesos, al ser el pilar fundamental del organismo, son un foco destacado de investigación para poder conocer su anatomía, función y procesos biológicos en los cuales se encuentran comprometidos, como su mantención a través de la vida y/o mecanismos de reparación a la hora de sufrir algún trauma u enfermedad. El hueso está constituido por el tejido óseo, el cual esta compuesto principalmente por osteoblastos, osteoclastos y osteocitos, los cuales se encargan de mantener la homeostasis del hueso entre formación y resorción (Hadjidakis y Androulakis, 2006). La formación es un foco recurrente de investigaciones, ya que traumas como fracturas y/o enfermedades como osteoporosis, necesitan de este mecanismo para volver a su equilibrio y es fundamental el descubrimiento de fármacos o fitofármacos que contribuyan a esto. Andrografólido, es un labdano diterpénico, y es el componente principal de la planta Andrographis paniculata, la cual ha mostrado tener cualidades farmacológicas anticancerígenas, inmunoestimulantes y antiinflamatorias (Liang et al., 2008; Kumar et al., 2004; Rajapogal et al., 2003; Shen et al., 2002). Las propiedades farmacológicas hasta el momento aún no han sido exploradas en líneas celulares osteoblásticas. Estudios previos realizados en este laboratorio han mostrado que andrografólido por sí solo es capaz de aumentar la expresión de COX-2 en células MC3T3-E1 y debido a que

80 69 COX-2 participa en el proceso de mineralización ósea, se propuso en el presente trabajo de tesis el objetivo de conocer si andrografólido es capaz de estimular la formación ósea (mineralización) en la línea celular osteoblástica de ratón MC3T3-E1, como así también evaluar las vías de señalización MAPK y PI3K, que podrían estar contribuyendo en la modulación de esta respuesta. Los primeros datos obtenidos sobre viabilidad celular muestra que andrografólido no es citotóxico a las 6 horas ya que el porcentaje de muerte celular fue de cercano al 4% con la concentración de andrografólido 100 µm (Figura 7), lo cual nos permitió realizar los experimentos siguientes descartando un potencial efecto citotóxico agudo. Del análisis de Western blot realizado para evaluar las cinéticas de fosforilación de las vías MAPK (Figura 9 y 10), se observó que andrografólido 50 µm es capaz de aumentar significativamente la vía ERK 1/2, no pudiendo evidenciarse de la misma manera en las otras vías. Estudios realizados en modelos animales muestran que ERK1 y ERK2 son esenciales para la diferenciación osteoblástica y la formación de hueso. Mediante técnicas de hibridación in situ, fluorescencia basada en la tinción de TRAP (fosfatasa acida resistente a tartrato) y PCR en tiempo real, se mostró que la expresión de osteocalcina en osteoblastos maduros no se desarrollaría en ausencia de ERK1 y ERK2, indicando que ERK1 y ERK2 son esenciales para la diferenciación a osteoblastos maduros (Matsuchita et al., 2009). Otros estudios realizados muestran que la producción autocrina de PGE2, inducida por TGF-β, juega un importante rol en la estimulación de las vías MAPK, en particular en la vía ERK, y la activación de ésta

81 70 MAPK media la proliferación celular inducida por TGF-β en estas células (Ghayor et al., 2005). Por otra parte, estudios de otros compuestos naturales que estimulan la diferenciación osteoblástica, como por ejemplo Balicaina, ha mostrado también un aumento en la fosforilación de las vías de señalización MAPK, como ERK 1/2 (Kim et al., 2008). Para evaluar que este aumento inducido por andrografólido sea producto de la activación de la vía ERK 1/2 o participe de manera indirecta a través de cross talk las vías p38 MAPK o PI3K, se analizó mediante western blot la fosforilación de ERK 1/2 en presencia de los inhibidores UO126 (inhibidor de la vía MEK1 y MEK2), SB (inhibidor de la vía p38 MAP quinasa) y LY (inhibidor de la vía PI3K) (Figura 11). UO126 inhibe significativamente esta fosforilación indicando que andrografólido mediante la activación de MEK1/2 fosforila a ERK 1/2. Sin embargo también se aprecia una disminución estadísticamente significativa con el inhibidor LY294002, dejando entre ver que la vía Akt podría estar participando río arriba de ERK1/2. El inhibidor SB presenta una tendencia a la disminución la cual no es estadísticamente significativa. Otros estudios realizados con cultivos de médula ósea han mostrado que la vía de señalización de PI3-K es requerida por BMP para la inducción de la expresión de genes osteoblásticos tempranos (Osyczka y Leboy, 2005). Asimismo, en células MC3T3-E1 estimuladas con epinefrina, se ha visto distintos roles para las vías MAP quinasa ERK y p38, en donde ERK estaría involucrada en el control de la proliferación celular mientras

82 71 que la vía de p38 regularía la actividad de fosfatasa alcalina en respuesta a la activación de receptores acoplados a proteína G (Suzuki et al, 1999). Para confirmar si estas vías provocaban algún efecto sobre COX-2 se analizó la expresión de la proteína mediante Western blot (Figura 12) y el RNAm mediante RT- PCR en tiempo real (Figura 13). Ambos análisis se efectuaron en presencia o ausencia de los inhibidores para p38 MAPK, ERK1/2 y PI3K. En los análisis de Westerm blot se observó una disminución para el inhibidor UO126 y para el inhibidor LY294002, los cuales no fueron estadísticamente significativos, en cambio, con el inhibidor SB203580, si hubo una inhibición estadísticamente significativa (p<0.01), indicando un rol más destacado para la vía p38 MAPK sobre la expresión de COX-2 en osteoblastos inducida por andrografólido. Mediante RT-PCR en tiempo real, se pudo evidenciar que en presencia de los tres inhibidores hay una disminución estadísticamente significativa (p<0.05 y p<0.01), dejando entre ver que en estas células osteoblásticas, las vías ERK, p38 y Akt posiblemente estarían participando en la regulación de los niveles de RNAm de COX-2. Una posible diferencia entre los resultados obtenidos en el Western blot y RT-PCR en tiempo real, se puede deber a que los niveles de RNA mensajero a las 6 horas aún no haya alcanzado su máximo umbral de transcripción provocando de esta manera que la inhibición con UO126 y LY fuera significativa. De otra manera, la sensibilidad de ambos métodos puede ser un factor que esté influenciando dicho comportamiento estadístico.

83 72 Algunos estudios demuestran que la vía ERK/MAPK activa y fosforila al factor de trascripción RUNX2 el cual es el mayor regulador de la expresión de genes específicos de osteoblastos (Ge et al., 2007; Franceschi y Xiao, 2003). Se ha visto también que la activación de las vías MAPK, (ERK1/2, p38 y JNK/SAPK) aumentan la expresión de COX-2 (Pratt et al., 2003). Estudios en células óseas muestran que la estimulación mecánica lleva a la regulación positiva de factores de crecimiento como es el factor de crecimiento de insulina (IGF) I y II, factor de crecimiento vascular endotelial (VEGF), factor de crecimiento transformante β1 (TGF-β1), y proteínas morfogéneticas de hueso 2 y 4, los cuales actúan vía mecanismos autocrinos y paracrinos, a través de sus receptores tirosina y serina/treonina quinasa. Estos factores de crecimiento activan fosfoinositol 3 quinasa (PI3K)-Akt, MAPK, y la vía de transducción de señales SMAD (Liedert et al., 2006). Para evaluar el efecto de andrografólido a más largo plazo sobre los marcadores osteogénicos, se realizó un análisis de viabilidad mediante citometría de flujo para descartar un efecto citotóxico (Figura 14, 15, 16). Estos datos sugieren que períodos de incubación de 10 días con andrografólido 100 µm, eleva de una manera esperable la cantidad de células apoptóticas y necróticas (total de células apoptóticas y necróticas 10 a 15% aproximadamente). Por esto se prefirió utilizar una dosis menor para los experimentos de ALP y mineralización para descartar la posible interferencia por disminución de la viabilidad celular, ya que estudios en otras líneas celulares como por ejemplo en células de hepatoma humano HepG2 han concluido que andrografólido

84 73 ejerce un efecto citotóxico, el cual es atribuido a la inducción del arresto de ciclo celular por la alteración del estado redox en la célula (Li et al., 2007). En células de cáncer humano colorectal LOVO también se ha visto que andrografólido produce una inhibición del crecimiento celular por un arresto en la fase G1-S del ciclo (Shi et al., 2008). En células de cáncer humanas, miembros de la familia pro apoptosis Bcl-2 (Bind y Bax) serían las piezas claves en la transmisión de la señalización de muerte celular inducida por andrografólido desde caspasa 8 hasta la mitocondria, llevando así a una eventual muerte celular por apoptosis (Zhou et al., 2006). El experimento realizado para evaluar la actividad de la fosfatasa alcalina en presencia de andrografólido 10 y 50 µm (Figura 17) mostró que hay una disminución dosis dependiente estadísticamente significativa (p<0.01). De esto se puede concluir que bajo las condiciones experimentales utilizadas en este trabajo, andrografólido no estaría aumentando los marcadores osteogénicos, por ende no estaría fomentando la mineralización en cultivos osteoblásticos in vitro. Para corroborar ésto se realizó el análisis de mineralización el cual mostró correlación con los datos obtenidos anteriormente, observándose una disminución de manera dosis dependiente, la cual es estadísticamente significativa p<0.01 (Figura 18). Estos resultados podrían sustentarse con otros reportes que sugieren un posible crosstalk entre las vías Smad y MAPK, modulando la regulación transcripcional de genes blanco. En este sentido, Sowa et al. (2002) concluye en su estudio que TGF-β activa las cascadas ERK 1/2 y JNK, y regulan negativamente la actividad transcripcional así como

85 74 la actividad de fosfatasa alcalina y mineralización, inducido por Smad3 en células osteoblásticas de ratón. Nakayama et al. (2003) sugiere que la vía RTK-Ras-ERK suprime la señal de BMP por interferir con la transactividad con Smad1. Kretzschmar et al. (1997) y Higuchi et al. (2002) también sugieren que MAPK inhibe la señalización de BMP evitando así la fosforilación de la proteína Smad1 y que la continua inhibición de la vía de señalización MAPK promovería la diferenciación osteoblástica temprana y la mineralización de la matriz extracelular. Por otra parte, Kono et al. (2007) sugieren que la vía ERK regula negativamente la mineralización de la matriz tanto in vivo como in vitro. Diversos estudios sugieren que COX-2 es un poderoso modulador de la función celular en el hueso y que su expresión es crítica en traumatismos (Leis y Windischhofer, 2008; Xie et al., 2008; Gerstenfeld et al., 2003). La fosforilación de señales extracelulares reguladas por quinasa (ERK) regula la expresión y fosforilación de factores de transcripción de la familia fos y jun que controla la transcripción río abajo de genes blancos con promotores que contienen sitios de unión a AP-1, así como también la fosforilación de RUNX2 (Jansen et al., 2004). El gen promotor de COX-2 contiene cajas canónicas TATA box y sitios de unión para varios factores de transcripción incluyendo NF-kB, NF-IL6/C/EBP, PEA3, NFAT, CRE, AP-2 y SP-1 (Chun y Surth, 2004; Kosaka et al., 1994). Ante estos datos obtenidos de literatura, se evaluó el potencial efecto de andrografólido sobre los factores de transcripción NF-κB y AP-1 en la línea celular osteoblástica

86 75 MC3T3-E1. Primero se realizó un análisis de western blot para la proteína IκBα, la cual se encarga de secuestrar a NF- κb cuando está inactivo. El resultado obtenido en el análisis de inmunodetección (Figura 19) mostró que a las 2 horas, la proteína IκBα presenta una disminución notoria con respecto al control, sugiriendo que esta proteína estaría siendo degradada para activar al factor de transcripción NF-κB que se estaría translocando al núcleo. Para confirmar esto se realizó una inmunocitoquímica, en la cual se marcó la proteína p65, la cual forma parte del factor de transcripción NF-κB. Como se aprecia en la Figura 20, la localización del factor de transcripción está en el citoplasma, y a medida que pasa el tiempo, se va translocando al núcleo viéndose más claramente a las 2 horas. Estos datos apoyan a los experimentos realizados anteriormente en el cual la proteína IκBα iba disminuyendo su presencia. Este resultado muestra relación a su vez con el aumento de la expresión de la proteína COX-2, ya que como se mencionó anteriormente, el gen contiene sitios de unión para este factor de transcripción (Figura 6), sugiriéndonos que NF-κB al ser estimulado con andrografólido tiene una participación en la expresión de la proteína COX-2. El rol de COX-2 en la reparación de hueso ha recibido reciente atención, ya que fármacos que inhiben la producción de prostaglandinas, han mostrado inhibir experimentalmente la reparación de fracturas (Einhorn, 2002; Goodman et al., 2002), además la formación de hueso en respuesta a la carga mecánica exógena, es dependiente de la síntesis de prostaglandinas vía COX-2 (Chen et al., 2003).

87 76 El otro factor de transcripción analizado fue el heterodimero AP-1. La proteína AP-1, la cual esta formada por las proteínas Fos y Jun, han sido implicadas en una amplia variedad de procesos biológicos incluyendo diferenciación celular, proliferación, apoptosis y transformación oncogénica (Suetsugu et al., 2007; Naito et al., 2004). En osteoblastos la actividad de AP-1 puede ser inducida por TGF-β, por la hormona paratiroidea y por 1,25-dihidroxi vitamina D, las cuales son potentes reguladores de la diferenciación y proliferación osteoblástica (Wagner, 2002). Se sabe además que señales extracelulares activan a esta proteína, siendo la familia de las MAPK una de ellas. Las MAPKs son activadas por fosforilación en el citoplasma y translocan hacia el núcleo, donde ellas inducen la fosforilación de factores de transcripción, co-activadores y proteínas nucleosomales. Las vías de señalización MAPKs regula la actividad de AP-1 mediante el aumento de la transcripción y por la fosforilación de la proteína AP-1. La proteína c-fos es expresada en niveles bajos o en niveles casi indetectables en la mayoría de los tipos celulares, pero es rápida y transientemente inducida en respuesta a varios estímulos como factores de crecimiento, y estrés ambiental y físico (Eriksson, 2005). La cinética de expresión realizada a la proteína c-fos (un componente del factor de transcripción AP-1), mostró un aumento estadísticamente significativo (p<0.01) a los 30 minutos de estimulación (Figura 21), correlacionándose con el aumento visto en la cinética de fosforilación de ERK, en donde su pico estaba alrededor de los 15 minutos (Figura 10), además como el gen de COX-2 tiene sitios de unión para la familia de factores de transcripción de la proteína AP-1 (Chen et al., 2003; Wadleigh y Herschman,

88 ; Chun y Surh, 2004) (Figura 6), se sugiere que estas vías estarían estimulándose de una manera secuencial al ser estimuladas con andrografólido. Por otra parte estudios en otras líneas celulares revelan que andrografólido suprime la migración quimiotáctica a través de la inhibición de la fosforilación de ERK 1/2 y Akt en macrófagos pudiendo contribuir a la actividad anti-inflamatoria de andrografólido (Tsai et al., 2004). Hay estudios que indican que andrografólido suprime la apoptosis celular endotelial mediante la activación de la vía PI3-K/ Akt (Chen et al., 2007), y también de que andrografólido interfiere con la activación de células T y reduce la encéfalo mielitis autoinmune experimental en el ratón (Iruretagoyena et al., 2004). Estudios de este laboratorio han mostrado que andrografólido inhibe la producción de IL-2, aumentando la fosforilación de JNK y disminuyendo la fosforilación del factor de transcripción NF-κB y la de la vía de señalización ERK1 y ERK5, sugiriendo además que andrografólido a concentraciones 100 µm aumentaría la apoptosis temprana en células Jurkat (Carretta et al., 2009). Los resultados obtenidos de este trabajo, demuestran por primera vez que andrografólido es capaz de estimular por sí solo la fosforilación de la vía MAPK ERK 1/2, siendo esta dependiente de la activación de MEK1/2. Además, esta vía tendría una estrecha relación con la activación de los factores de transcripción NF-κB y AP-1 que regulan la expresión de COX-2, sin embargo la participación de las vías p38 y Akt no pueden ser excluídas de este fenómeno.

89 78 Bajo las condiciones de cultivo realizadas, andrografólido no fue capaz de estimular marcadores osteogénicos como ALP ni provocar la mineralización de cultivos in vitro siendo afectada posiblemente por un cross-talk con las vías de señalización de Smad o por un posible efecto citotóxico causado por la cantidad de días a las que fueron expuestas las células frente al fármaco. En la Figura 22, se propone un posible mecanismo por el cual andrografólido ejercería su efecto sobre la línea celular osteoblástica MC3T3-E1. Como se aprecia en el esquema, andrografólido activaría la vía Ras, fosforilando a MEK1/2 y este fosforila a ERK1/2 el cual transloca al núcleo activando la transcripción de genes blancos como c-fos y c-jun, provocando el aumento en la expresión de la proteína COX-2. También ERK1/2 podría estar actuando en la translocación al núcleo del factor de transcripción NF-κB, o bien esto lo podría estar ejerciendo alguna otra MAP quinasa, como por ejemplo p38. Por otra parte, estudios de este laboratorio muestran que andrografólido no presenta cambios en la fosforilación de Smad2/3, desconociéndose si afecta a otras proteínas de esta familia (Pérez, 2008). Investigaciones de Nakayama et al. (2003) muestra que la vía RTK-Ras-ERK suprime la señal de BMP por interferir con la transactividad de Smad1, señalando que la fosforilación directa de Smad1 por ERK no es requerida para la inhibición de la diferenciación osteoblástica y que otros factores, que son fosforilados por ERK, posiblemente estarían envueltos en la regulación de la diferenciación. Suzawa et al. (2002) sugiere que Ras, pero no PI3-K potencia la actividad transcripcional de Smad1 a través de la activación de ERK, sin embargo la vía Ras támbien es activada por EGF, el cual inhibiría la transactivación de Smad1 provocando así el efecto inhibitorio de la diferenciación osteoblástica.

90 79 Andrografólido??? p38 y otras kinasas Ras MEK1/2 Célula osteoblástica Smad1 ERK1/2 Apoptosis IkBα p53 p65 ALP y factores osteogénicos COX-2 c-fos c-jun p53 p65 Núcleo Figura 22. Esquema propuesto para el aumento de COX-2 en las células MC3T3-E1 por andrografólido. Andrografólido actuaría vía Ras fosforilando a MEK1/2, provocando así la subsiguiente fosforilación de ERK1/2, translocando éste al núcleo activando la expresión del gen de COX-2.

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a Introducción Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a los investigadores verificar la expresión de una proteína, determinar la cantidad relativa

Más detalles

2. Fisiopatología del hueso y de la osteoporosis

2. Fisiopatología del hueso y de la osteoporosis 12 2. Fisiopatología del hueso y de la osteoporosis Dra. Amanda Páez Talero Médica Endocrinóloga, Universidad Nacional de Colombia Hospital Central de la Policía, Bogotá. El riesgo de presentar osteoporosis

Más detalles

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN 5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN Materiales - Eppendorf de 1,5 ml estériles - Eppendorf de pared fina para PCR - Puntas de pipeta estériles desechables - Guantes

Más detalles

TP6: Western blot. Objetivos. Introducción

TP6: Western blot. Objetivos. Introducción TP6: Western blot Objetivos Familiarizarse con la técnica de western blot. Determinar los niveles de IgG en sueros murinos Comparar la sensibilidad del western blot vs el SDS page Introducción La transferencia

Más detalles

Calcio (Ca ++ ) 11/22/2012. Regulación Endocrina del Metabolismo del Calcio

Calcio (Ca ++ ) 11/22/2012. Regulación Endocrina del Metabolismo del Calcio Regulación Endocrina del Metabolismo del Calcio La homeostasis del calcio, fosfato y magnesio es fundamental para la salud y para la vida Los elementos clave del sistema regulador son la vitamina D y la

Más detalles

LAS TRANSLOCACIONES DE RAF PARTICIPAN EN EL CANCER

LAS TRANSLOCACIONES DE RAF PARTICIPAN EN EL CANCER Genética Molecular 10/11 Ana Serrano Puebla LAS TRANSLOCACIONES DE RAF PARTICIPAN EN EL CANCER En este trabajo se dispusieron a investigar sobre el desarrollo y mantenimiento de células cancerígenas en

Más detalles

Fisiología y envejecimiento Sistema Esquelético. Tema 3

Fisiología y envejecimiento Sistema Esquelético. Tema 3 . Tema 3 Generalidades. Estructura macroscópica del hueso. Estructura microscópica del hueso. Funciones del sistema esquelético. Remodelación ósea. Fracturas. Factores que afectan al crecimiento óseo.

Más detalles

TRANSDUCCIÓN DE SEÑALES: TIROSINA QUINASAS

TRANSDUCCIÓN DE SEÑALES: TIROSINA QUINASAS TRANSDUCCIÓN DE SEÑALES: TIROSINA QUINASAS Dra Claudia Tomes REACCIÓN de FOSFORILACIÓN CATALIZADA POR PROTEINA QUINASAS SUSTRATO-aa-OH + APPP (ATP) SUSTRATO-aa-OP + APP (ADP) Ser/Tre quinasas fosforilan

Más detalles

MATERIALES Y MÉTODOS

MATERIALES Y MÉTODOS MATERIALES Y MÉTODOS Para la obtención, aislamiento y caracterización de la proteína de superficie HSPB66 de H. pylori ATCC 43504 se realizó un cultivo de esta cepa, seguido de la extracción de proteínas

Más detalles

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR Módulo 1 Amplificación de un fragmento de ADN genómico por PCR En este primer módulo se amplificará por PCR, mediante el uso de oligonucleótidos específicos, un fragmento de ADN genómico de Aspergillus

Más detalles

Electroforesis en gel de poliacrilamida y electrotransferencia

Electroforesis en gel de poliacrilamida y electrotransferencia Electroforesis en gel de poliacrilamida y electrotransferencia INDICE ELECTROFORESIS Fundamento y características Tipos de electroforesis: libre y de zona Electroforesis en papel, acetato de celulosa Electroforesis

Más detalles

CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL

CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL LIBRO DE MEMORIAS 2 CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL Santiago de Cali, 23 al 28 de agosto de 2010 3 Libro de memorias

Más detalles

ANEXO I. Inmunofenotipificación Celular por Citometría de Flujo

ANEXO I. Inmunofenotipificación Celular por Citometría de Flujo ANEXO I Inmunofenotipificación Celular por Citometría de Flujo Reactivos Anticuerpos monoclonales fluoromarcados (BD Bioscience Pharmingen) Medio DMEM con 0.02% de azida de sodio Paraformaldehido (PFA)

Más detalles

En el control y regulación del proceso inflamatoria intervienen de forma activa diferentes sistemas.

En el control y regulación del proceso inflamatoria intervienen de forma activa diferentes sistemas. FISIOPATOLOGÍA DE LA INFLAMACIÓN: En el control y manejo del proceso inflamatorio intervienen varios sistema del organismo, neural, endocrino, inmune y psicológico, lo que nos lleva a afirmar que la inflamación

Más detalles

Western Blot Introducción y Optimización. Ariana Veiga

Western Blot Introducción y Optimización. Ariana Veiga Western Blot Introducción y Optimización 10 Abril 2013 Ariana Veiga Western Blot En qué consiste el Western Blot? Cómo funciona? También llamado Inmunoblot Técnica utilizada para identificar una proteína

Más detalles

CURSO BIOLOGIA CELULAR INGENIERIA CIVIL - BIOTECNOLOGIA SEÑALIZACION CELULAR

CURSO BIOLOGIA CELULAR INGENIERIA CIVIL - BIOTECNOLOGIA SEÑALIZACION CELULAR CURSO BIOLOGIA CELULAR INGENIERIA CIVIL - BIOTECNOLOGIA SEÑALIZACION CELULAR ORGANISMO: Es todo ser vivo animal o vegetal capaz de desempeñar funciones a través de sus órganos ORGANO: Parte estructural

Más detalles

FISIOLOGÍA GENERAL Jesús Merino Pérez y María José Noriega Borge

FISIOLOGÍA GENERAL Jesús Merino Pérez y María José Noriega Borge SEÑALES QUÍMICAS En los organismos pluricelulares, la coordinación entre las células se realiza a través de mediadores o mensajeros de la comunicación intercelular de los que hay descritos varios centenares.

Más detalles

CAPÍTULO VI. Expresión de genes relacionados con apoptosis

CAPÍTULO VI. Expresión de genes relacionados con apoptosis CAPÍTULO VI Expresión de genes relacionados con apoptosis 1.- Introducción 2.- Protocolos para análisis genéticos 3.- Resultados en MCF-7 4.- Discusión 1.- Introducción Como se ha descrito anteriormente,

Más detalles

CICLO 2 : Fraccionamiento subcelular

CICLO 2 : Fraccionamiento subcelular Curso de Fisicoquímica Biológica 2006 Licenciatura de Bioquímica. Facultad de Ciencias. CICLO 2 : Fraccionamiento subcelular OBJETIVOS GENERALES: 1) Obtención de preparados enriquecidos en fracciones subcelulares

Más detalles

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas ELEMENTOS BÁSICOS DE LA INVESTIGACIÓN EN GENES Análisis

Más detalles

Por: Matías San Martín Bioquímica Oral N 04 06/05/02 Odontología II año U. de Chile

Por: Matías San Martín Bioquímica Oral N 04 06/05/02 Odontología II año U. de Chile RUTA DE TRANSDUCCIÓN MEDIADA POR EL FC ESTRUCTURA Y FUNCIÓN DE LOS FC IMPLICADOS EN EL DESARROLLO DENTARIO CARACTERÍSTICA GENERALES: Son un componente de la MEC, secretados por la célula. Participan en

Más detalles

FOSFOLIPASAS. Las fosfolipasas son moléculas capaces de romper los fosfolípidos

FOSFOLIPASAS. Las fosfolipasas son moléculas capaces de romper los fosfolípidos FOSFOLIPASAS Las fosfolipasas son moléculas capaces de romper los fosfolípidos de membrana. Se nombran dependiendo del punto en que cortan a ese fosfolípido. Las fosfolipasas de tipo C serán capaces de

Más detalles

RESULTADOS Y DISCUSIÓN. Estimación de la Concentración Proteica del Filtrado de Cultivo de Mycobacterium tuberculosis H37Rv

RESULTADOS Y DISCUSIÓN. Estimación de la Concentración Proteica del Filtrado de Cultivo de Mycobacterium tuberculosis H37Rv RESULTADOS Y DISCUSIÓN Estimación de la Concentración Proteica del Filtrado de Cultivo de Mycobacterium tuberculosis H37Rv La curva estándar con la que se estimó la concentración proteica del filtrado

Más detalles

Técnicas. Transferencia de las proteínas a la membrana. Bloqueo de los sitios de unión inespecíficos.

Técnicas. Transferencia de las proteínas a la membrana. Bloqueo de los sitios de unión inespecíficos. Técnicas Transferencia de las proteínas a la membrana. Bloqueo de los sitios de unión inespecíficos. Lavado de la membrana. Anticuerpos primarios y secundarios. Marcaje de anticuerpos. Sustratos cromogénicos.

Más detalles

Taller Factores de Crecimiento Plasmático. 29 de Noviembre de 2013

Taller Factores de Crecimiento Plasmático. 29 de Noviembre de 2013 Taller Factores de Crecimiento Plasmático Mercedes Corbacho Francisca Muñoz 29 de Noviembre de 2013 Regeneración Proceso fisiológico Actividad continua de los tejidos Durante toda la vida Tejidos dañados

Más detalles

De manera general la teoría celular moderna se resume en tres postulados:

De manera general la teoría celular moderna se resume en tres postulados: De manera general la teoría celular moderna se resume en tres postulados: La célula es la unidad básica estructural de todos los seres vivos, todos los organismos están formados por células. La célula

Más detalles

Células especializadas

Células especializadas Células especializadas Célula muscular Has aprendido en años anteriores que el tejido muscular permite el movimiento del cuerpo. Las células que componen este tejido reciben el nombre de miocitos y se

Más detalles

-Definición de Reparación: -Factores a considerar: -La reparación puede ser: Reparación tisular.

-Definición de Reparación: -Factores a considerar: -La reparación puede ser: Reparación tisular. Reparación tisular. *Indispensable para la homeostasis. *Fin último de la inflamación -Definición de Reparación: Es el proceso de sustitución de células muertas por células nuevas, sanas, derivadas del

Más detalles

CHAPTER 9 Sumario en español

CHAPTER 9 Sumario en español CHAPTER 9 Sumario en español Mecanismos de muerte celular inducidos por estrés oxidativo en hepatocitos. Objetivos para una intervención de protección Chapter 9 Radical libre es aquella especie química

Más detalles

DANAGENE RNA PURIFICATION KIT

DANAGENE RNA PURIFICATION KIT DANAGENE RNA PURIFICATION KIT REF.0801.1 100 EXTRACCIONES REF.0801.2 500 EXTRACCIONES 1.INTRODUCCION Este kit permite la permite la obtención de ARN total a partir de cultivos celulares, tejidos animales,

Más detalles

MANUAL DE PRÁCTICAS DE LABORATORIO

MANUAL DE PRÁCTICAS DE LABORATORIO MANUAL DE PRÁCTICAS DE LABORATORIO INGENIERIA ENBIOTECNOLOGÍA INGENIERÍA GENÉTICA FICHA TECNICA FICHA TÉCNICA SEMINARIO DE BIOTECNOLOGÍA MÉDICO-FARMACÉUTICA Fecha: Nombre del catedrático: 10-Julio-2012

Más detalles

INFORME PROYECTO DE INVESTIGACION

INFORME PROYECTO DE INVESTIGACION INFORME PROYECTO DE INVESTIGACION EFECTO DE LOS EXTRACTOS DIALIZABLES EN LA RESPUESTA INMUNE HUMORAL EN UN MODELO DE INFECCIÓN IN VIVO CON HERPES SIMPLEXI CLAVE: 20070367 DR. SERGIO ANTONIO ESTRADA PARRA.

Más detalles

MENSAJEROS QUÍMICOS HIDROFÓBICOS

MENSAJEROS QUÍMICOS HIDROFÓBICOS TRANSDUCCIÓN DE SEÑALES EN EUCARIOTAS: MENSAJEROS QUÍMICOS HIDROFÓBICOS Vamos a ver en esta clase como se biosintetizan algunos de estos mensajeros químicos hidrofóbicos y después veremos cómo se biosintetizan

Más detalles

Técnicas de Biología Molecular

Técnicas de Biología Molecular Técnicas de Biología Molecular DNA I. Enzimas de restricción Análisis Las enzimas de restricción fueron aisladas de bacterias; su función natural es proteger contra DNA extraño II. Separación electroforética

Más detalles

Modificación de proteínas

Modificación de proteínas Modificación de proteínas Compilación y armado: Prof. Sergio Pellizza Dto. Apoyatura Académica I.S.E.S Universidad Complutense de Madrid Facultad de Ciencias Biológicas Profesor: Iñigo Azcoitia La estructura

Más detalles

Hormonas tiroideas (permisivas ) Contribuye con el desarrollo del sistema nervioso

Hormonas tiroideas (permisivas ) Contribuye con el desarrollo del sistema nervioso CRECIMIENTO Y BALANCE DE CALCIO El crecimiento puede dividirse en crecimiento de tejidos blandos y crecimiento óseo. En los niños el crecimiento óseo puede evaluarse midiendo la estatura y el crecimiento

Más detalles

5. MATERIALES Y MÉTODOS

5. MATERIALES Y MÉTODOS 5. MATERIALES Y MÉTODOS 5.1 Equipos Los siguientes termocicladores se emplearon para la amplificación por PCR: - Perkin Elmer, GeneAmp PCR System 2400. - Perkin Elmer, GeneAmp PCR System 9600. - Applied

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

Receptores para medicamentos

Receptores para medicamentos FARMACODINAMIA mayor selectividad de acción habrá FARMACODINAMIA La farmacocinética hace relación específicamente a las diferentes acciones que el organismo ejerce sobre un fármaco, como su desintegración,

Más detalles

TRABAJO PRACTICO Nº 3 ENZIMOINMUNOANALISIS ELISA

TRABAJO PRACTICO Nº 3 ENZIMOINMUNOANALISIS ELISA TRABAJO PRACTICO Nº 3 ENZIMOINMUNOANALISIS ELISA Docentes encargados: Bioq. Natalia Guiñazú Bioq. Maria Sol Renna Biol. Virginia Andreani Bioq. Mauricio Figueredo Bioq. Vanina Garrido Bioq. Laura Dulgerian

Más detalles

FACULTAD DE CIENCIAS EXACTAS

FACULTAD DE CIENCIAS EXACTAS FACULTAD DE CIENCIAS EXACTAS Presentación curso de postgrado Año 2015 Semestre 2do Nombre del Curso Metabolismo mineral y enfermedades metabólicas óseas Profesor Responsable (indicando las horas que participa

Más detalles

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática.

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Departamento de Bioquímica Médica y Biología Molecular Práctica 3 Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Curso 1 Medicina (Abril) 2012 BIOQUÍMICA

Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO

AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO E l estudio del genoma de los seres vivos a sido uno d los principales objetivos de la Biología. Desde los trabajos de Mendel (1866),

Más detalles

ELECTROFORESIS WESTERN BLOT ELISA

ELECTROFORESIS WESTERN BLOT ELISA ELECTROFORESIS WESTERN BLOT ELISA INTEGRANTES: Arguelles, Rocío Assandri, Matías Almirón, Marianela Buonanduci, Facundo Gómez, Alan Miller, Florencia López, Rocío Vidal, Sol Sillingardi, Leonardo Soria,

Más detalles

TESIS DOCTORAL. Regulación transcripcional durante la activación de los linfocitos T por la enzima Poli-ADP-ribosa polimerasa-1.

TESIS DOCTORAL. Regulación transcripcional durante la activación de los linfocitos T por la enzima Poli-ADP-ribosa polimerasa-1. Unidad de Cirugía Experimental. Hospital Universitario Virgen de la Arrixaca. Universidad de Murcia Dpto. Bioquímica, Biología Molecular B e Inmunología, Facultad de Medicina TESIS DOCTORAL Regulación

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

Evaluación de la actividad antiinflamatoria

Evaluación de la actividad antiinflamatoria Evaluación de la actividad antiinflamatoria del Omega 3 Informe final del Proyecto Román Pérez Fernández Universidad de Santiago de Compostela José Esteban Castelao Fernández Servicio Gallego de Salud-SERGAS

Más detalles

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa?

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa? 2º BIOQUÍMICA CUESTIONES 1. Por qué la PCR convencional no es cuantitativa? En la PCR convencional, la cuantificación del ADN de la muestra es complicada debido a que la eficacia de amplificación va disminuyendo

Más detalles

Vanessa Iglesias Fernández 2

Vanessa Iglesias Fernández 2 AGRADECIMIENTO Antes de nada me gustaría dar las gracias a la Dra. Carmen García por haberme dado la oportunidad de realizar las prácticas en su laboratorio. Gracias a todo el equipo del laboratorio (Patricia,

Más detalles

MORFOFISIOLOGÍA HUMANA III VIDEOCONFERENCIA 1 SISTEMA ENDOCRINO, METABOLISMO Y SU REGULACION. GENERALIDADES

MORFOFISIOLOGÍA HUMANA III VIDEOCONFERENCIA 1 SISTEMA ENDOCRINO, METABOLISMO Y SU REGULACION. GENERALIDADES MORFOFISIOLOGÍA HUMANA III VIDEOCONFERENCIA 1 SISTEMA ENDOCRINO, METABOLISMO Y SU REGULACION. GENERALIDADES METABOLISMO Es el conjunto de todas las reacciones químicas que ocurren en el organismo vivo,

Más detalles

BIOQUÍMICA TEMA 3. METABOLISMO CELULAR

BIOQUÍMICA TEMA 3. METABOLISMO CELULAR BIOQUÍMICA TEMA 3. METABOLISMO CELULAR D. Ph. Daniel Díaz Plascencia. Contacto: dplascencia@uach.mx www.lebas.com.mx QUÉ ES EL METABOLISMO CELULAR? El metabolismo se podría definir como el conjunto de

Más detalles

Químicas: hormonas, factores de crecimiento,.. neurotransmisores, etc.

Químicas: hormonas, factores de crecimiento,.. neurotransmisores, etc. Señales Físicas: presión, cambios de Tº C, etc. Químicas: hormonas, factores de crecimiento,.. neurotransmisores, etc. son MOLÉCULAS Diferentes formas de información mediada por moléculas señal: Transducción

Más detalles

Metodologías básicas del procesamiento de Proteinas

Metodologías básicas del procesamiento de Proteinas Metodologías básicas del procesamiento de Proteinas Alejandra Kun Departamento de Proteínas y Ácidos Nucleicos-IIBCE Unidad Asociada Sección Bioquímica Facultad de Ciencias 13 de octubre 2014 Curso Introducción

Más detalles

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles

REGULACIÓN TRANSCRIPCIONAL DE LA EXPRESIÓN GENICA

REGULACIÓN TRANSCRIPCIONAL DE LA EXPRESIÓN GENICA REGULACIÓN TRANSCRIPCIONAL DE LA EXPRESIÓN GENICA Niveles de organización de los seres humanos Biología Molecular Básica e Ingeniería Genética T.M. Claudia Troncoso M. Regulación expresión génica Diversidad

Más detalles

Fig.3.24. Invaginaciones basales. MODELOS CELULARES

Fig.3.24. Invaginaciones basales. MODELOS CELULARES Fig.3.24. Invaginaciones basales. MODELOS CELULARES Los contenidos del tema, enfocan el estudio del Modelo de Célula Eucariota, pero es importante darse cuenta que en el organismo existen millones de células

Más detalles

UN PROCEDIMIENTO AMIGABLE AL INVESTIGADOR Y A LA ECOLOGÍA: EL USO DEL ISOPROPANOL COMO SUSTITUTO DEL METANOL EN LA ELECTROTRANSFERENCIA DE PROTEÍNAS

UN PROCEDIMIENTO AMIGABLE AL INVESTIGADOR Y A LA ECOLOGÍA: EL USO DEL ISOPROPANOL COMO SUSTITUTO DEL METANOL EN LA ELECTROTRANSFERENCIA DE PROTEÍNAS Clave: 448840 UN PROCEDIMIENTO AMIGABLE AL INVESTIGADOR Y A LA ECOLOGÍA: EL USO DEL ISOPROPANOL COMO SUSTITUTO DEL METANOL EN LA ELECTROTRANSFERENCIA DE PROTEÍNAS Marco A., Villanueva Méndez DIRECCIÓN

Más detalles

5. MATERIAL Y MÉTODOS

5. MATERIAL Y MÉTODOS 5. MATERIAL Y MÉTODOS 5.1 ANIMALES Se utilizaron setenta ratas Wistar adultas, hembras (Bioterio Claude Bernard, BUAP) con un peso entre 170 y 240 g. Se colocaron en cajas de policarbonato con aserrín

Más detalles

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles

Bioquímica III- 2009

Bioquímica III- 2009 Facultad de Ciencias Exactas, Universidad Nacional de La Plata Bioquímica III- 2009 Trabajo Práctico Nro 4 Extracción de RNA y DNA bacteriano INTRODUCCIÓN El RNA es el ácido nucleico más abundante en la

Más detalles

7.012 Serie de ejercicios 5

7.012 Serie de ejercicios 5 Nombre Grupo 7.012 Serie de ejercicios 5 Pregunta 1 Al estudiar los problemas de esterilidad, usted intenta aislar un hipotético gen de conejo que explique la prolífica reproducción de estos animales.

Más detalles

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082 Página 1 de 5 1. OBJETIVO Detectar la presencia de Campylobacter jejuni en hamburguesa de pollo mediante técnica de PCR. 2. CAMPO DE APLICACIÓN Y ALCANCE Aplicar este procedimiento a muestras de hamburguesa

Más detalles

ENFERMEDADES TROPICALES

ENFERMEDADES TROPICALES Departamento de Biología Animal, Parasitología, Ecología, Edafología y Química Agrícola. Área de Parasitología MÁSTER EN ENFERMEDADES TROPICALES Proteómica en Enfermedades Tropicales Código 302731 (3 créditos

Más detalles

Para mejor presentación de su pieza ósea comience definiendo que es la OSTEOLOGIA.

Para mejor presentación de su pieza ósea comience definiendo que es la OSTEOLOGIA. GUIA DE ESTUDIO PARA MEJORAR APRENDIZAJE EN OSTEOLOGIA. Para mejor presentación de su pieza ósea comience definiendo que es la OSTEOLOGIA. Divida al armazón óseo en distintos segmentos: por ejemplo: a.

Más detalles

Práctico: Genética bacteriana 2007.

Práctico: Genética bacteriana 2007. Práctico: Genética bacteriana 2007. Actividad integrada Departamento de Genética Departamento de Bacteriología y Virología. OBJETIVOS Objetivos generales El estudiante al terminar la actividad práctica

Más detalles

Por Roberto Rustom y Matías San Martín Fisiología General N 06 25/04/02 Odontología II año U de Chile

Por Roberto Rustom y Matías San Martín Fisiología General N 06 25/04/02 Odontología II año U de Chile La fisiología del metabolismo del calcio y del fosfato, la función de la vitamina D, y la formación del hueso y de los di entes están ligadas en un sistema común junto a las dos hormonas reguladoras, la

Más detalles

PARATIROIDES HORMONA PARATIROIDEA, CALCITONINA, METABOLISMO DEL CALCIO Y DEL FOSFATO, VITAMINA D, HUESOS.

PARATIROIDES HORMONA PARATIROIDEA, CALCITONINA, METABOLISMO DEL CALCIO Y DEL FOSFATO, VITAMINA D, HUESOS. PARATIROIDES HORMONA PARATIROIDEA, CALCITONINA, METABOLISMO DEL CALCIO Y DEL FOSFATO, VITAMINA D, HUESOS. La fisiología del metabolismo del calcio y del fosfato, la función de la vitamina D y la formación

Más detalles

Guía Práctica 9. Producción de micelio en medio líquido para extracción de ADN. Micelio de hongos. Contenido

Guía Práctica 9. Producción de micelio en medio líquido para extracción de ADN. Micelio de hongos. Contenido Guía Práctica 9 Micelio de hongos Producción de micelio en medio líquido para extracción de ADN Guillermo Castellanos, Experto en Investigación 2 Carlos Jara, Ing. Agr. M.Sc., Asociado en Investigación

Más detalles

MÉTODOS CROMATOGRÁFICOS: 1. Exclusión molecular 2. Intercambio iónico 3. Afinidad SSN

MÉTODOS CROMATOGRÁFICOS: 1. Exclusión molecular 2. Intercambio iónico 3. Afinidad SSN MÉTODOS CROMATOGRÁFICOS: 1. Exclusión molecular 2. Intercambio iónico 3. Afinidad SSN Propiedades de una proteína que son útiles para su purificación por cromatografía Peso molecular Carga iónica Hidrofobicidad

Más detalles

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR)

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) Centro de de Microscopía Electrónica Facultad de de Ciencias Médicas Universidad Nacional de de Córdoba

Más detalles

Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala

Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala IICA/Red SICTA-CIAT INFORME DE AVANCE Gerardo Gallego - Harold

Más detalles

Organización general de las células: Citosol y sistema de endomembranas 1

Organización general de las células: Citosol y sistema de endomembranas 1 Organización general de las células: Citosol y sistema de endomembranas 1 Tema 10. El sistema de endomembranas de la célula. Componentes. La compartimentalización del citoplasma. Retículo endoplásmico:

Más detalles

Electroforesis de proteínas en geles de poliacrilamida. Electroforesis de proteínas en geles de poliacrilamida: Introducción y técnica básica

Electroforesis de proteínas en geles de poliacrilamida. Electroforesis de proteínas en geles de poliacrilamida: Introducción y técnica básica Electroforesis de proteínas en geles de poliacrilamida Electroforesis de proteínas en geles de poliacrilamida: Introducción y técnica básica La electroforesis de proteínas en geles con una matriz de poliacrilamida,

Más detalles

CELULAR. En organismos multicelulares, las células intercambian información:

CELULAR. En organismos multicelulares, las células intercambian información: MECANISMOS DE COMUNICACIÓN -acerca de su posición -sobre sus actividades metabólicas interdependientes CELULAR En organismos multicelulares, las células intercambian información: -sobre la concentración

Más detalles

QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA. Julio A. Carrasco Vallejo Julio 2014

QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA. Julio A. Carrasco Vallejo Julio 2014 QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA Julio A. Carrasco Vallejo Julio 2014 Definiciones Biología Molecular: Estudio de los flujos de información genética en una célula Biotecnología: Uso de sistemas

Más detalles

Receptores celulares y vías de señalización

Receptores celulares y vías de señalización Receptores celulares y vías de señalización Dra. María Victoria Aguirre Prof. Titular Química Biológica II FaCENA- UNNE Objetivos Definir y clasificar a los receptores Caracterizar a los receptores intracelulares

Más detalles

HORMONAS CALCIOTROPAS

HORMONAS CALCIOTROPAS HORMONAS CALCIOTROPAS Sistema hormonal que contribuye a la homeostasis del calcio y fosfato: PARATOHORMONA CALCITONINA CALCITRIOL REGULACION DE LA HOMEOSTASIS DEL CALCIO Y DEL FOSFORO 3 CELULAS OB OB HUESO

Más detalles

MATERIALES Y MÉTODOS. Proteína PE_PGRS33

MATERIALES Y MÉTODOS. Proteína PE_PGRS33 MATERIALES Y MÉTODOS Proteína PE_PGRS33 La proteína PE_PGRS33 de Mycobacterium tuberculosis que se utilizó en este estudio, fue proporcionada amablemente por la Dra. Clara Inés Espitia Pinzón, del Departamento

Más detalles

Biología Celular y Molecular. Guía de TP Nro. 2. Mantenimiento de líneas celulares.

Biología Celular y Molecular. Guía de TP Nro. 2. Mantenimiento de líneas celulares. Biología Celular y Molecular. Guía de TP Nro. 2 Mantenimiento de líneas celulares. Introducción Una de las formas de crecimiento in vitro es el cultivo en monocapa. Cuando las células requieren la adhesión

Más detalles

TEMA 6. PURIFICACIÓN DE PROTEÍNAS

TEMA 6. PURIFICACIÓN DE PROTEÍNAS TEMA 6. PURIFICACIÓN DE PROTEÍNAS 1. Introducción 2. Métodos de rotura celular y extracción de proteínas 3. Métodos cromatográficos 4. Métodos electroforéticos 1. Introducción La mayor parte de las investigaciones

Más detalles

ELISA. Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes

ELISA. Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes ELISA Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes ELISA Enzyme Linked Immuno Sorbent Assay Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes

Más detalles

Curso de biología molecular CIMAT 2010

Curso de biología molecular CIMAT 2010 Curso de biología molecular CIMAT 2010 INTRODUCCIÓN Este curso-taller tiene como propósito mostrar de manera teórica y práctica algunos principios básicos de biología molecular e ingeniería genética. Conocerás

Más detalles

Biología Celular y Molecular. Guía de TP Nro. 3. Ensayos de proliferación, adhesión y migración celular in vitro.

Biología Celular y Molecular. Guía de TP Nro. 3. Ensayos de proliferación, adhesión y migración celular in vitro. Biología Celular y Molecular. Guía de TP Nro. 3 Ensayos de proliferación, adhesión y migración celular in vitro. Introducción La valoración de la proliferación celular y la citotoxicidad in vitro es, muchas

Más detalles

Guías Didácticas para el desarrollo de experimentos

Guías Didácticas para el desarrollo de experimentos Guías Didácticas para el desarrollo de experimentos 1) Obtención y cuantificación de tu propio ADN El ácido desoxirribonucleico, abreviado como ADN, es un tipo de ácido nucleico, una molécula que forma

Más detalles

Int. Cl. 7 : C12N 9/02. 72 Inventor/es: Kajiyama, Naoki. 74 Agente: Carvajal y Urquijo, Isabel

Int. Cl. 7 : C12N 9/02. 72 Inventor/es: Kajiyama, Naoki. 74 Agente: Carvajal y Urquijo, Isabel 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 249 794 1 Int. Cl. 7 : C12N 9/02 12 TRADUCCIÓN DE PATENTE EUROPEA T3 86 Número de solicitud europea: 9766.6 86 Fecha de presentación

Más detalles

38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa

38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa 38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa José Luis Caballero Repullo, Enriqueta Moyano, Juan Muñoz Blanco Departamento de Bioquímica y Biología Molecular, Campus

Más detalles

Universidad Austral de Chile Facultad de Ciencias Escuela de Química y Farmacia

Universidad Austral de Chile Facultad de Ciencias Escuela de Química y Farmacia Universidad Austral de Chile Facultad de Ciencias Escuela de Química y Farmacia PROFESOR PATROCINANTE: Dr. Rafael Burgos A. INSTITUTO : Farmacología y Morfofisiología FACULTAD : Ciencias Veterinarias PROFESOR

Más detalles

LA CELULA Y SU FUNCION BIOLOGIA

LA CELULA Y SU FUNCION BIOLOGIA LA CELULA Y SU FUNCION BIOLOGIA LA CELULA Organización de la célula n Citoplasma y Núcleo n Protoplasma La célula Evolución de la célula La célula Organización de la célula n Protoplasma: n Agua n Electrolitos

Más detalles

Láminas epiteliales y uniones célula a célula

Láminas epiteliales y uniones célula a célula Láminas epiteliales y uniones célula a célula Tomado y modificado de ALBERTS. B. BRAY D. JOHNSON A. LEWIS J. RAFF M. ROBERTS K. WALTER P.: Introducción a la Biología Celular (2ª edición 2006) Editorial

Más detalles

NUEVAS TERAPEÚTICAS: UTILIZACIÓN DEL PLASMA RICO EN PLAQUETAS

NUEVAS TERAPEÚTICAS: UTILIZACIÓN DEL PLASMA RICO EN PLAQUETAS NUEVAS TERAPEÚTICAS: UTILIZACIÓN DEL PLASMA RICO EN PLAQUETAS Conceptos generales de Citoquinas Señales biológicas y coordinación de: Funciones celulares Factores de crecimiento Factores de crecimiento

Más detalles

OLIMPÍADA ARGENTINA DE BIOLOGÍA APEB ÁREA DE ACTUALIZACIÓN Y PERFECCIONAMIENTO EN LA ENSEÑANZA DE LA BIOLOGÍA CONTINUIDAD Y CAMBIO DE LAS ESPECIES I:

OLIMPÍADA ARGENTINA DE BIOLOGÍA APEB ÁREA DE ACTUALIZACIÓN Y PERFECCIONAMIENTO EN LA ENSEÑANZA DE LA BIOLOGÍA CONTINUIDAD Y CAMBIO DE LAS ESPECIES I: MINISTERIO DE EDUCACIÓN, CIENCIA Y TECNOLOGIA UNIVERSIDAD NACIONAL DE RIO CUARTO FACULTAD DE CIENCIAS EXACTAS, FÍSICO - QUÍMICAS Y NATURALES DEPARTAMENTO DE CIENCIAS NATURALES OLIMPÍADA ARGENTINA DE BIOLOGÍA

Más detalles

El tipo de alteración observada también proporciona gran información:

El tipo de alteración observada también proporciona gran información: TEMA 5: ENZIMOLOGÍA CLÍNICA 1. Valor diagnóstico de las enzimas en el plasma. 2. Principios del análisis de enzimas 3. Análisis de isoenzimas. 4. Determinación enzimática de sustratos. 1. Valor diagnóstico

Más detalles

Para orientarnos en la comprensión del significado de la diferenciación celular nos basaremos en tres características esenciales:

Para orientarnos en la comprensión del significado de la diferenciación celular nos basaremos en tres características esenciales: 1 Facultad de Ciencias Médicas Dr. Salvador Allende. Diplomado en Morfofisiología. Encuentro No. 4. Modelos Celulares Objeto y método de estudio. La vida es el resultado del movimiento progresivamente

Más detalles

1. Diseño, elaboración de manuales y desarrollo de prácticas de las asignaturas del primer año de la titulación.

1. Diseño, elaboración de manuales y desarrollo de prácticas de las asignaturas del primer año de la titulación. Anexo I. 1. Diseño, elaboración de manuales y desarrollo de prácticas de las asignaturas del primer año de la titulación. a) Asignatura BIOQUÍMICA Esta asignatura es la primera en la que el alumno entra

Más detalles

Centro: Facultat de Ciències de la Salut i de la Vida. Universitat Pompeu Fabra

Centro: Facultat de Ciències de la Salut i de la Vida. Universitat Pompeu Fabra IDENTIFICACIÓN DE LOS FACTORES CELULARES QUE INTERACCIONAN CON LA PROTEÍNA VIF DEL VIRUS DE LA INMUNODEFICIENCIA ADQUIRIDA Investigador principal: Dr. Juan Sayós Ortega Centro: Facultat de Ciències de

Más detalles

1. Concepto de sistema tampón. Cita algunos ejemplos biológicos de tampones inorgánicos.

1. Concepto de sistema tampón. Cita algunos ejemplos biológicos de tampones inorgánicos. VALENCIA (COMUNIDAD VALENCIANA) / JUNIO 00. COU / BIOLOGIA / BIOMOLECULAS / OPCION A / EJERCICIO 1 OPCION A 1. Concepto de sistema tampón. Cita algunos ejemplos biológicos de tampones inorgánicos. La actividad

Más detalles

ADENDUM TEMA 1 RUTA FOSFATIDIL INOSITOL 3 QUINASA. 1.6.2.2 Ruta de la Fisfatidil inositol 3 quinasa (PI3K)

ADENDUM TEMA 1 RUTA FOSFATIDIL INOSITOL 3 QUINASA. 1.6.2.2 Ruta de la Fisfatidil inositol 3 quinasa (PI3K) ADENDUM TEMA 1 RUTA FOSFATIDIL INOSITOL 3 QUINASA 1.6.2.2 Ruta de la Fisfatidil inositol 3 quinasa (PI3K) Además de la ruta de las MAPK, descrita anteriormente, otra de las rutas que activan los receptores

Más detalles

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Para la purificación de ADN genómico de todos los kits de colección Oragene y ORAcollect. Visite nuestro sitio

Más detalles

Material sintético reabsorbible para regeneración ósea. Granulate

Material sintético reabsorbible para regeneración ósea. Granulate Material sintético reabsorbible para regeneración ósea Granulate Regeneración ósea con Sil-Oss Gránulos de es un material bioactivo y osteoconductor que estimula la completa regeneración del defecto óseo

Más detalles