Redalyc. Disponible en:

Tamaño: px
Comenzar la demostración a partir de la página:

Download "Redalyc. Disponible en:"


1 Redalyc Sistema de Información Científica Red de Revistas Científicas de América Latina, el Caribe, España y Portugal Kairiyama, Claudia;Benhaim, Marcela;Buresti, Patricia;Citatti, Sergio;Pengue, Claudia;Perroni, Nancy;Pittaluga, Sergio;Tonelli, María C. Detección de VIH proviral por nested-pcr utilizando metodología casera (in house) Bioquímica y Patología Clínica, Vol. 71, Núm. 1, -, 2007, pp Asociación Bioquímica Argentina Argentina Disponible en: Bioquímica y Patología Clínica ISSN (Versión impresa): Asociación Bioquímica Argentina Argentina Cómo citar? Número completo Más información del artículo Página de la revista Proyecto académico sin fines de lucro, desarrollado bajo la iniciativa de acceso abierto

2 REVISTA BIOQUIMICA Y PATOLOGIA CLINICA VOL 71 Nº Trabajo: págs Pág 49 Detección de VIH proviral por nested-pcr utilizando metodología casera (in house) Claudia Kairiyama 1 Marcela Benhaim 2 Patricia Buresti 3 Sergio Citatti 4 Claudia Pengue 5 Nancy Perroni 6 Sergio Pittaluga 7 María C. Tonelli 8 1 doctora en farmacia y bioquímica 2 bioquímica, Jefa de Laboratorio del Hospital Interzonal Eva Perón 3 bioquímica 4 bioquímico 5 bioquímica 6 licenciada en química 7 bioquímico 8 bioquímico Lugar de Trabajo: Laboratorio Central, Hospital Interzonal de Agudos Eva Perón, San Martín, Provincia de Buenos Aires Enviar Correspondencia a: Marcela Benhaim, Helguera 4445, C 1419 CUK Buenos Aires, , RESUMEN En este trabajo se estudió la sensibilidad de un método de detección de VIH proviral basado en una metodología de PCR anidada cualitativa como ayuda diagnóstica para infección por VIH neonatal. Para ello se estudiaron treinta pacientes con serología positiva VIH, con bajo recuento de linfocitos CD4 y, como control de número de copias capaces de detectar, se utilizó la línea linfoidea 8E5. Se amplificó por nested PCR dos regiones específicas del gen gag VIH. Como control de purificación y estado de conservación de la muestra se amplificó una región del gen constitutivo de β-globina. En los treinta casos se obtuvo amplificación gen gag de VIH para las dos regiones y para el control de β-globina y, para la línea 8E5, se obtuvo positividad para las tres bandas aun en el caso de sólo diez copias de VIH proviral. Se demuestra un alta sensibilidad para esta metodología in house, que la hace apta para su aplicación en diagnóstico pediátrico a un costo accesible para instituciones públicas. Palabras claves PCR anidada, sensibilidad, controles, diagnóstico, infección VIH SUMMARY We studied the sensibility of a proviral HIV detection method, based in a qualitative nested PCR methodology, as a neonatal HIV infection diagnostic tool. 30 hiv infected patients with low CD4 lymphocytes count were monitored and we used the 8E5 lymphoid line to control the number of copies capable of detection. Two specific regions of gag gene of HIV were amplified by nested PCR. For control of purification and preservation state of the sample we amplified a region of β-globin constitutive gene. All cases were positive for amplification of two regions of gag HIV gene and for control of β-globin, and with only 10 copies of proviral HIV, we found three positive bands in the 8E5 cellular line. This in house methodology, thus demonstrates a high sensibility, making it capable for application in pediatric diagnosis with an accessible cost in public institutions. Keywords nested PCR, sensibility, controls, diagnosis, HIV infection Revista ByPC. Incorporada al Latindex. ISSN Código Bibliográfico: RByPC Trabajo Recibido: Aceptado:

3 Detección de VIH proviral por nested-pcr utilizando metodología casera (in house) Introduccion: Es conocida la dificultad para arribar al diagnóstico de infección por VIH en niños menores de dieciocho meses, ya que la posible presencia de anticuerpos maternos no permite realizar técnicas serológicas, lo cual hace necesario el uso de técnicas de detección viral. Entre ellas, la PCR es la técnica más sensible y específica para la detección viral en lactantes. La prueba de antígeno p 24 disociado es desaconsejable para ser usada aisladamente para descartar infección y los cultivos virales resultan inaccesibles, debido a su complejidad, riesgo de contaminación y tiempo requerido para su correcta evaluación (1,2). En nuestro laboratorio se puso a punto una técnica casera (in house), casera, para la detección cualitativa de VIH proviral mediante una técnica de reacción en cadena de polimerasa PCR anidada (3). El objetivo de nuestro trabajo es estudiar la sensibilidad de este método mediante su aplicación en pacientes infectados con bajo conteo de células T CD4 y el uso de una línea linfoidea 8E5 con número de copias de VIH proviral conocidas como control. Metodo: Se estudiaron treinta pacientes VIH positivo con bajo rango CD4 entre 0 y 195 cél/μl. Como control de número de copias (1 genoma por cél) de DNA HIV proviral, se utilizó una línea linfoidea 8E5 (ATCC CRL- 8993) y se realizaron diluciones de 0, 1, 10,100 y 1000 células resuspendidas en un millón de linfocitos normales. La purificación de ADN genómico se realizó con columnas QiaGen a partir de 200 μl de buffy-coat, con citrato como anticoagulante, ó células resuspendidas en buffer fosfato salino. Se amplificaron dos regiones específicas del gen gag del VIH en dos pasos (fig. 1). Se utilizaron como primers externos JA4gag y JA7gag ; y como primers internos JA5gag , JA6gag , SK431gag y SK462gag (4,5) y (tabla 1). La amplificación que resulta de la nested PCR con los primers JA4, JA7y JA5, JA6 da una banda 131 bp y con los primers JA4, JA7 y Sk431,SK462 da una banda de 142 bp. Como control de purificación y estado de conservación de la muestra se amplificó una región del gen constitutivo β-globina con los primers GH20 y PC04 (210 bp). Los primers fueron sintetizados por Operon Biotechnologies. Se utilizó la enzima Hot Start de Fermentas y un ciclador Perkin Elmer Gene Amp PCR System 2400, donde se realizaron las dos amplificaciones sucesivas, para lo cual primero se activó la enzima durante cinco minutos a 95ºC y luego se cicló treinta veces: desnaturalización 30 seg. a 94º C, annealing 30 seg. a 41ºC y extensión 30 segundos a 72ºC. Las bandas específicas de amplificación se visualizaron al UV en un gel de agarosa 3%, teñido con Bromuro de etidio. El recuento de linfocitos CD4/CD8 se realizó por Citometría de Flujo (EPICS) Coulter, utilizando anti CD8FITC, anticd4 PE y anticd3 PC. En todos los casos se realizaron controles de calidad externo del Ministerio de Salud Pública de la Provincia de Buenos Aires, del PEEC y del Círculo Rioplatense de Citometría de Flujo. Resultados: En todos los casos 30/30 pacientes se observó amplificación para las dos bandas específicas del gen gag y para la banda control de β-globina (Figura 2 y Tabla 2). Para la línea celular 8E5 se obtuvo positividad para las tres bandas, aun en el caso de sólo diez copias de VIH proviral totales (Figura 3 y Tabla 2). En general se visualizó una intensidad mayor en la banda obtenida luego del la Nested con los primers SK431-SK462. Discusion: Según la clasificación propuesta por el CDC en 1994 y las recomendaciones emanadas de Ministerio de Salud de la Tabla 1: Oligonucleótidos para la detección de VIH por PCR. Primer Secuencia 5-3 Gen y localización JA 4 GAAGGCTTTCAGCCCAGAAG gag JA5 ACCATCAATGAGGAAGCTGC gag JA6 TATTTGTTCCTGAAGGGTAC gag JA7 TCTCCTACTGGGATAGGTGG gag SK462 AGTTGGAGGACATCAAGCAGCCATGCAAAT Gag SK431 TGCTATGTCAGTTCCCCTTGGTTCTCT Gag GH20 GAAGAGCCAAGGACAGGTAC β-globina PC04 CAACTTCATCCACGTTCACC β- Globina

4 REVISTA BIOQUIMICA Y PATOLOGIA CLINICA VOL 71 Nº Trabajo: págs Pág 51 Tabla 2: Resultados de las nested PCR`s en muestras de treinta pacientes VIH positivos con recuento de CD4/ul sangre entre 195-0, y en células 8E5 resuspendidas en 1x10 6 linfocitos normales (*). Las intensidades de las bandas específicas visualizadas en el gel de agarosa se especifican de la siguiente manera: (+++) muy fuerte, (++) fuerte, (+) regular, (+/-) baja y (-) nula. CD4 cel / ul β-globina gag Nested JA5-6 gag Nested SK / / / / /- +/ /- +/ Cél. 8E5 β-globina gag Nested JA5-6 gag Nested SK * * Nación, en niños nacidos de madre VIH positiva la infección por VIH se determina según los siguientes criterios: 1.- En menores de dieciocho meses: dos resultados positivos de PCR y/o aislamiento viral y/o antígeno p24 en sangre en dos muestras diferentes. 2.- En mayores de dieciocho meses: serología repetidamente positiva por métodos de tamizaje y confirmación por WB o IFI o con los criterios mencionados en 1. Considerando las técnicas recomendadas para menores de dieciocho meses, que es el motivo de nuestra preocupación, la determinación de antígeno p24 tiene una sensibilidad de aproximadamente un 45%, que la hace inaplicable para ser usada de manera aislada. El aislamiento del VIH por cultivos virales sigue siendo hoy en día una técnica de referencia con adecuada sensibilidad y especificidad, absolutamente necesaria cuando se necesita establecer la fenotipificación VIH, pero su empleo queda restringido a laboratorios muy bien equipados con complejos sistemas de contención biológica (nivel P3) y, por lo tanto, inaccesible para numerosos centros asistenciales. La técnica más ampliamente usada en centros de salud es la reacción en cadena de la polimerasa por tener una adecuada sensibilidad y especificidad y oportunidad en la entrega de resultados, a diferencia de la técnica de cultivo. En el caso de la PCR, el grado de estandarización de estas pruebas, así como la disponibilidad de reactivos, es desigual. La estandarización de ensayos caseros es en general laboriosa debido al número de variables que deben ajustarse

5 Detección de VIH proviral por nested-pcr utilizando metodología casera (in house) Figura 1: Esquema de los oligonucleótidos específicos para gag HIV-1 empleados en las nested PCR s. para su óptimo funcionamiento. Existen reactivos comerciales para PCR diagnóstica de VIH-1, pero sus precios siguen siendo muy elevados, ya que también incluyen el costo de la aparatología que sólo puede ser utilizado para esos kits. También es una dificultad real en el uso de técnicas PCR la falta de criterios internacionalmente aceptados en la validación de resultados, por lo que debe considerarse en forma escrupulosa cada caso clínico en particular. En un estudio anterior efectuado entre los años 2001 y 2003 en nuestro Hospital sobre la metodología de VIH PCR casera empleada en este trabajo, evaluamos en ciento cuarenta casos la sensibilidad clínica de este ensayo, analizados según el Test de Bayes. Ciento ocho casos corresponden a niños menores de dieciocho meses nacidos de madres portadoras del VIH, otros dieciocho casos eran pacientes adultos con más de un ELISA VIH positivo pero WB indeterminado, nueve de pacientes con sintomatología y clínica sospechosa pero serología negativa; y cinco casos provenientes de accidente laboral relacionado con fuente VIH positiva. De los ciento ocho casos pediátricos analizados, se obtuvieron amplificación específica de la región gag en seis casos (5,6 %); de estos seis casos, 5/6 provenían de niños cuyas madres y neonato no habían recibido profilaxis antirretroviral (ARV) o la habían recibido de manera incompleta. De dieciocho casos con serología por WB indeterminado, catorce (77/%) resultaron positivos por esta metodología siendo pacientes con SIDA en etapa terminal, y de los otros cuatro casos, tres eran mujeres en período de embarazo o puerperio. De nueve pacientes con sintomatología y clínica sospechosa pero serología negativa, sólo uno (11%) resultó positivo por esta técnica. En todos los casos de PCR negativa, luego se demostró una etiología no relacionada con VIH o ausencia de infección por VIH. Finalmente, los cinco casos provenientes de exposiciones ocupacionales arrojaron resultados negativos. La sensibilidad en ese estudio resultó del 100 % y la especificidad diagnóstica mayor del 95 %, por lo que representó una herramienta de suma utilidad como ayuda diagnóstica en casos de VIH pediátricos y WB indeterminado. No se registraron casos de falsos negativos. A pesar de que los resultados previos sobre la utilidad clínica de esta metodología fueron realmente alentadores, en este nuevo trabajo nos abocamos a desarrollar controles de sensibilidad que nos permitieran fijar los límites de detec- Figura 2: Detección de VIH-1 proviral en sangre de pacientes infectados con bajo recuento de CD4. Electroforesis en gel de agarosa 3% de productos esperados del segundo round de PCR, 131bp (nested JA5/JA6) y 142bp (nested SK431/SK462). Calle: 1) control VIH-1 positivo, 2) 0 CD4/ul, 3) y 4) 3 CD4/ul, 5) 6 CD4/ ul y 6) 49 CD4/ul. Figura 3: Detección de copias de VIH-1 proviral en células linfoideas 8E5 por nested PCR. Electroforesis en gel de agarosa 3% de productos esperados del segundo round de PCR, 131bp (nested JA5/JA6) y 142bp (nested SK462/ SK431); y PCR de B-Globina 260bp. Calles: 1) control VIH-1 positivo, 2) 1 copia, 3) 10 copias, 4) 100 copias, 5) 1000 copias y 6) 0 copias de VIH-1 proviral 8E5.

6 REVISTA BIOQUIMICA Y PATOLOGIA CLINICA VOL 71 Nº Trabajo: págs Pág 53 ción en cuanto a número de copias virales y a la presencia de células CD4 en los pacientes investigados. Está ya demostrado que los principales blancos para infección por VIH son los linfocitos T helpers CD4. (6), aunque no todas las subpoblaciones presentan la misma susceptibilidad. Los linfocitos TH1 serían menos proclives a la infección viral que los TH0 y TH2 (7 y 8) y, en cambio, los linfocitos CD4 de memoria son más susceptibles (9). A pesar de que los linfocitos CD4, como vemos, son los principales blancos para la infección viral, otras células también están involucradas, como por ejemplo macrófagos y células dendríticas (10 y 11). Por la especial importancia de las células CD4 en la progresión de la infección, pareció oportuno probar la respuesta de nuestra metodología casera frente a pacientes con valores muy diversos de células CD4. Los resultados obtenidos demuestran que aun en uno de los dos casos en que no se detectaron en sangre células CD4, obtuvimos una positividad franca en las bandas y, en el otro, una positividad débil. La línea celular usada en este trabajo como control del límite de detección de la PCR nested fue la 8E5 de origen humano, de estirpe linfoblástica, que contiene un solo genoma defectivo proviral de VIH por célula. Pudimos comprobar que nuestra técnica tiene un límite de detección adecuado, ya que se detectó positividad a partir de 10 copias de HIV proviral por muestra. Comparando con técnicas comerciales (13), la performance de nuestra técnica in house demostró ser sensible, rápida y confiable para la detección de infección por VIH y su puesta en marcha nos permitió mejorar el diagnóstico clínico en aquellos casos en que los métodos serológicos son inaplicables. Bibliografía: 1. Ministerio de Salud de la Nación. Recomendaciones para el diagnóstico y tratamiento de VIH SIDA en Pediatría, Ministerio de Salud de la Nación. Recomendación para la Prevención de la transmisión perinatal de VIH. Unidad Coordinadora Ejecutora VIH/SIDA/ETS Argentina, noviembre de Kairiyama C., Canella V., Corazza R., Tonelli C., Pallone E. y Benhaim M. Aplicación de HIV DNA PCR in house como ayuda-diagnóstico de infección por HIV. Ponencia presentada a las Jornadas de Actualización Científica del Hospital Eva Perón de San Martín, noviembre de Albert, Jan Fenyo, Eva Maria. Simple, Sensitive, and Specific Detection of Human Immunodeficiency Virus Type 1 in Clinical Specimens by Polimerase Chain Reaction with Nested Primers, Journal of clinical microbiology, July 1990, pp Kwok, Shirley Sninsky, John. PCR Detection oh Human Immunodeficiency Virus Type 1 Proviral DNA Sequences, en David H. Persing et al. edd. Diagnostic Molecular Microbiology. Principles and Applications. American Society for Microbiology, 1993, pp Klatzmann D., Barre Sinoussi M.T., Nugeyre C., Dauquet E., Vilmer C., Griscelli F., Brun-Vezinet C., Rouzioux J., Gluckman J., Chermann J. Selective tropism of lymphadenopathy-associated virus for helper-inducer T-lymphocytes, Science 225 (1984), Clerici M., Balotta C., Moroni L., Ferrario E., Riva C., Trabattoni D., Rodolfo A., Villa M., Shearer G., Moroni M., Galli M. Type I cytokine production and low prevalence of viral isolation correlate with long-term non-progression in HIV infection AIDS, Res Hum Retro 12 (1996), Maggi E., Mazzetti M., Ravina A.,Annunziato F., de Carli M., Piccinni P., Manetti R., Carbonari M., Pesce A., del Prete G., Romagnani S. Ability of HIV to promote a TH1 to TH0 shift and to replicate preferentially in TH2 and TH0 cells, Science 265 (1994), Adleman L., Wofsy D., T cell homeostasis: implications in HIV infection, J AIDS 6 (1993) Gartner S., Markovitz D., Kaplan M., Gallo R., Popovic, M. The role of mononuclear phagocytes in HTLV-III/LAV infection, Science 233 (1986), Patterson S., Knight S. Susceptibility of human peripheral blood dendritic cells to infection by human immunodeficiency virus J, Gen Virol 68 (1987), , 12. Kabamba-Mukadi, Benoît 1 ; Henrivaux, Philippe 2 ; Ruelle, Jean 1 ; Delferrière, Nicole 1 ; Bodéus, Monique 1, Goubau, Patrick. Human immunodeficiency virus type 1 (HIV-1) proviral DNA load in purified CD4+ cells by LightCycler Real-time PCR. BMC Infect Dis. 2005; 5: 15. Agradecimientos: Agradecemos especialmente a la doctora Moira Vignoles del Centro Nacional de Referencia para el SIDA, Facultad de Medicina UBA, por proveernos de los controles de 8E5.

Algoritmos diagnósticos para VIH

Algoritmos diagnósticos para VIH Algoritmos diagnósticos para VIH ALGORITMOS DIAGNÓSTICOS PARA VIH Los avances tecnológicos de los distintos ensayos para el tamizaje y diagnóstico de la infección por VIH, conjuntamente con la necesidad

Más detalles

Diagnóstico microbiológico de la infección por HIV

Diagnóstico microbiológico de la infección por HIV Diagnóstico microbiológico de la infección por HIV Juan Carlos Rodríguez Díaz S. Microbiología Hospital General Universitario de Alicante E-mail: http://microbiologí

Más detalles

Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio

Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio El VIRUS PRUEBAS PRESUNTIVAS ELISA: es la prueba convencional para la detección

Más detalles

NOCIONES DE EPIDEMIOLOGÍA Y DIAGNOSTICO DE HIV. Dra G Carballal Laboratorio de Virología Clínica CEMIC, 2009

NOCIONES DE EPIDEMIOLOGÍA Y DIAGNOSTICO DE HIV. Dra G Carballal Laboratorio de Virología Clínica CEMIC, 2009 NOCIONES DE EPIDEMIOLOGÍA Y DIAGNOSTICO DE HIV Dra G Carballal Laboratorio de Virología Clínica CEMIC, 2009 La Pandemia de SIDA Personas que viven con el HIV/SIDA Total 40 millones Adultos 38 Niños 2 Nuevas

Más detalles

APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR. Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina

APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR. Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina BiologÍa Molecular: es una disciplina que se enfoca principalmente en el estudio

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60.

Más detalles


5-MARCO DE REFERENCIA 5-MARCO DE REFERENCIA Para hablar de pruebas diagnosticas es necesario el conocimiento de ciertos términos que a continuación se describen. Sensibilidad: Es la probabilidad de obtener una prueba positiva

Más detalles

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

Facultad de Ciencias Bioquímicas y Farmacéuticas Área de Integración n Disciplinar y Estudio de la Problemática Profesional TPP I Unidad 2 Aspectos biológicos del VIH Algunos datos importantes 1959 Se

Más detalles



Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

PRUEBA RAPIDA EN EMBARAZADAS (n=62,214 2009-Junio 2010) NO REACTIVO n=218 REACTIVO INDETERMINADO. Tabla 9: Resultados Prueba rápida

PRUEBA RAPIDA EN EMBARAZADAS (n=62,214 2009-Junio 2010) NO REACTIVO n=218 REACTIVO INDETERMINADO. Tabla 9: Resultados Prueba rápida 11-RESULTADOS 11.1-Interpretación y análisis de resultados Un total de de 62,214 mujeres embarazadas se realizaron la prueba rápida de VIH durante años 2009 hasta junio 2010 (Tabla 9). De ellas, 61,808

Más detalles

Carga viral y subpoblaciones linfocitarias en la infección con VIH- 1. Comparación entre sus determinaciones basales

Carga viral y subpoblaciones linfocitarias en la infección con VIH- 1. Comparación entre sus determinaciones basales Revista Mexicana de Patología Clínica 1998; Volumen 45(3): 159-161 Carga viral y subpoblaciones linfocitarias en la infección con VIH- 1. Comparación entre sus determinaciones basales NOHEMI PATRICIA CASTILLO

Más detalles

CONVENIO 036 de 2012

CONVENIO 036 de 2012 CONVENIO 036 de 2012 Guía de Práctica Clínica basada en la evidencia científica para la atención integral del VIH/Sida en niñas y niños. Guía de práctica clínica basada en la evidencia científica para

Más detalles

Técnicas moleculares.

Técnicas moleculares. Técnicas moleculares. DMTV Carolina Acevedo Curso de Microbiología 2015 SÍNTESIS IN VITRO DE UNA GRAN CANTIDAD DE COPIAS DE UN SEGMENTO DE ADN EXISTENTE EN UNA MUESTRA. O sea. Amplificamos en forma exponencial

Más detalles

Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional

Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional BIOQ. LILIANA DI TULLIO BUDASSI FAC. CS.BIOQUÍMICAS Y FARMACÉUTICAS UNIVERSIDAD NACIONAL DE ROSARIO

Más detalles

11.2-DISCUSIÓN Prueba rápida

11.2-DISCUSIÓN Prueba rápida 11.2-DISCUSIÓN Prueba rápida Como se observa en la tabla 9 del total de las embarazadas (62,214) a las que se les realizo la prueba rápida un 99.3%(61,808) de ellas dio como resultado no reactivo, tan

Más detalles



Más detalles

Resultados confirmación de infección por VIH. Chile, 2009-2012.

Resultados confirmación de infección por VIH. Chile, 2009-2012. 1 Boletín Vol. 3, No. 2, Enero 2013. Resultados confirmación de infección por VIH. Chile, 2009-2012. 1. Antecedentes El virus de la inmunodeficiencia humana (VIH) pertenece a la familia de los retrovirus,

Más detalles

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental.

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Gemma Saucedo. Laboratorio Aguas de Barcelona 22-23 de noviembre de 2006 Introducción PCR: Polymerase Chain Reaction

Más detalles

Licda. Yarisel Rodríguez Mgtra. Dalis Mojica ICGES/LCRSP


Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles


PRÁCTICAS DE MICROBIOLOGIA CLINICA PRÁCTICAS DE MICROBIOLOGIA CLINICA Juan Carlos Rodríguez Hospital General Universitario de Alicante E-mail: CASO CLINICO: Rubéola Evolución

Más detalles

Guía de Detecció n y Diagnó sticó Integral de VIH/SIDA

Guía de Detecció n y Diagnó sticó Integral de VIH/SIDA Guía de Detecció n y Diagnó sticó Integral de VIH/SIDA Ciudad de México, 2011 Guía de Detección y Diagnóstico Integral de VIH/SIDA - 1 - Índice Antecedentes 3 Objetivos 5 Definiciones operativas 5 Resumen

Más detalles

La Biología Molecular Aplicada a la detección de patógenos en alimentos

La Biología Molecular Aplicada a la detección de patógenos en alimentos La Biología Molecular Aplicada a la detección de patógenos en alimentos La detección fiable y rápida de microorganismos patógenos en el mercado alimentario es de especial importancia no sólo por sus efectos

Más detalles


PERFIL DE LOS NUEVOS CABA 2010-2011 PERFIL DE LOS NUEVOS DIAGNÓSTICOS CABA 2010-2011 Distribución de las notificaciones según sexo y estadio clínico al momento del diagnóstico CABA 2010-2011 Estadio % mujeres % hombres SRA 1,9 1,8 Asintomático

Más detalles

Pruebas rápidas r. Estrategias preventivas. Propuesta de nuevas estrategias preventivas

Pruebas rápidas r. Estrategias preventivas. Propuesta de nuevas estrategias preventivas XV ENCUENTRO ESTATAL PARA ONG s Madrid, 1-3 de Octubre 2009 Diagnóstico tardío o. Pruebas rápidas r Dra Carmen Rodríguez Centro Sanitario Sandoval Madrid Estrategias preventivas La prevención de nuevas

Más detalles


DIAGNÓSTICO DE CMV CONGÉNITO POR NESTED-PCR DIAGNÓSTICO DE CMV CONGÉNITO POR NESTED-PCR obertrand, María Victoria oflores, Antonio Ezequiel ogoyechea, Roxana María Itatí omartinez, Silvina María Inmunología Clínica 2009 CITOMEGALOVIRUS: CARACTERISTICAS

Más detalles


PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH Blga. Gisely Hijar Guerra Coordinación del Laboratorio de Biotecnología y Biología Molecular. Responsable de los Procesos de la Prueba

Más detalles


DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino DIAGNOSTICO VIROLOGICO MOLECULAR Dr. Gerardo Andino DIAGNÓSTICO MOLECULAR La tecnología empleada para la detección de genomas virales mediante la amplificación de secuencias específicas (PCR y reacciones

Más detalles

infección por el virus.

infección por el virus. Utilización de distintos reactivos y metodologías para el estudio de Anticuerpos anti HTLV- I/II en donantes de sangre José, A. (*); Orofino, M. T. (*); Murlo, P. (**); García, C. (**) (*) Bioquímica.

Más detalles

Métodos de determinación del virus del papiloma humano (HPV) en cribado de cáncer de cérvix

Métodos de determinación del virus del papiloma humano (HPV) en cribado de cáncer de cérvix Métodos de determinación del virus del papiloma humano (HPV) en cribado de cáncer de cérvix Beatriz Bellosillo Servicio de Anatomía Patológica Hospital del Mar, Barcelona Virus del Papiloma Humano- HPV

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles


DIAGNÓSTICO DE LABORATORIO DE DENGUE EN PANAMÁ DIAGNÓSTICO DE LABORATORIO DE DENGUE EN PANAMÁ TM Brechla Moreno A. Instituto Conmemorativo Gorgas de Estudios de la Salud, Panamá Departamento de Virología y Biotecnología 2013 TÉCNICAS PARA LA DETECCIÓN

Más detalles

Profilaxis de accidentes post exposición a sangre o derivados

Profilaxis de accidentes post exposición a sangre o derivados Universidad de Buenos Aires - Facultad de Odontología - Hospital Odontológico Universitario 2009 Profilaxis de accidentes post exposición a sangre o derivados La actual información está fundamentada en

Más detalles


ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles

Perinatal Transmisión al bebé, durante el embarazo, parto o lactancia.

Perinatal Transmisión al bebé, durante el embarazo, parto o lactancia. Dr. Horacio Salomón Investigador Principal del CONICET Director del INBIRS (Ex-CNRSIDA) UBA-CONICET Contacto sexual Relaciones sexuales sin protección por contacto directo con fluidos corporales como secreciones

Más detalles

Propuesta de nuevos algoritmos para el diagnóstico de VIH

Propuesta de nuevos algoritmos para el diagnóstico de VIH Propuesta de nuevos algoritmos para el diagnóstico de VIH Propuesta de nuevos algoritmos para el diagnóstico de VIH Autores Bioq. María Belén Bouzas Jefa de División Análisis Clínicos. Hospital de Infecciosas

Más detalles

PCR? PCR en el diagnóstico? Objetivo: Obtener un gran número de copias de un fragmento particular de ADN a partir de una cantidad mínima original.

PCR? PCR en el diagnóstico? Objetivo: Obtener un gran número de copias de un fragmento particular de ADN a partir de una cantidad mínima original. PCR? Objetivo: Obtener un gran número de copias de un fragmento particular de ADN a partir de una cantidad mínima original. PCR en el diagnóstico? A partir de una mezcla compleja de ADN, se puede realizar

Más detalles

Diagnóstico Serológico de Sífilis Técnicas treponémicas

Diagnóstico Serológico de Sífilis Técnicas treponémicas Diagnóstico Serológico de Sífilis Técnicas treponémicas T.M. Rodrigo Colina Morales Laboratorio de Infecciones de Transmisión Sexual Sección Bacteriología Mayo 2014 FTA-ABS (Fluorescent Treponemal Antibody

Más detalles

Tuberculosis: Problema global de salud pública que afecta a 1/3 de la población mundial.

Tuberculosis: Problema global de salud pública que afecta a 1/3 de la población mundial. Tuberculosis: Problema global de salud pública que afecta a 1/3 de la población mundial. RADIOGRAFÍA DE TÓRAX HISTORIA CLÍNICA PRUEBA DE TUBERCULINA En la infancia, hay más susceptibilidad a la enfermedad

Más detalles



Más detalles


PROTOCOLO: ENFERMEDAD DE CHAGAS Y GESTACIÓN 1 PROTOCOLO: ENFERMEDAD DE CHAGAS Y GESTACIÓN Unidad de Infecciones Perinatales, Servicio de Medicina Materno-Fetal. Institut Clínic de Ginecologia, Obstetrícia i Neonatologia, Hospital Clínic de Barcelona

Más detalles

VIH / sida prevención y atención sanitaria P R O C E S O S Definición funcional Proceso que tras la identificación de una situación o práctica de riesgo, conduce a: La programación de medidas preventivas

Más detalles

Pontificia Universidad Católica del Ecuador

Pontificia Universidad Católica del Ecuador Av. 1 de Octubre 1076 y Roca Apartado postal 17-01-184 Fax: 59 99 16 56 Telf: 59 99 15 5 1. DATOS INFORMATIVOS: MATERIA O MÓDULO: CÓDIGO: 160 INMUNODIAGNOSTICO DE MICROORGANISMOS T-L CARRERA: Microbiología

Más detalles


DETERMINACIÓN DEL FACTOR Rh por PCR Ref.PCRRh DETERMINACIÓN DEL FACTOR Rh por PCR 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

TIPIFICACION HLA. Bioq. Eliana Palomino Lab. De Histocompatibilidad Hospital Privado

TIPIFICACION HLA. Bioq. Eliana Palomino Lab. De Histocompatibilidad Hospital Privado TIPIFICACION HLA Bioq. Eliana Palomino Lab. De Histocompatibilidad Hospital Privado Tipificación HLA: Estudio mediante el cual se determina cuales de todas las variantes conocidas del locus HLA están presentes

Más detalles

8 Congreso Argentino de Salud Integral del Adolescente. Dr. Eduardo Rubinstein. Hospital Francisco J. Muñiz Adolescencia

8 Congreso Argentino de Salud Integral del Adolescente. Dr. Eduardo Rubinstein. Hospital Francisco J. Muñiz Adolescencia 8 Congreso Argentino de Salud Integral del Adolescente Dr. Eduardo Rubinstein Hospital Francisco J. Muñiz Adolescencia VIH EN ADOLESCENTES: QUE HAY DE NUEVO? En diagnóstico de infección por VIH En seguimiento

Más detalles



Más detalles

Analizador portátil til CD4. Solución innovadora y revolucionaria para el seguimiento de pacientes HIV positivos

Analizador portátil til CD4. Solución innovadora y revolucionaria para el seguimiento de pacientes HIV positivos Analizador portátil til CD4 Solución innovadora y revolucionaria para el seguimiento de pacientes HIV positivos Qué es PIMA? Es la primer solución point-of-care para el análisis de CD4. Diseñado para desempeñarse

Más detalles

Problemas en el Diagnostico de la Infección VIH. Diplomado de Atención Integral del VIH-SIDA. 2007

Problemas en el Diagnostico de la Infección VIH. Diplomado de Atención Integral del VIH-SIDA. 2007 Problemas en el Diagnostico de la Infección VIH Diplomado de Atención Integral del VIH-SIDA. 2007 Algunas Generalidades Sub - tipos del VIH y pruebas de laboratorio Analogía del VIH 1 y 2 es de: 40-60%

Más detalles


PRINCIPIO DE LA PRUEBA: USO PREVISTO: ESPECIFICACIONES DEL KIT: Cat. No Cantidad Reactivo Almacenamiento ADRT0011 1 x 20 PRUEBAS 1 x 3 ml Diluente USO PREVISTO: HIV 2-30 C El HIV-1/2 Plus Combo Rapid Test es un inmunoensayo de flujo lateral

Más detalles

Rol del Laboratorio en el Diagnóstico. CMV en pacientes transplantados. Bioquímica Mariela Merkt

Rol del Laboratorio en el Diagnóstico. CMV en pacientes transplantados. Bioquímica Mariela Merkt Rol del Laboratorio en el Diagnóstico y Prevención n de la Infección n por CMV en pacientes transplantados Bioquímica Mariela Merkt CMV: Características Familia β Herpesviridae DNA doble cadena Virus envuelto

Más detalles

Hepatitis viral tipo C (HCV) RT-PCR

Hepatitis viral tipo C (HCV) RT-PCR Hepatitis viral tipo C (HCV) RT-PCR Celía, Alejandro Fabián Taborda, Florencia Ines Características Generales del HCV Agente etiológico de las HNANB transmitidas por transfusiones Flia: Flaviviridae Género:

Más detalles


DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082 Página 1 de 5 1. OBJETIVO Detectar la presencia de Campylobacter jejuni en hamburguesa de pollo mediante técnica de PCR. 2. CAMPO DE APLICACIÓN Y ALCANCE Aplicar este procedimiento a muestras de hamburguesa

Más detalles



Más detalles

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras METODOLOGIA DEL PCR Lic. Jorge Mato Luis Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras Desnaturalización del DNA 5 A G G T T A G T G G A C C C T T G A T 3 3 T C C A

Más detalles

COQUELUCHE: Actualización 2011


Más detalles

PRUEBA DE VIH. Universidad de Panamá USAID Proyecto Capacity Centroamérica

PRUEBA DE VIH. Universidad de Panamá USAID Proyecto Capacity Centroamérica PRUEBA DE VIH Universidad de Panamá USAID Proyecto Capacity Centroamérica Es la prueba de detección que produce los resultados rápidamente, en aproximadamente 20 minutos y utiliza sangre de una vena o

Más detalles

Métodos de laboratorio para el diagnóstico pediátrico del VIH

Métodos de laboratorio para el diagnóstico pediátrico del VIH Métodos de laboratorio para el diagnóstico pediátrico del VIH Presidenta de la Nación Dra. Cristina Fernández de Kirchner Ministro de Salud Dr. Juan Luis Manzur Secretario de Promoción y Programas Sanitarios

Más detalles



Más detalles

GUIAS DE ATENCION EN VIH SIDA. Madeleyne Jaramillo Zapata Enfermera, Universidad de Antioquia Mg. En Administración en salud, Universidad CES

GUIAS DE ATENCION EN VIH SIDA. Madeleyne Jaramillo Zapata Enfermera, Universidad de Antioquia Mg. En Administración en salud, Universidad CES GUIAS DE ATENCION EN VIH SIDA Madeleyne Jaramillo Zapata Enfermera, Universidad de Antioquia Mg. En Administración en salud, Universidad CES VIH en cifras En 2011, el Programa de las Naciones Unidas sobre

Más detalles



Más detalles

Detección del virus de inmunodeficiencia humana tipo 1 mediante la PCR, en neonatos de madres seropositivas

Detección del virus de inmunodeficiencia humana tipo 1 mediante la PCR, en neonatos de madres seropositivas Revista de la Sociedad Venezolana de Microbiología 2007; 27:79-84 Artículo original Detección del virus de inmunodeficiencia humana tipo 1 mediante la PCR, en neonatos de madres seropositivas Pierina D

Más detalles

Autores Bioq. María Belén Bouzas Jefa de División Análisis Clínicos. Hospital de Infecciosas Francisco Muñiz.

Autores Bioq. María Belén Bouzas Jefa de División Análisis Clínicos. Hospital de Infecciosas Francisco Muñiz. Autores Bioq. María Belén Bouzas Jefa de División Análisis Clínicos. Hospital de Infecciosas Francisco Muñiz. Bioq. Analia Cudola Jefa de Departamento Laboratorio Central. Ministerio de Salud Pública de

Más detalles


ESTUDIOS DE POBLACIONES Y SUBPOBLACIONES LINFOCITARIAS POR CMF ESTUDIOS DE POBLACIONES Y SUBPOBLACIONES LINFOCITARIAS POR CMF Dra. Mónica Saracco Instituto de Investigaciones Biomédicas en Retrovirus y SIDA (ex CNRS) Aplicaciones Clínicas Analisis de subpoblaciones

Más detalles

Brote de Enterovirus D68- EEUU 2014 Perspectiva laboratorio

Brote de Enterovirus D68- EEUU 2014 Perspectiva laboratorio Brote de Enterovirus D68- EEUU 2014 Perspectiva laboratorio Allan Nix Jefe de equipo Laboratorio de Picornavirus Rama de laboratorio de Polio y Picornavirus Webinar OPS / SARInet 6 de noviembre de 2014

Más detalles


FORMATO 1. ASIGNATURA FORMATO 1. ASIGNATURA Nombre de la asignatura: MCBA-0707-ITEL Técnicas Biotecnológicas de Diagnóstico Línea de investigación o trabajo: Biotecnología en Ciencia Animal - Horas prácticas - Horas trabajo

Más detalles


ACTUALIZACIÓN EN DENGUE Y CHIKUNGUNYA ACTUALIZACIÓN EN DENGUE Y CHIKUNGUNYA Diagnóstico de las infecciones por DENV y CHIKV María Gabriela Barbás Bioq. Esp.en Virología Jefa del Servicio Bioquímico Laboratorio Central de la Provincia de Córdoba

Más detalles

Nuevos ensayos moleculares de la tecnología SUMA para el diagnóstico de las hepatitis B y C

Nuevos ensayos moleculares de la tecnología SUMA para el diagnóstico de las hepatitis B y C Nuevos ensayos moleculares de la tecnología SUMA para el diagnóstico de las hepatitis B y C MSc. Anny Armas Cayarga Laboratorio de Biología Molecular Centro de Inmunoensayo Octubre 16, 2015 Qué es el diagnóstico

Más detalles

Aplicación del PCR-ADN en el diagnóstico de la infección por VIH-1 en infantes PCR for diagnosis of HIV-1 infection in infants

Aplicación del PCR-ADN en el diagnóstico de la infección por VIH-1 en infantes PCR for diagnosis of HIV-1 infection in infants TRABAJO CIENTÍFICO ORIGINAL Rev Med Hond 2003; 71:123-130 Aplicación del PCR-ADN en el diagnóstico de la infección por VIH-1 en infantes PCR for diagnosis of HIV-1 infection in infants Ivette Lorenzana

Más detalles

DOCUMENTO ALCANCE Y OBJETIVOS Actualización de la guía de práctica clínica basada en la evidencia científica, para la atención de la infección por

DOCUMENTO ALCANCE Y OBJETIVOS Actualización de la guía de práctica clínica basada en la evidencia científica, para la atención de la infección por DOCUMENTO ALCANCE Y OBJETIVOS Actualización de la guía de práctica clínica basada en la evidencia científica, para la atención de la infección por VIH en niños y niñas menores a 13 años; según los lineamientos

Más detalles

Nuevos enfoques diagnósticos de la infección por VIH

Nuevos enfoques diagnósticos de la infección por VIH Nuevos enfoques diagnósticos de la infección por VIH Santiago Estrada M.D Laboratorio Clínico VID Agosto 28 de 2015 Hoja informativa para los pacientes que solicitan una prueba de VIH Recomendaciones para

Más detalles


2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA BIOLOGIA MOLECULAR Hemos elaborado un programa en 3 niveles, en función del tipo de estudiante y las posibilidades del centro educativo: 1. NIVEL BASICO 2. NIVEL MEDIO DANAEXTRACTOR KIT Práctica que constituye

Más detalles

Investigador principal: Dr. Jordi Casabona Barbarà. Centro: Hospital Universitari Germans Trias i Pujol. Duración: 3 años MEMORIA FINAL. 1.


Más detalles



Más detalles


Redalyc ARMENDÁRIZ, ESPERANZA Redalyc Sistema de Información Científica Red de Revistas Científicas de América Latina, el Caribe, España y Portugal ARMENDÁRIZ, ESPERANZA Entrevista al doctor Mario Alberto Rocha Peña Ciencia UANL, vol.

Más detalles

Nuevo algoritmo diagnóstico de la Infección por VIH

Nuevo algoritmo diagnóstico de la Infección por VIH Nuevo algoritmo diagnóstico de la Infección por VIH Dra. Manuelita Zavala Pineda Médico Adscrito Servicio Infectología Hospital General de México Dr. Eduardo Liceaga Marcadores inmunológicos y virológicos

Más detalles


PCR EN TIEMPO REAL, UNA HERRAMIENTA EN EL PACIENTE TRASPLANTADO PCR EN TIEMPO REAL, UNA HERRAMIENTA EN EL PACIENTE TRASPLANTADO Dra. Carolina Rodríguez Laboratorio Dr. Stamboulian División Biología Molecular Introducción En la actualidad, el paciente trasplantado,

Más detalles

El laboratorio de Microbiología y Parasitología en el diagnóstico de las enfermedades tropicales importadas

El laboratorio de Microbiología y Parasitología en el diagnóstico de las enfermedades tropicales importadas El laboratorio de Microbiología y Parasitología en el diagnóstico de las enfermedades tropicales importadas Juan Carlos Rodríguez S. Microbiología Hospital General Universitario de Alicante Universidad

Más detalles

Experiencias en Q-PCR para la aplicación y diagnóstico en Medicina Humana

Experiencias en Q-PCR para la aplicación y diagnóstico en Medicina Humana Experiencias en Q-PCR para la aplicación y diagnóstico en Medicina Humana MSc. Gonzalo Manrique Laboratorio de Biología Molecular Asociación Española Junio de 2009 INDICE INTRODUCCION (conceptos básicos,

Más detalles

Unidad de Enfermedades Infecciosas. Servicio de Medicina Interna. Complejo Hospitalario Universitario de Santiago de Compostela

Unidad de Enfermedades Infecciosas. Servicio de Medicina Interna. Complejo Hospitalario Universitario de Santiago de Compostela PACIENTE CON SINDROME MENINGEO Y EXANTEMA Caso presentado por: E. Losada, A. Antela, A. Prieto. Unidad de Enfermedades Infecciosas. Servicio de Medicina Interna. Complejo Hospitalario Universitario de

Más detalles



Más detalles


PROCALCITONINA COMO MARCADOR DE INFECCIÓN NEONATAL PROCALCITONINA COMO MARCADOR DE INFECCIÓN NEONATAL V. Roqués, C Fernández, M Gormaz y M.A. Cabezas Servicio de Neonatología. Hospital Universitario La Fe. Valencia PCT. Procalcitonina PCR. Proteína C Reactiva

Más detalles

7.012 Serie de ejercicios 5

7.012 Serie de ejercicios 5 Nombre Grupo 7.012 Serie de ejercicios 5 Pregunta 1 Al estudiar los problemas de esterilidad, usted intenta aislar un hipotético gen de conejo que explique la prolífica reproducción de estos animales.

Más detalles

Reacción en cadena de la polimerasa (PCR)

Reacción en cadena de la polimerasa (PCR) Dr. Alejandro Leal Reacción en cadena de la polimerasa (PCR) La reacción en cadena de la polimerasa (PCR, por sus siglas en inglés de "polymerase chain reaction") es un método de amplificación in vitro

Más detalles



Más detalles

Vigilancia epidemiológica en salud pública de la transmisión madre - niño del VIH

Vigilancia epidemiológica en salud pública de la transmisión madre - niño del VIH NTS para la Vigilancia Epidemiológica en Salud Pública de la Infección por el VIH y de las ITS en el Perú Vigilancia epidemiológica en salud pública de la transmisión madre - niño del VIH Dra. Mary Reyes

Más detalles

Herramientas diagnós.cas para la determinación de alérgenos en alimentos. Mgr., Bqca. Patricia Silvina Knass Romer Labs La:n America Adviser

Herramientas diagnós.cas para la determinación de alérgenos en alimentos. Mgr., Bqca. Patricia Silvina Knass Romer Labs La:n America Adviser Herramientas diagnós.cas para la determinación de alérgenos en alimentos Mgr., Bqca. Patricia Silvina Knass Romer Labs La:n America Adviser Resumen de la presentación Porqué vamos a analizar? Qué vamos

Más detalles

Manifestaciones clínicas. Cuadro mononucleósido asociado a la primoinfección. Clasificación de la infección VIH.

Manifestaciones clínicas. Cuadro mononucleósido asociado a la primoinfección. Clasificación de la infección VIH. Manifestaciones clínicas. Cuadro mononucleósido asociado a la primoinfección. Clasificación de la infección VIH. Jose Maria Kindelán. Hospital Universitario Reina Sofía. Córdoba I. Historia natral de la

Más detalles

PCR Punto de No Retorno de la Biología Molecular

PCR Punto de No Retorno de la Biología Molecular TÉCNICAS DE ANÁLISIS EN BIOLOGÍA MOLECULAR CURSO DE BIOTECNOLOGÍA ELEMENTAL Biotechnology Explorer Julio 2012 PCR Punto de No Retorno de la Biología Molecular Qué es un gen Técnicas de aislamiento y estudio

Más detalles


SERVICIOS LABORATORIO HISTOCOMPATIBILIDAD SERVICIOS LABORATORIO HISTOCOMPATIBILIDAD El laboratorio de histocompatibilidad está capacitado para desarrollar los estudios necesarios para trasplantes de órganos de acuerdo a los requerimientos internacionalmente

Más detalles

Análisis de la coestimulación vía CD28 en células linfoides de pacientes infectados. con el virus de la Hepatitis C RESUMEN

Análisis de la coestimulación vía CD28 en células linfoides de pacientes infectados. con el virus de la Hepatitis C RESUMEN Análisis de la coestimulación vía CD28 en células linfoides de pacientes infectados con el virus de la Hepatitis C RESUMEN La infección por el virus de la hepatitis C (VHC) afecta a más de 170 millones

Más detalles



Más detalles



Más detalles

Anexo X Técnicas disponibles en el Centro Nacional de Microbiología (CNM) para el Diagnóstico del SRAS

Anexo X Técnicas disponibles en el Centro Nacional de Microbiología (CNM) para el Diagnóstico del SRAS nexo X Técnicas disponibles en el Centro Nacional de Microbiología (CNM) para el Diagnóstico del SRS Técnicas disponibles en el Centro Nacional de Microbiología (CNM) para el Diagnóstico del SRS 1.- islamiento

Más detalles


PAREJAS SERODISCORDANTE PAREJAS SERODISCORDANTE Las parejas serodiscordantes son aquellas en las que uno de los dos miembros es seropositivo al virus de la inmunodeficiencia humana (VIH). La elevada incidencia del VIH en pacientes

Más detalles

EDUCACION CONTINUADA. Introducción. Caso clínico nº 1

EDUCACION CONTINUADA. Introducción. Caso clínico nº 1 EDUCACION CONTINUADA L. Castaño, J.R. Bilbao, I. Urrutia An Esp Pediatr 1997;46:513-518. Introducción a la biología molecular y aplicación a la pediatría (5): Casos clínicos. Alteraciones genéticas en

Más detalles

Determinación de la carga viral para el diagnóstico precoz de la infección perinatal por el virus de la inmunodeficiencia humana tipo 1 (VIH-1)

Determinación de la carga viral para el diagnóstico precoz de la infección perinatal por el virus de la inmunodeficiencia humana tipo 1 (VIH-1) Determinación de la carga viral para el diagnóstico precoz de la infección perinatal por el virus de la inmunodeficiencia humana tipo 1 (VIH-1) S. Resino García, R. Alonso Arias, J.L. Jiménez Fuentes,

Más detalles