PRACTICAS EN: Sergio Luquero Bueno M Facultad de Biología. Salamanca.

Tamaño: px
Comenzar la demostración a partir de la página:

Download "PRACTICAS EN: Sergio Luquero Bueno 71132703-M Facultad de Biología. Salamanca."

Transcripción

1 PRACTICAS EN: Sergio Luquero Bueno M Facultad de Biología. Salamanca.

2 2 Índice Introducción.3 El CIC.4 Isidro Sánchez García.6 Breve descriptiva previa sobre la familia Snail.7 PCR.9 ELECTROFORESIS EN GEL DE AGAROSA.13 CULTIVOS CELULARES.15 MEDIOS DE CULTIVO.15 PHOENIX Y MEF s.16 Preparación de células Phoenix.16 CONSERVACIÓN DE PHOENIX.17 CONGELAR CÉLULAS MEF SIN TRATAR.17 FORMACIÓN DE cdna.18 ESTUDIO EN PLACAS DE DAÑO EN ADN.19 EXTRACCIÓN PROTEICA.19 WESTERN BLOT.20 Tecnología de ADN recombinante.25 MINIPREPs.26 ENZIMAS DE RESTRICCIÓN.27 Purificación proteica.28 Southern Blot.30 Seguimiento del trabajo de otros compañeros.33 Otras Actividades.34 Conclusiones.36 Bibliografía.37 2

3 3 Introducción: Este verano, tras cursar quinto curso, tuve la oportunidad de realizar las prácticas de mi carrera, Biología, en el Centro de Investigación del Cáncer dentro del laboratorio de Isidro Sánchez García. El periodo de realización fue del 1 de Julio al 14 de Agosto de Ante la decisión de dónde realizar las prácticas, y tras el conocimiento por parte del Vicedecano Fernado Leal de la posibilidad de realizarlas en CSIC gracias al convenio entre éste y la facultad de biología de Salamanca decidí realizarlas en el Centro de investigación de Cáncer. La elección vino dada por mi interés en realizar prácticas de laboratorio, la investigación en el cáncer me resultaba atrayente y por último la decisión de la selección del tutor vino dada tras la lectura de las interesantes líneas de investigación presentes y pasadas del Dr. Isidro Sánchez García. En esta memoria de prácticas expongo brevemente la enriquecedora experiencia que ha supuesto este periodo en el centro y las técnicas dadas en la carrera que he podido poner en práctica. Sergio Luquero Bueno. 3

4 4 El CIC: El Centro de investigación del Cáncer está situado en Salamanca, en el campus Miguel de Unamuno. Su estructura organizativa está centrada alrededor del Instituto de Biología Molecular y Celular del Cáncer (IBMCC), que tiene carácter de Instituto Universitario Mixto, patrocinado por la Universidad de Salamanca y el Consejo Superior de Investigaciones Científicas: USAL-CSIC. Está también reconocido como Centro Sanitario (N Registro ) por el Sistema de Salud de Castilla y León (SACYL). El IBMCC es un centro integrado de investigación del cáncer cuya constitución fue aprobada en 1997 que, respondiendo al modelo de los Comprehensive Cancer Center norteamericanos, se caracteriza por integrar investigación competitiva y de excelencia sobre cáncer en tres niveles distintos: básico, clínico y aplicado o traslacional. Para ello está formado por un Instituto mixto dependiente de la Universidad de Salamanca y el Consejo Superior de Investigaciones Científicas así como por diversas unidades dependientes del Sistema de Salud de Castilla y León. La idea inicial de formar un centro especializado en investigación sobre el cáncer en la Universidad de Salamanca, surgió ante la constatación de la presencia en la misma de un núcleo importante de investigadores de los procesos básicos y clínicos del cáncer que si bien estaban desconectados entre sí por estar dispersos entre varios departamentos de la Universidad de Salamanca, resultaba muy significativo en calidad y número en comparación con otras universidades del país. De esta forma surgió el Centro de Investigación del Cáncer, con una contribución científica local y regional a través de la Universidad de Salamanca y una dimensión nacional mediante el CSIC, quien manifestó su deseo explícito de participar creando el Instituto Mixto de Biología Molecular y Celular del Cáncer del CIC, para permitir el acceso de investigadores y científicos especializados de todo el territorio nacional a este Centro. Las Consejerías de Sanidad y de Educación de la Junta de Castilla y León han asumido una participación directa en el CIC a través de su presencia en el Patronato de la FICUS (Fundación para la Investigación del Cáncer de la Universidad de Salamanca) y la promoción de esta institución como Centro Sanitario del sistema autonómico SACYL. El Instituto de Salud Carlos III del Ministerio de Sanidad participa en el CIC a través de la designación de este centro como uno de los nodos de su Red Temática de Investigación cooperativa de Cáncer a nivel nacional y de la adscripción de Investigadores FIS a este centro. 4

5 5 Objetivos del centro: 1. Realizar investigación puntera en cáncer a nivel básico, aplicado y clínico. 2. Favorecer el trasvase bidireccional de información entre la ciencia biomédica básica y la aplicada, para fomentar la sinergia de los tres tipos de investigación y así mejorar la productividad. 3. Constituirse como un centro científico de excelencia capaz de competir en igualdad de condiciones con otros centros internacionales. 4. Fomentar la conexión del CIC con redes temáticas de investigación oncológica tanto nacionales como internacionales. 5. Potenciar la creación de riqueza y servicios que reviertan en el bienestar social y desarrollo económico a nivel regional y nacional. Finalidad: El CIC se concibe como un elemento de aglutinación de los mejores recursos humanos existentes en el campo de la investigación del cáncer a nivel regional (Castilla y León) y nacional. Ser referencia por su calidad, tanto a nivel nacional como internacional. 5

6 6 Isidro Sánchez García: Dr. Isidro Sánchez-García. Investigador Científico, CSIC. Lab. 13. Es uno de los investigadores principales del CIC en el área de Investigación Aplicada. Las líneas generales de su proyecto de investigación son la generación de modelos genéticos animales para el estudio de tumorigénesis y hematopoyesis, las alteraciones cromosómicas en tumores hematopoyéticos y terapia génica. Líneas de investigación: Aunque la mayor parte de los pacientes con cáncer responden a la terapia, tan sólo una minoría son curados. Datos recientes que sugieren el origen de muchas enfermedades en una población poco común de células responsables exclusivamente de conservar la capacidad de auto-renovación y mantenimiento del tumor (es decir,?células stem cancerígenas?) podrían explicar la paradoja de que respuesta y supervivencia no siempre van unidas. En este contexto, una pequeña población de células cancerígenas adquiriría propiedades características de células stem. En algunos casos, las células stem cancerígenas (CSC) podrían derivar directamente de las células stem normales de un tejido. En cualquiera de las situaciones el resultado final sería el mismo, conduciendo a las CSC como células diana en el desarrollo de terapias moleculares y farmacéuticas para el tratamiento y prevención del cáncer humano. Este podría representa un nuevo paradigma en el tratamiento del cáncer, alejado del tratamiento dirigido a las células blásticas y orientado a las CSC. El desafío para esta nueva aproximación es encontrar una forma de atacar específicamente estas CSC sin que sea tóxica para las células normales. En este sentido, nuestro laboratorio se sirve de la genética y genómica del ratón para diseccionar los mecanismos moleculares y procesos biológicos que gobiernan el papel de las CSC en la biología tumoral y en la Oncología Translacional. Con este objetivo hemos desarrollado los siguientes programas de investigación: a) Identificación y caracterización de las células stem cancerígenas en varios tipos de tumor. b) Atlas genómico de las CSC: genética y epigenética. c) Biología Celular y de sistemas de las células stem cancerígenas (Análisis funcional de los genes Slug y Snail en el desarrollo y mantenimiento de la célula stem cancerígena). d) Modelos animales para el Estudio de la Célula Stem Cancerígena. e) Aplicaciones diagnósticas y pronósticas del Estudio de la Célula Stem Cancerígena (Imagen Molecular). f) Identificación y evaluación de dianas terapéuticas en las células stem cancerígenas. g) Descubrimiento y desarrollo de inhibidores selectivos de las CSC. Esperamos que esta investigación no sólo redunde en nuevos conocimientos en la biología y desarrollo del cáncer, sino que proporcione las bases para el desarrollo de nuevas estrategias en la terapia frente al cáncer y nuevos métodos para valorar tratamientos eficaces. Isidro Sánchez García. 6

7 7 Experiencia personal en el CIC: Mi trabajo dentro del Laboratorio de Dr. Isidro Sánchez García, el laboratorio número 13 dentro del instituto del Cáncer, vino determinado por el miembro del equipo que Isidro seleccionó para tutelarme y que fue variando en el tiempo, permitiéndome así conocer y participar en las múltiples líneas de investigación que posee dicho equipo. En primer lugar estuve colaborando con Katja Gutsche, bióloga de origen alemán que basa su investigación en el estudio de la función del gen Snai3 en procesos en respuesta al daño en el ADN. Snai3 forma parte de la familia de genes Snail. Breve descriptiva previa sobre la familia Snail: Miembros de la superfamilia Snail donde también se aúna la familia Scratch. Los genes de la familia Snail de vertebrados se organizan en Subfamilias: Snai1, Snai2 y Snai3. Todos ellos formados por una región carboxi-terminal muy conservada que contiene entre 4 y 6 dominios en dedos de Zinc y una región amino-terminal mucho más variable. Los dedos de Zinc son C2H2 (2 cisteínas y 2 histidinas), estos son importantes para la unión a secuencias específicas de ADN, importantes por tanto para su función como represores transcripcionales. Funciones de las proteínas de la familia Snail: - Transición epitelio-mesénquima: fundamental para el desarrollo normal y tumoral. Los genes de la familia Snail actúan reprimiendo marcadores epiteliales y aumentando los mesenquimales, participando además en el cambio de forma celular y en propiedades invasivas. Snai1 y Snai2 reprimen la expresión del gen E-caderina. - Decisiones del destino celular y supervivencia celular. - División celular (inhibición de la mitosis). - Asimetría derecha-izquierda en desarrollo embrional y neural. - Evidencias de su intervención en la protección de las células ante muerte celular. o Snai 2: Antiapoptótico; inducido a nivel transcripcional por p53. o Snai 1: Factor de supervivencia; células con resistencia a señales apoptóticas directas (ante daño en ADN, ). Ante Cáncer: estas funciones, tan importantes en desarrollo embrionario, en desarrollo patológico, como cáncer, facilitarán el desarrollo del tumor y su metástasis. Actúan como marcadores de malignidad y potencial metastásico. Snai3 (Smuc) : se encuentra presente en el cromosoma 16 humano, se expresa en desarrollo embrionario y en diversos tejidos adultos. 7

8 8 Se han realizado estudios sobre su secuencia, estructura y su expresión en tejidos pero muy poco sobre su función. Dadas las evidencias de participación de los miembros de la superfamilia Snail en supervivencia celular Katja Gutsche estudia la función de Snai 3 en respuesta a daño en el ADN. (Podría poseer funciones diferenciales con respecto a los demás miembros de la familia Snail). La razón de ese desconocimiento funcional está relacionado con la baja expresión de Snai3, lo que dificulta su estudio. Gracias a dicho estudio pude poner en práctica diversas técnicas: PCR y electroforesis. Cultivos celulares. Extracción proteica. Western blot. 8

9 9 PCR: La reacción en cadena de la polimerasa, PCR, es una técnica que permite replicar entre cientos de miles y millones de veces, en el transcurrir de pocas horas e in vitro, pequeñas cantidades de ADN. La técnica se basa en la replicación del ADN realizada por la ADN polimerasa. Estas enzimas realizan la síntesis de una cadena complementaria de ADN en el sentido 5 -> 3 usando un molde de cadena sencilla, pero a partir de una región de doble cadena. Para crear esta región doble cadena se usan los denominados iniciadores (primers). Son una pareja de oligonucleótidos sintetizados de manera que sean complementarios a cada uno de los extremos del fragmento de ADN que se desea amplificar. Partiendo de este principio, la Reacción en Cadena de la Polimerasa se basa en la repetición de un ciclo básico formado por tres etapas: 1ª Desnaturalización del ADN doble cadena: la doble hélice de ADN se separa en dos hebras. Para ello se realiza una incubación de la muestra a altas temperaturas (93-97ºC). (La renaturalización se producirá cuando la temperatura disminuya). 2ª Hibridación de los iniciadores a la zona 3 específica de cada una de las hebras: (50-65º C) la temperatura se reduce para permitir el apareamiento o hibridación de cada una de dos cadenas cortas de nucleótidos (oligonucleótidos) con cada una de las 9

10 10 hebras separadas del ADN molde. Se trata de segmentos de ADN de cadena simple, sintetizados en el laboratorio y diseñados de manera tal que permiten definir los límites del tramo de ADN que se desea replicar. Obviamente, para que se pueda producir el apareamiento, cada uno de estos oligonucleótidos, a los que también denominan "iniciadores", debe ser complementario del tramo al que tienen que unirse en las cadenas separadas del ADN molde. 3ª Extensión del cebador por actuación de la ADN polimerasa: Elongación, se produce la síntesis de una cadena sencilla (produciéndose un fragmento de doble cadena por la complementariedad) en la dirección 5 -> 3 mediante la enzima ADN polimerasa, la cual incorpora siguiendo la cadena molde los desoxinucleótidos fosfato (dntps) agregados a la mezcla de reacción. La temperatura a la que se realiza el tercer paso está condicionada por aquélla a la cual trabaja la enzima ADN polimerasa. Al cabo del primer ciclo de tres reacciones (desnaturalización, apareamiento, extensión) el tramo de ADN elegido se ha duplicado y el doble de su cantidad original se encuentra disponible para ser nuevamente replicado en un segundo ciclo. El resultado de la aplicación de numerosos ciclos "en cadena" da lugar a la amplificación geométrica del segmento de ADN delimitado por los primers. 10

11 11 Hemos llevado a cabo en el laboratorio la técnica PCR semicuantitativa, que incluye diluciones de cada muestra de cdna de 1/5 y 1/25 ya que nuestras PCR s tenían en su gran mayoría una finalidad comparativa entre los patrones de expresión de Snai3 o Smuc en distintas variantes génicas y mutantes, con estas diluciones controlamos y observamos mejor las variaciones. Mix por cada eppendorf/muestra por cada 10 µl de cdna: 19 5 µl MPW. 5 µl MgCl2 5mM. 5 µl dntps 2mM. Previamente: Baño 30º 5 µl 10x Taq Buffer. 2 5 µl Oligo 1 (1/100). Direcciones contrarias 2 5 µl Oligo 2 (1/100). Hielo (para evitar pérdida de 0 5 µl Taq polimerasa. actividad) Realmente lo que realizamos es un Mix conjunto para todas las muestras, además debemos incluir un eppendorf sin muestra, sólo con mix para utilizarlo como control evitando posibles contaminaciones. Taq. ADN polimerasa: enzima recombinante purificada en Scherichia Coli DH1 (mediante el buffer se ajusta la [Mg+2], eliminando la necesidad de optimización de este componente crítico). El cdna utilizado en estos estudios procede de MEF s (murine embryonic fibroblast) y Timocitos de ratones. Variantes utilizadas: - wt. - wt ir(2,5 Gy) (irradiado gamma). - p53 -/-. - p53 -/- ir(2,5 Gy). - CombiSmuc x p53 -/-. - CombiSmuc x p53 -/- ir. - CombiSmuc. - CombiSmuc ir. 11

12 12 - Hemos utilizado también marcadores de gen Slug (Snai2) para conocer la posible interferencia. - cdna + retrovirus vacío. - cdna + retrovirus vacío dañado con Doxorrubicina. - cdna con siarn (pequeño de interferencia). - cdna con siarn y dañado con Doxorrubicina. Los programas utilizados para llevar a cabo la PCR de nuestras muestras en la termocicladora han sido Actina y GAPdh con un número variable de ciclos. 12

13 13 ELECTROFORESIS EN GEL DE AGAROSA: Estudia la migración de las partículas coloidales en el seno de un campo eléctrico Consiste en la separación de los fragmentos de distinto tamaño de ADN en el gel de agarosa, en el que dichos fragmentos migraran a diferente velocidad según su peso molecular al ser sometidos a una corriente eléctrica. La agarosa es un polisacárido (originalmente obtenido de algas, como el agaragar, pero de composición homogénea), cuyas disoluciones (típicamente de 0.5 a 2 %) poseen la propiedad de permanecer liquidas por encima de 50 ºC y formar un gel semisólido al enfriarse. Este gel esta constituido por una matriz o trama tridimensional de fibras poliméricas embebida en gran cantidad de medio líquido, que retarda el paso de las moléculas, se usa para separar moléculas grandes de alrededor de nucleótidos. Dependiendo del número de muestras y, por tanto, de pocillos necesarios hemos utilizado dos tamaños distintos de cámaras electroforéticas horizontales para las que realicé los geles con esta composición y características: / 50 ml de TBE 1x / 0 9 gr. de Agarosa (1 8%). - 5 / 1 5 µl de Bromuro de etidio: colorante que se intercala entre las bases nitrogenadas de ADN y emite fluorescencia ante luz ultravioleta (carcinógeno) / 55 Voltios durante una hora. Tras la realización de las mezclas para los geles, colocación de peines de formación de pocillos y la solidificación del gel debemos cubrirlo para evitar su deshidratación con solución TBE 1x. 13

14 14 Previa a la introducción de las muestras obtenidas por PCR a los pocillos mediante pipeta, debemos aplicar a cada muestra (cdna+mix) una solución Loading Buffer, es el tampón de carga: - 50% Glicerol % Azul de Bromofenol: quedando así marcada la muestra a simple vista mM EDTA ph=8. Gracias a esta solución monitorizamos la migración del ADN. Con estos estudios de PCR y electroforesis y tras el revelado del gel con el transiluminador hemos ido ponderando las concentraciones de cdna de las muestras para unificar los resultados expresados por las bandas para luego realizar los pertinentes estudios PCR de expresión diferencial del gen Smuc (Snai3). 14

15 15 CULTIVOS CELULARES: MEDIOS DE CULTIVO. Mantenemos Placas Petri en crecimiento con los siguientes cultivos: - 8 placas con MEF s wt 9 (embrión 9) con retrovirus vacío. - 8 placas con MEF s Smuc. - 8 placas con MEF s Smuc A : mutante de Smuc con supresión de fracción de aminoácidos para reconocer si actúa de la misma manera sobre p placa control de MEF sin modificación alguna. Cambios de medio de Cultivo: Se realizan los cambios de medio cada 3 días aproximadamente dependiendo de las necesidades celulares. Para realizar dicho cambio acudimos a la sala de cultivos y utilizamos la cámara de cultivos tras apagar la luz ultravioleta y esterilizar todo el material utilizable con etanol. - Desechamos el medio de cultivo mediante aspiración. - Echamos PBS para eliminar restos del medio anterior y facilitar así la acción de la Tripsina. - Utilizamos Tripsina: 3ml por placa para despegar los MEF s que se encuentran adheridas a la placa. Dejamos que actúe durante 5 minutos. - Recogemos en los tubos Falcon las muestras celulares recogidas gracias a la Tripsina y unimos el nuevo medio de cultivo. - Medio de cultivo: o 500 ml DMEM. o 10% Suero bovino (50 ml) filtrado previamente (0 45µm) o 5 5 ml Glutamina. o 5 5 ml Penicilina//Estreptomicina. - Centrifugación del Falcon a 1200 rpm. Durante 10 minutos, obteniendo un pellet más o menos marcado(tripsina ya inactivada por el medio). - A continuación se introduce en el medio de cultivo Puromicina a razón de 2 µg/ml; la utilizamos para seleccionar las células marcadas debido al cassette asociado al retrovirus, de esta forma, en el falcon control que sólo posee células MEF s se provocará la muerte celular en presencia de puromicina. 15

16 16 - Tras resuspender el pellet con el medio + puromicina y dependiendo de las condiciones celulares observadas debemos determinar si pasamos nuestro cultivo al mismo número de placas, a menos o a más. PHOENIX Y MEF s. Los MEF s fueron infectados utilizando retrovirus producidos mediante la transfección pasajera de células Phoenix. Una vez trasfectadas con ADN retroviral, estas células codifican para las proteínas de la cápsida de los retrovirus, que se van a liberar al medio de cultivo. Los vectores retrovirales utilizados para transfectar phoenix y así obtener retrovirus para infectar los MEF s son varios y entre ellos está pqcxip, que es un vector de expresión bicistrónico diseñado para expresar un determinado gen bajo la acción del promotor de citomegalovirus (CMV), junto con un marcador de selección de puromicina. Preparación de células phoenix: En medio DMEM (Dulbecco s modified Eagle s suplementado con un 10% de suero bovino fetal inactivado con calor (30 min. a 56ºC) y filtrado por 0 45 µm, 2 mm L-Glutamina, 50µg/ml Estreptomicina. Preparación del ADN: Por cada placa Phoenix a transfectar 16 µg de ADN retroviral. Preparación de MEF s: Plaqueamos 1x10 6 céls/placa 10cm diámetro. Infección de las MEF s: Para infectarlas se recogió el medio de cultivo de las Phoenix que contendrá los retrovirus correspondientes en cada caso liberados en el medio. El sobrenadante de cada placa Phoenix filtrado sirve para infectar dos placas MEF. Se realizarán tres infecciones consecutivas por placa MEF. (Los retrovirus generados con la cápsida y el fragmento de ADN que nos interesa se encuentran en el sobrenadante de Phoenix, no pegado a la placa). (Ver gráfico en página siguiente) 16

17 17 Placa de Phoenix transfectada. Se introduce CaCl 2 para mejorar la entrada del vector. 12ml Sobrenadante 6 ml. 6ml. X3 : Se realiza la infección de MEFs desde el mismo Phoenix al que se va añadiendo medio de cultivo y hacia los dos mismos placas sin retirarles el sobrenadante (finalmente serán 18 ml.) CONSERVACIÓN DE PHOENIX SIN SER TRANSFECTADOS. - En la campana de cultivo retiro el medio de placa Phoenix mediante aspiración. - Vierto 3 ml. de Tripsina en placa para despegar las Phoenix del fondo: 5 min. incubando. - En este caso (retrovirales) no es necesario echar antes PBS para que los restos del medio no afecten a la tripsina. - Tras la tripsinización queremos hacer tres placas con Split en proporción 1/15; para ello utilizo un falcon de 12 ml de medio sin puromicina y junto a los 3 ml. de tripsina que contiene las células en suspensión, nos da 15 ml. - De esos 15 ml. tomaremos 1 ml. para cada placa con las células (proporción 1/15) y echamos el resto de medio hasta completar volumen. CONGELAR CÉLULAS MEF SIN TRATAR: Para ello quitamos el medio y usamos tripsina, las pasamos a Falcon con medio y tras centrifugar, el pellet obtenido se resuspende en suero, del cual verteremos en el dial de congelación 0 5 ml. y otros 0 5 ml. de suero + DMSO que mantiene la forma celular. El dial rápidamente se pone a 4ºC debido al suero utilizado que es frío, lo pasamos a - 20ºC en el congelador aproximadamente una media hora y después lo pasamos a -80ºC y finalmente se mantiene en N2 Líquido ( es importante esta congelación gradual). 17

18 18 FORMACIÓN DE cdna: El Adn copia lo realizaremos a partir de 5 µg de ARN con un volumen total de 12 µl. Deberemos conocer la concentración de ARN por µl para tomar los microlitros necesarios hasta los 5 µgramos de ARN y llevar hasta 12 µl con agua. Ejemplo: [ARN]= 0 64 µg/µl. 7 8 µl ARN 4 2 µl MPW (el H 2 O utilizado para esta técnica se debe mantener exclusivamente para esta técnica y tapón cerrado con parafilm). RNAsa-libre tubo eppendorff hielo + 7 µl RNA-MPW. + 1 µl RNAsin (inhibidor RNAasa). + 5 µl RNA. 5 minutos a 65ºC. Spin Transferir a Temperatura Ambiente + 1 µl Oligo dt. + 1 µl ARN sin. + 4 µl 5x buffer (-20ºC). + 1 µl RT (Transcriptasa Inversa). Mix 1 hora a 42ºC. Almacenamiento Mix + 80 µl RNA-MPW a -20ºC. 18

19 19 ESTUDIO EN PLACAS DE DAÑO EN ADN: Sobre los cultivos hacemos pruebas con doxorrubicina en tres tipos de placas: - wt 9. - wt 9 Smuc. Para observar el daño y efectos mediante análisis proteico. - wt 9 Smuc A La doxorrubicina la dejamos actuar en las placas a distintos tiempos, en algunas 12 horas, en otras 24 horas; tras lo cual: - Quitamos el medio de cultivo. - Lavado con PBS. - Tripsinizamos. - Resuspensión en medio de cultivo. - Centrifugación. - Nos quedamos con el pellet tras quitar el sobrenadante y conservamos a -80ºC. EXTRACCIÓN PROTEICA: - Resuspenderemos el pellet obtenido tras la aplicación de doxorrubicina a las placas anteriormente citadas con solución de lisis previamente preparada, esta solución lisa la membrana celular y nuclear y tiene como componentes Trix e inhibidores de proteasas. - La solución de lisis utilizada varía entre µl dependiendo del tamaño del pellet. Se agita cada eppendorf y los mantenemos en hielo durante 15 minutos. - Centrifugación a 4ºC, rpm durante 30 minutos. De esta forma el extracto proteico quedará en el sobrenadante y los restos celulares en el fondo. - La concentración de proteína obtenida la mediremos mediante espectofotometría utilizando una recta patrón a base de BSA por el método Bradford utilizando el reactivo comercial facilitado. 19

20 20 WESTERN BLOT: La transferencia de proteínas o 'blotting' supone la inmovilización de las proteínas sobre membranas sintéticas, seguido de la detección empleando sistemas especialmente diseñados para la tinción de 'blots'. El método más potente es el denominado 'Western blot' en el que las proteínas son separadas en primer lugar mediante electroforesis en geles de poliacrilamida y posteriormente se transfieren mediante la aplicación de un campo eléctrico perpendicular al gel a una membrana. Todo procedimiento de 'blotting' consta de 5 etapas : Inmovilización de proteínas sobre la membrana mediante transferencia electroforética. Saturación de todos los lugares de unión de proteínas de la membrana no ocupados para evitar la unión no específica de anticuerpos, que son proteínas. Incubación del 'blot' con anticuerpo primarios contra la/s proteína/s de interés. Incubación del 'blot' con anticuerpos secundarios, o reactivos que actúan de ligando del anticuerpo primario unidos a enzimas u otros marcadores. Las bandas de proteínas marcadas con enzimas se hacen visibles por incubación con los sustratos apropiados para formar productos coloreados insolubles en el lugar donde se encuentran las bandas de proteína. El gel: - Gel al 12%. - 6 ml Acrilamida (actúa como espesante) ml 1 5M Tris ph ml H2O ml 10% SDS ml 25% Ampersulfato (hace solidificar la acrilamida) ml TEMED (tetrametiletildiamina). 20

21 21 El gel diferencial: En la parte superior del gel, coincidiendo con la zona de inclusión del peine formador de pocillos se dispone otro tipo de gel: - Marcado con 1 38 ml. de Bromofenol dando apariencia azulada para observar la diferencia ml Acrilamida. - Tris a 0 5M ph ml Agua ml 10% SDS ml 25% Ampersulfato ml. TEMED. Este gel será utilizado para depositar las muestras en los pocillos y será separado fácilmente del gel por el que correrán las bandas antes de transferencia a membrana gracias a su menor estabilidad y solidificación. manipulación en torno a los 0.4 mm. El grosor del gel es un factor que influye notablemente en la transferencia, siendo muy ineficiente a partir de geles de 2 mm de espesor, y tanto más eficiente cuanto más fino es el gel, con un límite debido a los problemas de El gel se deja correr en la cubeta electroforética durante 2:15 horas a 85 Voltios. Tras la extracción del gel lo colocamos en una cubeta con la solución de transferencia durante 10 minutos (balanceo). Solución de transferencia: 21

22 gr. Glicina gr. Tris (Trihidroximetil aminometano en polvo). Disolución y ml. Metanol. conservamos a 4ºC. - Lo ajusto hasta un litro con agua destilada. hasta que se use. Preparamos la membrana de nitrocelulosa a la que pasaremos las proteínas del gel para un correcto estudio con anticuerpos. Dicha membrana tiene como medidas 6x8cm. Para su utilización pasamos la membrana a una cubeta con metanol durante un minuto y luego mantendremos la misma en solución de transferencia cinco minutos. Transferencia electroforética ('electroblotting'): En este método, descrito por Towbin, las proteínas son transferidas desde el gel a la membrana electroforéticamente. La ventaja de este proceso es su corta duración (de 30 min a pocas horas), lo que reduce notablemente el efecto de difusión de las bandas. El procedimiento se inicia apilando sucesivamente sobre una esponja plana papel de filtro empapado en tampón de transferencia, el gel, la membrana en contacto directo con el gel, más papel de filtro y finalmente una esponja plana. Este conjunto se recoge entre dos capas de plástico perforado y se introduce en un tanque en el que se encuentra una solución salina (tampón de transferencia) y dos electrodos planos (diseñados para conseguir un campo uniforme en toda la superficie del gel). Se dispone de forma que el gel quede hacia el ánodo (-) y la membrana hacia el cátodo (+). La carga neta de las proteínas en el caso de los geles de SDS-PAGE es positiva debida a la carga del SDS. Debemos además tener en cuenta a la hora de preparar esta transferencia de echar solución de transferencia al colocar cada una de las capas así como alisarlas para que quede bien prensado y sin burbujas. Una vez montado se inserta dentro de la cubeta en el rail facilitado a tal efecto acompañado de un depósito para hielo necesario para mantener la temperatura baja. En el fondo de la cubeta principal colocamos un imán ( estéril ) ya que el tiempo que 22

23 23 tengamos la cubeta electroforética conectada la mantendremos encima de un rotatorio para que la solución de transferencia se encuentre en movimiento gracias a dicho imán. Dejamos la cubeta conectada toda la noche a 35 Voltios en la cámara fría de 4ºC de la que disponemos. Al día siguiente tras extraer el gel de la cubeta obtenemos la membrana ya marcada; debemos secarla para lo que es suspendida en metanol en dos ciclos consecutivos de un minuto. Una vez realizada la transferencia la membrana se puede analizar inmediatamente o bien conservarla en frio (2 a 8ºC) durante meses. Tras el secado utilizamos solución Ponceau, un marcador granate que nos permite observar a simple vista todas las fracciones proteicas en membrana según el peso molecular dado en KD. (el Ponceau no lo desechamos sino que es reutilizable). Pasamos la membrana por una serie de lavados mediante solución de lavado TBST cambiándola cada 5 minutos (3 ciclos). Tras estos lavados preparamos una nueva solución, esta vez de leche en polvo libre de grasa con TBST, se utiliza para rellenar los espacios libres de la membrana sin proteína con la proteína de la leche y así evitar un contacto inespecífico entre la membrana y los anticuerpos primarios que insertaremos. Dejamos por ello la membrana durante 2 horas en hibridación con la leche en el balanceador. Además, cada membrana que estudiamos la cortamos dividiéndola (por los Kda de las fracciones proteicas mediante el patrón de estudio) en los distintos fragmentos que recibirán un tratamiento diferencial dependiendo de los estudios a realizar: en los distintos western hemos realizado tratamiento para estudiar p53, p21, caspasas activas e inactivas, Smuc, Utilizamos Anticuerpos específicos primarios con una concentración que se conoce de antemano que funciona, la mayoría 1:500 aunque alguno es 1:1000. Dejamos que actúe durante dos horas sobre la membrana. Lavamos con TBST 6 veces tras la aplicación del primario, 3 lavados cada 5 minutos y 3 lavados cada

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN 5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN Materiales - Eppendorf de 1,5 ml estériles - Eppendorf de pared fina para PCR - Puntas de pipeta estériles desechables - Guantes

Más detalles

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a Introducción Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a los investigadores verificar la expresión de una proteína, determinar la cantidad relativa

Más detalles

Práctico: Genética bacteriana 2007.

Práctico: Genética bacteriana 2007. Práctico: Genética bacteriana 2007. Actividad integrada Departamento de Genética Departamento de Bacteriología y Virología. OBJETIVOS Objetivos generales El estudiante al terminar la actividad práctica

Más detalles

38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa

38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa 38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa José Luis Caballero Repullo, Enriqueta Moyano, Juan Muñoz Blanco Departamento de Bioquímica y Biología Molecular, Campus

Más detalles

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas ELEMENTOS BÁSICOS DE LA INVESTIGACIÓN EN GENES Análisis

Más detalles

DANAGENE RNA PURIFICATION KIT

DANAGENE RNA PURIFICATION KIT DANAGENE RNA PURIFICATION KIT REF.0801.1 100 EXTRACCIONES REF.0801.2 500 EXTRACCIONES 1.INTRODUCCION Este kit permite la permite la obtención de ARN total a partir de cultivos celulares, tejidos animales,

Más detalles

Clonación molecular. Clonar significa hacer copias idénticas

Clonación molecular. Clonar significa hacer copias idénticas INGENIERÍA GENÉTICA Clonación molecular Clonar significa hacer copias idénticas Este término originalmente fue aplicado al procedimiento de aislar una célula y permitirle reproducirse creando una población

Más detalles

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR Módulo 1 Amplificación de un fragmento de ADN genómico por PCR En este primer módulo se amplificará por PCR, mediante el uso de oligonucleótidos específicos, un fragmento de ADN genómico de Aspergillus

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

Tema 11. Herramientas de la genética molecular

Tema 11. Herramientas de la genética molecular Tema 11. Herramientas de la genética molecular Genética CC. Mar 2004-05 Objetivos Técnicas de clonación Construcción de genotecas e identificación de secuencias Mapas de restricción Amplificación (PCR)

Más detalles

ELECTROFORESIS EN GELES DE AGAROSA. Agustín Garrido. agugarrido@hotmail.com

ELECTROFORESIS EN GELES DE AGAROSA. Agustín Garrido. agugarrido@hotmail.com 1 ELECTROFORESIS EN GELES DE AGAROSA Agustín Garrido agugarrido@hotmail.com Introducción En este trabajo práctico se utilizó la técnica de electroforesis. Este proceso se basa en la migración de las moléculas

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA. Grado en Medicina

CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA. Grado en Medicina DEPARTAMENTO DE BIOQUÍMICA Y BIOLOGÍA MOLECULAR III FACULTAD DE MEDICINA UNIVERSIDAD COMPLUTENSE DE MADRID CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA Grado en Medicina CURSO ACADÉMICO 2014/2015 INDICE

Más detalles

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles

TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO

TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO TEST de PATERNIDAD Este experimento introduce a los alumnos en el uso del ADN y la PCR para simular una determinación de paternidad. Los estudiantes

Más detalles

Técnicas de Biología Molecular

Técnicas de Biología Molecular Técnicas de Biología Molecular DNA I. Enzimas de restricción Análisis Las enzimas de restricción fueron aisladas de bacterias; su función natural es proteger contra DNA extraño II. Separación electroforética

Más detalles

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa?

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa? 2º BIOQUÍMICA CUESTIONES 1. Por qué la PCR convencional no es cuantitativa? En la PCR convencional, la cuantificación del ADN de la muestra es complicada debido a que la eficacia de amplificación va disminuyendo

Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

TEMA 6. PURIFICACIÓN DE PROTEÍNAS

TEMA 6. PURIFICACIÓN DE PROTEÍNAS TEMA 6. PURIFICACIÓN DE PROTEÍNAS 1. Introducción 2. Métodos de rotura celular y extracción de proteínas 3. Métodos cromatográficos 4. Métodos electroforéticos 1. Introducción La mayor parte de las investigaciones

Más detalles

CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL

CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL LIBRO DE MEMORIAS 2 CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL Santiago de Cali, 23 al 28 de agosto de 2010 3 Libro de memorias

Más detalles

CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015

CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 DEFINICIÓN PCR: Constituye la técnica más importante para amplificar ácidos nucleicos in vitro. Ambas hebras del DNA de interés son replicadas

Más detalles

TRABAJO PRÁCTICO Nº 5: ÁCIDOS NUCLEICOS DESCRIPCIÓN DE LOS MÉTODOS A UTILIZAR

TRABAJO PRÁCTICO Nº 5: ÁCIDOS NUCLEICOS DESCRIPCIÓN DE LOS MÉTODOS A UTILIZAR TRABAJO PRÁCTICO Nº 5: ÁCIDOS NUCLEICOS DOCENTES: Andrés Ciocchini, Gabriela Niemirowicz. DESCRIPCIÓN DE LOS MÉTODOS A UTILIZAR Purificación de ácido desoxiribonucleico (ADN) por partición diferencial

Más detalles

MANUAL DE PRÁCTICAS DE LABORATORIO

MANUAL DE PRÁCTICAS DE LABORATORIO MANUAL DE PRÁCTICAS DE LABORATORIO INGENIERIA ENBIOTECNOLOGÍA INGENIERÍA GENÉTICA FICHA TECNICA FICHA TÉCNICA SEMINARIO DE BIOTECNOLOGÍA MÉDICO-FARMACÉUTICA Fecha: Nombre del catedrático: 10-Julio-2012

Más detalles

Practica la genética Ficha didáctica del profesorado Bachillerato

Practica la genética Ficha didáctica del profesorado Bachillerato Ficha didáctica del profesorado Bachillerato www.eurekamuseoa.es Extracción de ADN Cuál es la función de cada uno de los ingredientes utilizados para realizar la disolución tampón para la visualización

Más detalles

Grado en Química. 4º Curso Bioquímica. Guión de Prácticas

Grado en Química. 4º Curso Bioquímica. Guión de Prácticas Grado en Química 4º Curso Bioquímica Guión de Prácticas UTILES A TRAER POR EL ALUMNO Bata Gafas de Seguridad Cuaderno de Laboratorio NORMAS DE TRABAJO Antes de empezar Antes de empezar cada práctica, el

Más detalles

17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico

17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico 17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico Carmen Alicia Padilla Peña, Jesús Diez Dapena, Emilia Martínez Galisteo, José

Más detalles

DIAGNÓSTICO GENÉTICO DE LA HIPERCOLESTEROLEMIA FAMILIAR POR RFLP Ref.PCRCOLEST(4 prácticas)

DIAGNÓSTICO GENÉTICO DE LA HIPERCOLESTEROLEMIA FAMILIAR POR RFLP Ref.PCRCOLEST(4 prácticas) DIAGNÓSTICO GENÉTICO DE LA HIPERCOLESTEROLEMIA FAMILIAR POR RFLP Ref.PCRCOLEST(4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios

Más detalles

Curso de biología molecular CIMAT 2010

Curso de biología molecular CIMAT 2010 Curso de biología molecular CIMAT 2010 INTRODUCCIÓN Este curso-taller tiene como propósito mostrar de manera teórica y práctica algunos principios básicos de biología molecular e ingeniería genética. Conocerás

Más detalles

Materiales para la secuenciación de ADN

Materiales para la secuenciación de ADN Introduccion La Secuenciación Sanger es un método de secuenciación de ADN en el que el ADN diana se desnaturaliza y se hibrida con un cebador de oligonucleótidos, que se extiende entonces gracias a la

Más detalles

AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO

AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO E l estudio del genoma de los seres vivos a sido uno d los principales objetivos de la Biología. Desde los trabajos de Mendel (1866),

Más detalles

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri OBJETIVO Desarrollar un banco de datos a partir de plantas de origen indudable y del uso

Más detalles

Protocolos de secuenciación de ADN

Protocolos de secuenciación de ADN 1 Protocolos de secuenciación de ADN Introducción El método de secuenciación utilizado aquí es el desarrollado por Sanger en 1975. Este consiste en la incorporación de didesixinucleótidos marcados fluorescentemente

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. info@atgen.com.uy www.atgen.com.uy

Más detalles

5. MATERIALES Y MÉTODOS

5. MATERIALES Y MÉTODOS 5. MATERIALES Y MÉTODOS 5.1 Equipos Los siguientes termocicladores se emplearon para la amplificación por PCR: - Perkin Elmer, GeneAmp PCR System 2400. - Perkin Elmer, GeneAmp PCR System 9600. - Applied

Más detalles

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml)

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml) PCR SIMULADA Ref.PCR Simulada (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

Guía Práctica 9. Producción de micelio en medio líquido para extracción de ADN. Micelio de hongos. Contenido

Guía Práctica 9. Producción de micelio en medio líquido para extracción de ADN. Micelio de hongos. Contenido Guía Práctica 9 Micelio de hongos Producción de micelio en medio líquido para extracción de ADN Guillermo Castellanos, Experto en Investigación 2 Carlos Jara, Ing. Agr. M.Sc., Asociado en Investigación

Más detalles

velocidades de movimiento mediante la aplicación de un campo eléctrico a través de una matriz porosa

velocidades de movimiento mediante la aplicación de un campo eléctrico a través de una matriz porosa INTRODUCCIÓN En general, la electroforesis es una técnica que separa las moléculas en base a sus diferentes velocidades de movimiento mediante la aplicación de un campo eléctrico a través de una matriz

Más detalles

Bioquímica III- 2009

Bioquímica III- 2009 Facultad de Ciencias Exactas, Universidad Nacional de La Plata Bioquímica III- 2009 Trabajo Práctico Nro 4 Extracción de RNA y DNA bacteriano INTRODUCCIÓN El RNA es el ácido nucleico más abundante en la

Más detalles

INTRODUCCIÓN AL CULTIVO CELULAR

INTRODUCCIÓN AL CULTIVO CELULAR INTRODUCCIÓN AL CULTIVO CELULAR Cultivo celular: Es un modelo de estudio in vitro constituido por células que pueden crecer y mantenerse en suspensión o en monocapa por más de 24 horas en condiciones controladas.

Más detalles

TP6: Western blot. Objetivos. Introducción

TP6: Western blot. Objetivos. Introducción TP6: Western blot Objetivos Familiarizarse con la técnica de western blot. Determinar los niveles de IgG en sueros murinos Comparar la sensibilidad del western blot vs el SDS page Introducción La transferencia

Más detalles

Laboratorio. Objetivos I N T R O D U C C I Ó N. Al finalizar este laboratorio el estudiante podrá:

Laboratorio. Objetivos I N T R O D U C C I Ó N. Al finalizar este laboratorio el estudiante podrá: Laboratorio 12 Biología molecular Objetivos Al finalizar este laboratorio el estudiante podrá: 1. Conocer los principios básicos de la técnica de electroforesis y su aplicación al análisis del ADN. 2.

Más detalles

MEMORIA DE PRÁCTICAS SILVIA PÉREZ SOLANA

MEMORIA DE PRÁCTICAS SILVIA PÉREZ SOLANA MEMORIA DE PRÁCTICAS SILVIA PÉREZ SOLANA DATOS DE LA EMPRESA Instituto de Biotecnología y Biomedicina de Cantabria (CSIC-UC- SODERCAN), Avda. Herrera Oria s/n. Santander. El tutor CSIC fue Raúl Fernández

Más detalles

DIAGNÓSTICO GENÉTICO DEL CÁNCER HEREDITARIO Ref.PCRCAN(4 prácticas)

DIAGNÓSTICO GENÉTICO DEL CÁNCER HEREDITARIO Ref.PCRCAN(4 prácticas) DIAGNÓSTICO GENÉTICO DEL CÁNCER HEREDITARIO Ref.PCRCAN(4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción

Más detalles

Electroforesis en gel de poliacrilamida y electrotransferencia

Electroforesis en gel de poliacrilamida y electrotransferencia Electroforesis en gel de poliacrilamida y electrotransferencia INDICE ELECTROFORESIS Fundamento y características Tipos de electroforesis: libre y de zona Electroforesis en papel, acetato de celulosa Electroforesis

Más detalles

3.- TECNOLOGIA EN EL DIAGNOSTICO MOLECULAR

3.- TECNOLOGIA EN EL DIAGNOSTICO MOLECULAR 3.- TECNOLOGIA EN EL DIAGNOSTICO MOLECULAR 3.1.- INTRODUCCIÓN Pocas áreas de la Biología Molecular han permanecido inalteradas con la aparición de una serie de técnicas englobadas dentro del término genérico

Más detalles

ELECTROFORESIS AVANZADA

ELECTROFORESIS AVANZADA Ref.ELECAVANZADA (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO ELECTROFORESIS AVANZADA El objetivo de este experimento es introducir a los alumnos en el conocimiento de la teoría electroforética y familiarizarse

Más detalles

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica TÉCNICAS GENÓMICAS Utilidad/Objetivos: 1) Detección de microorganismos directamente en muestras clínicas identificando un fragmento específico del genoma del microorganismo concreto 2) Cuantificación del

Más detalles

Técnicas descritas en el curso 7.28

Técnicas descritas en el curso 7.28 Técnicas descritas en el curso 7.28 Técnica: Clase 1 Experimento de incorporación de dntps Ensayo de extensión del cebador Ensayo de unión en filtro Electroforesis en gel Análisis de ADN Helicasa Polaridad

Más detalles

Soluciones de la serie de ejercicios 4 (Curso 7.012)

Soluciones de la serie de ejercicios 4 (Curso 7.012) Pregunta 1 Soluciones de la serie de ejercicios 4 (Curso 7.012) Usted está estudiando la síntesis del aminoácido triptófano en las bacterias. Las enzimas TrpA, TrpB, TrpC, TrpD, TrpE and AroH son necesarias

Más detalles

39. Aislamiento y purificación del DNA de un plásmido recombinante

39. Aislamiento y purificación del DNA de un plásmido recombinante 39. Aislamiento y purificación del DNA de un plásmido recombinante Aurora Galván Cejudo, Manuel Tejada, Antonio Camargo, José Javier Higuera, Vicente Mariscal, Emilio Fernández Reyes Departamento de Bioquímica

Más detalles

MATERIALES Y MÉTODOS

MATERIALES Y MÉTODOS MATERIALES Y MÉTODOS Para la obtención, aislamiento y caracterización de la proteína de superficie HSPB66 de H. pylori ATCC 43504 se realizó un cultivo de esta cepa, seguido de la extracción de proteínas

Más detalles

OLIMPÍADA ARGENTINA DE BIOLOGÍA APEB ÁREA DE ACTUALIZACIÓN Y PERFECCIONAMIENTO EN LA ENSEÑANZA DE LA BIOLOGÍA CONTINUIDAD Y CAMBIO DE LAS ESPECIES I:

OLIMPÍADA ARGENTINA DE BIOLOGÍA APEB ÁREA DE ACTUALIZACIÓN Y PERFECCIONAMIENTO EN LA ENSEÑANZA DE LA BIOLOGÍA CONTINUIDAD Y CAMBIO DE LAS ESPECIES I: MINISTERIO DE EDUCACIÓN, CIENCIA Y TECNOLOGIA UNIVERSIDAD NACIONAL DE RIO CUARTO FACULTAD DE CIENCIAS EXACTAS, FÍSICO - QUÍMICAS Y NATURALES DEPARTAMENTO DE CIENCIAS NATURALES OLIMPÍADA ARGENTINA DE BIOLOGÍA

Más detalles

P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA"

P.C.R. Técnica de amplificación enzimática de secuencias específicas de DNA P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA" Paso 1: Desnaturalización del DNA Paso 2: Hibridación de los "Primers" Paso 3: Extensión Paso 1: Desnaturalización del DNA

Más detalles

Cultura Cientí fica 1 Bachillerato

Cultura Cientí fica 1 Bachillerato Cultura Cientí fica 1 Bachillerato 3. La revolución genética: biotecnología Actividades de consolidación 1. Cualquier molécula de ADN formada por la unión de segmentos de ADN de origen diferente es: a)

Más detalles

CAPÍTULO VI. Expresión de genes relacionados con apoptosis

CAPÍTULO VI. Expresión de genes relacionados con apoptosis CAPÍTULO VI Expresión de genes relacionados con apoptosis 1.- Introducción 2.- Protocolos para análisis genéticos 3.- Resultados en MCF-7 4.- Discusión 1.- Introducción Como se ha descrito anteriormente,

Más detalles

DETERMINACIÓN DEL FACTOR Rh por PCR

DETERMINACIÓN DEL FACTOR Rh por PCR Ref.PCRRh DETERMINACIÓN DEL FACTOR Rh por PCR 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

CAPÍTULO III. Metodología e instrumentación de análisis celular

CAPÍTULO III. Metodología e instrumentación de análisis celular CAPÍTULO III Metodología e instrumentación de análisis celular 1.- Hemocitómetro y test de exclusión de colorante Trypan blue 2.- Citometría de flujo 3.- PCR 4.- Electroforesis en gel 5.- Secuenciación

Más detalles

DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino

DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino DIAGNOSTICO VIROLOGICO MOLECULAR Dr. Gerardo Andino DIAGNÓSTICO MOLECULAR La tecnología empleada para la detección de genomas virales mediante la amplificación de secuencias específicas (PCR y reacciones

Más detalles

Reacción en cadena de la polimerasa (PCR)

Reacción en cadena de la polimerasa (PCR) Dr. Alejandro Leal Reacción en cadena de la polimerasa (PCR) La reacción en cadena de la polimerasa (PCR, por sus siglas en inglés de "polymerase chain reaction") es un método de amplificación in vitro

Más detalles

ACTIVIDAD PRACTICA No. 8 BIOLOGIA CELULAR EXTRACCIÓN DE ADN

ACTIVIDAD PRACTICA No. 8 BIOLOGIA CELULAR EXTRACCIÓN DE ADN Universidad Centroccidental Lisandro Alvarado Decanato de Ciencias de la Salud ACTIVIDAD PRACTICA No. 8 BIOLOGIA CELULAR EXTRACCIÓN DE ADN Octubre 2009 INTRODUCCION La molécula de ADN (que es la que se

Más detalles

Análisis en Genética 1

Análisis en Genética 1 Análisis en Genética 1 Análisis Genético FUNCION BIOLOGICA Gen o genes implicados Localización Cartografiado Función Interacciones TIPOS DE MUTACIÓN MUTACIÓN GÉNICA -El alelo de un gen sufre un cambio,

Más detalles

CROMATOGRAFÍA DE FILTRACIÓN EN GEL

CROMATOGRAFÍA DE FILTRACIÓN EN GEL 1.- FUNDAMENTO TEÓRICO CROMATOGRAFÍA DE FILTRACIÓN EN GEL Filtración en gel - 1 (Farmacia) La cromatografía de exclusión o filtración en gel es una clase de cromatografía sólido-líquido que permite la

Más detalles

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS Prácticas docentes en la COD: 10-71 APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS FUNDAMENTO TEÓRICO La PCR es una técnica que permite llevar a cabo la síntesis in vitro de fragmentos de ADN. Está basada

Más detalles

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Para la purificación de ADN genómico de todos los kits de colección Oragene y ORAcollect. Visite nuestro sitio

Más detalles

Tecnología de DNA recombinante I

Tecnología de DNA recombinante I Tecnología de DNA recombinante I Base: capacidad de manipular moléculas de DNA en un tubo de ensayo Enzimas: Purificadas, con actividades conocidas y controladas DNA polimerasas Síntesis de DNA Nucleasas

Más detalles

Laboratorio Biología Molecular: EPSH. Universidad de Zaragoza

Laboratorio Biología Molecular: EPSH. Universidad de Zaragoza GEL DE POLIACRILAMIDA A) Preparación del soporte del gel: Para hacer el gel se utilizan dos láminas de vidrio (cristal en "U" y cristal recto) unidas con cinta adhesiva. Estas láminas son diferentes, se

Más detalles

Investigación en genes. Tecnología del ADN recombinante

Investigación en genes. Tecnología del ADN recombinante Investigación en genes Tecnología del ADN recombinante Tecnología del ADN recombinante 1º parte: Conocimientos básicos que posibilitaron su desarrollo 2º parte: Instrumentos básicos 3º parte Ejemplos Conocimientos

Más detalles

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante BIOTECNOLOGÍA 1.- Ingeniería Genética, ADN recombinante Técnica del ADN recombinante: es la más usada en ingeniería genética, esta basada en el uso de las enzimas de restricción o endonucleasas de restricción

Más detalles

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

Reacción en cadena de la polymerasa (PCR)

Reacción en cadena de la polymerasa (PCR) Reacción en cadena de la polymerasa (PCR) 1 PCR Que es? Es una técnica in vitro diseñada para amplificar una región específica de DNA. Es extremadamente sensible, con la capacidad de amplificar millones

Más detalles

ELECTROFORESIS WESTERN BLOT ELISA

ELECTROFORESIS WESTERN BLOT ELISA ELECTROFORESIS WESTERN BLOT ELISA INTEGRANTES: Arguelles, Rocío Assandri, Matías Almirón, Marianela Buonanduci, Facundo Gómez, Alan Miller, Florencia López, Rocío Vidal, Sol Sillingardi, Leonardo Soria,

Más detalles

ELECTROFORESIS. Agarosa. Poliacrilamida

ELECTROFORESIS. Agarosa. Poliacrilamida ELECTROFORESIS DE ADN ELECTROFORESIS Agarosa Poliacrilamida Finalidad de la electroforesis Separar Identificar Purificar 1 2 3 4 5 Tinción del ADN Bromuro de etidio Absorbancia a 302 y 366 y emisión a

Más detalles

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA BIOLOGIA MOLECULAR Hemos elaborado un programa en 3 niveles, en función del tipo de estudiante y las posibilidades del centro educativo: 1. NIVEL BASICO 2. NIVEL MEDIO DANAEXTRACTOR KIT Práctica que constituye

Más detalles

MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR)

MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) OBJETIVOS - Definir PCR, conocer los reactivos que

Más detalles

TaqMan GMO Maize Quantification Kit. Part No: 4481972

TaqMan GMO Maize Quantification Kit. Part No: 4481972 TaqMan GMO Maize Quantification Kit Part No: 4481972 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan

Más detalles

MEMORIA DE PRÁCTICAS

MEMORIA DE PRÁCTICAS MEMORIA DE PRÁCTICAS Empresa: Centro Nacional de Tecnología y Seguridad Alimentaria (CNTA)- Laboratorio del Ebro. San Adrián (Navarra). Alumna: Laura Sánchez Vicente Período de prácticas: 01-07-08 hasta

Más detalles

ADN y RNA caracterización y métodos de estudio

ADN y RNA caracterización y métodos de estudio ADN y RNA caracterización y métodos de estudio Separación por centrifugación de equilibrio en gradiente de densidad de en CsCl Separación por centrifugación de equilibrio en gradiente de densidad de en

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082 Página 1 de 5 1. OBJETIVO Detectar la presencia de Campylobacter jejuni en hamburguesa de pollo mediante técnica de PCR. 2. CAMPO DE APLICACIÓN Y ALCANCE Aplicar este procedimiento a muestras de hamburguesa

Más detalles

DANAGENE SALIVA KIT. Ref.0603.4 50 Extracciones / Ref.0603.41 160 Extracciones

DANAGENE SALIVA KIT. Ref.0603.4 50 Extracciones / Ref.0603.41 160 Extracciones DANAGENE SALIVA KIT Ref.0603.4 50 Extracciones / Ref.0603.41 160 Extracciones 1.INTRODUCCION DANAGENE SALIVA Kit provee un método para la extracción de ADN genómico de alta calidad a partir de muestras

Más detalles

CICLO 2 : Fraccionamiento subcelular

CICLO 2 : Fraccionamiento subcelular Curso de Fisicoquímica Biológica 2006 Licenciatura de Bioquímica. Facultad de Ciencias. CICLO 2 : Fraccionamiento subcelular OBJETIVOS GENERALES: 1) Obtención de preparados enriquecidos en fracciones subcelulares

Más detalles

ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA

ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA FACULTAD DE VETERINARIA DEPARTAMENTO DE SANIDAD ANIMAL ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA GUIÓN DE PRÁCTICAS DE LABORATORIO CURSO 2014 2015 MÓDULO: PORCINO Síndrome respiratorio y reproductor

Más detalles

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática.

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Departamento de Bioquímica Médica y Biología Molecular Práctica 3 Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Curso 1 Medicina (Abril) 2012 BIOQUÍMICA

Más detalles

PROTOCOLOS ACTIVIDAD PRÁCTICA Nº 1

PROTOCOLOS ACTIVIDAD PRÁCTICA Nº 1 CURSO DE POSTGRADO DE MEDICINA Técnicas de Biología Celular y Molecular Utilizadas en Investigación Científica Básica y Aplicada PROTOCOLOS ACTIVIDAD PRÁCTICA Nº 1 Cortar el material en trozos pequeños

Más detalles

Experimento con reactivos de la vida cotidiana!

Experimento con reactivos de la vida cotidiana! Experimento con reactivos de la vida cotidiana Laura Martínez Martín- 1º Grado Genética - UAB Abril de 2015 1 Índice Introducción 3 Objetivos 3 Material. 3 Procedimiento 4 Explicaciones científicas del

Más detalles

GUIA DE LABORATORIO PRACTICA 8 EXTRACCIÓN ADN PROGRAMA DE ENFERMERIA CURSO INTEGRADO DE PROCESOS BIOLOGICOS

GUIA DE LABORATORIO PRACTICA 8 EXTRACCIÓN ADN PROGRAMA DE ENFERMERIA CURSO INTEGRADO DE PROCESOS BIOLOGICOS GUIA DE LABORATORIO PRACTICA 8 EXTRACCIÓN ADN PROGRAMA DE ENFERMERIA CURSO INTEGRADO DE PROCESOS BIOLOGICOS Leidy Diana Ardila Leal Docente. INTRODUCCIÓN En esta práctica se va a realizar la extracción

Más detalles

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR)

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) Centro de de Microscopía Electrónica Facultad de de Ciencias Médicas Universidad Nacional de de Córdoba

Más detalles

NORMAS DE TRABAJO EN BIOLOGÍA MOLECULAR Y GUÍA DE PROBLEMAS HABITUALES Y SU SOLUCIÓN

NORMAS DE TRABAJO EN BIOLOGÍA MOLECULAR Y GUÍA DE PROBLEMAS HABITUALES Y SU SOLUCIÓN NORMAS DE TRABAJO EN BIOLOGÍA MOLECULAR Y GUÍA DE PROBLEMAS HABITUALES Y SU SOLUCIÓN 1. PROCEDIMIENTOS BÁSICOS: En este apartado pretendemos detallar algunos factores muy importantes a la hora de realizar

Más detalles

CAPACITACIÓN PROFESORES/AS COMUNA DE VIÑA DEL MAR

CAPACITACIÓN PROFESORES/AS COMUNA DE VIÑA DEL MAR CAPACITACIÓN PROFESORES/AS COMUNA DE VIÑA DEL MAR Relatora: María Isabel Muñoz Rojo Fecha: 05 mayo 2012 Células! Cromosomas! ADN! Hacen la diferencia entre tú, yo y los otros seres vivos INTRODUCCIÓN:

Más detalles

QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA. Julio A. Carrasco Vallejo Julio 2014

QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA. Julio A. Carrasco Vallejo Julio 2014 QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA Julio A. Carrasco Vallejo Julio 2014 Definiciones Biología Molecular: Estudio de los flujos de información genética en una célula Biotecnología: Uso de sistemas

Más detalles

Biología Celular y Molecular. Guía de TP Nro. 2. Mantenimiento de líneas celulares.

Biología Celular y Molecular. Guía de TP Nro. 2. Mantenimiento de líneas celulares. Biología Celular y Molecular. Guía de TP Nro. 2 Mantenimiento de líneas celulares. Introducción Una de las formas de crecimiento in vitro es el cultivo en monocapa. Cuando las células requieren la adhesión

Más detalles

Enzimas de restricción

Enzimas de restricción BIOTECNOLOGIA Enzimas de restricción Endonucleasas que reconocen dianas específicas en el ADN Protegen a cada cepa de bacterias de otro ADN que no pertenece al sistema El ADN propio está protegido porque

Más detalles

Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón

Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón Reacción en Cadena de la INTRODUCCION: Polimerasa (RCP) Década de los 70: Grandes

Más detalles

Curso de biología molecular CIMAT 2008

Curso de biología molecular CIMAT 2008 Curso de biología molecular CIMAT 2008 Resumen Este curso-taller tiene como propósito mostrar de manera teórica y práctica algunos principios básicos de biología molecular e ingeniería genética. Conocerás

Más detalles

I.S.P.I. N 9009 San Juan Bautista de La Salle INTRODUCCIÓN A LA BIOTECNOLOGÍA Y TECNOLOGÍAS ESPECÍFICAS

I.S.P.I. N 9009 San Juan Bautista de La Salle INTRODUCCIÓN A LA BIOTECNOLOGÍA Y TECNOLOGÍAS ESPECÍFICAS I.S.P.I. N 9009 San Juan Bautista de La Salle INTRODUCCIÓN A LA BIOTECNOLOGÍA Y TECNOLOGÍAS ESPECÍFICAS Asignatura: Frecuencia: Docente a cargo: Destinatarios: Anual 5 horas por semana Lic. César R. Olsina

Más detalles

EXTRACCIÓN DE ADN (3)

EXTRACCIÓN DE ADN (3) EXTRACCIÓN DE ADN (3) PROCEDIMIENTO BÁSICO PARA FUENTES ALTERNATIVAS Muchos estudios de Biología Molecular comienzan con la extracción de ácidos nucleicos. La lisis celular libera las moléculas en una

Más detalles

7.012 Serie de ejercicios 5

7.012 Serie de ejercicios 5 Nombre Grupo 7.012 Serie de ejercicios 5 Pregunta 1 Al estudiar los problemas de esterilidad, usted intenta aislar un hipotético gen de conejo que explique la prolífica reproducción de estos animales.

Más detalles

Características del kit:

Características del kit: ! La detección de clonalidad mediante análisis molecular por PCR de reordenamientos de los genes de las inmunoglobulinas (Ig) y TCR, es un instrumento de gran valor en el diagnóstico de los procesos linfoproliferativos

Más detalles

PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN DE LAS COMPETENCIAS PROFESIONALES CUESTIONARIO DE AUTOEVALUACIÓN PARA LAS TRABAJADORAS Y TRABAJADORES

PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN DE LAS COMPETENCIAS PROFESIONALES CUESTIONARIO DE AUTOEVALUACIÓN PARA LAS TRABAJADORAS Y TRABAJADORES MINISTERIO DE EDUCACIÓN SECRETARÍA DE ESTADO DE EDUCACIÓN Y FORMACIÓN PROFESIONAL DIRECCIÓN GENERAL DE FORMACIÓN PROFESIONAL INSTITUTO NACIONAL DE LAS CUALIFICACIONES PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN

Más detalles