Tamaño: px
Comenzar la demostración a partir de la página:



1 FACULTAD DE MEDICINA DE LA UNIVERSIDAD DE SEVILLA. PRACTICAS DE VIROLOGÍA. GRADO BIOMEDICINA SEGUNDO CICLO PRACTICA 1: Visualización del efecto citopático. PRACTICA 2: Técnicas de Diagnóstico Serológico (ELISA) PRACTICA 3: Técnicas de Diagnóstico Serológico (Western-blot) PRACTICA 4: Multiplex PCR (Realtime-PCR) de virus herpes. Día 1: Visualización del efecto citopático Desarrollo de la Tecnica de ELISA Western-Blot (Incubación con anticuerpo primario) Día 2: Visualización del efecto citopático Western-Blot (Detección) Día 3: Visualización del efecto citopático Multiplex PCR (Realtime-PCR) de virus herpes

2 PRACTICA 1: Visualización del efecto citopático. Para cultivar virus se utilizan tipos específicos de células de cultivo tisular. Los cultivos de células primarias se obtienen por tratamiento de algún órgano animal específico con tripsina o colagenasa. Las células obtenidas con este método se cultivan en monocapa (fibroblasto o células epiteliales) o en suspensión (linfocitos) en medios artificiales complementados con suero bovino o alguna otra de factores de crecimiento. Las células primarias se puedn separar con tripsina, se diluyen y crecen en nuevas monocapas (subcultivos) para convertirse en cultivos celulares secundarios. Las líneas de células diploides son cultivos de un único tipo de células con los que se puede hacer un gran número de pases, aunque finito, antes de presentar signos de senescencia o experimentar cambios significativos en sus características. Las líneas celulares tumorales y las líneas celulares inmortalizadas, iniciadas a partir de tumores de pacientes o por efecto de virus o compuestos químicos respectivamente, se componen de células de un solo tipo que pueden ser sometidas a pases continuos sin envejecer. Las células primarias de riñón de mono son muy adecuadas para llevar a cabo el aislamiento del virus de la gripe, paramixovirus, muchos enterovirus y alguno adenovirus. Las células diploides fetales humanas, que generalmente son fibroblastos, permiten el crecimiento de un amplio abanico de virus (VHS, VVZ, CMV, adenovirus, picornavirus). Las células HeLa, una línea continua de células epiteliales derivadas de un cancre humano son excelentes para aislar el VRS, los adenovirus y los VHS. Muchos virus con importancia clínica se pueden aislar con algunos de estos cultivos celulares. Se denomina efecto citopático (ECP) a los cambios bioquímicos y moleculares, morfológicos y de viabilidad celular, visibles a microscopía óptica, causados durante el ciclo de replicación viral. Estos efectos se usan para reconocer las células infectadas por virus en un cultivo. Los efectos citopáticos inducidos por los virus se pueden examinar con un microscopio de luz invertida de baja potencia. Se determinan características como redondeamiento y contracción de las células, aumento de la refractabilidad, fusión o formación de sincitios, agregación, pérdida de adherencia y lisis o muerte celular. Los efectos citopáticos se producen como resultado de: Ingreso del virus en el huésped (paso a través de la membrana plasmática) Inhibición de la transcripción celular o estimulación de la actividad de la RNA polimerasa celular Interacciones del virus con las vías de procesamiento del RNA Interacciones del virus con el aparato de traducción Respuesta del huésped a la infección viral Los efectos citopáticos son los criterios más simples y utilizados con más frecuencia para reconocer las infecciones virales, aunque no todos los virus causan estos efectos. Por tal razón deben usarse otros métodos para detectar las infecciones virales. Células A-549: Línea diploide de epitelio alveolar de pulmón humano (Se utiliza para cultivo de Herpevirus). Línea celular tumoral. Células MRC-5: Línea diploide de fibroblasto de pulmón humano (Se utiliza para cultivo de CMV). Línea celular tumoral. La práctica consistirá en la visualización del efecto citopático de los virus VHS y CMV a lo largo de tres días consecutivos.

3 Efecto citopático inducido por Virus Herpes Simplex. Muestra de Biopsia Hepática. (A) Cuerpo de inclusión eosinófilo. (B) Célula infectada con nucleo condensado más pequeño. Efecto citopático inducido por Virus Herpes Simplex. Cultivo de células Vero (estirpe celular de riñón de mono verde verde africano) no infectada. (B) Células de riñón de mono verde verde africano infectadas por VHS-1 en la que se aprecian células redondeadas, células multinucleadas y desaparición de la monocapa. Las flechas indican los sincitios.

4 PRACTICA 2: Técnicas de Diagnóstico Serológico (ELISA) Los métodos serológicos son especialmente útiles para estudiar virus de difícil desarrollo en cultivos celulares y virus que causan enfermedades de curso lento. Se puede utilizar el suero del paciente (que contiene anticuerpos) para identificar cepas virales o serotipos, evaluar el curso de una infección y evaluar si la infección es reciente o crónica. La detección de anticuerpos contra un virus es una determinación indirecta de la infección viral. Indica la respuesta antiviral de un huésped más que la presencia de partículas virales. Cuando un individuo se encuentra por primera vez con un virus, el organismo responde mediante la producción de un tipo de anticuerpos específicos contra el virus denominado IgM. Los anticuerpos IgM son proteínas que se encuentran en el suero durante las primeras dostres semanas de una infección primaria. La presencia de anticuerpos IgM específicos indica una infección reciente. Luego aparecen los anticuerpos IgG. Estos son los más comunes ya que representan hasta el 75% de anticuerpos totales. Si una persona se reinfecta con un virus, la respuesta del anticuerpo IgM es similar a la respuesta primaria, pero para la IgG se activan células de memoria que producen anticuerpos IgG específicos en un corto periodo de tiempo. Mediante el examen de los perfiles de anticuerpos se pueden diferenciar infecciones crónicas de infecciones recientes. Las enfermedades de curso lento como la mononucleosis infecciosa causada por el virus Epstein-Barr y la hepatitis B y C, son pasibles a ser diagnosticadas de este modo. TOMA DE MUESTRA. Estas determinaciones, salvo excepciones (LCR...) se van a realizar en suero. Con estas técnicas podremos determinar tanto las inmunoglobulinas globales (IgG + IgM) o bien sólo la IgM, la IgG, o en algunos casos especiales otras Ig (IgA). siguiente: La evolución de estas inmunoglobulinas en el curso de una infección primaria es la F Aguda F Convalescencia

5 La detección de inmunoglobulinas totales o de IgG en una muestra de suero nos indicará la prevalencia de anticuerpos frente a una infección o bien que el paciente ha tenido previo contacto con el agente infeccioso. Solamente en caso de títulos muy altos podría tener valor diagnóstico. La presencia de IgM indica que la infección está en actividad por lo que una sola determinación podría ser diagnóstica (aunque existen excepciones). Normalmente lo que se hace es la determinación de inmunoglobulinas totales en dos sueros del paciente, uno tomado en la fase aguda de la enfermedad y otro en la fase de convalecencia (separación días) y lo que vamos a valorar es un aumento significativo (4 diluciones ó más) en los títulos de anticuerpos. A esto lo denominamos Seroconversión. TÉCNICAS. Aglutinación: Se usa cuando queremos poner de manifiesto anticuerpos frente a antígenos grandes. Si hay Ac, estos se unirán al Ag formando una malla tridimensional que se ve a simple vista. Si no hay Ac, el Ag sedimentará en el fondo del pocillo formando un botón. - Lectura positiva: Malla que cubre todo el fondo del pocillo. - Lectura negativa: Punto o botón en el centro del pocillo. Hemaglutinación: Para Ags pequeños se utiliza un soporte que haga la reacción visible. En este caso son hematíes. Aglutinación con partículas de Latex: Es similar a la hemaglutinación, Aquí el soporte son partículas de látex. Fijación del complemento: Pone de manifiesto la IgM (que es la que más fija el complemento) o grandes cantidades de IgG. Por tanto es útil para detectar una infección en actividad y no para determinar el estado inmune. Si hay Ac, frente al Ag estudiado, la unión Ag-Ac va a fijar el complemento y a consumirlo. Para poderlo visualizar vamos a utilizar como sistema indicador el complejo Hematíes-Hemolisina.

6 - Lectura positiva: botón o punto. Si había Ac frente al Ag no quedará complemento libre y la hemolisina no lisará los hematíes ocurriendo la precipitación de los mismos (Botón en el fondo). - Lectura negativa: no sedimentación de hematíes (agua de lavar carne) Si no había Ac, quedará complemento libre y éste será fijado por el complejo hemolisina-hematíes ocurriendo la lisis de hematíes. (Agua de carne). Inmunofluorescencia indirecta: Para poner de manifiesto la unión Ag-Ac utilizamos antigammaglobulinas, es decir, anticuerpos dirigidos contra gammaglobulinas (anticuerpos) humanos marcados con fluoresceína. Podemos poner de manifiesto bien los anticuerpos totales ó solo la IgM. Es una de las técnicas más usadas en la actualidad. Se emplea por ejemplo para el diagnóstico de las infecciones producidas por Treponemma pallidum, Legionella, Toxoplasma, virus de Epstein Barr,... Ensayos inmunoenzimáticos (ELISA): En este caso la unión Ag-Ac se pone de manifiesto mediante anticuerpos dirigidos contra los anticuerpos humanos que van unidos a un enzima. Este enzima va a catalizar una reacción de cambio de color cuando se le añada un sustrato específico. - Lectura positiva: Cambio de color. - Lectura negativa: Permanece el mismo color. Se utiliza frecuentemente para el diagnóstico de adenovirus, citomegalovirus, Epstein- Barr, Varicella-Zoster, Influenza, Herpes Simplex o VIH. Inmunoblotting o Western-blotting. Permite detectar Ac frente a proteínas (antígenos) de los microorganismos, previamente separadas mediante electroforesis y posteriormente transferidas a una membrana, mediante la realización de un inmunoensayo empleando la metodología antes indicada. Es una técnica de gran especificidad y se emplea, además de cómo herramienta de investigación, en el diagnóstico de las infecciones por virus, por ejemplo el VIH. Los ensayos de ELISA, que a veces se conocen como ensayos enzimáticos (EIA), se utilizan rutinariamente en el laboratorio de diagnóstico para detectar antígenos virales en las muestras clínicas y para identificar y cuantificar anticuerpos virales en suero. Se basan en la unión de los anticuerpos a sus antígenos y en la detección de esta reacción mediante anticuerpos comerciales conjugados con una enzima activa. La enzima reacciona son su sustrato y produce un cambio de color. La observación y la medición del color determinan el resultado de la prueba. El ELISA es un método muy sensible y reaccionará incluso cuando solo 1 o 2 anticuerpos de se hallen en la muestra de suero. En el caso de HIV, si la muestra es reactiva o positiva, se repite. Si la segunda muestra es también positiva se debe realizar una confirmación mediante Western-blot. El uso de las dos pruebas juntas proporciona la máxima seguridad diagnostica. Aunque los ELISA son muy sensibles y altamente específicos, se pueden producir reacciones falsas positivas debido a las reacciones cruzadas de los anticuerpos.

7 Nosotros en la práctica realizaremos un diagnóstico serológico de anticuerpos totales (IgG/IgM) frente al virus de la gripe (Influenza A). INFLUENZA A ELISA IgG/IgM La gripe o influenza es una enfermedad infecciosa causada por un tipo de virus de ARN. Los virus de gripe se caracterizan por una variabilidad genética pronunciada, pudiendo ser clasificados en los tipos A, B y C. Un elevado número de mutaciones conduce a modificaciones en las glicoproteínas, responsables de las típicas pandemias y endemias de los virus de la gripe A y B. La capacidad de intercambio genético entre virus humanos y animales de la gripe A conduce a la generación de nuevos subtipos como el H5N1 o el H1N1. Métodos de Diagnóstico: En época epidémica, el diagnóstico clínico es difícil debido que puede confundirse con otras enfermedades respiratorias. El diagnóstico de laboratorio es especialmente útil para enfermos con riesgo de sufrir enfermedad grave (inmunodeprimidos, mayores de 60 años, embarazadas de tercer trimestre). Las técnicas serológicas más empleadas son fijación de complemento, IFI y ELISA, aunque la mayor parte de los casos se detectan con biología molecular, cultivo y detección de antígeno. INFLUENZA A ELISA IgG/IgM INFLUENZA A ELISA IgG/IgM es una prueba inmunoenzimática indirecta para determinar anticuerpos IgG y/o IgM frente a Influenza A en suero o plasma humano. El kit contiene 96 tests. La presentación G/M incluye todos los reactivos necesarios para llevar a cabo todas las combinaciones posibles de determinaciones IgG e IgM con una sola referencia. El método de ELISA se basa en la reacción de los anticuerpos de la muestra con el antígeno unido a la superficie de poliestireno. Las inmunoglobulinas no unidas por reacción con el antígeno son eliminadas en el proceso de lavado. En un paso posterior la globulina antihumana reacciona con el complejo antígeno-anticuerpo, y la que no se une es eliminada por los lavados; la unida reacciona con el sustrato (TMB), para dar una reacción coloreada azul, que cambia a amarillo tras la adición de la solución de parada.

8 Protocolo: 1. Sacar los reactivos para que se atemperen. 2. Agitar todos los componentes. 3. Cada alumno trabajará con un suero problema, un control positivo y un control negativo. Dilución para IgG 4. Añadir a un tubo eppendorf 100 L de diluyente de muestra. 5. Añadir a cada tubo 5 L de suero, control positivo o control negativo. 6. Homogeneizar con la pipeta durante 1 minuto. 7. Añadir a cada pocillo 105 L de cada mezcla. Dilución para IgM 8. Añadir a un tubo eppendorf 25 L de sorbente. 9. Añadir a cada tubo 5 L de suero 10. Añadir a un tubo eppendorf 75 L de diluyente de muestra. 11. Homogeneizar con la pipeta durante 1 minuto. 12. Añadir a cada pocillo 105 L de cada mezcla. 13. Tapar mediante lámina adhesiva e incubar en estufa a 37ºC durante 45 minutos. 14. Retirar la lámina adhesiva, aspirar el contenido de todos los pocillos y lavar cada uno de ellos 5 veces con 0,3 ml de solución de lavado, asegurándose que no quedan restos de solución de lavado. 15. Añadir inmediatamente 100 μl de conjugado IgG o IgM a todos los pocillos. 16. Tapar mediante lámina adhesiva e incubar en estufa/baño durante 30min. a 37±1ºC. 17. Retirar la lámina adhesiva, aspirar el contenido de todos los pocillos y lavar cada uno de ellos 5 veces con 0,3 ml de solución de lavado 9, asegurándose que no quedan restos de solución de lavado. 18. Añadir inmediatamente 100 μl de solución de sustrato a todos los pocillos. 19. Incubar a temperatura ambiente durante 20 minutos, en la oscuridad. 20. Añadir inmediatamente 50 μl de solución de parada a todos los pocillos. 21. Valorar espectrofotométricamente a 450/620 nm, antes de 1 hora de acabado el ensayo.

9 PRACTICA 3: Técnicas de Diagnóstico Serológico (Western-blot) El análisis de transferencia de Western-blot es una variante del análisis de ELISA. Esta tecnica consiste en la transferencia de proteína víricas separadas mediante técnicas electroforéticas según su peso molecular y su carga eléctrica a un papel de filtro (nitrocelulosa, nailon, ). Cuando se expone al suero del paciente, las proteínas inmovilizadas atrapan los anticuerpos antivíricos específicos y éstos se visualizan mediante anticuerpos antihumanos conjugados con enzimas. Esta técnica muestra las proteínas reconocidas por el suero del paciente. El análisis de transferencia de Western-blot se usa como prueba confirmatoria de los resultados de análisis de ELISA sn sujetos con sospecha de infección por el virus de la inmunodeficiencia humana (VIH). Simulación de Western-blot de VIH a realizar en la práctica. ELECTROFORESIS Cargar el gel de proteínas virales y correr (dejar correr todo el frente) TRANSFERENCIA NEGRO ESPONJA WATMAN MEMBRANA GEL WATMAN ESPONJA TRANSPARENTE

10 La transferencia se realiza desde el ánodo ( - ) al cátodo ( + ) DETECCIÓN (Rehidratar la membrana con metanol) BLOQUEO TTBS 5% leche en polvo 2 horas ó O/N Tº Ambiente Lavado suave con H 2 O MQ ó destilada INCUBACIÓN Ac 1º (suero del paciente) Dilución 1/2000 del Ac en TTBS BSA 0,4 % 2 horas Tº Amb en agitación 3 lavados de 10 min con TTBS INCUBACIÓN Ac 2º (anti human marcado con peroxidasa) Dilución 1 / del Ac en TTBS BSA 0,4 % 1 hora Tº Amb en agitación 3 lavados de 10 min con TTBS REVELADO Se utilizará el reactivo SIGMAFast 3,3 -Diaminobenzidina en tabletas (sustrato del enzima peroxidasa). Éste es un sustrato precipitable de color negro para la detección de este enzima. Las tabletas se disuelven en 15ml de H2O destilada que produce una solución que consiste en 0.7mg/L DAB+0.67mg/L Peróxido de Urea+ 60mM Tris buffer. Esta solución está lista para su uso (usar la solución en un periodo de 1 hora).

11 Quitar el exceso de TTBS Cubrir la membrana con una pipeta con la solucion que contiene DAB. Esperar 1 minuto. El desarrollo de un precipitado de color negro ocurre rapidamente. En la muestra positivas debe apreciarse una banda de color negro mientras que en las muestra negativas la membrana se mantiene de color blanco. SOLUCIONES TRANSFER BUFFER G Tris 5.76 g Glicina ENRASAR A 2000 ml 800 ml Metanol TTBS TWEEN 20 1 ml 1 M TRIS7HCL Ph ml NaOH 5M 5 ml ENRASAR A 2000 ml Solución Ponceau: Ponceau-S al 2% en acético al 1%

12 PRACTICA 4: Multiplex PCR (Realtime-PCR) de virus herpes. Los ácidos nucléicos, tanto ADN como ARN, así como las proteínas de un agente infeccioso son huellas que delatan la presencia de los agentes infecciosos en las muestras clínicas y son muy útiles para su identificación. Las ventajas de los métodos moleculares radican en su sensibilidad, su especificidad y su seguridad. Desde el punto de vista de la seguridad, estas técnicas no requieren el aislamiento del agente infeccioso. Debido a su sensibilidad permiten detectar muestras muy diluidas de material genético en un tejido. Estas técnicas permiten distinguir variantes en función de su genotipo lo cual es especialmente útil para diagnosticar cepas resistentes a los agentes antivíricos, las cuales pueden diferir en un único nucleótido. Son varias las técnicas utilizadas como herramientas de Diagnóstico Molecular: Análisis electroforético y polimorfismos de longitud de fragmentos de restricción (RFLP). Se ha utilizado para diferenciar variantes del VHS y diferenciar VHS-1 de VHS- 2. Sondas genéticas (Hibridación in situ, Southern, Northern). Las sondas de ADN se pueden utilizar de manera semejante a los anticuerpos, como herramientas sensibles y específicas para detectar, localizar y cuantificar secuencias de ácidos nucleicos específicos de muestras clínicas. Reacción en cadena de la polimerasa (PCR). Amplifica copias simples de material genético vírico varios millones de veces. Esta técnica es especialmente útil para detectar virus latentes e integrados como es el caso de los retrovirus, herpes o papilomavirus. PCR RT-CPR PCR a tiempo real En la práctica realizaremos una PCR a tiempo real de virus Herpes Simple.

13 RT-PCR Virus de la familia herpesviridae (VHS, VVZ y CMV) PCR VIRUS HERPES SIMPLE FUNDAMENTO PCR anidada en tiempo real 382 pb HSV Os HSV Oa 2719 pb HSV Is HSV Ia 281 pb CEBADORES Sentido Posición Nombre Secuencia (5 3 ) Outer sense HSV Os ATCCGAACGCAGCCCCGCTG Outer antisense HSV Oa TCCGG(G/C)GGCAGCAGGGTGCT Inner sense HSV Is GCGCCGTCAGCGAGGATAAC Inner antisense HSV Ia AGCTGTATA(G/C)GGCGACGGTG Tamaño del amplicón (pb)

14 SEGUNDA PCR (TIEMPO REAL) 1) Preparar la mezcla maestra en un tubo de PCR de 1.5 ml añadiendo los siguientes volúmenes de reactivos (L): MEZCLA MAESTRA Número de reacciones N=1 N=2 N=3 Master Mix 5x activada (tapón verde) Cebador HSV Is (5 M) Cebador HVS Ia (5 M) Agua ) Repartir alícuotas de 8 µl en los capilares. 3) Añadir 2 µl de los productos de la primera PCR (muestra/control). 4) Dar un breve pulso de centrífuga (no superar las 200 rpm) a los capilares. 5) Realizar el Self Test. 6) Introducir los capilares en el Light Cycler. 7) Ejecutar el programa: protocolo EV+VHS+VVZ-READ (carpeta PROTOCOLOS HUV MACARENA/subcarpeta PROGRAMAS DE TRABAJO. 8) El archivo se guarda en la subcarpeta HSV-READ de la carpeta RESULTADOS. Utilizar las iniciales HSV seguido del Nº de la muestra (Ej. HSV ). VALIDACION DE LOS RESULTADOS 1) Para validar la prueba se tienen que cumplir los siguientes requisitos: o Control negativo: no se obtiene curva de amplificación, o si se obtiene una curva, la Tm del producto de PCR es inferior a 85ºC (dímeros de primers). o Control positivo VHS: se obtiene una curva de amplificación y la Tm es de o Control de beta-globina: se obtiene una curva de amplificación y la Tm es de (0.50). 2) Las causas más frecuentes para invalidar la prueba son: o Contaminación del control negativo con ADN o con productos amplificados del control positivo. En este caso hay que repetir la extracción de ADN, la1ª PCR y la 2ª PCR. o No se obtiene amplificación del control positivo. o No se obtiene amplificación de la beta-globina. INFORME DE RESULTADOS Los posibles resultados de la muestra problema son: 1. PCR negativa (no se detecta ADN de VHS): no se obtiene curva de amplificación, o si se obtiene curva, la Tm del producto de PCR es inferior a 85ºC (dímeros de primers).

15 2. PCR positiva (se detecta ADN de VHS): se obtiene una curva de amplificación y la Tm es de PCR no interpretable: no se obtiene amplificación de la beta-globina por inhibición de la PCR (incluso después de diluir la muestra). Si no amplifica el control positivo se repite la PCR de la muestra y de otro control positivo distinto. 4. El resultado de la PCR se pueden CONFIRMAR mediante electroforesis (geles de agarosa al 2%). 5. Los tamaños esperados de los fragmentos amplificados de la muestra problema deben ser: a) 382 pb (primera PCR VHS) y 281 pb (segunda PCR VHS). b) 248 pb (betaglobina).



Más detalles



Más detalles

Diagnóstico Serológico de Sífilis Técnicas treponémicas

Diagnóstico Serológico de Sífilis Técnicas treponémicas Diagnóstico Serológico de Sífilis Técnicas treponémicas T.M. Rodrigo Colina Morales Laboratorio de Infecciones de Transmisión Sexual Sección Bacteriología Mayo 2014 FTA-ABS (Fluorescent Treponemal Antibody

Más detalles

Diagnóstico microbiológico de la infección por HIV

Diagnóstico microbiológico de la infección por HIV Diagnóstico microbiológico de la infección por HIV Juan Carlos Rodríguez Díaz S. Microbiología Hospital General Universitario de Alicante E-mail: rodriguez_juadia@gva.es http://microbiología-alicante.umh.es

Más detalles



Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a Introducción Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a los investigadores verificar la expresión de una proteína, determinar la cantidad relativa

Más detalles

P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA"

P.C.R. Técnica de amplificación enzimática de secuencias específicas de DNA P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA" Paso 1: Desnaturalización del DNA Paso 2: Hibridación de los "Primers" Paso 3: Extensión Paso 1: Desnaturalización del DNA

Más detalles



Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles


DETERMINACIÓN DEL FACTOR Rh por PCR Ref.PCRRh DETERMINACIÓN DEL FACTOR Rh por PCR 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

Introducción al Inmunodiagnóstico.

Introducción al Inmunodiagnóstico. UNIVRSIDAD D LOS ANDS FACULTAD D FARMACIA Y BIOANÁLISIS CATDRA D INMUNOLOGÍA Introducción al Inmunodiagnóstico. César Pérez-Maldonado,PhD. 2009. INMUNIDAD Mecanismos de Defensa (specíficos / Inespecíficos)

Más detalles



Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. info@atgen.com.uy www.atgen.com.uy

Más detalles

Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio

Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio El VIRUS PRUEBAS PRESUNTIVAS ELISA: es la prueba convencional para la detección

Más detalles


DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino DIAGNOSTICO VIROLOGICO MOLECULAR Dr. Gerardo Andino DIAGNÓSTICO MOLECULAR La tecnología empleada para la detección de genomas virales mediante la amplificación de secuencias específicas (PCR y reacciones

Más detalles

NOCIONES DE EPIDEMIOLOGÍA Y DIAGNOSTICO DE HIV. Dra G Carballal Laboratorio de Virología Clínica CEMIC, 2009

NOCIONES DE EPIDEMIOLOGÍA Y DIAGNOSTICO DE HIV. Dra G Carballal Laboratorio de Virología Clínica CEMIC, 2009 NOCIONES DE EPIDEMIOLOGÍA Y DIAGNOSTICO DE HIV Dra G Carballal Laboratorio de Virología Clínica CEMIC, 2009 La Pandemia de SIDA Personas que viven con el HIV/SIDA Total 40 millones Adultos 38 Niños 2 Nuevas

Más detalles


5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN 5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN Materiales - Eppendorf de 1,5 ml estériles - Eppendorf de pared fina para PCR - Puntas de pipeta estériles desechables - Guantes

Más detalles

Anexo X Técnicas disponibles en el Centro Nacional de Microbiología (CNM) para el Diagnóstico del SRAS

Anexo X Técnicas disponibles en el Centro Nacional de Microbiología (CNM) para el Diagnóstico del SRAS nexo X Técnicas disponibles en el Centro Nacional de Microbiología (CNM) para el Diagnóstico del SRS Técnicas disponibles en el Centro Nacional de Microbiología (CNM) para el Diagnóstico del SRS 1.- islamiento

Más detalles

Diagnóstico Virológico 1 DIAGNÓSTICO VIRAL

Diagnóstico Virológico 1 DIAGNÓSTICO VIRAL Diagnóstico Virológico 1 DIAGNÓSTICO VIRAL El diagnóstico virológico comprende la detección e identificación del agente etiológico de una infección viral, clínica o inaparente, y /o de la respuesta inmune

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles


TRABAJO PRACTICO Nº 3 ENZIMOINMUNOANALISIS ELISA TRABAJO PRACTICO Nº 3 ENZIMOINMUNOANALISIS ELISA Docentes encargados: Bioq. Natalia Guiñazú Bioq. Maria Sol Renna Biol. Virginia Andreani Bioq. Mauricio Figueredo Bioq. Vanina Garrido Bioq. Laura Dulgerian

Más detalles


CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 DEFINICIÓN PCR: Constituye la técnica más importante para amplificar ácidos nucleicos in vitro. Ambas hebras del DNA de interés son replicadas

Más detalles

Técnicas de Biología Molecular

Técnicas de Biología Molecular Técnicas de Biología Molecular DNA I. Enzimas de restricción Análisis Las enzimas de restricción fueron aisladas de bacterias; su función natural es proteger contra DNA extraño II. Separación electroforética

Más detalles


ELISA IgM PARA DIAGNOSTICO DE LEPTOSPIRA Página 1 de 9 ELISA IgM PARA DIAGNOSTICO DE LEPTOSPIRA Elaborado por: CNSP Blgo. Manuel Céspedes Zambrano Revisado por: CNSP TM. Julia I. Espinoza Soto CNSP MV Gladys Malásquez Mendoza Aprobado por: RD

Más detalles


IDENTIFICACIÓN Y MEDICIÓN DE LA RESPUESTA INMUNE IDENTIFICACIÓN Y MEDICIÓN DE LA RESPUESTA INMUNE RESPUESTA INMUNE HUMORAL SEROLOGÍA suero estudio Ciencia de la detección de anticuerpos Medición de las interacciones Ag - Ac, con fines diagnósticos, a

Más detalles



Más detalles



Más detalles


ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles

APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR. Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina

APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR. Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina BiologÍa Molecular: es una disciplina que se enfoca principalmente en el estudio

Más detalles

Materiales para la secuenciación de ADN

Materiales para la secuenciación de ADN Introduccion La Secuenciación Sanger es un método de secuenciación de ADN en el que el ADN diana se desnaturaliza y se hibrida con un cebador de oligonucleótidos, que se extiende entonces gracias a la

Más detalles

ELISA. Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes

ELISA. Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes ELISA Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes ELISA Enzyme Linked Immuno Sorbent Assay Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes

Más detalles


INMUNOLOGÍA PRÁCTICO INMUNOLOGÍA PRÁCTICO DESCRIPCION La inmunología es el estudio del sistema defensivo del organismo huésped, sus aspectos anátomo-funcionales, los mecanismos de respuesta inmunológica, su relación con la

Más detalles

PRUEBA DE VIH. Universidad de Panamá USAID Proyecto Capacity Centroamérica

PRUEBA DE VIH. Universidad de Panamá USAID Proyecto Capacity Centroamérica PRUEBA DE VIH Universidad de Panamá USAID Proyecto Capacity Centroamérica Es la prueba de detección que produce los resultados rápidamente, en aproximadamente 20 minutos y utiliza sangre de una vena o

Más detalles


5-MARCO DE REFERENCIA 5-MARCO DE REFERENCIA Para hablar de pruebas diagnosticas es necesario el conocimiento de ciertos términos que a continuación se describen. Sensibilidad: Es la probabilidad de obtener una prueba positiva

Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

Técnicas moleculares.

Técnicas moleculares. Técnicas moleculares. DMTV Carolina Acevedo Curso de Microbiología 2015 SÍNTESIS IN VITRO DE UNA GRAN CANTIDAD DE COPIAS DE UN SEGMENTO DE ADN EXISTENTE EN UNA MUESTRA. O sea. Amplificamos en forma exponencial

Más detalles

TaqMan GMO Maize Quantification Kit. Part No: 4481972

TaqMan GMO Maize Quantification Kit. Part No: 4481972 TaqMan GMO Maize Quantification Kit Part No: 4481972 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan

Más detalles

El laboratorio de Microbiología y Parasitología en el diagnóstico de las enfermedades tropicales importadas

El laboratorio de Microbiología y Parasitología en el diagnóstico de las enfermedades tropicales importadas El laboratorio de Microbiología y Parasitología en el diagnóstico de las enfermedades tropicales importadas Juan Carlos Rodríguez S. Microbiología Hospital General Universitario de Alicante Universidad

Más detalles

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas ELEMENTOS BÁSICOS DE LA INVESTIGACIÓN EN GENES Análisis

Más detalles

Algoritmos diagnósticos para VIH

Algoritmos diagnósticos para VIH Algoritmos diagnósticos para VIH ALGORITMOS DIAGNÓSTICOS PARA VIH Los avances tecnológicos de los distintos ensayos para el tamizaje y diagnóstico de la infección por VIH, conjuntamente con la necesidad

Más detalles

Como interpretar las pruebas de serología hepatica

Como interpretar las pruebas de serología hepatica Introducción Para descartar en un paciente la presencia de infección viral se deben determinar exclusivamente el antígeno de superficie del virus de la hepatitis B (VHB) (HbsAg) y los anticuerpos frente

Más detalles

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico.

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. AQUAGESTION ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. Noviembre 2011 ACTUALIDAD Este año Sernapesca confirma

Más detalles

Diagnóstico del Dengue

Diagnóstico del Dengue Solución Total: Todo lo que usted necesita saber acerca del Diagnóstico del Dengue Prueba Rápida Dengue Duo ( + Ab Combo) Dengue IgG/IgM ELISA Dengue IgM capture ELISA Dengue IgG capture ELISA ELISA 2

Más detalles

Pruebas serológicas para dengue

Pruebas serológicas para dengue Pruebas serológicas para dengue El 40% de la población mundial corre riesgo de infección por dengue Durante más de 25 años, Focus Diagnostics ha sido un líder en el desarrollo de ensayos inmunológicos

Más detalles

ELISA. Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes

ELISA. Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes ELISA Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes ELISA Enzyme Linked Immuno Sorbent Assay Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes

Más detalles


ELECTROFORESIS WESTERN BLOT ELISA ELECTROFORESIS WESTERN BLOT ELISA INTEGRANTES: Arguelles, Rocío Assandri, Matías Almirón, Marianela Buonanduci, Facundo Gómez, Alan Miller, Florencia López, Rocío Vidal, Sol Sillingardi, Leonardo Soria,

Más detalles



Más detalles


TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO TEST de PATERNIDAD Este experimento introduce a los alumnos en el uso del ADN y la PCR para simular una determinación de paternidad. Los estudiantes

Más detalles


PRÁCTICAS DE MICROBIOLOGIA CLINICA PRÁCTICAS DE MICROBIOLOGIA CLINICA Juan Carlos Rodríguez Hospital General Universitario de Alicante E-mail: rodriguez_juadia@gva.es http://microbiologia-alicante.umh.es CASO CLINICO: Rubéola Evolución

Más detalles



Más detalles

TaqMan GMO Screening Kit. Part No: 4466334

TaqMan GMO Screening Kit. Part No: 4466334 TaqMan GMO Screening Kit Part No: 4466334 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan mayor

Más detalles

Facultad de Ciencias Bioquímicas y Farmacéuticas Área de Integración n Disciplinar y Estudio de la Problemática Profesional TPP I Unidad 2 Aspectos biológicos del VIH Algunos datos importantes 1959 Se

Más detalles

ELISA. Enzyme-Linked. Immuno Sorbent Assay

ELISA. Enzyme-Linked. Immuno Sorbent Assay ELISA Enzyme-Linked Immuno Sorbent Assay Recordemos Cuando un Ag y un Ac interaccionan in vitro PRIMERA ETAPA SEGUNDA ETAPA INTERACCIÓN 1ª INTERACCIÓN 2ª No visualizable Fenómeno visible Precipitación

Más detalles

Practica la genética Ficha didáctica del profesorado Bachillerato

Practica la genética Ficha didáctica del profesorado Bachillerato Ficha didáctica del profesorado Bachillerato www.eurekamuseoa.es Extracción de ADN Cuál es la función de cada uno de los ingredientes utilizados para realizar la disolución tampón para la visualización

Más detalles

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri OBJETIVO Desarrollar un banco de datos a partir de plantas de origen indudable y del uso

Más detalles

Pruebas de compatibilidad, qué técnica emplear?

Pruebas de compatibilidad, qué técnica emplear? Pruebas de compatibilidad, qué técnica emplear? XIV Jornadas de Medicina Transfusional Dra. Carmen Buesa García Sº Hematología y Hemoterapia Hospital Universitario Central de Asturias Pruebas pretransfusionales

Más detalles


DIAGNÓSTICO DE LABORATORIO DE DENGUE EN PANAMÁ DIAGNÓSTICO DE LABORATORIO DE DENGUE EN PANAMÁ TM Brechla Moreno A. Instituto Conmemorativo Gorgas de Estudios de la Salud, Panamá Departamento de Virología y Biotecnología 2013 TÉCNICAS PARA LA DETECCIÓN

Más detalles


2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA BIOLOGIA MOLECULAR Hemos elaborado un programa en 3 niveles, en función del tipo de estudiante y las posibilidades del centro educativo: 1. NIVEL BASICO 2. NIVEL MEDIO DANAEXTRACTOR KIT Práctica que constituye

Más detalles


PRINCIPIO DE LA PRUEBA: USO PREVISTO: ESPECIFICACIONES DEL KIT: Cat. No Cantidad Reactivo Almacenamiento ADRT0011 1 x 20 PRUEBAS 1 x 3 ml Diluente USO PREVISTO: HIV 2-30 C El HIV-1/2 Plus Combo Rapid Test es un inmunoensayo de flujo lateral

Más detalles

FeLV Ag / FIV Ab Test Kit

FeLV Ag / FIV Ab Test Kit SensPERT FeLV Ag / FIV Ab Test Kit CONCEPTO SENSPERT La línea de diagnóstico SensPERT de Rapid Test proporciona una solución rápida, específica y fiable para los médicos veterinarios en su práctica clínica

Más detalles

Práctico: Genética bacteriana 2007.

Práctico: Genética bacteriana 2007. Práctico: Genética bacteriana 2007. Actividad integrada Departamento de Genética Departamento de Bacteriología y Virología. OBJETIVOS Objetivos generales El estudiante al terminar la actividad práctica

Más detalles

Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional

Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional BIOQ. LILIANA DI TULLIO BUDASSI FAC. CS.BIOQUÍMICAS Y FARMACÉUTICAS UNIVERSIDAD NACIONAL DE ROSARIO lilianadt2003@yahoo.com.ar

Más detalles

Reacción en cadena de la polymerasa (PCR)

Reacción en cadena de la polymerasa (PCR) Reacción en cadena de la polymerasa (PCR) 1 PCR Que es? Es una técnica in vitro diseñada para amplificar una región específica de DNA. Es extremadamente sensible, con la capacidad de amplificar millones

Más detalles

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa?

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa? 2º BIOQUÍMICA CUESTIONES 1. Por qué la PCR convencional no es cuantitativa? En la PCR convencional, la cuantificación del ADN de la muestra es complicada debido a que la eficacia de amplificación va disminuyendo

Más detalles

TP6: Western blot. Objetivos. Introducción

TP6: Western blot. Objetivos. Introducción TP6: Western blot Objetivos Familiarizarse con la técnica de western blot. Determinar los niveles de IgG en sueros murinos Comparar la sensibilidad del western blot vs el SDS page Introducción La transferencia

Más detalles


DIAGNÓSTICO DE CMV CONGÉNITO POR NESTED-PCR DIAGNÓSTICO DE CMV CONGÉNITO POR NESTED-PCR obertrand, María Victoria oflores, Antonio Ezequiel ogoyechea, Roxana María Itatí omartinez, Silvina María Inmunología Clínica 2009 CITOMEGALOVIRUS: CARACTERISTICAS

Más detalles

Análisis de la Respuesta Inmunitaria a las vacunas

Análisis de la Respuesta Inmunitaria a las vacunas Análisis de la Respuesta Inmunitaria a las vacunas José Ignacio Santos Profesor de Medicina Experimental Jefe de la Subdivisión de Investigación Clínica Facultad de Medicina Universidad Nacional Autónoma

Más detalles


DANAGENE RNA PURIFICATION KIT DANAGENE RNA PURIFICATION KIT REF.0801.1 100 EXTRACCIONES REF.0801.2 500 EXTRACCIONES 1.INTRODUCCION Este kit permite la permite la obtención de ARN total a partir de cultivos celulares, tejidos animales,

Más detalles

El tipo de alteración observada también proporciona gran información:

El tipo de alteración observada también proporciona gran información: TEMA 5: ENZIMOLOGÍA CLÍNICA 1. Valor diagnóstico de las enzimas en el plasma. 2. Principios del análisis de enzimas 3. Análisis de isoenzimas. 4. Determinación enzimática de sustratos. 1. Valor diagnóstico

Más detalles

Palabras claves: Virus. Diagnóstico. Infección viral.

Palabras claves: Virus. Diagnóstico. Infección viral. Colombia Médica Vol. 31 Nº 3, 2000 El diagnóstico viral por el laboratorio María del Pilar Crespo, Bact., M.Sc.* RESUMEN El diagnóstico de las entidades virales es uno de los mayores retos a los que se

Más detalles


USO PRACTICO E INTERPRETACIÓN DE LA SEROLOGÍA EN CAMPO. Joaquín Girón, MSD AH USO PRACTICO E INTERPRETACIÓN DE LA SEROLOGÍA EN CAMPO. Joaquín Girón, MSD AH El objetivo final de las empresas es tener lotes con muy buenas producciones y económicamente rentables, lógicamente un lote

Más detalles


ACTUALIZACIÓN EN DENGUE Y CHIKUNGUNYA ACTUALIZACIÓN EN DENGUE Y CHIKUNGUNYA Diagnóstico de las infecciones por DENV y CHIKV María Gabriela Barbás Bioq. Esp.en Virología Jefa del Servicio Bioquímico Laboratorio Central de la Provincia de Córdoba

Más detalles



Más detalles

PRUEBA RAPIDA EN EMBARAZADAS (n=62,214 2009-Junio 2010) NO REACTIVO n=218 REACTIVO INDETERMINADO. Tabla 9: Resultados Prueba rápida

PRUEBA RAPIDA EN EMBARAZADAS (n=62,214 2009-Junio 2010) NO REACTIVO n=218 REACTIVO INDETERMINADO. Tabla 9: Resultados Prueba rápida 11-RESULTADOS 11.1-Interpretación y análisis de resultados Un total de de 62,214 mujeres embarazadas se realizaron la prueba rápida de VIH durante años 2009 hasta junio 2010 (Tabla 9). De ellas, 61,808

Más detalles

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica TÉCNICAS GENÓMICAS Utilidad/Objetivos: 1) Detección de microorganismos directamente en muestras clínicas identificando un fragmento específico del genoma del microorganismo concreto 2) Cuantificación del

Más detalles


VIGILANCIA DEL VIRUS CHIKUNGUNYA POR LABORATORIO EN ARGENTINA VIGILANCIA DEL VIRUS CHIKUNGUNYA POR LABORATORIO EN ARGENTINA Bioq. Victoria Luppo Laboratorio de Arbovirus Instituto Nacional de Enfermedades Virales Humanas (INEVH) Dr. J.I.Maiztegui - ANLIS, Pergamino-Argentina

Más detalles

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR Módulo 1 Amplificación de un fragmento de ADN genómico por PCR En este primer módulo se amplificará por PCR, mediante el uso de oligonucleótidos específicos, un fragmento de ADN genómico de Aspergillus

Más detalles


METODOS DE ESTUDIO Y DIAGNOSTICO VIRAL METODOS DE ESTUDIO Y DIAGNOSTICO VIRAL María Daniela Sandin I. INTRODUCCION Los métodos utilizados para reconocer las infecciones por virus humanos pueden clasificarse en DIRECTOS e INDIRECTOS, según persigan

Más detalles

TOXOPLASMOSIS. Dr. Jaime Altcheh Servicio de Parasitología Hospital de Niños Ricardo Gutiérrez

TOXOPLASMOSIS. Dr. Jaime Altcheh Servicio de Parasitología Hospital de Niños Ricardo Gutiérrez TOXOPLASMOSIS Dr. Jaime Altcheh Servicio de Parasitología Hospital de Niños Ricardo Gutiérrez Epidemiología No tengo la culpa!! Los felinos son huéspedes definitivos (ciclo sexuado y asexuado). Los humanos

Más detalles

Absoluta sencillez. Absoluta seguridad. Simple. Confiable. Económico

Absoluta sencillez. Absoluta seguridad. Simple. Confiable. Económico Absoluta sencillez. Absoluta seguridad. Simple. Confiable. Económico Más de 20 determinaciones HIV Anticuerpos, Ag p24 y confirmatorio HEPATITIS A, B y C ToRCH Toxoplasmosis (Toxo) Rubeola Citomegalovirus

Más detalles


SERVICIOS LABORATORIO HISTOCOMPATIBILIDAD SERVICIOS LABORATORIO HISTOCOMPATIBILIDAD El laboratorio de histocompatibilidad está capacitado para desarrollar los estudios necesarios para trasplantes de órganos de acuerdo a los requerimientos internacionalmente

Más detalles


PET-RPLA KIT para DETECCIÓN de TOXINAS. Código: TD0930 PET-RPLA KIT para DETECCIÓN de TOXINAS Código: TD0930 Kit para detección de enterotoxina tipo A de Clostridium perfringens en muestras fecales o en filtrados de cultivos por aglutinación pasiva de látex

Más detalles

Biología Molecular en el Diagnóstico de Enfermedades Infecciosas. Bq. Ivonne Vergara P. Laboratorio Biología Molecular Clínica Las Condes

Biología Molecular en el Diagnóstico de Enfermedades Infecciosas. Bq. Ivonne Vergara P. Laboratorio Biología Molecular Clínica Las Condes Biología Molecular en el Diagnóstico de Enfermedades Infecciosas Dirección Médica Bq. Ivonne Vergara P. Laboratorio Biología Molecular Clínica Las Condes Existen diversas técnicas de Biología Molecular

Más detalles

Rol del Laboratorio en el Diagnóstico. CMV en pacientes transplantados. Bioquímica Mariela Merkt

Rol del Laboratorio en el Diagnóstico. CMV en pacientes transplantados. Bioquímica Mariela Merkt Rol del Laboratorio en el Diagnóstico y Prevención n de la Infección n por CMV en pacientes transplantados Bioquímica Mariela Merkt CMV: Características Familia β Herpesviridae DNA doble cadena Virus envuelto

Más detalles


INTRODUCCIÓN AL CULTIVO CELULAR INTRODUCCIÓN AL CULTIVO CELULAR Cultivo celular: Es un modelo de estudio in vitro constituido por células que pueden crecer y mantenerse en suspensión o en monocapa por más de 24 horas en condiciones controladas.

Más detalles


APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS Prácticas docentes en la COD: 10-71 APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS FUNDAMENTO TEÓRICO La PCR es una técnica que permite llevar a cabo la síntesis in vitro de fragmentos de ADN. Está basada

Más detalles

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml)

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml) PCR SIMULADA Ref.PCR Simulada (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles



Más detalles

1. Diseño, elaboración de manuales y desarrollo de prácticas de las asignaturas del primer año de la titulación.

1. Diseño, elaboración de manuales y desarrollo de prácticas de las asignaturas del primer año de la titulación. Anexo I. 1. Diseño, elaboración de manuales y desarrollo de prácticas de las asignaturas del primer año de la titulación. a) Asignatura BIOQUÍMICA Esta asignatura es la primera en la que el alumno entra

Más detalles

Hepatitis viral tipo C (HCV) RT-PCR

Hepatitis viral tipo C (HCV) RT-PCR Hepatitis viral tipo C (HCV) RT-PCR Celía, Alejandro Fabián Taborda, Florencia Ines Características Generales del HCV Agente etiológico de las HNANB transmitidas por transfusiones Flia: Flaviviridae Género:

Más detalles

Pruebas rápidas r. Estrategias preventivas. Propuesta de nuevas estrategias preventivas

Pruebas rápidas r. Estrategias preventivas. Propuesta de nuevas estrategias preventivas XV ENCUENTRO ESTATAL PARA ONG s Madrid, 1-3 de Octubre 2009 Diagnóstico tardío o. Pruebas rápidas r Dra Carmen Rodríguez Centro Sanitario Sandoval Madrid Estrategias preventivas La prevención de nuevas

Más detalles



Más detalles

Los resultados serológicos. Limitaciones y aplicaciones prácticas para la enfermedad de Gumboro

Los resultados serológicos. Limitaciones y aplicaciones prácticas para la enfermedad de Gumboro PATOLOGÍA LOS RESULTADOS SEROLÓGICOS. LIMITACIONES Y APLICACIONES PRÁCTICAS PARA LA ENFERMEDAD DE GUMBORO Los resultados serológicos. Limitaciones y aplicaciones prácticas para la enfermedad de Gumboro

Más detalles


LA BIOTECNOLOGÍA HACE TU VIDA MEJOR Y MÁS FÁCIL LA BIOTECNOLOGÍA HACE TU VIDA MEJOR Y MÁS FÁCIL BIOTECNOLOGÍA APLICADA A LA SALUD La Biotecnología está presente en la Medicina y en la Salud animal, ya que participa en el diagnóstico y en el tratamiento

Más detalles



Más detalles

Nuevo algoritmo diagnóstico de la Infección por VIH

Nuevo algoritmo diagnóstico de la Infección por VIH Nuevo algoritmo diagnóstico de la Infección por VIH Dra. Manuelita Zavala Pineda Médico Adscrito Servicio Infectología Hospital General de México Dr. Eduardo Liceaga Marcadores inmunológicos y virológicos

Más detalles

Canine Parvovirus Test Kit. SensPERT CONCEPTO SENSPERT

Canine Parvovirus Test Kit. SensPERT CONCEPTO SENSPERT SensPERT Canine Parvovirus Test Kit CONCEPTO SENSPERT La línea de diagnóstico SensPERT de Rapid Test proporciona una solución rápida, específica y fiable para los médicos veterinarios en su práctica clínica

Más detalles

RESULTADOS Y DISCUSIÓN. Estimación de la Concentración Proteica del Filtrado de Cultivo de Mycobacterium tuberculosis H37Rv

RESULTADOS Y DISCUSIÓN. Estimación de la Concentración Proteica del Filtrado de Cultivo de Mycobacterium tuberculosis H37Rv RESULTADOS Y DISCUSIÓN Estimación de la Concentración Proteica del Filtrado de Cultivo de Mycobacterium tuberculosis H37Rv La curva estándar con la que se estimó la concentración proteica del filtrado

Más detalles