Diagnóstico y Seguimiento de la. Infección por VIH. El diagnóstico como fuente de salud

Save this PDF as:

Tamaño: px
Comenzar la demostración a partir de la página:

Download "Diagnóstico y Seguimiento de la. Infección por VIH. El diagnóstico como fuente de salud"


1 Diagnóstico y Seguimiento de la Infección por VIH El diagnóstico como fuente de salud

2 Introducción Este folleto ha sido escrito con la colaboración del: Profesor F. Barin Virology Laboratory and HIV National Reference Center Tours University Hospital Center - Bretonneau Hospital - Francia. También deseamos dar las gracias por su contribución a la sección Q & A al: Profesor F. Lucht Departamento de Enfermedades Infecciosas y Tropicales Saint-Etienne University Hospital Center - Bellevue Hospital - Francia. Una enfermedad emergente identificada en 1981 en Estados Unidos, el SIDA (Síndrome de Inmunodeficiencia Adquirida) alcanzó rápidamente unas proporciones de pandemia. Al final del 2004, se estimaba que más de 25 millones de personas habían fallecido a causa del SIDA desde el comienzo de la epidemia, y que aproximadamente 40 millones de personas estaban viviendo con el virus. Después de algo más de 20 años del descubrimiento del virus, se ha conseguido un considerable progreso en el diagnóstico, seguimiento y tratamiento de la infección. Sin embargo, la epidemia continua creciendo, con 5 millones de nuevas infecciones estimadas en el año 2004, el equivalente a 10 nuevas infecciones por minuto. Existe una necesidad urgente de información, screening y prevención...y allí donde ha fracasado la educación y la prevención, una gestión del paciente. Este folleto contiene la información básica necesaria para entender la biología del Virus de la Inmunodeficiencia Humana (VIH), así como, el diagnóstico y el seguimiento inmunovirológico de la infección y del tratamiento. Su objetivo es proporcionar una guía concisa y práctica, aunque no exhaustiva a los profesionales del laboratorio y a los clínicos.

3 El virus El VIH es un virus con envuelta que mide nm de diámetro y posee un tropismo hacia los linfocitos CD4+ y los monocitos. Pertenece a la familia Retroviridae (sub-familia : Lentivirinae) y posee tres enzimas necesarias para su multiplicación: VIH observado con microscopía electrónica. Fotografía usada por cortesía de P. Roingeard inversa que tras la infección de la célula, permite transcribir el RNA viral en DNA, transcriptasa que permite al DNA integrarse en la célula huésped (el genoma viral pasa a ser entonces ADN proviral), endonucleasa Su genoma está constituido por dos hebras de RNA con aproximadamente nucleótidos. Desde el extremo 5' al 3' están localizados los tres genes que caracterizan a los retrovirus: gag-pol-env. El gen gag codifica las proteínas estructurales internas, el gen pol las tres enzimas virales, y el gen env las glicoproteínas de la envuelta. Las secuencias LTR (Long Terminal Repeat) se encuentran en cada uno de los extremos del genoma, y contienen las señales que regulan la expresión de los genes virales. El genoma también tiene seis genes adicionales denominados "accesorios": vif, nef, vpr, tat, rev y vpu (HIV-1) o vpx (HIV-2). Genoma VIH que permite al virus madurar en el ciclo de multiplicación intracelular en un estadio más tardío. proteasa, Organización estructural de VIH y los principales antígenos usados para el diagnóstico Proteína HIV-2 Gen GPSU gp120 gp125 GPTM gp41 gp36/41 CA MA p24 p17 p26 p16 p66/51 p32 p68/53 pol p34 Transcriptasa inversa Endonucleasa 2 HIV-1 env Proteínas de la envuelta Cápside y matriz proteica pol 5' LTR gag env vpr vif tat U3 R U5 Factor de infectividad gag nef 3' LTR vpu U3 R U5 rev Proteasa Transcriptasa inversa (RT/TI) Activador de transcripción Regulador de expresión génica 3

4 La diversidad de VIH La diversidad genética de VIH es muy amplia. Los sistemas actuales de clasificación distinguen dos tipos, VIH -1 y VIH - 2, que a su vez están subdivididos en grupos y/o subtipos. La pandemia es causada por el VIH -1 grupo M. La distribución global de las diferentes cepas virales refleja el desarrollo de las sub-epidemias. Esta clasificación está constantemente en evolución debido a la continua diversificación del virus, y a causa especialmente de la recombinación viral. Tipo Grupo Subtipo, advertencias VIH-1 M - Subtipo puros : A, B, C, D, F, G, H, J, K - Más de 15 CRF, los de mayor prevalencia son CRFO1-AE (Asia) y CRFO2-AG (Oeste África) O Raro, limitado al Oeste de África N Raro, limitado al oeste de África Ecuatorial (Camerún) VIH-2 Esencialmente limitado al Oeste de África Algunas cepas recombinantes de VIH se conocen como CRF (Formas Circulantes Recombinantes) debido a su importancia epidemiológica. Sin embargo, el VIH -2 asociado también con el SIDA, no se transmite fácilmente y, en general, la progresión hacia la inmunodeficiencia es mucho más lenta en individuos con una infección por VIH 2. Las cepas encontradas en Francia, por ejemplo pertenecen al subtipo B, como ocurre en la mayoría de los países industrializados. Sin embargo, se ha observado un continuo incremento en la prevalencia de las cepas no-b en los últimos años (el 30% de las cepas identificadas durante las infecciones primarias en ). El VIH -2 representa del 2 al 3% de las cepas y, el VIH - 1 grupo O representa el 0.3%. Distribución geográfica de las diferentes cepas de VIH. Europa oriental A, CRF03_AB China B, CRF07_BC, CRF08_BC América del Norte y América Central B América del Sur B, F, C Europa occidental B A, C, G, CR F02_AG África Occidental CRF02_AG, A, G, HIV-2 África Oriental A, D, C África Ecuatorial La mayoría CRFs A, C, D, G, H, J, K, O, N África del Sur C Sudeste Asiático CRF01_AE Asia del Sur C Australia B 4 5

5 Fisiopatología de la Infección El VIH-1 es responsable de una infección crónica que se desarrolla gradualmente y causa la destrucción de los linfocitos CD4+ del organismo. Si no se aplica un tratamiento anti-retroviral, la continua replicación del virus en los órganos linfoides conduce a la producción diaria de viriones en el cuerpo durante años, incluso en pacientes cuya carga viral plasmática es baja o incluso indetectable. Desarrollo en marcadores inmunovirológicos Nº de CD4+/mm C 1 C 2 C 3 B 1 B 2 B 3 A 1 A 2 A semanas años síntomas Ag p24 anti-gp120 - anti-gp41 anti-p24 síntomas semanas años Clasificación CDC (Centres for Disease Control) La infección primaria es asintomática en más del 50% de los casos. En los demás casos, los síntomas aparecen dos a tres semanas después de la infección, y los signos clínicos normalmente son similares a los de la gripe o a los correspondientes a un síndrome de mononucleosis. Los principales signos clínicos durante la infección primaria por VIH son: (ref. P. Vanhems et al., Clin Infect Dis 1997, 24 : ) Fiebre (38 C) Astenia Adenopatía Rash cutáneo y erupciones Mialgia, artralgia Cefalgia Faringitis RNA plasmático (título) Estos síntomas desaparecen rápida y espontáneamente cuando el individuo infectado entra en la fase clínica de portador asintomático. Después de un tiempo variable, pueden aparecer los diferentes síntomas, indicando un deterioro clínico: fiebre crónica, pérdida de peso, diarrea, candidiasis oral, infección por herpes zoster. Al mismo tiempo, los signos biológicos revelarán la inmunosupresión, cuyo signo principal es linfopenia CD4 (< 200/mm 3 ). El desarrollo de infecciones oportunistas (pneumocistosis, toxoplasmosis, infecciones por micobacterias, infecciones severas por citomegalovirus, etc.) y la proliferación celular (Sarcoma de Kaposi, linfoma de células B, cáncer cervical, etc.) marcan la progresión total hacia el SIDA. Si no existe un tratamiento anti-retroviral, la media del periodo de incubación para el SIDA se estima en 8 años. Los niveles de viremia en plasma son generalmente elevados (10 6 copias de genoma viral/ml) durante la infección primaria. Estos niveles decaen muy rápidamente y se estabilizan a un nivel variable después de dos a tres meses, dependiendo de la intensidad de la respuesta inmune. El nivel de carga viral es un factor predictivo de la progresión de la enfermedad, a mayor carga viral, más rápida será la progresión de la enfermedad. Valor predictivo de la carga viral RNA VIH- 1 plasmático (copias/ml) Riesgo de SIDA 5 años después de la infección primaria Umbral de detección 0,2 Fuente : Mellors JW. Science. 1996, 272 : % 49 % 26 % 8 % 1 1,5 2 Tiempo (años después de la infección primaria) 6 7

6 Epidemiología Como se transmite el VIH Transmisión sexual, A través de la sangre cuando los usuarios de drogas por vía intravenosa comparten agujas o durante accidentes que impliquen una exposición a sangre (este último riesgo se cuantifica en el 0.3% de acuerdo con A. Tarentola et coll. Am. J. Infect. Control 2003; 31:357-63). Desde la implementación de métodos de screening altamente efectivos (screening serológico y screening molecular en países industrializados), el riesgo residual de contaminación debida a transfusiones de sangre se estima en 0.3/10 6. La transmisión vertical: el VIH puede transmitirse desde la madre a su hijo (TMN) durante tres periodos : prenatal (raro), perinatal (el más frecuente), y post-natal (a través de la lactancia). Gracias a los protocolos para prevenir TMN mediante fármacos y a las recomendaciones de administrar leche artificial, la frecuencia de la transmisión viral desde las madres seropositivas a sus hijos ha disminuido, situándose aproximadamente en 1-2% (comparado con el 15-30% cuando no se tomaban medidas preventivas). Número estimado de adultos y niños viviendo con VIH/SIDA, Fuente: OMS, finales 2004 América del Norte (540,000-1,6 millones) Europa Occidental 610,000 (480, ,000) Europa del Este y Asia Central 1,4 millones (920,000-2,1 millones) Lejano Oriente 1,1 millones (560,000-1,8 millones) Caribe 440,000 (270, ,000) África del Norte y del medio este 540,000 (230,000-1,5 millones) Sur de Asia y Sudeste asiático 7,1 millones (4,4-10,6 millones) TOTAL : 39.4 ( ) millones América Latina 1,7 millones (1,3-2,2 millones) África Sub-sahariana 25,4 millones (23,4-28,4 millones) Oceania 35,000 (25,000-48,000) 8 9

7 Diagnóstico viral El diagnóstico viral de una infección por VIH es principalmente un diagnóstico inmunológico basado en la identificación de anticuerpos frente a VIH utilizando pruebas inmunoenzimáticas (ELISA) u otras técnicas inmunológicas de sensibilidad equivalente. Tales métodos de detección son efectivos porque los anticuerpos VIH son producidos continuamente, y se pueden detectar rápidamente varias semanas después de la infección (una media de 22 días), permitiendo practicar pruebas serológicas. La mayoría de las pruebas de anticuerpos detectan tanto anticuerpos HIV-1 y HIV-2. Las pruebas rápidas, de un solo uso, que requieren una interpretación subjetiva (observación visual) son ligeramente menos sensibles y específicas que los tests ELISA. Sin embargo, estos tests son fáciles de usar y no requieren un equipamiento sofisticado, características que les permiten ser usados en situaciones de emergencia y en zonas donde no es factible usar técnicas sofisticadas. 4ª generación avanzada, estas últimas además, permiten diferenciar las señales separadas de anticuerpo y antígeno con un único test. Se debe realizar una prueba de confirmación (Western Blot o immunoblot) si los resultados de screening dan una señal positiva, dicha prueba permite visualizar con precisión la presencia de proteínas específicas de VIH. Está fuertemente recomendado usar una prueba de confirmación que distinga entre HIV-1 y HIV-2, dado que la progresión de la carga viral y la elección terapéutica puede ser diferente dependiendo del virus. Resultados típicos de Western Blot (HIV blot 2.2 Genelabs) Ejemplos de pruebas de VIH Dadas las consecuencias asociadas a un diagnóstico positivo de VIH y a la existencia de posibles falsos positivos, es absolutamente necesario realizar una prueba de confirmación antes de remitir un diagnóstico positivo. Ver el algoritmo de interpretación de las pruebas ELISA de 4ª generación (antígeno + anticuerpo) y las pruebas de 10 internal control Columna 1: control positivo; columna 2: control negativo; columnas 3-4: suero anti-vih-1 positivo; columna 5: suero anti-vih-1 grupo O positivo; columna 6: suero anti-vih-2 positivo; columnas 7-10: resultados del análisis de secuenciación de un suero de un paciente recientemente infectado con VIH-1. Fuente : Esta fotografía ha sido reproducida con el permiso de Revir (documento francés de referencia). 11

8 Diagnóstico viral Durante la infección primaria, los anticuerpos no pueden detectarse porque están ausentes o están presentes en cantidades demasiado pequeñas para ser detectados. Las pruebas diagnósticas deberían por tanto incluir una detección tanto de anticuerpos como de antígeno p24 (prueba ELISA). Un resultado positivo de antígeno p24 debería ser verificado usando una prueba de neutralización. El uso de pruebas ELISA combinadas denominadas tests de 4ª generación, que detectan simultáneamente anticuerpos de VIH y antígeno p24 de VIH, permiten una detección temprana más efectiva de las infecciones que, muy frecuentemente, son asintomáticas. En la mayoría de los casos los tests de 4ª generación usados en ausencia de tratamiento, pueden reducir la ventana serológica de detección de VIH-1 en aproximadamente una semana cuando comparamos con los tests de 3ª generación (solo anticuerpos). Algoritmo de interpretación para los tests serológicos de 4ª generación (detección (orientación del origen de la positividad gracias a las señales diferenciadas de Cinética de los marcadores virales durante los estadios tempranos de la infección Niveles de marcadores Umbral de detección de marcador Contagio RNA plasmático (copias/ml) 4ª generación p24 Ag 2ª generación Síntomas clínicos 3 e génération 4ª generación avanzada Anticuerpos detectados usando ELISA 1ª generación Setpoint Tiempo (días) Ventana serológica (ELISA negativo) DNA proviral Anticuerpos detectados usando Western Blot combinada de antígeno/anticuerpos) o tests de 4ª generación avanzada anticuerpo/antígeno) Resultado negativo Resultado positivo Este algoritmo, propuesto solo como referencia, es válido para la mayoría de los casos. Deben tomarse en cuenta las recomendaciones específicas de cada país. (1) Si los síntomas clínicos o factores de riesgo están presentes, debería extraerse una nueva muestra 2 semanas después. Para dar un diagnóstico más rápido a los pacientes, puede determinare la carga vial usando una 2ª muestra extraída inmediatamente. Sin infección por VIH (1) Resultados en doble 2 resultados negativos Sin infección por VIH (1) Repetir dos veces usando el mismo reactivo con la misma muestra Resultados en doble 2 resultados positivos o 1 resultado negativo y 1 resultado positivo Es necesario realizar un análisis complementario usando la misma muestra y usando una muestra reciente para confirmar la infección por VIH. (Consultar las recomendaciones actualmente en vigor en cada país) 12 13

9 Seguimiento inmunológico Cuando comenzar el tratamiento anti-retroviral El seguimiento biológico de la infección por VIH se basa esencialmente en el recuento del número de linfocitos CD4+ y en la determinación de la carga viral (cuantificación del RNA viral plasmático). Estas pruebas se realizan cada 6 meses si el recuento de CD4 es > 500/mm 3, y cada 3 meses si el recuento de CD4 está entre 200 y 500/mm 3. Dado que los virus de la hepatitis B (HBV) y C (HCV) son factores importantes de co-morbilidad, debería realizarse también, el screening de posibles co-infecciones con uno de estos dos virus. El tratamiento debería iniciarse obligatoriamente en cualquier paciente que posea menos de 200 CD4 linfocitos/mm 3. En la mayoría de los casos, el tratamiento se inicia en pacientes con menos de 350 CD4 linfocitos/mm 3 dado que los datos actualmente disponibles sugieren que no existen ventajas aparentes en iniciar un tratamiento anti-retroviral cuando el número de linfocitos CD4 esté por encima de 350. La carga viral en plasma se mide usando pruebas cuantitativas basadas en herramientas moleculares : amplificación de genes (PCRpolymerase chain reaction, LCR-ligase chain reaction, transcripción TMA mediada por amplificación, amplificación NASBA basada en la secuencia de ácido nucleico) o hibridación, seguido a continuación de una amplificación de la señal (bdna-branched DNA). La mayoría de estas pruebas tienen una sensibilidad del orden de copias/ml. Para facilitar comparaciones, los resultados se expresan normalmente en log 10 (ejemplos: 100 copias/ml = 2 log 10, copias/ml = 4 log 10 ). Debido a las fluctuaciones biológicas y a la reproducibilidad de estas técnicas, solamente una variación 0.5 log 10 es significativa. La amplia diversidad genética del VIH muy frecuentemente origina resultados discordantes cuando se utilizan dos técnicas diferentes para la cuantificación. Consecuentemente, un paciente debería ser controlado usando, en la medida de lo posible, la misma técnica. Detección NASBA a tiempo real RNA Sentido Oligo P1 Transcriptasa inversa RNasa H Transcriptasa inversa RNA polimerasa T7 RT Oligo P2 Molecular beacons diana específicas RNasa H oligo P1 Anti-sentido RNA RT T7 RNAP Hibridación de molecular beacon 14 15

10 Terapia Anti-retroviral y resistencia Los fármacos actualmente disponibles pertenecen a 4 clases terapéuticas: inhibidores de la transcriptasa inversa nucleósido o nucleótido (RTNI), inhibidores de transcriptasa inversa no-nucleósido (nnrti), inhibidores de proteasa (PI), inhibidores de fusión (FI). Clase Nombre Marca Laboratorio RTNI Abacavir (ABC) Ziagen GSK Didanosine (ddi) Videx BMS Emtricitabine (FTC) Emtriva Gilead Lamivudine (3TC) Epivir GSK Stavudine (d4t) Zerit BMS Tenofovir (TDF) Viread Gilead Zalcitabine (ddc) Hivid Roche Zidovudine (ZDV or AZT) Retrovir GSK AZT + 3TC Combivir GSK AZT + 3TC + ABC Trizivir GSK nnrti Delavirdine (DLV) Rescriptor Agouron Efavirenz (EFV) Sustiva BMS Névirapine (NVP) Viramune Boehringer PI Amprénavir (APV) Agenerase GSK Atazanavir (ATV) Reyataz BMS Fosamprénavir (fosapv) Telzir GSK Indinavir (IDV) Crixivan MSD Nelfinavir (NFV) Viracept Roche Ritonavir (RTV) Norvir Abbott Saquinavir (SQV) Fortovase Roche Tipranavir (TPV) Tipranavir Boehringer Lopinavir (LPV) + RTV Kaletra Abbott FI Enfuvirtide (T20) Fuzeon Roche Las monoterapias y las biterapias no son lo suficientemente eficaces y por tanto, no deberían usarse. Para optimizar la respuesta inmunovirológica, especialmente durante los 6 meses iniciales del tratamiento de primera línea, debería implementarse una aproximación terapéutica potente mediante la combinación de tres fármacos (terapia triple). Las combinaciones recomendadas para el tratamiento de primera línea utilizan [2 RTNI + 1 nnrti o 1 PI]. Por razones farmacológicas, la mayoría de los PI están "fomentados" por ser administrados con Ritonavir. El HIV-1 Grupo O y el HIV-2 son normalmente resistentes a nnrtis. Uno de los objetivos del tratamiento es disminuir la carga viral plasmática para que no pueda ser detectada más. Usualmente se recomienda el seguimiento clínico y biológico regular (CD4, carga viral, seguimiento del estado de salud y metabólico) un mes después de comenzar el tratamiento y, posteriormente cada 3 o 4 meses. La carga viral llega a ser indetectable después de 3-6 meses. Un tratamiento anti-retroviral efectivo también conduce a un incremento gradual en los niveles de linfocitos CD4. En el caso que la carga viral vuelva a aparecer o se incremente por encima de las 1000 copias/ml, es aconsejable realizar un control usando una nueva muestra para confirmar la liberación viral. La liberación viral puede ser debida a un seguimiento poco estricto del régimen de tratamiento, a problemas metabólicos o a la selección de mutantes resistentes

11 Terapia anti-retroviral y resistencia Las pruebas de resistencia juegan un papel importante en la decisión terapéutica. Las pruebas de genotipado de resistencias están recomendadas en caso de fallo terapéutico y en la infección primaria. Tales pruebas detectan mutaciones conocidas por conferir resistencia a uno u otro fármaco, en los genes de la transcriptasa inversa (RTNI y nnrti), proteasa (PI), o envuelta (FI). La técnica de referencia actualmente en uso es la secuenciación nucleotídica, tras la amplificación de genes (genotipado de resistencia). En el futuro, esta indicación puede representar una aplicación importante para la tecnología DNA chip. La interpretación está basada en algoritmos actualizados regularmente por grupos de expertos, disponibles en distintos sitios de internet. El resultado obtenido entonces, sirve como una guía en las decisiones terapéuticas. Principio de genotipado de resistencia por secuenciación Extracción RNA Amplificación de genes Las pruebas de resistencia fenotípica (las cuales analizan la sensibilidad de las cepas virales in vitro cuando se ponen en presencia de cada uno de los fármacos) son largas y caras, y su superioridad no está demostrada en la predicción de la respuesta del paciente al tratamiento. Secuenciación (RT, Prot, env) Identificación de mutaciones de resistencia Algoritmo de interpretación Elección de moléculas activas 18 19

12 Preguntas y Respuestas Profesor F. Lucht Departamento de Enfermedades Infecciosas y Tropicales Saint-Etienne University Hospital Center Bellevue Hospital, France Profesor F. Barin Virology Laboratory and HIV National Reference Center Tours University Hospital Center Bretonneau Hospital, France Cual es la diferencia entre los reactivos de 3ª y 4ª generación? F. Barin : Un test de 3ª generación es una prueba ELISA, que tiene una excelente sensibilidad y que detecta solamente los anticuerpos dirigidos contra VIH. Un reactivo de 4ª generación realiza dos cosas simultáneamente: detecta los anticuerpos VIH, así como el antígeno p24 de VIH, permitiendo una detección más temprana de la infección primaria, en particular, en la infección primaria asintomática que, por definición no se sospechará clínicamente. Sin embargo, estos reactivos de 4ª generación no pueden sustituir a los reactivos de detección del antígeno p24, que son más sensibles y, consecuentemente son los únicos reactivos indicados para el screening de la infección primaria. En ciertas situaciones, puede obtenerse un resultado negativo con un test de 3ª generación y un resultado positivo con un test de 4ª generación. Si esto sucede, debería sospecharse una infección primaria y debe procederse a realizar una determinación del antígeno p24, además del Western Blot obligatorio. 20 Puede ayudar la valoración de la carga viral de VIH al diagnóstico de la infección primaria? F. Barin : Los reactivos usados para determinar la carga viral están registrados solamente para proceder al seguimiento de pacientes VIH seropositivos, y no para el diagnóstico de la infección primaria, debido a su baja especificidad. En este caso, es necesario usar reactivos que detecten la antigenemia p24. Se estima que con estos reactivos, una reacción será positiva con una carga viral de aproximadamente 10,000 copias (4 log) por ml. Debe advertirse que durante una infección primaria, la carga viral VIH frecuentemente es muy alta. También se estima que el antígeno p24 hace posible acelerar la detección, la cual puede obtenerse una semana antes cuando se compara con el screening de anticuerpos únicamente. Es absolutamente necesario realizar un diagnóstico diferencial para HIV-2? F. Lucht y F. Barin : Si, naturalmente, porque la fisiopatología de la infección no es la misma, y mucho más importante, porque se conseguirá que el seguimiento biológico y el tratamiento estén específicamente adaptados. La progresión clínica de la enfermedad es más lenta y la transmisión madre niño es menor con el VIH-2 que con el VIH-1 (la transmisión materno-fetal es < 2% en ausencia de tratamiento). Desde un punto de vista clínico, el seguimiento es más difícil porque no existen herramientas en el mercado para medir la carga viral del VIH -2. Desde un punto de vista terapéutico, los inhibidores de la transcriptasa inversa no nucleosídica no son efectivos frente al VIH

13 Como es interpretada la carga viral VIH desde una perspectiva clínica? F. Lucht : Entre los pacientes no tratados, la interpretación ha cambiado fundamentalmente. En el pasado, los parámetros clínicos CD4 y la carga viral VIH se usaban de forma equivalente a las herramientas tecnológicas, y el tratamiento se iniciaba en un paciente no tratado con una carga viral VIH elevada (> 30,000 cp/ml). Actualmente, un nivel de CD4 < 350/ml es el primer parámetro biológico tomado en cuenta, con la valoración de la carga viral como apoyo. La carga viral no se usa ya como único criterio para decidir si iniciar o no, el tratamiento, excepto cuando es superior a 100,000 copias/ml o si existen signos clínicos significativos de un mal pronóstico y una progresión de la enfermedad. Cuales son las indicaciones para el genotipado de resistencias? F. Lucht y F. Barin : El genotipado de resistencias, es decir, la búsqueda de mutaciones identificadas por estar asociadas con la resistencia frente a las moléculas activas en algunos fármacos, está indicado en dos casos : - en la infección primaria, archivando el resultado en el historial clínico del paciente para un tratamiento en fecha posterior; - en el caso de escape terapéutico, para ajustar el tratamiento. En cuanto al seguimiento de pacientes, cuáles son las principales limitaciones de la técnicas de carga viral? F. Lucht y F. Barin : Las limitaciones están relacionadas con las variaciones fisiológicas detectadas en la carga viral, por ejemplo, durante la estimulación inmune, con infecciones recurrentes como la gripe, y con la vacunación. En estas situaciones, frecuentemente aparecen aumentos significativos de forma temporal y ocasional en la carga viral plasmática VIH. Segundo, existen también variaciones técnicas: variaciones del orden de un factor 3 que pueden ser observadas para la misma muestra usando el mismo reactivo, sin que esto sea significativo. Con el mismo reactivo, se considera significativo una variación en la carga viral de mas de 0.5 log. Cuando se usan diferentes reactivos, es posible observar variaciones de mas de 1 log para la misma muestra, esto justifica monitorizar en la medida de lo posible la carga viral con el mismo reactivo. Si existe un incremento notable en la carga viral VIH entre dos muestras, no es suficiente con mirar un único valor, y es esencial confirmar este valor tomando una muestra adicional unas semanas después, antes de comenzar o de ajustar el tratamiento

14 Selección de artículos originales S Lindback, R Thorstensson, AC Karlsson, M von Sydow, L Flamholc, A Blaxhult, A Sönnerborg, G Biberfeld, H Gaines. Diagnosis of primary HIV-1 infection and duration of follow-up after HIV exposure. AIDS 2000, 14 : TD Ly, L Martin, D Daghfal, A Sandridge, D West, R Bristow, L Chalouas, X Qiu, SC Lou, JC Hunt, G Schochetman, SG Devare. Seven human immunodeficiency virus (HIV) antigen-antibody combination assays : evaluation of HIV seroconversion sensitivity and subtype detection. J. Clin. Microbiol. 2001, 39 : M Peeters, C Toure-Kane, JN Nkengasong JN. Genetic diversity of HIV in Africa: impact on diagnosis, treatment, vaccine development and trials. AIDS 2003, 17: L Perrin, L Kaiser, S Yerly. Travel and the spread of HIV-1 genetic variants. Lancet Infect. Dis. 2003, 3: ME Roland, TA Elbeik, JO Kahn, JD Bamberger, TJ Coates, MR Krone, MH Katz, MP Busch, JN Martin. HIV RNA testing in the context of nonoccupational postexposure prophylaxis. J. Infect. Dis. 2004, 190 : B Weber, A Berger, H Rabenau, HW Doerr. Evaluation of a new combined antigen and antibody human immunodeficiency virus screening assay, VIDAS HIV DUO ultra. J. Clin. Microbiol. 2002, 40 : Bibliografía AIDS in Africa. 2nd edition. M Essex, S M Boup, PJ Kanki, RG Marlink, SD Tlou. Eds., Kluwer Academic/Plenum publishers, New-York, Fields Virology, 4th edition DM Knipe, PM Howley, DE Griffin eds. Lippincott-Raven publishers, Philadelphia, Traité de Virologie Médicale. JM Huraux, JC Nicolas, H Agut, H Peigue-Lafeuille, eds. Estem, Paris, Prise en charge thérapeutique des personnes infectées par le VIH, Rapport 2004 sous la direction du Professeur JF Delfraissy, Médecine-Sciences Flammarion, Paris Páginas Web Productos biomérieux Pruebas de screening de 3ª generación Vironostika HIV Uni-form II plus O VIKIA HIV* Pruebas de screening de 4ª generación Vironostika HIV Uni-form II Ag/Ab VIDAS HIV DUO QUICK VIDIA TM HIV DUO* Pruebas de screening de 4ª generación avanzada VIDAS HIV DUO ULTRA * en desarrollo Determinación de antígeno p24 VIDAS HIV P24 VIDAS HIV P24 CONFIRMATION Vironostika HIV 1Ag Vironostika HIV 1Ag Confirmation Determinación de carga viral VIH NucliSens EasyQ HIV-1 24

15 11-05 / 008ES99090A / Documento no contractual; biomérieux se reserva el derecho de modificar las características indicadas sin preaviso/ BIOMERIEUX y su logo azul, VIDAS, VIDIA, VIKIA, Vironostika y Nuclisens son marcas depositadas ó denominaciones comerciales que pertenecen a biomérieux sa ó a una de sus filiales / biomérieux sa RCS Lyon / Foto(s) : Fotografía HIV Virus usada por cortesía de P. Roingeard ; biomérieux / biomérieux sa RCS Lyon / Impreso en Francia / TL McCANN Santé Lyon / RCS Lyon B biomérieux España s.a. Manuel Tovar, Madrid Tel. : (34) Fax : (34) biomérieux Argentina s.a. Congreso C1428BUE Buenos Aires Tel. : Fax : biomérieux Mexico S.A. de C.V. Chihuahua N 88, Col. Progreso C.P , D.F. Mexico Tel. : (52) Fax : (52) biomérieux Colombia Ltda. Avenida 15 N , Piso 2 Bogotá, D.C. Tel. : (571) Fax : (571) /

Diagnóstico microbiológico de la infección por HIV

Diagnóstico microbiológico de la infección por HIV Diagnóstico microbiológico de la infección por HIV Juan Carlos Rodríguez Díaz S. Microbiología Hospital General Universitario de Alicante E-mail: rodriguez_juadia@gva.es http://microbiología-alicante.umh.es

Más detalles

Tratamiento de la infección por el VIH

Tratamiento de la infección por el VIH Tratamiento de la infección por el VIH i ii Tratamiento de la infección por el VIH Bernardino Roca Unidad de Enfermedades Infecciosas Servicio de Medicina Interna Hospital General de Castellón Adaptado

Más detalles

Hepatitis virales. Juan Carlos Rodríguez Díaz S. Microbiología Hospital General Universitario de Elche

Hepatitis virales. Juan Carlos Rodríguez Díaz S. Microbiología Hospital General Universitario de Elche Hepatitis virales Juan Carlos Rodríguez Díaz S. Microbiología Hospital General Universitario de Elche Hepatitis Características generales Es un proceso asociado a muchas causas, tanto infecciosas como

Más detalles



Más detalles

Facultad de Ciencias Bioquímicas y Farmacéuticas Área de Integración n Disciplinar y Estudio de la Problemática Profesional TPP I Unidad 2 Aspectos biológicos del VIH Algunos datos importantes 1959 Se

Más detalles

NOCIONES DE EPIDEMIOLOGÍA Y DIAGNOSTICO DE HIV. Dra G Carballal Laboratorio de Virología Clínica CEMIC, 2009

NOCIONES DE EPIDEMIOLOGÍA Y DIAGNOSTICO DE HIV. Dra G Carballal Laboratorio de Virología Clínica CEMIC, 2009 NOCIONES DE EPIDEMIOLOGÍA Y DIAGNOSTICO DE HIV Dra G Carballal Laboratorio de Virología Clínica CEMIC, 2009 La Pandemia de SIDA Personas que viven con el HIV/SIDA Total 40 millones Adultos 38 Niños 2 Nuevas

Más detalles

8 Congreso Argentino de Salud Integral del Adolescente. Dr. Eduardo Rubinstein. Hospital Francisco J. Muñiz Adolescencia

8 Congreso Argentino de Salud Integral del Adolescente. Dr. Eduardo Rubinstein. Hospital Francisco J. Muñiz Adolescencia 8 Congreso Argentino de Salud Integral del Adolescente Dr. Eduardo Rubinstein Hospital Francisco J. Muñiz Adolescencia VIH EN ADOLESCENTES: QUE HAY DE NUEVO? En diagnóstico de infección por VIH En seguimiento

Más detalles

APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR. Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina

APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR. Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina BiologÍa Molecular: es una disciplina que se enfoca principalmente en el estudio

Más detalles

Algoritmos diagnósticos para VIH

Algoritmos diagnósticos para VIH Algoritmos diagnósticos para VIH ALGORITMOS DIAGNÓSTICOS PARA VIH Los avances tecnológicos de los distintos ensayos para el tamizaje y diagnóstico de la infección por VIH, conjuntamente con la necesidad

Más detalles

CONVENIO 036 de 2012

CONVENIO 036 de 2012 CONVENIO 036 de 2012 Guía de Práctica Clínica basada en la evidencia científica para la atención integral del VIH/Sida en niñas y niños. Guía de práctica clínica basada en la evidencia científica para

Más detalles

Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio

Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio El VIRUS PRUEBAS PRESUNTIVAS ELISA: es la prueba convencional para la detección

Más detalles

HIV. Curso de Salud Internacional. Máster en Ciencias de la Salud: Salud Pública. Curso 2007-2008

HIV. Curso de Salud Internacional. Máster en Ciencias de la Salud: Salud Pública. Curso 2007-2008 HIV Curso de Salud Internacional Máster en Ciencias de la Salud: Salud Pública Curso 2007-2008 Virus de Inmunodeficiencia Humana - HIV Infección por HIV y progresión hacia el SIDA Problema: Por qué hay

Más detalles

Información general MX HIV 0 0 0 0 0 ID CAPASITS. ID Nacional. Sexo: Masc Fem Edad al Dx de HIV / SIDA: mm/aa. Etnicidad: Mez Ext Ind Indique:

Información general MX HIV 0 0 0 0 0 ID CAPASITS. ID Nacional. Sexo: Masc Fem Edad al Dx de HIV / SIDA: mm/aa. Etnicidad: Mez Ext Ind Indique: Información general Sexo: Masc Fem Edad al Dx de HIV / SIDA: mm/aa Etnicidad: Mez Ext Ind Indique: Clase: Pediatrico Adulto Embarazada Preso Fecha de nacimiento: Estadio CDC Fecha de ingreso a MGDC Fecha

Más detalles


INSTRUCTIVO PARA GESTION DE MEDICACIÓN ESPECIAL: 20 Manual para Procedimientos, Dispositivos y Medicación SUR Form. C.1.1.1. Se informa a Ud. que, con el fin de realizar la solicitud de Efavirenz (EFV) / Nevirapina (NVP) / Abacavir (ABC) / Lamivudina

Más detalles

ACTUALIZACION EN SIDA INFANTIL. Antonio Bascuñana Quirell Hospital Virgen del Camino Octubre 2009

ACTUALIZACION EN SIDA INFANTIL. Antonio Bascuñana Quirell Hospital Virgen del Camino Octubre 2009 ACTUALIZACION EN SIDA INFANTIL Antonio Bascuñana Quirell Hospital Virgen del Camino Octubre 2009 CONTENIDO Importancia del problema En el mundo En España Transmisión materno-fetal Tratamiento/profilaxis

Más detalles



Más detalles

HIV. Curso de Salud Internacional. Máster en Ciencias de la Salud: Salud Pública. Curso 2006-2007

HIV. Curso de Salud Internacional. Máster en Ciencias de la Salud: Salud Pública. Curso 2006-2007 HIV Curso de Salud Internacional Máster en Ciencias de la Salud: Salud Pública Curso 2006-2007 Virus de Inmunodeficiencia Humana - HIV Infección por HIV y progresión hacia el SIDA Problema: Por qué hay

Más detalles

Tecnologia de Diagnostico y Tratamiento del VIH

Tecnologia de Diagnostico y Tratamiento del VIH Tecnologia de Diagnostico y Tratamiento del VIH El virus de la inmunodeficiencia humana (VIH), como dice su nombre, es un virus que ataca el sistema inmunológico y debilita los sistemas de defensa y vigilancia

Más detalles

Pruebas rápidas r. Estrategias preventivas. Propuesta de nuevas estrategias preventivas

Pruebas rápidas r. Estrategias preventivas. Propuesta de nuevas estrategias preventivas XV ENCUENTRO ESTATAL PARA ONG s Madrid, 1-3 de Octubre 2009 Diagnóstico tardío o. Pruebas rápidas r Dra Carmen Rodríguez Centro Sanitario Sandoval Madrid Estrategias preventivas La prevención de nuevas

Más detalles


5-MARCO DE REFERENCIA 5-MARCO DE REFERENCIA Para hablar de pruebas diagnosticas es necesario el conocimiento de ciertos términos que a continuación se describen. Sensibilidad: Es la probabilidad de obtener una prueba positiva

Más detalles

Codificación CIE 10 B24.X enfermedad por virus de la inmunodeficiencia humana (VIH), sin otra especificación

Codificación CIE 10 B24.X enfermedad por virus de la inmunodeficiencia humana (VIH), sin otra especificación Título: SINDROME DE INMUNODEFICIENCIA ADQUIRIDA (VIH) Codificación CIE 10 B24.X enfermedad por virus de la inmunodeficiencia humana (VIH), sin otra especificación Problema: Defecto adquirido de inmunidad

Más detalles

Herramientas de laboratorio aplicadas al diagnóstico y el monitoreo del tratamiento de la infección por VIH (Virus

Herramientas de laboratorio aplicadas al diagnóstico y el monitoreo del tratamiento de la infección por VIH (Virus Herramientas de laboratorio aplicadas al diagnóstico y el monitoreo del tratamiento de la infección por VIH (Virus Inmunodeficiencia Humana) Fabián Fay CIBIC. Rosario. Argentina Test de laboratorio para

Más detalles

Perinatal Transmisión al bebé, durante el embarazo, parto o lactancia.

Perinatal Transmisión al bebé, durante el embarazo, parto o lactancia. Dr. Horacio Salomón Investigador Principal del CONICET Director del INBIRS (Ex-CNRSIDA) UBA-CONICET Contacto sexual Relaciones sexuales sin protección por contacto directo con fluidos corporales como secreciones

Más detalles

Problemas en el Diagnostico de la Infección VIH. Diplomado de Atención Integral del VIH-SIDA. 2007

Problemas en el Diagnostico de la Infección VIH. Diplomado de Atención Integral del VIH-SIDA. 2007 Problemas en el Diagnostico de la Infección VIH Diplomado de Atención Integral del VIH-SIDA. 2007 Algunas Generalidades Sub - tipos del VIH y pruebas de laboratorio Analogía del VIH 1 y 2 es de: 40-60%

Más detalles

Resumen de la clase teórica sobre Infección persistente crónica II: HIV Dictada el día 30 de junio de 2008. Prof. Dra. Liliana Martínez Peralta

Resumen de la clase teórica sobre Infección persistente crónica II: HIV Dictada el día 30 de junio de 2008. Prof. Dra. Liliana Martínez Peralta Resumen de la clase teórica sobre Infección persistente crónica II: HIV Dictada el día 30 de junio de 2008. Prof. Dra. Liliana Martínez Peralta El HIV es un retrovirus que pertenece al género de los Lentivirus.

Más detalles

GPC. Guía de Referencia Rápida. Tratamiento Antirretroviral del Paciente Pediátrico con Infección por el VIH. Guía de Práctica Clínica

GPC. Guía de Referencia Rápida. Tratamiento Antirretroviral del Paciente Pediátrico con Infección por el VIH. Guía de Práctica Clínica Guía de Referencia Rápida Tratamiento Antirretroviral del Paciente Pediátrico con Infección por el VIH GPC Guía de Práctica Clínica Número de Registro: IMSS-196-10 Guía de Referencia Rápida CIE-10: 1-13

Más detalles


LABORATORIO N 10 DETERMINACIÓN DE VIH 1 Y 2 LABORATORIO N 10 DETERMINACIÓN DE VIH 1 Y 2 1 Prevalencias de VIH en la Región Mesoamericana País No. De personas con VIH+ Belice 3600 2.1 Costa Rica 9700 0.4 Salvador 35,000 0.8 Guatemala 59,000 0.8 Honduras

Más detalles

Rol del Laboratorio en el Diagnóstico. CMV en pacientes transplantados. Bioquímica Mariela Merkt

Rol del Laboratorio en el Diagnóstico. CMV en pacientes transplantados. Bioquímica Mariela Merkt Rol del Laboratorio en el Diagnóstico y Prevención n de la Infección n por CMV en pacientes transplantados Bioquímica Mariela Merkt CMV: Características Familia β Herpesviridae DNA doble cadena Virus envuelto

Más detalles

PRUEBA DE VIH. Universidad de Panamá USAID Proyecto Capacity Centroamérica

PRUEBA DE VIH. Universidad de Panamá USAID Proyecto Capacity Centroamérica PRUEBA DE VIH Universidad de Panamá USAID Proyecto Capacity Centroamérica Es la prueba de detección que produce los resultados rápidamente, en aproximadamente 20 minutos y utiliza sangre de una vena o

Más detalles


HEPATITIS C, EPIDEMIA SILENTE PILDORAS EPIDEMIOLOGICAS Hepatitis C en el Mundo Se estima una prevalencia de 200 millones de portadores a nivel mundial con una mortalidad anual de 350 mil personas como consecuencia del efecto crónico

Más detalles

Unidad de Enfermedades Infecciosas. Servicio de Medicina Interna. Complejo Hospitalario Universitario de Santiago de Compostela

Unidad de Enfermedades Infecciosas. Servicio de Medicina Interna. Complejo Hospitalario Universitario de Santiago de Compostela PACIENTE CON SINDROME MENINGEO Y EXANTEMA Caso presentado por: E. Losada, A. Antela, A. Prieto. Unidad de Enfermedades Infecciosas. Servicio de Medicina Interna. Complejo Hospitalario Universitario de

Más detalles

No te salgas de tu plan

No te salgas de tu plan 10 11 9 8 7 6 1 3 4 5 1 1 10 11 1 10 11 1 1 10 11 9 3 9 3 9 3 8 4 8 4 8 4 No te salgas de tu plan Cómo tomar cada para el VIH Los s para el VIH son una parte esencial de tu tratamiento contra el VIH. Pueden

Más detalles

La mayoría de exposiciones no ocasionan una infección. Después de una exposición, el riesgo de infección depende de factores como los siguientes:

La mayoría de exposiciones no ocasionan una infección. Después de una exposición, el riesgo de infección depende de factores como los siguientes: Exposición a la sangre Lo que deben saber los trabajadores de la salud Departamento de Salud y Servicios Humanos Centros para el Control y la Prevención de Enfermedades Exposiciones ocupacionales a la

Más detalles



Más detalles

Como interpretar las pruebas de serología hepatica

Como interpretar las pruebas de serología hepatica Introducción Para descartar en un paciente la presencia de infección viral se deben determinar exclusivamente el antígeno de superficie del virus de la hepatitis B (VHB) (HbsAg) y los anticuerpos frente

Más detalles

A PERSONAS VIVIENDO CON VIH/ SIDA. Marisel Colautti Área Farmacia Asistencial FBIOyF.UNR

A PERSONAS VIVIENDO CON VIH/ SIDA. Marisel Colautti Área Farmacia Asistencial FBIOyF.UNR ATENCIÓN N FARMACÉUTICA A PERSONAS VIVIENDO CON VIH/ SIDA Marisel Colautti Área Farmacia Asistencial FBIOyF.UNR Cuál l es el rol del farmacéutico? 1. Gestionar los insumos para promoción, prevención y

Más detalles

FeLV Ag / FIV Ab Test Kit

FeLV Ag / FIV Ab Test Kit SensPERT FeLV Ag / FIV Ab Test Kit CONCEPTO SENSPERT La línea de diagnóstico SensPERT de Rapid Test proporciona una solución rápida, específica y fiable para los médicos veterinarios en su práctica clínica

Más detalles

Prevención Posterior. a la Exposición. cuando usted piensa que fueron expuestas al vih dentro de los tres últimos días

Prevención Posterior. a la Exposición. cuando usted piensa que fueron expuestas al vih dentro de los tres últimos días Prevención Posterior a la Exposición No Ocupacional u cuando usted piensa que fueron expuestas al vih dentro de los tres últimos días publicado por Enero de 2011 Si está leyendo esto es porque ha estado

Más detalles

A principios de los años ochentas el desarrollo de nuevas tecnologías para la

A principios de los años ochentas el desarrollo de nuevas tecnologías para la Nuevos marcadores para la detección temprana y predicción de sobrevida en blancos terapéuticos. A principios de los años ochentas el desarrollo de nuevas tecnologías para la identificación del ADN del

Más detalles

2.1 Medicamentos Antirretrovirales

2.1 Medicamentos Antirretrovirales 2.1 Medicamentos Antirretrovirales Existen grupos de medicamentos antirretrovirales que poseen diferentes mecanismos de acción en la terapéutica de la infección por VIH: FAMILIA Inhibidores de la transcriptasa

Más detalles

Aspectos Clínicos en el Monitoreo de VIH-SIDA

Aspectos Clínicos en el Monitoreo de VIH-SIDA Aspectos Clínicos en el Monitoreo de VIH-SIDA Dra. Rosa Elena Morales Diplomado Centroamericano Monitoreo Y Evaluación para la Gestión de Políticas y Programas de VIH SIDA Febrero 2012 1 Evaluación Inicial

Más detalles



Más detalles



Más detalles

Intervenciones. Vacunas y medicamentos

Intervenciones. Vacunas y medicamentos Intervenciones Vacunas y medicamentos TERAPIA ANTIRETROVIRAL RECOMENDACIONES 2008 OBJETIVOS Y BENEFICIOS DE LA TERAPIA ARV Control de la Replicacion viral y reduccion de la carga viral. Reduccion de la

Más detalles



Más detalles

Tratamiento Antirretroviral TAR Inicio/cambio

Tratamiento Antirretroviral TAR Inicio/cambio Diagnóstico precoz y atención integral del paciente con infección por VIH: Implicación del personal sanitario hospitalario y de atención primaria Tratamiento Antirretroviral TAR Inicio/cambio Mª Jesús

Más detalles



Más detalles

Artículo de revisión: hepatitis viral B y su manejo

Artículo de revisión: hepatitis viral B y su manejo Rev. Med. FCM-UCSG, Año 2010, vol.16 Nº4. PáGS. 307-332 ISSN - 1390-0218 Artículo de revisión: hepatitis viral B y su manejo Review article: viral hepatitis B and its handling Jaramillo Tobón Antonio 1

Más detalles


PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH Blga. Gisely Hijar Guerra Coordinación del Laboratorio de Biotecnología y Biología Molecular. Responsable de los Procesos de la Prueba

Más detalles

El VIH y el embarazo. Hojas informativas

El VIH y el embarazo. Hojas informativas Hojas informativas El VIH y el embarazo La prueba de detección del VIH y el embarazo Transmisión maternoinfantil del VIH Medicamentos contra el VIH empleados durante el embarazo Inocuidad de los medicamentos

Más detalles

VIH/SIDA Signos y síntomas Transmisión Factores de riesgo

VIH/SIDA Signos y síntomas Transmisión Factores de riesgo VIH/SIDA El virus de la inmunodeficiencia humana (VIH) ataca el sistema inmunitario y debilita los sistemas de vigilancia y defensa contra las infecciones y algunos tipos de cáncer. A medida que el virus

Más detalles


INFORME VIH - SIDA COMUNITAT VALENCIANA INFORME VIH - SIDA COMUNITAT VALENCIANA VIGILANCIA EPIDEMIOLÓGICA AÑO 2014 RESPONSABLE DE LA EDICIÓN: Dirección General de Salud Pública. Avda. Cataluña, 21 46020 Valencia http://www.sp.san.gva.es/epidemiologia

Más detalles

Nuevas recomendaciones para el tratamiento de personas con infección por VIH 1

Nuevas recomendaciones para el tratamiento de personas con infección por VIH 1 Nuevas recomendaciones para el tratamiento de personas con infección por VIH 1 Palabras clave: síndrome de inmunodeficiencia adquirida, virus de la inmunodeficiencia humana, terapia ARMA, antirretrovíricos.

Más detalles

Entendiendo la resistencia a los

Entendiendo la resistencia a los Competencias Esenciales: VIH/SIDA: -los Efectos Secundarios & la Resistencia Entendiendo la resistencia a los medicamentos* sobre esta actividad Tiempo: 65 minutos Objectivos: Al finalizar esta sesión,

Más detalles


INTERACCIONES MEDICAMENTOSAS DE LOS ANTIRRETROVIRALES INTERACCIONES MEDICAMENTOSAS DE LOS ANTIRRETROVIRALES Prof.Adj. Dra. Leticia Cuñetti Dpto.Farmacología y Terapéutica Facultad de Medicina UDELAR Junio 2008 Introducción 1981 se describen primeros casos

Más detalles



Más detalles

25 años de progreso HEPATITIS C. Innovación Biofarmacéutica: Una nueva esperanza para los pacientes

25 años de progreso HEPATITIS C. Innovación Biofarmacéutica: Una nueva esperanza para los pacientes 25 años de progreso HEPATITIS C Innovación Biofarmacéutica: Una nueva esperanza para los pacientes HEPATITIS C Causa principal de cáncer y trasplante hepático en Chile La Hepatitis C es una enfermedad

Más detalles

Datos básicos sobre el tratamiento del VIH

Datos básicos sobre el tratamiento del VIH Datos básicos sobre el tratamiento del VIH A principios de los años 80, cuando comenzó la epidemia, las personas que vivían con el VIH no solían vivir más de unos años. Sin embargo, con el desarrollo de

Más detalles


DR. JORGE VARGAS GUZMAN. Asesor salud CONAVIHSIDA SIDA Y EMBARAZO DR. JORGE VARGAS GUZMAN Asesor salud CONAVIHSIDA Porqué ITS son un problema médico y de salud pública? 1. Muchas de ellas son Enfermedades Prevenibles 2. Presencia de algunas implica sexo

Más detalles

NATAP NATIONAL. VIH 102: Cuidado Y Tratamiento del VIH AIDS TREATMENT ADVOCACY PROJECT. Orígenes del VIH. Contenido

NATAP NATIONAL. VIH 102: Cuidado Y Tratamiento del VIH AIDS TREATMENT ADVOCACY PROJECT. Orígenes del VIH. Contenido National AIDS Treatment Advocacy Project VIH 102: Cuidado Y Tratamiento del VIH Escrito por Jose G. Castro, MD Escuela de Medinica "Miller" de la Universidad de Miami, FL Editor y contribuciones de Jules

Más detalles



Más detalles

GUSTAVO TORRES MORA. Trabajo de investigación para optar el título de Especialista en Medicina Interna


Más detalles



Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles



Más detalles

Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional

Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional BIOQ. LILIANA DI TULLIO BUDASSI FAC. CS.BIOQUÍMICAS Y FARMACÉUTICAS UNIVERSIDAD NACIONAL DE ROSARIO lilianadt2003@yahoo.com.ar

Más detalles

GUIAS DE ATENCION EN VIH SIDA. Madeleyne Jaramillo Zapata Enfermera, Universidad de Antioquia Mg. En Administración en salud, Universidad CES

GUIAS DE ATENCION EN VIH SIDA. Madeleyne Jaramillo Zapata Enfermera, Universidad de Antioquia Mg. En Administración en salud, Universidad CES GUIAS DE ATENCION EN VIH SIDA Madeleyne Jaramillo Zapata Enfermera, Universidad de Antioquia Mg. En Administración en salud, Universidad CES VIH en cifras En 2011, el Programa de las Naciones Unidas sobre

Más detalles

El primer caso de SARS se declaró en febrero. SARS, una neumonía atípica de etiología desconocida No se dispone de tratamiento ni de vacuna aprobada

El primer caso de SARS se declaró en febrero. SARS, una neumonía atípica de etiología desconocida No se dispone de tratamiento ni de vacuna aprobada SARS, una neumonía atípica de etiología desconocida No se dispone de tratamiento ni de vacuna aprobada El síndrome agudo respiratorio severo (SARS) es una neumonía muy grave, causada por un nuevo virus

Más detalles

El abuso de drogas y su conexión con el VIH/SIDA y otras enfermedades infecciosas

El abuso de drogas y su conexión con el VIH/SIDA y otras enfermedades infecciosas El abuso de drogas y su conexión con el VIH/SIDA y otras enfermedades infecciosas El VIH/SIDA Desde el comienzo de la pandémica del VIH/SIDA hace más de 25 años, uno de los factores centrales en su propagación

Más detalles

Agentes Antivirales Los virus

Agentes Antivirales Los virus Los virus Los virus son elementos genéticos conteniendo AD o AR que pueden encontrarse alternadamente en dos estados: extracelular y intracelular. Los virus se apropian y reacondicionan la maquinaria biosintética

Más detalles


UNIVERSIDAD PEDRO DE VALDIVIA ASIGNATURA :FARMACOLOGIA Docente : Susana Rivera Itte RETROVIRALES UNIVERSIDAD PEDRO DE VALDIVIA ASIGNATURA :FARMACOLOGIA Docente : Susana Rivera Itte RETROVIRALES INTRODUCCIÓN El virus de inmunodeficiencia humana forma parte del género Lentivirus. Estos constituyen un

Más detalles

Guía de Referencia Rápida. Prevención, Diagnóstico y Tratamiento en el binomio madre-hijo con Infección por el VIH

Guía de Referencia Rápida. Prevención, Diagnóstico y Tratamiento en el binomio madre-hijo con Infección por el VIH Guía de Referencia Rápida Prevención, Diagnóstico y Tratamiento en el binomio madre-hijo con Infección por el VIH Guía de Práctica Clínica GPC Catálogo maestro de guías de práctica clínica: IMSS-246-12

Más detalles



Más detalles

Qué necesito saber... sobre el VIH?

Qué necesito saber... sobre el VIH? QUÉ NECESITO SABER... SOBRE EL VIH? El VIH: Acción y estrategias para impedir su actuación Cuando el virus de inmunodeficiencia humana entra en el cuerpo humano no es capaz de reproducirse por sí solo

Más detalles

Terapia antirretroviral, acceso, costos, tendencias,riesgos y desafíos.

Terapia antirretroviral, acceso, costos, tendencias,riesgos y desafíos. Terapia antirretroviral, acceso, costos, tendencias,riesgos y desafíos. COSTA RICA Setiembre 2010 Dra. Zahira Tinoco M. Costa Rica ACCESO A LA TERAPIA CCSS Costa Rica MEDICAMENTOS ANTIRETROVIRALES Costa

Más detalles

Pruebas serológicas para dengue

Pruebas serológicas para dengue Pruebas serológicas para dengue El 40% de la población mundial corre riesgo de infección por dengue Durante más de 25 años, Focus Diagnostics ha sido un líder en el desarrollo de ensayos inmunológicos

Más detalles

Principios para la utilización de Fármacos en el Tratamiento de las Infecciones Víricas

Principios para la utilización de Fármacos en el Tratamiento de las Infecciones Víricas FARMACOLOGÍA CINICA Principios para la utilización de Fármacos en el Tratamiento de las Infecciones Víricas 2005-2006 Ciclo de replicación de un DNA virus Goodman-Gilman 9th edition Ciclo de replicación

Más detalles

No te salgas de tu plan

No te salgas de tu plan 10 11 9 8 7 6 1 3 5 10 11 1 10 11 10 11 9 3 9 3 9 3 8 8 8 No te salgas de tu plan Cómo tomar cada para el VIH Los s para el VIH son una parte esencial de tu tratamiento contra el VIH. Pueden reducir la

Más detalles


VIRUS DE LA INMUNODEFICIENCIA HUMANA VIRUS DE LA INMUNODEFICIENCIA HUMANA Héctor Chiparelli Elizabet Ingold Alicia del Monte INTRODUCCION El origen infeccioso del Síndrome de la Inmunodeficiencia Adquirida (SIDA) fue reconocido inmediatamente

Más detalles

Acta Médica Peruana ISSN: 1018-8800 fosores@cmp.org.pe Colegio Médico del Perú Perú

Acta Médica Peruana ISSN: 1018-8800 fosores@cmp.org.pe Colegio Médico del Perú Perú Acta Médica Peruana ISSN: 1018-8800 fosores@cmp.org.pe Colegio Médico del Perú Perú Castro Danós, José; Gutiérrez Rodríguez, Raúl; Villena Vizcarra, Juan Actualización para el médico no especialista en

Más detalles

Nuevo algoritmo diagnóstico de la Infección por VIH

Nuevo algoritmo diagnóstico de la Infección por VIH Nuevo algoritmo diagnóstico de la Infección por VIH Dra. Manuelita Zavala Pineda Médico Adscrito Servicio Infectología Hospital General de México Dr. Eduardo Liceaga Marcadores inmunológicos y virológicos

Más detalles

Nuevos enfoques diagnósticos de la infección por VIH

Nuevos enfoques diagnósticos de la infección por VIH Nuevos enfoques diagnósticos de la infección por VIH Santiago Estrada M.D Laboratorio Clínico VID Agosto 28 de 2015 Hoja informativa para los pacientes que solicitan una prueba de VIH Recomendaciones para

Más detalles

Diagnóstico Serológico de Sífilis Técnicas treponémicas

Diagnóstico Serológico de Sífilis Técnicas treponémicas Diagnóstico Serológico de Sífilis Técnicas treponémicas T.M. Rodrigo Colina Morales Laboratorio de Infecciones de Transmisión Sexual Sección Bacteriología Mayo 2014 FTA-ABS (Fluorescent Treponemal Antibody

Más detalles

Charla de Salud Sexual y VIH/SIDA. Carlos Savoie Pérez (Coordinador del Área de Salud)

Charla de Salud Sexual y VIH/SIDA. Carlos Savoie Pérez (Coordinador del Área de Salud) Charla de Salud Sexual y VIH/SIDA Carlos Savoie Pérez (Coordinador del Área de Salud) Índice Estadísticas Qué es VIH? Qué es SIDA? Mecanismo de transmisión Prácticas de riesgo Profilaxis Post Exposición

Más detalles

VIH / sida prevención y atención sanitaria P R O C E S O S Definición funcional Proceso que tras la identificación de una situación o práctica de riesgo, conduce a: La programación de medidas preventivas

Más detalles

Resultados confirmación de infección por VIH. Chile, 2009-2012.

Resultados confirmación de infección por VIH. Chile, 2009-2012. 1 Boletín Vol. 3, No. 2, Enero 2013. Resultados confirmación de infección por VIH. Chile, 2009-2012. 1. Antecedentes El virus de la inmunodeficiencia humana (VIH) pertenece a la familia de los retrovirus,

Más detalles


BOLETÍN EPIDEMIOLÓGICO DE CASTILLA-LA MANCHA OCTUBRE 2008/ Vol.20 /Nº 44 BOLETÍN EPIDEMIOLÓGICO DE CASTILLA-LA MANCHA OCTUBRE 2008/ Vol.20 /Nº 44 ESTRATEGIAS TERAPÉÚTICAS ANTIRRETROVIRALES El riesgo de transmisión del VIH a personal sanitario tras exposición accidental percutánea

Más detalles

FAMILIA RETROVIRIDAE. Prof. Adj. Dra. Dora Ruchansky Departamento de Bacteriologia y Virología Instituto de Higiene - Facultad de Medicina Abril 2010

FAMILIA RETROVIRIDAE. Prof. Adj. Dra. Dora Ruchansky Departamento de Bacteriologia y Virología Instituto de Higiene - Facultad de Medicina Abril 2010 FAMILIA RETROVIRIDAE Prof. Adj. Dra. Dora Ruchansky Departamento de Bacteriologia y Virología Instituto de Higiene - Facultad de Medicina Abril 2010 FAMILIA SUBFAMILIA GENERO EJEMPLOS Retroviridae Orthoretrovirinae

Más detalles

del VIH a los medicamentos

del VIH a los medicamentos Información, Inspiración y Defensa de la Gente con HIV/AIDS Un buen número de medicamentos se encuentran ahora disponibles Pruebas de para el tratamiento de la infección del VIH. Con más medicamentos para

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles



Más detalles

El abuso de drogas y su conexión con el VIH/SIDA y otras enfermedades infecciosas

El abuso de drogas y su conexión con el VIH/SIDA y otras enfermedades infecciosas El abuso de drogas y su conexión con el VIH/SIDA y otras enfermedades infecciosas Qué es el El virus de la inmunodeficiencia humana (VIH), que causa el síndrome de inmunodeficiencia adquirida (SIDA), es

Más detalles

Historia Natural y clasificación n de la infección n por el VIH

Historia Natural y clasificación n de la infección n por el VIH Historia Natural y clasificación n de la infección n por el VIH Epidemiología del VIH/SIDA Total39.4 millones (35.9-45.3) ONUSIDA/OMS, Diciembre del 2004 Historia del VIH-SIDA 1981 UCLA reporta 5 casos

Más detalles

Programas de Educación Sanitaria VIH/SIDA JOSE Mª SOBRÓN GUTIÉRREZ

Programas de Educación Sanitaria VIH/SIDA JOSE Mª SOBRÓN GUTIÉRREZ SOCIEDAD ESPAÑOLA DE SANIDAD PENITENCIARIA Programas de Educación Sanitaria I VIH/SIDA JOSE Mª SOBRÓN GUTIÉRREZ A MODO DE PRESENTACIÓN. No es un tratado sobre VIH/SIDA lo que tienes en tus manos. Es simplemente

Más detalles

Estrategia utilizada

Estrategia utilizada Estrategia utilizada 1) Extracción HIV RNA V3 7114 7218 2) One Step RT-PCR (x triplicado) 3) 2 nd PCR (A1 A2 A3) A1 A2 A3 4) Secuencuiación A1 A2 A3 TGTACAAGACCCAACAACAATACAAGAAAAAGTATACATGTAGGACG AGGGAGATCAATTTATGCAACAGAAAAAATAATAGGAGATACAAAAC

Más detalles

Erika Rosina Recinos de Ramírez

Erika Rosina Recinos de Ramírez Universidad de San Carlos de Guatemala Universidad de Granada, España Facultad de Ciencias Químicas y Farmacia Maestría en Atención Farmacéutica ADHERENCIA AL TRATAMIENTO DE LOS PACIENTES QUE ACUDEN A

Más detalles



Más detalles

Infección por el virus de la inmunodeficiencia humana

Infección por el virus de la inmunodeficiencia humana Infección por el virus de la inmunodeficiencia humana La infección causada por el virus de la inmunodeficiencia humana (VIH) es una enfermedad provocada por uno o dos virus que progresivamente destruyen

Más detalles

Alteraciones del sistema inmune. Unidad 4 / Inmunología una Mirada Preventiva

Alteraciones del sistema inmune. Unidad 4 / Inmunología una Mirada Preventiva Alteraciones del sistema inmune Unidad 4 / Inmunología una Mirada Preventiva Índice Introducción Lección 1. Alergias y Síndrome de Inmunodeficiencia adquirida a) Alergias. Qué es la alergia? Síntomas de

Más detalles

INTRODUCIÓN. Los datos de la distribución geográfica quedarían distribuidos según el siguiente esquema

INTRODUCIÓN. Los datos de la distribución geográfica quedarían distribuidos según el siguiente esquema INTRODUCIÓN Hagamos un repaso de los datos recogidos en la bibliografía. Infección por VHC: Infección crónica por VHC afecta al 3% de la población mundial Incidencia de infección aguda: 1/100.000 habitantes

Más detalles