ES A1 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA. 11 Número de publicación: Número de solicitud:

Tamaño: px
Comenzar la demostración a partir de la página:

Download "ES 2 217 931 A1 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA. 11 Número de publicación: 2 217 931. 21 Número de solicitud: 200201609"


1 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: Número de solicitud: Int. Cl. 7 : G01N 33/68 12 SOLICITUD DE PATENTE A1 22 Fecha de presentación: Solicitante/s: Universidad de Barcelona Centro de Patentes. Baldiri Reixac, Barcelona, ES 43 Fecha de publicación de la solicitud: Inventor/es: López Tejero, María Dolores y Través Polo, María Carmen 43 Fecha de publicación del folleto de la solicitud: Agente: Segura Cámara, Pascual 54 Título: Método de diagnóstico de la evolución de la masa intestinal absortiva en un individuo. 57 Resumen: Método de diagnóstico de la evolución de la masa intestinal absortiva en un individuo Conlleva el someter muestras de suero y/o plasma provenientes de la sangre del paciente a un inmunoensayo para determinar la cantidad de apolipoproteína humana apoa- IV, usando un anticuerpo específico obtenido a partir de apoa-iv intestinal, humana y purificada, de apoa-iv humana recombinante, o de un fragmento activo de apoa- IV humana. Se pueden usar ensayos de inmunodifusión por electroforesis, ELISA o Western blot. Comparado con los métodos clínicos habituales (endoscopia y biopsia en ayuno), es ventajoso porque no es invasivo para el paciente y porque puede ser fácilmente industrializado. Es útil para la diagnosis de desórdenes funcionales del intestino causados por un nivel anormal de masa intestinal funcionalmente efectiva, tales como la malabsorción, la enfermedad celíaca, la atrofia vellositaria, el síndrome del intestino corto, la diarrea crónica y la flatulencia. ES A1 Venta de fascículos: Oficina Española de Patentes y Marcas. C/Panamá, Madrid

2 DESCRIPCIÓN Método de diagnóstico de la evolución de la masa intestinal absortiva en un individuo Esta invención trata sobre nuevos métodos de diagnóstico y kits en el área de la gastroenterología clínica, los cuales se basan en la determinación de una proteína natural de origen intestinal en el plasma y/o suero obtenido de un paciente. Estado de la técnica anterior Ciertas alteraciones funcionales del intestino que están causadas total o parcialmente por la ausencia (debido p.ej. a una pérdida o a falta de madurez) de masa absortiva intestinal funcionalmente efectiva son la malabsorción, la enfermedad celíaca, la atrofia vellositaria, el síndrome del intestino corto, la diarrea crónica y la flatulencia, siendo la malabsorción una de las más frecuentes. La malabsorción (o sea, el empeoramiento de la absorción intestinal de nutrientes, principalmente azúcares y lípidos) es una patología intestinal que está asociada a determinadas condiciones fisiológicas como la malnutrición, la aerofagia, las alteraciones gastrointestinales y el malestar general. Una de las principales causas de la malabsorción es la atrofia intestinal o disminución de la superficie de la mucosa intestinal (es decir, la disminución de la masa total absortiva de las vellosidades intestinales). En relación con la terapia de las diferentes alteraciones funcionales del intestino, es interesante diagnosticar el estatus de la masa total absortiva funcionalmente efectiva de un individuo dado, tanto en diferentes etapas de su desarrollo individual (o sea, a diferentes edades), como a lo largo del tratamiento terapéutico del daño intestinal. Sin embargo, en la actualidad la mayoría de los métodos de diagnóstico usados con dicha finalidad son agresivos y están basados o en la endoscopia o en el análisis de muestras de biopsia yeyuna. La mayoría de clínicos diagnostican los síndromes de malabsorción mediante endoscopia y biopsia intestinal, pero dichas prácticas presentan ciertos inconvenientes y limitaciones. Así, en algunas ocasiones la biopsia intestinal no es representativa del estado de todo el intestino y se pueden observar áreas con mucosa mosaico, alternando áreas de vellosidades atrofiadas y normales (cf. S.C. Tawil et al., Scalloping of the valvulae conniventes and mosaic mucosa in tropical sprue; Gastrointest. Endosc. 1991, vol. 37, pp ). Además, la orientación de la biopsia puede ocasionalmente enmascarar el diagnóstico, no pudiendo ser detectada una atrofia intestinal parcial (cf. M. Cassaro et al., The dark sida of the gastric biopsy, Hum. Pathol. 1999, vol. 30, pp ). Alrededor de la mitad de los casos de enfermedad celíaca (intolerancia al gluten de la dieta) no pueden ser diagnosticados como tales ya que no presentan los síntomas característicos de malabsorción; y lo mismo ocurre con el esprúe tropical (estomatitis tropical). Estudios de cromoendoscopia, que permiten la magnificación de la mucosa intestinal durante la endoscopia, revelan que un número importante de atrofias parciales no se habrían detectado mediante la endoscopia clásica (cf. L.M. Siegel et al., Evaluation of latino expatriates for evident of tropical sprue (abstract) ; Gastroenterology 1995, vol. 108, p. A324). Por lo tanto, sería útil encontrar marcadores en suero y/o plasma que indiquen el estatus clínico de la mucosa intestinal, particularmente la atrofia intestinal, y obviar así el uso general de métodos invasivos como la biopsia yeyuna y la endoscopia. En la clínica, con la finalidad de diagnosticar la malabsorción intestinal, se han sugerido algunos métodos de determinación en el suero y/o plasma que difieren da la biopsia y la endoscopia clásicas. De acuerdo con uno de ellos, en pacientes con pancreatitis crónica la malabsorción lipídica se diagnostica por un test indirecto que mide la apolipoproteina B-48 (apob-48) en plasma después de una ingesta rica en lípidos (cf. B. Saviana et al., Diagnosis of lipid malabsorption in patients with chronic pancreatitis: a new indirect test using postprandial plasma apolipoprotein B-48, Am. J. Gastroenterol. 1999, vol. 94, pp ). La apob-48 se sintetiza en el intestino junto con los quilomicrones (lipoproteínas); además la obtención de anticuerpos a partir de esta lipoproteína es dificultosa dada la similitud molecular con otra apolipoproteína hepática, la apob-100. Este método requiere el aislamiento previo de las lipoproteínas, lo que es una fuente de limitaciones en el ámbito clínico (gran volumen de muestra sanguínea, equipos técnicos especiales y caros, pérdida de dicha apolipoproteína durante el aislamiento de los quilomicrones, etc.). Otro método está basado en la medida de la citrulina circulante mediante HPLC (cromatografía líquida de alta eficacia) como marcador de la malabsorción en los casos de síndrome de intestino corto (cf. P. Crenn et al., Postabsorptive plasma citrulline concentration is a marker of absorptive enterocyte mass and intestinal failure in humans; Gastroenterology 2000, vol. 119, pp ). Una gran limitación de este método es que se puede usar sólo en adultos, pues el inicio de la síntesis de citrulina en el enterocito tiene lugar después del destete del mamífero (cf. G. Wu et al., Synthesis of citrulline from glutamine in pig enterocytes; Biochemical J. 1994, vol. 299, pp ). También se ha propuesto, para estudiar la malabsorción en adultos y niños, la medida en orina y suero por HPLC de azúcares (Iactulosa, manitol, lactosa, D-xilosa...) después de una sobrecarga oral de los mismos (cf. S. Travis et al.; Intestinal permeability: functional assessment and significante ; Clin. Sci. 1992, vol. 82, pp J.A. Kynaston et al., Simultaneous quantification of mannitol, 3-0-methyl glucose, and lactulose in urine by HPLC with pulsed electrochemical detection, for use in studies of intestinal permeability ; Clin. Chem. 1993, vol. 39, pp ). Pero resulta frecuentemente molesto para el paciente, y depende además de otros factores tales como el vaciado gástrico y la velocidad de recolección de la orina. En pacientes pediátricos, otros métodos más indirectos, que también resultan molestos y además dan falsos positivos, son por ejemplo los test del aliento que implican la medición del hidrógeno expirado producido por la fermentación bacteriana de los azúcares no absorbidos, o la medición del 14 CO 2 radiactivo expirado producido por el metabolismo de la 14 C-trioleína ingerida, que está relacionado con la malabsorción de lípidos 2

3 (cf. F. Fernández-Bañares et al., Procedimientos diagnósticos en gastroenterología y hepatología, in P. Humbert & M.A. Gassull (eds.), Capítulo 8, pp ; Mosby-Dioma Libros S.A.; Madrid 1995). 5 Así pues, resulta de interés clínico encontrar nuevos métodos de diagnóstico que, en un determinado paciente, indiquen el estatus de toda la masa intestinal absortiva funcionalmente activa, particularmente en relación con determinadas disfunciones intestinales. Explicación de la invención Según un aspecto de la presente invención, se proporciona un método de diagnóstico de una disfunción intestinal en un paciente causada por un nivel anormal de masa total absortiva funcionalmente efectiva que comprende someter una muestra de suero y/o plasma de la sangre del paciente a un inmunoensayo para evaluar la cantidad de apolipoproteína apoa-iv humana. El inmunoensayo implica un anticuerpo específico contra la apoa-iv humana obtenido a partir de dicha proteína intestinal ya purificada, o a partir de apoa-iv humana recombinante, o a partir de un fragmento activo de la apoa-iv humana. La apoliproteína A-IV (apoa-iv) es una proteína de aproximadamente 45 KDa sintetizada por los enterocitos (las células más abundantes del epitelio intestinal), que se libera a la linfa unida a quilomicrones (lipoproteínas sintetizadas después de una ingesta rica en lípidos), y que desde allí se libera a la sangre, donde se presenta principalmente en forma libre. La apoa-iv se expresa en los humanos desde la semana 20 de la gestación, lo que significa que puede ser cuantificada en el nacimiento y durante edades prenatales. En la actualidad se conocen cuatro isoformas (variantes genéticamente determinadas) de la apoa-iv humana. Dependiendo de la población examinada, la frecuencia alélica de la isoforma primaria es alrededor del 94%; la abundancia de la segunda isoforma es del 6% aproximadamente. Las otras dos isoformas identificadas tienen frecuencias muy bajas. Por ápoa-iv se entiende aquí cualquiera de las isoformas o sus mezclas. El método de la presente invención usa ensayos conocidos para la detección y cuantificación de la apoa-iv humana en el suero y/o en el plasma. Los ensayos de inmunodifusión mediante electroforesis, tal y como se describen en EP B1 para otras apolipoproteínas, también pueden usarse en el método de la presente invención. No obstante, se prefieren las técnicas de ELISA (ensayos inmunosorbentes unidos a enzimas, en inglés enzyme-linked immunosorbent assays ) y los ensayos Western blot. La masa absortiva intestinal funcionalmente efectiva en el paciente se refiere a la parte de su mucosa intestinal que está formada principalmente por enterocitos (células absorbentes). Un nivel anormal de masa intestinal absortiva, funcionalmente efectiva, puede ser el resultado de una pérdida de enterocitos (p.ej. por la ingesta de etanol), o puede ser causada por la falta de madurez de dichas células (p.ej. en neonatos prematuros). Por anticuerpo específico contra apoa-iv humana se entiende cualquier anticuerpo monoclonal o policlonal que interactúe únicamente con la apoa-iv intestinal humana. Este anticuerpo puede obtenerse por cualquiera de los métodos estándar, conocidos por los expertos en la materia, usando como inmunógeno o bien la apoa-iv humana purificada (en cualquiera de sus isoformas o mezclas de las mismas), o bien una apoa-iv humana recombinante, o bien un fragmento activo de la apoa-iv humana. En una realización preferida, el inmunoensayo usado en el método de la presente invención es del tipo ELISA sandwich. En una realización más preferida, el inmunoensayo ELISA sandwich implica el pretratamiento de la muestra con un tampón específico (tampón clarificante, en inglés clearing buffer ) que contiene una colesterol-esterasa pancreática para disminuir la interferencia de los lípidos circulantes de la muestra, en la cuantificación de la apoa-iv. En otra realización preferida, el inmunoensayo es un Western blot (especialmente preferido con un control interno). Y en otra realización preferida, el inmunoensayo es de inmunodifusión. Entre los desórdenes de la función intestinal causados por un nivel anormal masa intestinal absortiva funcionalmente efectiva que pueden ser diagnosticados por el método de la presente invención, están la malabsorción, la enfermedad celíaca (o sea, la intolerancia al gluten de la dieta), la atrofia intestinal vellositaria, el síndrome del intestino corto, la diarrea crónica y la flatulencia. Entre las diferentes causas de dichos desórdenes intestinales están: la predisposición genética, la malnutrición, el ayuno, la nutrición parenteral, la cirugía intestinal, la quimioterapia, la prematuridad al nacer, la infección bacteriana intestinal, etc. Según otro aspecto de la presente invención, se proporciona un kit in vitro para el diagnóstico de un desorden de la función intestinal causado por un nivel anormal de masa intestinal absortiva funcionalmente efectiva (incluyendo cualquiera de las condiciones mencionadas anteriormente) en un paciente dado. El kit tiene un anticuerpo específico contra la apoa-iv humana, obtenido a partir de una apoa-iv humana intestinal purificada, a partir de una apoa- IV humana recombinante, o a partir de un fragmento activo de la apoa-iv humana, junto con otros materiales y/o componentes para evaluar por inmunoensayo la cantidad de apoa-iv humana. En realizaciones preferidas, el kit tiene materiales y/o componentes para un inmunoensayo de tipo ELISA, o para un ensayo Western blot, o para un ensayo de inmunodifusión. Para un experto en la materia será fácil seleccionar los materiles y/o los componentes para preparar los kits in vitro apropiados para el inmunoensayo seleccionado: p. ej., una microplaca con pocillos para el ELISA, o un film cubierto con gel para el Wester blot o para el ensayo de inmudifusión. 3

4 La determinación de la cantidad de apolipoproteína A-IV humana puede ser más o menos cuantitativa dependiendo del tipo de inmunoensayo empleado y de la disponibilidad de la proteína pura apoa-iv humana como estándar, tal y como se ilustra en los ejemplos adjuntos Es de destacar que algunos factores tales como la dieta grasa, la malabsorción lipídica por causas pancreáticas, la inflamación aguda y la disfunción hormonal pueden alterar las concentraciones plasmáticas de apoa-iv en los humanos. Así, hay unas pocas patologías asociadas con el metabolismo lipídico en las que esas concentraciones plasmáticas están alteradas. En pacientes con esas patologías, el experto en la materia debe usar el método de la presente invención con cierta precaución, tomando la muestra de sangre después de un ayuno de la noche anterior, como mínimo. Aunque los niveles absolutos de apoa-iv en pacientes con esas patologías pueden diferir significativamente respecto a los valores medios de la población control, la evolución de los niveles de apoa-iv para un mismo paciente seguirá siendo significativa. Entre esas patologías se encuentran las siguientes: la enfermedad coronaria, la obesidad, la diabetes mellitus, la insuficiencia renal, la pancreatitis crónica y la malnutrición severa. Hasta ahora la apoa-iv humana ha recibido muy poca atención en el ámbito de la diagnosis y la terapia clínica, siendo una excepción la 5 sugerencia de administrar apoa-iv humana a pacientes, mediante una formulación inyectable, con el propósito de controlar el apetito y de reducir la ingesta y el peso corporal (cf. WO 94/27629 Al ). En comparación con los métodos clínicos habitualmente empleados en la técnica (endoscopia y biopsia yeyuna), la invención es ventajosa en el sentido de que proporciona un método de diagnóstico que no es invasivo para el paciente y que puede ser fácilmente industrializado con muestras de plasma y/o suero separadas del paciente. En comparación con la posible determinación de otras proteínas intestinales, otra ventaja de esta invención deriva del hecho de que la apoa-iv puede ser determinada a cualquier edad del individuo, incluyendo edades prenatales. El hecho de que la vida media de la apoa-iv humana sea baja y su concentración en plasma se correlacione significativamente con su velocidad de liberación desde el enterocito, y no con su velocidad de degradación, hace que la determinación de la apoa-iv humana sea muy indicativa del estatus funcional y morfológico de la mucosa. Una ventaja adicional, en comparación con la determinación de otras lipoproteínas, deriva del hecho de que la apoa-iv humana se libera a la sangre principalmente en forma libre (o sea, no asociada a proteínas), lo que tiene como resultado que el método de la presente invención sufre menos de interferencias de los lípidos circulantes. A lo largo de la descripción y de las reivindicaciones, la palabra comprende y sus variaciones no pretenden excluir otros aditivos, componentes, elementos o fases. La descripción en el resumen se incorpora aquí como referencia. La siguiente descripción detallada y los dibujos se presentan a título de ilustración, y no se pretende que limiten a la presente invención. Breve descripción de los dibujos 40 La Fig. 1 ilustra la detección de la apoa-iv humana en plasma y en biopsia intestinal mediante el ensayo Western blot. La Fig. 2 muestra una inmunolocalización histológica de la apoa-iv en una biopsia intestinal humana de duodenoyeyuno proximal. 45 La Fig. 3 incluye dos gráficas de un ELISA sandwich para detectar apoa-iv humana en plasma. La Fig. 4 corresponde a dos ensayos de Western blot de apoa-iv purificada y plasma humano, a lo largo del desarrollo pre y postnatal La Fig. 5 muestra los niveles de apoa-iv mediante el ensayo de ELISA sandwich, en el suero de cordón umbilical de humanos recién nacidos, procedentes de madres alcohólicas y de controles, según la distribución del peso corporal. La Fig. 6 corresponde a un ensayo Western blot para detectar la apoa-iv del suero del cordón umbilical de humanos recién nacidos, procedentes de madres alcohólicas y de madres control. La Fig. 7 muestra la detección y la cuantificación por Western blot de apoa-iv en plasma, en niños celíacos en diferentes fases de su enfermedad. La Fig. 8 muestra la detección y la cuantificación por Western blot de apoa-iv en plasma, en pacientes con nutrición parenteral después de una cirugía abdominal. La Fig. 9 muestra la detección y la cuantificación por Western blot de apoa-iv en plasma, en pacientes bajo alimentación parenteral y sucesiva alimentación enteral después de cirugía gástrica. 65 Descripción detallada de realizaciones particulares El método de la presente invención se ilustra a continuación mediante el empleo de ensayos tipo ELISA sandwich y Western blot, en dos patologías pediátricas representativas de desórdenes intestinales (los efectos del alcohol en el 4

5 5 10 feto y la enfermedad celíaca) y en dos modelos de atrofia intestinal en adultos (alimentación parenteral y alimentación parenteral). En un modelo en rata, los inventores han mostrado previamente que el consumo de etanol durante la gestación por parte de la madre causa alteraciones intestinales en el feto y el recién nacido (cf. L. Camps et al., Effects of prenatal exposure to ethanol on intestinal development of rat fetuses; Journal Pediatric Gastroenterol. Nutr. 1997, vol. 24, pp , y sus referencias), y también se han publicado algunos casos clínicos en humanos (cf. S. Tourtet et al., Small intestine atresia and abnormal insertion of the umbilicus in a child with fetal alcohol syndrome; Archives de Pediatrie 1997, vol. 4, pp , y sus referencias). La enfermedad celíaca (intolerancia al gluten de la dieta) es una patología bien establecida de atrofia severa o moderada de la vellosidad intestinal, donde el diagnóstico definitivo se hace hasta ahora mediante biopsia intestinal. Se sabe bien que cualquier alimentación parenteral y un estado ayunado en general desarrollan la alteración de la mucosa, con cierta atrofia de la vellosidad intestinal. Grupos de población de los cuatro modelos Niños recién nacidos de madres que habían consumido alcohol durante la gestación fueron distinguidos de niños recién nacidos procedentes de madres control: Una mujer era catalogada como alcohólica si había tomado alcohol durante la gestación y antes del parto, y tenía la alcoholuria positiva (etanol en orina) en el momento del alumbramiento. Los niños diagnosticados como celíacos tenían en el suero los anticuerpos antiendomisio y tomaban una dieta que incluía el gluten. Los niños celíacos a los que se les realizó una biopsia yeyuna (casi el 80%) tenían atrofia intestinal en todos los casos. La edad del estudio fue entre 1-6 años. La nutrición parenteral fue realizada en pacientes adultos y ancianos (entre años de edad) sometidos a cirugía abdominal (resección del colon). Todos los pacientes fueron seleccionados en base a los siguientes criterios: que no presentaran enfermedades renales o hepáticas, ni carcinomastosis peritoneal o metástasis conocida, ni malnutrición, ni pérdida de peso, ni enfermedad metabólica o endocrina. Después de la intervención los pacientes recibieron soporte nutricional con alimentación parenteral, sin ningún tipo de ingesta oral hasta el día siete. Otros grupos de pacientes (sometidos a resección gástrica) y seleccionados con el mismo criterio estuvieron bajo nutrición parenteral (tres o cinco días después de la operación) y sucesivamente bajo nutrición enteral (con dieta líquida y blanda durante cuatro días después). Muestras clínicas Los plasmas y/o los sueros de los pacientes fueron tomados después del ayuno de la noche anterior, excepto para los neonatos. En el nacimiento las muestras de suero fueron recolectadas desde el cordón umbilical, en los Departamentos de Obstetricia y Ginecología correspondientes. Los plasmas fueron obtenidos con EDTA disódico y centrifugados y congelados a -30 C. Un pequeño fragmento de biopsia intestinal era colocada a 4 C en PBS (tampón fosfato salino, ph 7.5), y procesada lo más rápidamente posible para los estudios de Western blot y/o de inmunolocalización histológica. Las biopsias para los análisis de Western fueron procesados previamente a 4 C y a una dilución de 1/25 con PBS con Tritonx100 al 1% (v/v). Los estudios clínicos fueron realizados con consentimiento de los Comités Éticos de los diferentes Hospitales implicados: Hospital Clínic de Barcelona, Hospital Sant Joan de Déu en Barcelona, y Hospital Vall d Hebron en Barcelona. Western blot para la detección de apoa-iv en plasma, suero y biopsia intestinal Los ensayos de Western blot para la detección de apoa-iv se realizaron a partir de las proteínas separadas en SDS- PAGE (dodecilsulfato sódico-electroforesis en gradiente de poliacrilamida) al 10% y transferidas sobre membranas de Inmovilon-P Millipore. Alícuotas de suero y/o plasma diluídos (1/100) fueron cargadas con tampón de muestra, resultando por pocillo 0.2 µl de suero y/o plasma. Se utilizó como anticuerpo primario IgG contra apoa-iv humana (desarrollado en el laboratorio de los inventores) y obtenido en conejo a la dilución 1/500; y como anticuerpo secundario un anti IgG de conejo comercial obtenido en cerdo (marcado con peroxidasa de rábano, HRP) a la dilución 1/15,000 (Dako, Glostrup, Dinamarca). Otras diluciones especiales de los anticuerpos están descritas en las correspondientes figuras. El bloqueo de las uniones inespecíficas se realizó con BSA (albúmina sérica bovina) al 2%, w/v. Para el revelado del Western blot se utilizó el sistema comercial ECL (luminol de quimioluminiscencia aumentada, en inglés enhanced chemiluminiscence luminol ) (Amersham Pharmacia Biotech, Little Chalfont Buckinghamshire, Inglaterra) or el sustrato quimioluminiscente con detección por HRP SuperSignal West Pico (Pierce, Rockford, Illinois, USA). ELISA sandwich para la cuantificación de apoa-iv en suero y/o plasma 65 La concentración plasmática de apoa-iv se determinó mediante un ELISA sandwich puesto a punto en el laboratorio de los inventores. En una placa de poliestireno de 96 pocillos se inmunoabsorbían 500 ng por pocillo del anticuerpo captador (IgG contra apoa-iv humana, desarrollado en el laboratorio de los inventores) obtenido en conejo, y diluído 5

6 en 100 µl de tampón carbonato-bicarbonato (Na 2 CO g/l, NaHCO g/l, ph 9.6). Después de incubar la placa toda la noche a 4 C en una cámara húmeda, se lavaba cinco veces con PBS-T (phosphate buffer salina ph:7.4 con Tween %, v/v) a temperatura ambiente. Para bloquear la unión inespecífica, cada pocillo se incubaba con 360 µl de la solución de bloqueo que contenía albúmina sérica bovina (PBS y bovina serum albumine 0.5%, w/v) durante 1 hora a 37 C en una cámara húmeda con agitación. Posteriormente, se realizaban cinco lavados con PBS-T, y se incubaban 100 µl de las muestras, la estándar y el control interno (para los controles inter- e intra-ensayo, ver párrafos inferiores) ya diluídos en PBS-T-BSA (PBS con BSA al 0.5% y Tween-20 al 0.05%) durante 1 hora a 37 C en una cámara húmeda. Posteriormente, se realizaron cinco lavados con PSB-T. Seguidamente se incubaba la placa durante 2 horas a temperatura ambiente en la cámara húmeda con el anticuerpo detector, es decir las mismas IgG contra apoa-iv humana obtenidas en conejo, pero unidas a biotina (0.5 mg/ml, 12,4 mol biotina/mol IgG), y diluídas 1/500 en 100 µl PBS-T-BSA. Una vez completada la incubación, se realizaron 5 lavados con PSB-T. Seguidamente se incubaba la placa durante 20 minutos a temperatura ambiente en la cámara húmeda con una solución de avidina unida a peroxidasa 0.2 mg/i y diluída en PBS-T-BSA (100 µl por pocillo). Se realizaron cinco lavados con la solución de PBS-T. Seguidamente se pipeteaban 100 µl por pocillo de la solución OPD (O-fenilendiamina 0.4 g/l, ácido cítrico 7.3 g/l, Na 2 HPO g/l, y H 2 O µl/ml) preparada en el momento de su utilización. El revelado o aparición del color del producto se realizaba a temperatura ambiente. Transcurrido un tiempo máximo de 20 minutos se paraba la reacción añadiendo 50 µl por pocillo de HCI 2.5 M. La placa se agitaba unos segundos en un agitador orbital y se leía a 492 nm con el lector de ELISA Titertek Multiskan. Pretratamiento de los plasmas o sueros En los experimentos preliminares de la puesta apunto del ELISA no se obtuvieron resultados totalmente satisfactorios: el volumen de las muestras no presentaba linealidad; y la repetitividad inter- e intraensayo no era aceptable. Fue necesario realizar un pretratamiento de las muestras con colesterol esterasa pancreática para obtener resultados más satisfactorios, evitando la posible interferencia de los lípidos plasmáticos en la cuantificación de la apoa-iv. Las muestras de plasma y el control interno (para los controles inter- e intraensayo) se diluyeron 1/10 en PBS, seguidamente se incubaron a 37 C con un tampón aclarador usado para nefelometría que contenía: ácido aspártico 87.2 g/l, colato sódico 17.5 g/l, Tween %, colesterol-esterasa 0.4 g/l, y Tris 0.1 M, ph 7.7 en la proporción (1:1) (v:v). La reacción se paraba a los diez minutos con hielo, posteriormente se añadía PBS-T-BSA, hasta completar, la dilución final de la muestra (1/150 y 1/300). El tampón aclarador se procesaba sin suero y/o plasma como blanco. La estándar se realizaba a partir de una solución de apoa-iv purificada previamente en el laboratorio de los inventores. La concentración de proteínas se determinó mediante el kit comercial BCA Protein assay reagent (Pierce, Rockford, Illinois) utilizando BSA como estándar. La estándar de apoa-iv se diluía en PST-T-BSA y se utilizó un intervalo de concentraciones de 1 a 2,000 ng por pocillo. Se verificó que no había interferencia del tampón aclarador en la estándar, y por tanto ya no se utilizó con dicho tampón. El ajuste de la curva patrón se realizó mediante análisis de regresión polinómica. Se ensayaron dos diluciones de cada muestra (1/150 y 1/300), y la concentración de apoa-iv se calcularon realizando la media de las dos diluciones. Las diluciones de la muestra y de las diferentes concentraciones de la estándar se ensayaron por duplicado. El control interno fue el de un plasma de adulto ayunado toda la noche, con una concentración de apoa-iv de mg/100 ml, y fue ensayado por cuadruplicado. El control intra- e inter-ensayo fue respectivamente 4.2% y 9.1%. Detección de apoa-iv humana en plasma v biopsia intestinal mediante ensayo Western blot La especificidad de los anticuerpos (IgG de conejo) obtenidos por los inventores, para detectar la apolipoproteína A-IV en plasma y biopsia intestinal humanos, se ilustra en los resultados de las Figs. 1, 2 y 3. La Fig. 1 ilustra los resultados obtenidos por electroforesis SDS-PAGE y Western blot. En la Fig. A fueron cargadas en los pocillos 30 µg de proteína de plasma (de origen humano y de rata). Uno de los pocillos se cargó con 20 ng de apoa-iv humana purificada. El anticuerpo primario fue diluído 1/200, y el anticuerpo secundario (contra IgG de conejo unido a HRP, peroxidasa de rábano) a 1/2000. La detección se realizó con DAB (diaminobenzidina). Se demostraba que el anticuerpo primario no marcaba la apoa-iv procedente de la rata. En la Fig. B fueron cargadas 22 ng de apoa-iv humana purificada y 5 µg de proteína de plasma humano. Cantidades diferentes de proteínas de biopsia intestinal (18 µg and 9 µg) fueron cargadas en diferentes pocillos. Los anticuerpos primario y secundario fueron procesados idénticamente a los resultados de la Fig. A. La detección se realizó con ECL. Con el ECL se mostró una mayor marca que con la detección por DAB. Los símbolos de la Fig. 1A son los siguientes. Pr: plasma de rata. Ph: plasma humano. La ApoA-IV es una proteína purificada en el laboratorio de los inventores. Los símbolos de la Fig. 1B son los siguientes: lh significa biopsia intestinal humana (procedente de duodeno-yeyuno proximal). Inmunolocalización de la apolipoproteína A-IV en una biopsia intestinal humana del duodeno-yeyuno proximal La Fig. 2 muestra la inmunolocalización de la apoa-iv en intestino humano mediante microscopía cofocal (Laica TCS 4D, Serveis Científico-Técnics, Parc Científic de Barcelona, UB). El anticuerpo primario (IgG de conejo) fue diluído a 1/40 en PBS-FCS (suero fetal de ternero al 10%, v/v); como anticuerpo secundario se usó anti IgG de conejo obtenido de cabra y unido a rojo de Texas que fue diluído a 1/200 en PBS-FCS. Las imágenes mostraban que la proteína estaba localizada a lo largo del epitelio de la mucosa intestinal (ver a 50 y 25 µm), y específicamente en los enterocitos, no mostrando ninguna marca en otros tipos celulares. La apoa-iv estaba localiza principalmente 6

7 en el área supranuclear del enterocito (ver a 10 y 5 µm). Se demostró la localización celular y la especificidad del anticuerpo de los inventores (IgG de conejo) para detectar la apoa-iv humana, la cual estaba sintetizada básicamente por el enterocito. Estos datos se complementan con los resultados previos obtenidos con el ensayo Western blot en la Fig. 1 B. ELISA sandwich para detectar la apolipoproteína A-IV en plasma humano La Fig. 3 muestra diferentes resultados del método de ELISA sandwich. La Fig. 3A ilustra la especificidad del anticuerpo de los inventores para detectar concentraciones crecientes de apoa-iv humana. La apoa-i comercial (también sintetizada por la mucosa intestinal) y la albúmina humana no fueron detectadas usando el mismo ELISA sandwich. En la Fig. 3B volúmenes crecientes de la muestra (ensayo de dilución) se correlacionaban con cantidades variadas de apoa-iv de diferentes plasmas humanos: niveles bajos para neonatos, altos para un niño de 5-6 años, y niveles adultos para un adulto de 20 años de edad. El valor obtenido de recuperación de la apoa-iv purificada en diferentes muestras fue entre 90.5 y 106.2%. En la Fig. 3A los símbolos son los siguientes: cuadrados para la apoa-iv humana, triángulos para la apoa-i humana y círculos para la albúmina humana. En la Fig. 3B los símbolos son los siguientes: triángulos para el plasma de un niño de 5-6 años, círculos para el plasma de un adulto de 20 años y rombos para un plasma de un recién nacido a término. Ensayo de Western blot para apoa-iv purificada y para detectar apoa-iv en plasma humano a lo largo del desarrollo pre- y postnatal La Fig. 4 muestra diferentes marcas de plama humano con diferentes cantidades de apoa-iv de acuerdo con la etapa de desarrollo (desde nacimiento hasta la edad adulta). El ensayo Western blot puede ser usado como método alternativo a la cuantificación por ELISA. El límite de detección del Western blot en las condiciones experimentales que se detallan es alrededor de 5-2 ng de proteína y 0.2 µl de muestra de suero y/o plasma. El índice de correlación de 59 muestras medidas paralelamente mediante ambos análisis fue de Aunque el ensayo Western blot es una técnica semicuantitativa comparada con el ELISA, su principal ventaja es falta de la interferencia de los lípidos plasmáticos. Los símbolos de la Fig 4 A son los siguientes. N: suero de cordón umbilical de neonatos (de 30 y 31 semanas de gestación); A: plasma de un adulto (de 20 años). La Fig. 4B se refiere a plasmas de diferentes momentos de la gestación en humanos (25 semanas, 36 semanas y 38 semanas); niños lactantes de diferentes periodos de lactancia (2 y 8 meses de edad) y niños de diferentes edades (1.5 y 10 años) Niveles de apoa-iv en suero de cordón umbilical de neonatos humanos de madres alcohólicas y controles en relación con la distribución de su peso corporal La Tabla 1 presenta el peso corporal y los niveles de apoa-iv, de triacilglicéridos y de colesterol, en el suero del cordón umbilical de neonatos de 36 a 42 semanas de gestación. La apoa-iv de dichas muestras fue cuantificada mediante ELISA sandwich (Fig. 3). Para la determinación de triacilglicéridos y colesterol en suero se utilizaron kits comerciales (Medical Analysis Systems and Boehringer Mannheim GmbH respectivamente). El etanol in utero redujo significativamente en el nacimiento la apoa-iv en suero de cordón umbilical, independientemente del peso corporal de neonato. Este resultado podría estar relacionado con las alteraciones morfológicas y funcionales encontradas por los inventores en el intestino de fetos experimentales (de rata) afectados por la ingesta de alcohol por parte de la madre, probablemente relacionadas con la presencia de etanol en el líquido amniótico y en el lumen intestinal del feto durante la gestación. Los datos vienen expresados como la media ± SEM de n individuos. Se aplicó el test de Mann-Whitney U. Neonatos C = neonatos de madres control. Neonatos A = neonatos de madre alcóholica. NS = no significativo. TABLA 1 Peso corporal, apoa-iv, triacilglicéridos y colesterol en suero de cordón umbilical de neonatos de 36 a 42 semanas de gestación. Neonatos C Neonatos A p-values n = 139 n = 78 Peso corporal (g) 3140 ± ± 32 NS ApoA-IV (mg/100ml) 1.66 ± ± 0.11 < triacilglicéridos (mg/100ml) ± ± 2.17 NS Colesterol (mm) 1.75 ± ± 0.05 NS La Fig. 5 presenta los datos de apoa-iv en suero (Tabla 1) en relación a la distribución de pesos de los neonatos. Los neonatos de las madres alcohólicas siempre tienen menos apoa-iv en comparación con los neonatos control (especialmente en neonatos que pesan entre 2.5 y 3.5 Kg). Los datos se expresan como la media ± SEM de n individuos. Barras oscuras = neonatos de madres control. Barras claras = neonatos de madres alcohólicas. 7

8 Ensayo de Western blot para detectar apoa-iv en suero de cordón umbilical de neonatos humanos de madres alcohólicas y madres control La Fig. 6 muestra un Western blot de apoa-iv analizado en suero de algunos recién nacidos de madres control y alcohólicas con diferentes edades gestacionales. Se observa que la intensidad de la marca es menos detectable en el suero de la descendencia del grupo alcohólico comparada con la de los sueros de los neonatos controles de la misma edad gestacional. Estos resultados se complementan con los datos de la Tabla 1 y de la Fig. 5. Suero de cordón en neonatos de 35, 36, 40 y 41 semanas de gestación. C = neonatos de madres control. A = neonatos de madres alcohólicas. Niveles de apoa-iv en plasma de niños celíacos La Tabla 2 muestra la concentración plasmática de apoa-iv, trialcilglicéridos y colesterol en niños celíacos activos (con ingesta de gluten) de edades entre 1-6 años, y controles de la misma edad. La apoa-iv de dichas muestras fueron cuantificadas mediante ELISA sandwich (Fig. 3). Para determinar los triacilglicéridos y el colesterol en plasma se usaron kits comerciales (Medical Analysis Systems and Boehringer Mannheim GmbH respectively). Los valores de triacilglicéridos fueron significativamente más altos en los niños celíacos que en los controles. Los valores de colesterol fueron significativamente más bajos en niños celíacos que en los controles. Los valores de apoa-iv en niños celíacos estaban por debajo de los controles, aunque no se encontraron diferencias significativas entre grupos. Los datos se expresan como la media ± SEM de n individuos. Se aplicó el test Mann-Whitney U. NS = no significativo. TABLA 2 ApoA-IV, triacilglicéridos y colesterol en plasma de niños celíacos activos (entre 1-6 años) y controles de la misma edad Celíacos Controles p-values n = 40 n = 173 ApoA-IV (mg/100ml) 7.87 ± ± 0.70 NS Triacilglicéridos (mg/100ml) ± ± 2.54 < 0.01 Colesterol (mm) 3.23 ± ± 0.26 < 0.01 Ensayo Western blot para detectar apoa-iv en plasma de niños celíacos en diferentes momentos de su enfermedad El ensayo de Western blot de la apoa-iv plasmática en niños celíacos en diferentes momentos de su enfermedad se presenta en la Fig. 7. En la Fig. 7A se cargaron muestras de plasma de un niño celíaco y otro control, y 80 ng de apoa- IV purificada. El niño celíaco en fase activa de su enfermedad [con marcadores positivos en suero (+): anticuerpos IgA-AGA y IgA-AEA] tenía una marca de apoa-iv menos intensa comparada con la del mismo niño alimentado con una dieta sin gluten ( ), y significativamente más baja que las marcas de los controles de su misma edad (Fig. 7B) (unidades arbitrarias de seis individuos). Los símbolos de la Fig. 7 son los siguientes: C = niño control; Ce = niño celíaco; [ + o = niños celíacos en fase activa con marcadores positivos en suero (anticuerpos IgA-AGA y IgA- AEA ); [ ] = los mismos niños celíacos pero alimentados con una dieta sin gluten (celíacos tratados). En la Fig. 7B las unidades arbitrarias se expresan como la media ± SEM para n = 6 individuos (C and Ce). Se aplicó el test de Mann- Whitney U (p < 0.01 * *, y p < 0.1 * son significativamente diferentes frente a C). Los bajos niveles de apoa-iv en plasma encontrados mediante Western blot en niños celíacos revela una alteración del metabolismo de dicha proteína, probablemente relacionada con la atrofia de la mucosa intestinal y la malnutrición en esos niños. Los niños celíacos de edades comprendidas entre 1 y 6 años presentan alterado el metabolismo lipídico caracterizado por una bajada de la concentración plasmática de colesterol y apoa-iv y un aumento de los triacilglicéridos en plasma. Estas alteraciones pueden estar directamente relacionadas con la malabsorción y la malnutrición asociadas a la enfermedad celíaca. Ensayo de Western blot para detectar apoa-iv en plasma de pacientes quirúrqicos baio nutrición parenteral El Western blot de apoa-iv plasmática en pacientes (diferente sexo y edad) nutridos parenteralmente después de cirugía abdominal (resección del colon) se presenta en la Fig. 8. Las muestras de plasma en cada paciente fueron cargadas según la Fig. 8A. Los días de estudio fueron: tres días antes de la cirugía (ayuno de noche anterior); durante la intervención (con h de ayuno); y 2, 4 y 7 días después de la cirugía (recibiendo un aporte nutricional por vía parenteral). La Fig. 8B muestra las unidades arbitrarias cuantificadas como porcentaje respecto a la marca obtenida de un control interno (plasma de un adulto sano ayunado de la noche anterior) que se cargaba en el mismo gel. Estos resultados mostraban claramente los sucesivos y profundos cambios significativos en la marca de la apoa-iv plasmática a lo largo de los días de alimentación parenteral a la que estaban sometidos los individuos. Los símbolos de la Fig. 8A son los siguientes: -3 = tres días antes de la cirugía; 0 = el mismo momento de la intervención; + 2, + 4, + 7 = 2, 4 y 7 días después de la cirugía. En la Fig. 8B las unidades arbitrarias fueron cuantificadas como el porcentaje respecto a la marca obtenida de un control interno. Los datos se expresaron como la media ± SEM de n = 8

9 21 individuos. Se aplicó el test de Wilcoxon (p < * * * significa que hay diferencias significativas respecto los valores del preoperatorio del mismo paciente, -3) Ensayo Western blot para detectar apoa-iv en plasma de pacientes quirúrgicos balo sucesiva alimentación parenteral-enteral Los resultados de la alimentación parenteral-enteral en pacientes después de cirugía abdominal (resección gástrica) se corresponden con los datos de la Fig. 9. En la Fig. 9A se presentan los resultados del ensayo Western blot de apoa-iv plasmática en sucesiva alimentación parenteral-enteral de uno de dichos pacientes. Se utilizaron los mismos criterios clínicos de selección que para los pacientes del estudio de la Fig. 8. Los días de estudio fueron: justo antes de la intervención quirúrgica (mínimo 18 horas de ayuno); justo antes del inicio de la dieta oral (con tres días como mínimo bajo alimentación parenteral); y después de cuatro días recibiendo nutrición enteral (con exclusión de dieta grasa). En la Fig. 9B se muestran la unidades arbitrarias cuantificadas como porcentaje respecto a la marca obtenida de un control interno (plasma de un adulto sano ayunado de la noche anterior) que se cargaba en el mismo gel. Estos resultados mostraban claramente en este grupo de individuos que hay un incremento de la marca cuando la dieta cambia de parenteral a enteral en el mismo paciente. Los símbolos de la Fig. 9A son los siguientes: 0 = justo antes de la intervención quirúrgica; = justo antes del inicio de la dieta oral y con 3-4 días bajo alimentación parenteral; y 4 = cuatro días recibiendo sólo nutrición enteral. En Fig. 9B las unidades arbitrarias fueron cuantificadas como el porcentaje respecto a la marca obtenida de un control interno. Los datos se expresan como media ± SEM de n = 6 individuos

10 REIVINDICACIONES Método de diagnóstico de un desorden de la función intestinal causado por un nivel anormal de masa absortiva funcionalmente efectiva en un paciente dado, que comprende someter muestras de suero y/o plasma de la sangre del paciente a un inmunoensayo para determinar la cantidad de apolipoproteína humana apoa-iv, donde dicho inmunoensayo conlleva un anticuerpo específico contra la apoa-iv humana obtenido a partir de una proteína seleccionada entre el grupo que consiste en apoa-iv humana intestinal purificada, una apoa-iv humana recombinante, y un fragmento activo de proteína apoa-iv humana. 2. Método según la reivindicación 1, donde el inmunoensayo es del tipo ELISA sandwich. 3. Método según la reivindicación 2, donde el inmunoensayo ELISA sandwich conlleva el pretratamiento de la muestra con un tampón clarificante que contiene colesterol-esterasa pancreática. 4. Método según la reivindicación 1, donde el inmunoensayo es un ensayo Western blot. 5. Método según la reivindicación 1, donde el inmunoensayo es un ensayo de inmunodifusión Método según cualquiera de las reivindicaciones 1-5, donde el desorden de la función intestinal se selecciona entre el grupo que consiste en la malabsorción, la enfermedad celíaca, la atrofia vellositaria, el síndrome del intestino corto, la diarrea crónica y la flatulencia. 7. Método según la reivindicación 6, donde el desorden intestinal es la malabsorción. 8. Método según la reivindicación 6, donde el desorden intestinal es la enfermedad celíaca. 9. Método según la reivindicación 6, donde el desorden intestinal es la atrofia vellositaria Método según la reivindicación 6, donde el desorden intestinal es el síndrome del intestino corto. 11. Método según la reivindicación 6, donde el desorden intestinal es la diarrea crónica. 12. Método según la reivindicación 6, donde el desorden intestinal es la flatulencia. 13. Kit in vitro para el diagnóstico de un desorden de la función intestinal causado por un nivel anormal de masa absortiva funcionalmente efectiva en un paciente dado, que comprende: (i) un anticuerpo específico contra la apoa- IV humana obtenido a partir de una proteína seleccionada entre el grupo que consiste en apoa-iv humana intestinal purificada, una apoa-iv humana recombinante, y un fragmento activo de proteína apoa-iv humana; y (ii) otros materiales y/o componentes para determinar la cantidad de apolipoproteína apoa-iv humana mediante inmunoensayo. 14. Kit según la reivindicación 13, donde el inmunoensayo es del tipo ELISA sandwich. 15. Kit según la reivindicación 13, donde el inmunoensayo es un ensayo Western blot. 16. Kit según la reivindicación 13, donde el inmunoensayo es un ensayo de inmunodifusión. 17. Kit según la reivindicación 13, donde el desorden de la función intestinal se selecciona entre el grupo que consiste en la malabsorción, la enfermedad celíaca, la atrofia vellositaria, el síndrome del intestino corto, la diarrea crónica y la flatulencia

11 11

12 12 ES A1

13 13

14 14 ES A1

15 15

16 16 ES A1

17 17

18 18 ES A1

19 19

20 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 ES Nº de solicitud: Fecha de presentación de la solicitud: Fecha de prioridad: INFORME SOBRE EL ESTADO DE LA TÉCNICA 51 Int. Cl. 7 : G01N 33/68 DOCUMENTOS RELEVANTES Categoría Documentos citados Reivindicaciones afectadas A A P ES A1 (CONSEJO SUPERIOR DE INVESTIGACIONES CIENTÍFICAS) WO A1 (THE PROVOST, FELLOWS AND SCHOLARS OF THE COLLEGE OF THE HOLY AND UNDIVIDED TRINITY OF QUEEN ELIZABETH DUBLIN) WO A1 (CONSEJO SUPERIOR DE INVESTIGACIONES CIENTÍFICAS) P WO A2 (THE NOTTHINGHAM TRENT UNIVERSITY) A IVAN STANKOVIC et al. Determination of antisecalin Antibodies in sera from Coeliac Patients by Elisa-bored assay. JOURNAL OF PHARMACEUTICAL AND BIOMEDICAL ANALYSIS. 18 (1998), páginas Categoría de los documentos citados X: de particular relevancia Y: de particular relevancia combinado con otro/s de la misma categoría A: refleja el estado de la técnica El presente informe ha sido realizado para todas las reivindicaciones O: referido a divulgación no escrita P: publicado entre la fecha de prioridad y la de presentación de la solicitud E: documento anterior, pero publicado después de la fecha de presentación de la solicitud para las reivindicaciones nº: Fecha de realización del informe Examinador Página M. Ybarra Fernández 1/1

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a Introducción Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a los investigadores verificar la expresión de una proteína, determinar la cantidad relativa

Más detalles

Valoración Nutricional

Valoración Nutricional Valoración Nutricional Peso: el peso reciente es un marcador sensitivo del estado nutricional del paciente. La pérdida de peso de 5% en 1 mes o 10% en 6 meses previo a la hospitalización ha demostrado

Más detalles

Departamento de Bioquímica y Biología Molecular,

Departamento de Bioquímica y Biología Molecular, 18. Inmunoanálisis Aurora Galván Cejudo 1, Isaac Túnez Fiñana 2 Departamento de Bioquímica y Biología Molecular, 1 Campus Universitario de Rabanales, Edificio Severo Ochoa, 14071-Córdoba, 2 Facultad de

Más detalles


EMBARAZO Y NEONATOLOGÍA EMBARAZO Y NEONATOLOGÍA 1. Introducción 2. Diagnóstico del embarazo 3. Parámetros bioquímicos alterados durante el embarazo 4. Estudio del líquido amniótico para la detección y prevención de alteraciones

Más detalles

Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio

Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio El VIRUS PRUEBAS PRESUNTIVAS ELISA: es la prueba convencional para la detección

Más detalles

La lactosa es el principal azúcar de la leche y únicamente

La lactosa es el principal azúcar de la leche y únicamente C a p í t u l o 1 6 Intolerancia a la lactosa Mercedes Ruiz Moreno La lactosa es el principal azúcar de la leche y únicamente se produce, de forma natural, en la glándula mamaria. Es un disacárido que,

Más detalles

RESULTADOS Y DISCUSIÓN. Estimación de la Concentración Proteica del Filtrado de Cultivo de Mycobacterium tuberculosis H37Rv

RESULTADOS Y DISCUSIÓN. Estimación de la Concentración Proteica del Filtrado de Cultivo de Mycobacterium tuberculosis H37Rv RESULTADOS Y DISCUSIÓN Estimación de la Concentración Proteica del Filtrado de Cultivo de Mycobacterium tuberculosis H37Rv La curva estándar con la que se estimó la concentración proteica del filtrado

Más detalles

Azúcares de la dieta

Azúcares de la dieta Azúcares de la dieta Ingresan como poli, mono o disacáridos (el principal polisacárido de la dieta humana es el almidón) Enzimas salivares y pancreáticos y de la leche materna (amilasas) HIDRÓLISIS Disacáridos

Más detalles

El tipo de alteración observada también proporciona gran información:

El tipo de alteración observada también proporciona gran información: TEMA 5: ENZIMOLOGÍA CLÍNICA 1. Valor diagnóstico de las enzimas en el plasma. 2. Principios del análisis de enzimas 3. Análisis de isoenzimas. 4. Determinación enzimática de sustratos. 1. Valor diagnóstico

Más detalles

Detección de IgE específica.

Detección de IgE específica. Detección de IgE específica. Una forma de identificar los alérgenos responsables de los síntomas alérgicos es la detección de anticuerpos IgE específicos frente a dichos alérgenos. Estos anticuerpos están

Más detalles

Mercodia Ultrasensitive C-peptide ELISA

Mercodia Ultrasensitive C-peptide ELISA Mercodia Ultrasensitive C-peptide ELISA Instrucciones para el uso 10-1141-01 REACTIVOS PARA 96 DETERMINACIONES Para uso diagnóstico in vitro ATENCIÓN! Protocolo de actualización Fabricado por Mercodia

Más detalles



Más detalles


PET-RPLA KIT para DETECCIÓN de TOXINAS. Código: TD0930 PET-RPLA KIT para DETECCIÓN de TOXINAS Código: TD0930 Kit para detección de enterotoxina tipo A de Clostridium perfringens en muestras fecales o en filtrados de cultivos por aglutinación pasiva de látex

Más detalles


5-MARCO DE REFERENCIA 5-MARCO DE REFERENCIA Para hablar de pruebas diagnosticas es necesario el conocimiento de ciertos términos que a continuación se describen. Sensibilidad: Es la probabilidad de obtener una prueba positiva

Más detalles

Diagnóstico Serológico de Sífilis Técnicas treponémicas

Diagnóstico Serológico de Sífilis Técnicas treponémicas Diagnóstico Serológico de Sífilis Técnicas treponémicas T.M. Rodrigo Colina Morales Laboratorio de Infecciones de Transmisión Sexual Sección Bacteriología Mayo 2014 FTA-ABS (Fluorescent Treponemal Antibody

Más detalles

Int. Cl. 7 : G01N 33/04

Int. Cl. 7 : G01N 33/04 k 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 k Número de publicación: 2 144 36 21 k Número de solicitud: 009800009 1 k Int. Cl. 7 : G01N 33/04 A23C 11/10 k 12 SOLICITUD DE PATENTE A1 22 kfecha

Más detalles

ELISA. Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes

ELISA. Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes ELISA Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes ELISA Enzyme Linked Immuno Sorbent Assay Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes

Más detalles

ES 2 239 545 A1 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA. 11 Número de publicación: 2 239 545. 21 Número de solicitud: 200400636

ES 2 239 545 A1 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA. 11 Número de publicación: 2 239 545. 21 Número de solicitud: 200400636 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 239 4 21 Número de solicitud: 00636 1 Int. Cl. 7 : G01N 33/02 12 SOLICITUD DE PATENTE A1 22 Fecha de presentación: 1.03.04 43

Más detalles


CAP ITULO XII HERENCIA CAP ITULO XII HERENCIA Algunas enfermedades son genéticas en origen y por lo tanto son transmitidas en familias. La mayoría de las enfermedades de inmunodeficiencia son heredades en alguno de los dos diferentes

Más detalles

Int. Cl. 7 : C08B 37/10

Int. Cl. 7 : C08B 37/10 k 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 k Número de publicación: 2 161 61 21 k Número de solicitud: 009901671 1 k Int. Cl. 7 : C08B 37/ A61K 31/727 A61P 7/02 k 12 SOLICITUD DE PATENTE A1 22

Más detalles

Técnicas. Transferencia de las proteínas a la membrana. Bloqueo de los sitios de unión inespecíficos.

Técnicas. Transferencia de las proteínas a la membrana. Bloqueo de los sitios de unión inespecíficos. Técnicas Transferencia de las proteínas a la membrana. Bloqueo de los sitios de unión inespecíficos. Lavado de la membrana. Anticuerpos primarios y secundarios. Marcaje de anticuerpos. Sustratos cromogénicos.

Más detalles

ELISA. Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes

ELISA. Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes ELISA Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes ELISA Enzyme Linked Immuno Sorbent Assay Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes

Más detalles



Más detalles

prueba diagnóstica no invasiva de la deficiencia de este enzima.

prueba diagnóstica no invasiva de la deficiencia de este enzima. 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 208 099 21 Número de solicitud: 200202372 1 Int. Cl. 7 : C12Q 1/34 12 SOLICITUD DE PATENTE A1 22 Fecha de presentación: 16..2002

Más detalles


LA INTOLERANCIA A LA GLUCOSA 1 LA INTOLERANCIA A LA GLUCOSA Luego de ingerir alimentos, muchos de ellos son degradados a azúcares en el intestino (el azúcar más importante es la glucosa); esa glucosa es absorbida desde el intestino

Más detalles


INTERFERÓN BETA-1A BIOFARMACO, SOLUCIÓN CONCENTRADA MONOGRAFÍA NUEVA Con fundamento en el numeral 4.11.1 de la Norma Oficial Mexicana NOM-001-SSA1-2010, se publica el presente proyecto a efecto de que los interesados, a partir del 1º de agosto y hasta el

Más detalles

TRATAMIENTO DE LA OBESIDAD EN ADOLESCENTES. Dra. M. del Pilar Medina D. Endocrinóloga Pediatra

TRATAMIENTO DE LA OBESIDAD EN ADOLESCENTES. Dra. M. del Pilar Medina D. Endocrinóloga Pediatra TRATAMIENTO DE LA OBESIDAD EN ADOLESCENTES Dra. M. del Pilar Medina D. Endocrinóloga Pediatra INTRODUCCION El Pediatra tiene una situación privilegiada en la salud del adolescente con respecto a otras

Más detalles

Prof. Laura Carmona Salazar Semestre: 13-II

Prof. Laura Carmona Salazar Semestre: 13-II FACULTAD DE QUÍMICA DEPARTAMENTO DE BIOQUÍMICA CURSO DE BIOQUÍMICA CLÍNICA (CLAVE 1807) Licenciatura de QFB Prof. Laura Carmona Salazar Semestre: 13-II Este material es exclusivamente para uso educativo

Más detalles

ELISA PeliClass human IgG subclass kit REF M1551

ELISA PeliClass human IgG subclass kit REF M1551 Sanquin Reagents Plesmanlaan 5 0 CX Amsterdam The Netherlands Phone: +.0.5.599 Fax: +.0.5.570 Email: Website: M55/ November 007 ELISA PeliClass human IgG subclass

Más detalles

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Para la purificación de ADN genómico de todos los kits de colección Oragene y ORAcollect. Visite nuestro sitio

Más detalles

DIABETES MELLITUS. Dra. Luz Don Centro de Nutrición


Más detalles


TRABAJO PRACTICO Nº 3 ENZIMOINMUNOANALISIS ELISA TRABAJO PRACTICO Nº 3 ENZIMOINMUNOANALISIS ELISA Docentes encargados: Bioq. Natalia Guiñazú Bioq. Maria Sol Renna Biol. Virginia Andreani Bioq. Mauricio Figueredo Bioq. Vanina Garrido Bioq. Laura Dulgerian

Más detalles

DEPARTAMENTO DE MEDICINA INTERNA HOSPITAL DE EXPLORACIÓN COLEGIO UNIVERSITARIO YONSEI DE MEDICINA 1- Test: Efectos de bloqueo por el filtro nasal Nosk, en la penetración de alérgenos. 2- Resumen: Certificamos

Más detalles

4.2 Posología y forma de administración

4.2 Posología y forma de administración 1. DENOMINACIÓN DEL MEDICAMENTO duphalac solución oral botellas duphalac solución oral sobres 2. COMPOSICIÓN CUANTITATIVA Y CUALITATIVA duphalac solución oral contiene: botellas: cada 100 ml de solución

Más detalles



Más detalles

Diabetes Gestacional: Riesgo silencioso. Dra. y M.C María Elena Reyes Gutiérrez Catedrática del IPN y de la UNAM

Diabetes Gestacional: Riesgo silencioso. Dra. y M.C María Elena Reyes Gutiérrez Catedrática del IPN y de la UNAM Diabetes Gestacional: Riesgo silencioso Dra. y M.C María Elena Reyes Gutiérrez Catedrática del IPN y de la UNAM Hay tres grandes tipos de diabetes DIABETES TIPO I Generalmente se diagnostica en la infancia

Más detalles

TP1: Diluciones. Objetivos. Introducción. Introducción a la Biología Celular y Molecular

TP1: Diluciones. Objetivos. Introducción. Introducción a la Biología Celular y Molecular TP1: Diluciones Objetivos Familiarizarse con las unidades mas utilizadas en biología molecular y ser capaces de intercambiar ágilmente las distintas unidades. Familiarizarse con el material de uso corriente

Más detalles


PRUEBA DE TOLERANCIA ORAL A LA GLUCOSA PRÁCTICA No. 7 PRUEBA DE TOLERANCIA ORAL A LA GLUCOSA PRESENTACIÓN La presente guía constituye la séptima actividad práctica (Unidad IX Fisiología del Sistema Endocrino Reproductor) de la asignatura Fisiología

Más detalles


PRINCIPALES PARÁMETROS FARMACOCINÉTICOS 11 11 El programa de farmacología clínica que ha permitido la evaluación de las propiedades farmacocinéticas y farmacodinámicas de Victoza ha incluido 26 estudios (19 en individuos sanos y 7 en pacientes

Más detalles


ENFERMEDAD ARTERIAL DE LOS MIEMBROS INFERIORES ENFERMEDAD ARTERIAL DE LOS MIEMBROS INFERIORES Este manual contiene información dirigida al médico, enfermera y paciente, acerca de la enfermedad arterial de los miembros inferiores, su manejo y el tratamiento

Más detalles

Int. Cl. 7 : A61M 5/155. 22 kfecha de presentación: 15.09.1998 71 k Solicitante/s: Alberto Fernández-Arias Montoya C/ La Paz, 20 50008 Zaragoza, ES

Int. Cl. 7 : A61M 5/155. 22 kfecha de presentación: 15.09.1998 71 k Solicitante/s: Alberto Fernández-Arias Montoya C/ La Paz, 20 50008 Zaragoza, ES k 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 k Número de publicación: 2 144 971 21 k Número de solicitud: 00980193 1 k Int. Cl. 7 : A61M /1 A61D 19/02 k 12 SOLICITUD DE PATENTE A1 22 kfecha de

Más detalles


DÉFICIT SELECTIVO DE IgA INFORMACIÓN PARA PACIENTES Y FAMILIARES DÉFICIT SELECTIVO DE IgA INFORMACIÓN PARA PACIENTES Y FAMILIARES DEFINICIÓN El déficit selectivo de IgA se define como la ausencia total de Inmunoglobulina de tipo IgA en sangre. Existen cinco tipos (clases)

Más detalles

La insulina es una hormona peptídica secretada por el páncreas en respuesta al aumento de azúcar en la sangre, por lo general después de una comida.

La insulina es una hormona peptídica secretada por el páncreas en respuesta al aumento de azúcar en la sangre, por lo general después de una comida. Qué es la insulina? La insulina es una hormona peptídica secretada por el páncreas en respuesta al aumento de azúcar en la sangre, por lo general después de una comida. Sin embargo, no tienes que comer

Más detalles



Más detalles

Gluten - Tratamiento - Guías.


Más detalles

Investigador principal : Dr. Fernando Fernández Bañares Hospital Mútua de Terrassa Duración: 3 años MEMORIA FINAL. 1. Resumen


Más detalles

ES 2 179 789 A1 A23L 1/0528 A23L 1/0526 A61P 3/04. Número de publicación: 2 179 789 PATENTES Y MARCAS. Número de solicitud: 200101561

ES 2 179 789 A1 A23L 1/0528 A23L 1/0526 A61P 3/04. Número de publicación: 2 179 789 PATENTES Y MARCAS. Número de solicitud: 200101561 k 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 k Número de publicación: 2 179 789 21 k Número de solicitud: 0161 1 k Int. Cl. 7 : A61K 3/78 A23L 1/028 A23L 1/026 A61P 3/04 k 12 SOLICITUD DE PATENTE

Más detalles


DETERMINACIÓN DE GLUTEN EN ALIMENTOS PARA CELÍACOS INDICE DETERMINACIÓN DE GLUTEN EN ALIMENTOS PARA CELÍACOS INDICE 1 Objetivo 2 2 Alcance 2 3 Desarrollo 2 4 Anexo 8 1.0. Objetivo Determinación de gluten en alimentos para celíacos. 2.0. Alcance Este método analítico

Más detalles

25. Perfil lipídico. Isaac Túnez Fiñana 1, Aurora Galván Cejudo 2 RESUMEN

25. Perfil lipídico. Isaac Túnez Fiñana 1, Aurora Galván Cejudo 2 RESUMEN 25. Perfil lipídico Isaac Túnez Fiñana 1, Aurora Galván Cejudo 2 1 Departamento de Bioquímica y Biología Molecular, Avda. Menéndez Pidal s/n, 14071- Córdoba, 2 Campus de Rabanales, Edif. Severo Ochoa 14071-Córdoba

Más detalles



Más detalles

PROSPECTO: INFORMACIÓN PARA EL USUARIO. Glucosada Grifols 50% Solución para perfusión Glucosa

PROSPECTO: INFORMACIÓN PARA EL USUARIO. Glucosada Grifols 50% Solución para perfusión Glucosa PROSPECTO: INFORMACIÓN PARA EL USUARIO Glucosada Grifols 50% Solución para perfusión Glucosa Lea todo el prospecto detenidamente antes de empezar a usar el medicamento. - Conserve este prospecto, ya que

Más detalles

ESTUDIO PRENATAL PARA SINDROME DE DOWN Y DEFECTOS DEL TUBO NEURAL En los últimos años se ha comenzado ha realizar, con gran aceptación en Europa y

ESTUDIO PRENATAL PARA SINDROME DE DOWN Y DEFECTOS DEL TUBO NEURAL En los últimos años se ha comenzado ha realizar, con gran aceptación en Europa y ESTUDIO PRENATAL PARA SINDROME DE DOWN Y DEFECTOS DEL TUBO NEURAL En los últimos años se ha comenzado ha realizar, con gran aceptación en Europa y EEUU, el método de screening prenatal en suero que permite

Más detalles

Nutrición y Diabetes Qué hay de nuevo? Información para profesionales

Nutrición y Diabetes Qué hay de nuevo? Información para profesionales Nutrición y Diabetes Qué hay de nuevo? Información para profesionales Qué es la diabetes? La diabetes es un desorden del metabolismo, en el que el páncreas, no produce insulina ó bien, las células no son

Más detalles



Más detalles

Otra forma de alimentación a través del estómago es mediante gastrostomía.

Otra forma de alimentación a través del estómago es mediante gastrostomía. SOPORTE NUTRICIONAL Se refiere al aporte enteral o parenteral de calorías, proteínas, electrolitos, vitaminas, minerales, oligoelementos y líquidos. El principal objetivo es proporcionar los sustratos

Más detalles

3. Definición, historia natural, criterios diagnósticos y cribado de DM 2

3. Definición, historia natural, criterios diagnósticos y cribado de DM 2 3. Definición, historia natural, criterios diagnósticos y cribado de DM 2 Preguntas para responder Cuál es la definición de diabetes? Criterios diagnósticos, pruebas a realizar y puntos de corte Cuáles

Más detalles

51 Int. CI.: A61M 1/02 (2006.01) TRADUCCIÓN DE PATENTE EUROPEA. Título: Dispositivo de extracción de sangre de la placenta y del cordón umbilical

51 Int. CI.: A61M 1/02 (2006.01) TRADUCCIÓN DE PATENTE EUROPEA. Título: Dispositivo de extracción de sangre de la placenta y del cordón umbilical 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 432 672 1 Int. CI.: A61M 1/02 (06.01) 12 TRADUCCIÓN DE PATENTE EUROPEA T3 96 Fecha de presentación y número de la solicitud europea:

Más detalles

La leche materna es lo mejor! Es esencial para el desarrollo del cerebro del recién nacido, y para su salud.

La leche materna es lo mejor! Es esencial para el desarrollo del cerebro del recién nacido, y para su salud. La leche materna es lo mejor! Es esencial para el desarrollo del cerebro del recién nacido, y para su salud. Los niveles de Omega 3 DHA en la leche materna son determinantes para el desarrollo neurológico

Más detalles

Debe utilizarse la dosis eficaz mínima durante el periodo más corto posible a fin de reducir las reacciones adversas.

Debe utilizarse la dosis eficaz mínima durante el periodo más corto posible a fin de reducir las reacciones adversas. ANEXO III 1 ENMIENDAS A INCLUIR EN LAS SECCIONES RELEVANTES DEL RESUMEN DE LAS CARACTERÍSTICAS DEL PRODUCTO DE LOS MEDICAMENTOS QUE CONTIENEN NIMESULIDA (FORMULACIONES SISTÉMICAS) El texto añadido aparece

Más detalles


Laboratorio Nº 4 Tema: INTERRELACIONES METABÓLICAS Laboratorio Nº 4 Tema: INTERRELACIONES METABÓLICAS Contenidos conceptuales: Integración del metabolismo de hidratos de carbonos, lípidos y proteínas. Interrelación de diferentes tejidos y órganos. La glucosa

Más detalles


RESUMEN DE LAS CARACTERÍSTICAS DEL PRODUCTO GLISULIN 500 XR. 500,0 mg RESUMEN DE LAS CARACTERÍSTICAS DEL PRODUCTO Nombre del producto: Forma farmacéutica: Fortaleza: Presentación: Titular del Registro Sanitario, país: Fabricante, país: GLISULIN 500 XR (Clorhidrato de metformina)

Más detalles

Glucosa sérica. Valores normales en adultos en ayunas. Mujeres 65-100 mg/dl Hombres 70-100 mg/dl.

Glucosa sérica. Valores normales en adultos en ayunas. Mujeres 65-100 mg/dl Hombres 70-100 mg/dl. Glucosa sérica Valores normales en adultos en ayunas Mujeres 65-100 mg/dl Hombres 70-100 mg/dl. Estados hiperglicémicos Respuesta a la tensión. Enfermedad de Cushing o cualquier trastorno que eleve la

Más detalles

ScanGel NEUTRAL 86429 48 Tarjetas 86430 1080 Tarjetas

ScanGel NEUTRAL 86429 48 Tarjetas 86430 1080 Tarjetas ScanGel NEUTRAL 86429 48 Tarjetas 86430 1080 Tarjetas GEL NEUTRO Grupo sérico, screening de Ac irregulares, pruebas cruzadas IVD Todos los productos fabricados y comercializados por la sociedad Bio-Rad

Más detalles

Cromatografía de exclusión molecular (filtración en gel)

Cromatografía de exclusión molecular (filtración en gel) romatografía de exclusión molecular (filtración en gel) K av K av = V e - V o V t -V o log MW Purificación de la HD de rata recombinante Etapa Actividad (µg 2 /h) Prot. total (mg) Actividad específica

Más detalles

Embarazo de Alto Riesgo

Embarazo de Alto Riesgo Embarazo de Alto Riesgo Definiciones Embarazo de bajo riesgo: es el que transcurre en patrones de normalidad o sin patología dentro de los cambios que esperaríamos encontrar en la madre y que conlleva

Más detalles

Int. Cl. 7 : C12N 9/02. 72 Inventor/es: Kajiyama, Naoki. 74 Agente: Carvajal y Urquijo, Isabel

Int. Cl. 7 : C12N 9/02. 72 Inventor/es: Kajiyama, Naoki. 74 Agente: Carvajal y Urquijo, Isabel 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 249 794 1 Int. Cl. 7 : C12N 9/02 12 TRADUCCIÓN DE PATENTE EUROPEA T3 86 Número de solicitud europea: 9766.6 86 Fecha de presentación

Más detalles

Una hormona, es una sustancia fabricada en el cuerpo, que actúa dentro nuestro, sin salir al exterior.

Una hormona, es una sustancia fabricada en el cuerpo, que actúa dentro nuestro, sin salir al exterior. QUÉ ÉS LA DIABETES CONCEPTO La diabetes es una enfermedad crónica, en la que hay un defecto en la fabricación de una hormona, que se llama insulina. Las células del cuerpo no pueden utilizar los azúcares

Más detalles


TALLER: LECHES INFANTILES I EXPOCongreso Nutrición desde la Farmacia TALLER: LECHES INFANTILES CASOS CLÍNICOS Dra. MONTSERRAT RIVERO Directora General Científica Grupo Ordesa Ex-Vocal Nacional del Consejo General de Colegios de

Más detalles

Higiénico-Dietéticas para Ulcerosa

Higiénico-Dietéticas para Ulcerosa Recomendaciones Higiénico-Dietéticas para los Pacientes con Colitis Ulcerosa 13 Dra. Laura Sempere Robles Unidad de Gastroenterología. Hospital General Universitario de Alicante Qué son las medidas higiénico-dietéticas?

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60.

Más detalles



Más detalles



Más detalles

Obesidad y sus complicaciones

Obesidad y sus complicaciones Obesidad y sus complicaciones 0123/#$4#(-#%,%#5/&()+)$,/*,/&6#5)%,%7/012)3$#5/8)#$#$/ -,9&(/()#5+&7/0:2;*#5/5&$/*,5/'&$5#'2#$'),57/ INTRODUCCIÓN La obesidad es por sí misma un problema de salud. Antes

Más detalles

Folleto Informativo. y Cáncer Gástrico

Folleto Informativo. y Cáncer Gástrico Folleto Informativo y Cáncer Gástrico Helicobacter pylori Helicobacter pylori (H. pylori) es un tipo de bacteria que se encuentra en el estómago de aproximadamente dos tercios de la población mundial.

Más detalles


SINDROME DIARREICO CRONICO DR. FERNANDO KAWAGUCHI P. SINDROME DIARREICO CRONICO DR. FERNANDO KAWAGUCHI P. 1. DIARREA CRONICA Se define como un aumento en la frecuencia y fluidez de las heces. Para la mayoría de los pacientes se presenta con un aumento de

Más detalles



Más detalles

constituye aproximadamente el 60% de la reserva de aminoácidos del músculo esquelético.

constituye aproximadamente el 60% de la reserva de aminoácidos del músculo esquelético. Qué es la glutamina? La glutamina es el más abundante aminoácido libre en el cuerpo humano, y constituye aproximadamente el 60% de la reserva de aminoácidos del músculo esquelético. La glutamina es un

Más detalles

C-peptide. N de código K6220. Inmunoensayo enzimático para la medición cuantitativa del péptido C en muestras clínicas humanas.

C-peptide. N de código K6220. Inmunoensayo enzimático para la medición cuantitativa del péptido C en muestras clínicas humanas. C-peptide N de código K6220 Inmunoensayo enzimático para la medición cuantitativa del péptido C en muestras clínicas humanas. Este kit contiene reactivos para 96 pocillos de prueba. (111838-002) K6220/ES/CKJ/2009.06.17

Más detalles

Nutrición y dietética. Tema 5. Dietas con modificación de la textura y la consistencia

Nutrición y dietética. Tema 5. Dietas con modificación de la textura y la consistencia Tema 5. Dietas con modificación de la textura y la consistencia Toda persona que requiera cuidados médicos, precisa la aplicación de una determinada dieta. Un segundo documento que contiene el Manual General

Más detalles

Una mirada interactiva al. del tracto gastrointestinal (GI) Bienvenido a esta guía interactiva

Una mirada interactiva al. del tracto gastrointestinal (GI) Bienvenido a esta guía interactiva Una mirada interactiva al tracto gastrointestinal (GI) Bienvenido a esta guía interactiva del tracto gastrointestinal (GI) Haga clic sobre el nombre del órgano para obtener información sobre las zonas

Más detalles


FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

TP6: Western blot. Objetivos. Introducción

TP6: Western blot. Objetivos. Introducción TP6: Western blot Objetivos Familiarizarse con la técnica de western blot. Determinar los niveles de IgG en sueros murinos Comparar la sensibilidad del western blot vs el SDS page Introducción La transferencia

Más detalles


DANAGENE RNA PURIFICATION KIT DANAGENE RNA PURIFICATION KIT REF.0801.1 100 EXTRACCIONES REF.0801.2 500 EXTRACCIONES 1.INTRODUCCION Este kit permite la permite la obtención de ARN total a partir de cultivos celulares, tejidos animales,

Más detalles

Control de Calidad en la Técnica de ELISA. Lic. Valentina Bastidas D.

Control de Calidad en la Técnica de ELISA. Lic. Valentina Bastidas D. Control de Calidad en la Técnica de ELISA Lic. Valentina Bastidas D. TÉCNICA DE ELISA DEFINICIÓN E L I S A Ensayo Inmunoabsorbente Ligado a Enzimas Enzime-Linked ImmunoSorbent Assay TIPOS DE ELISA: ELISA

Más detalles

Prevención del Cáncer de Colon. Dra. Carmen Gloria Yañez Unidad Gastroenterología Hospital del Trabajador de Concepción

Prevención del Cáncer de Colon. Dra. Carmen Gloria Yañez Unidad Gastroenterología Hospital del Trabajador de Concepción Prevención del Cáncer de Colon Dra. Carmen Gloria Yañez Unidad Gastroenterología Hospital del Trabajador de Concepción CANCER DE COLON QUE ES? EL COLON O INTESTINO GRUESO ES LA PARTE FINAL DE INTESTINO

Más detalles

MARCO TEORICO. La diabetes es una enfermedad crónica en la cual el cuerpo no puede regular la cantidad de azúcar en la sangre.

MARCO TEORICO. La diabetes es una enfermedad crónica en la cual el cuerpo no puede regular la cantidad de azúcar en la sangre. CAPITULO 2 MARCO TEORICO 2.1Que es la Diabetes La diabetes es una enfermedad crónica en la cual el cuerpo no puede regular la cantidad de azúcar en la sangre. Causas La insulina es una hormona producida

Más detalles

CAPÍTULO X. Acerca de la Redefinición del Infarto Agudo de Miocardio.

CAPÍTULO X. Acerca de la Redefinición del Infarto Agudo de Miocardio. CAPÍTULO X. Acerca de la Redefinición del Infarto Agudo de Miocardio. Guillermo Grau Jornet. Médico. Especialista en Cardiología. Hospital Virgen delos Lirios. Alcoy. Alicante. España. El desarrollo de

Más detalles


ENFERMEDADES TROPICALES Departamento de Biología Animal, Parasitología, Ecología, Edafología y Química Agrícola. Área de Parasitología MÁSTER EN ENFERMEDADES TROPICALES Proteómica en Enfermedades Tropicales Código 302731 (3 créditos

Más detalles



Más detalles

X-Plain Hipoglucemia Sumario

X-Plain Hipoglucemia Sumario X-Plain Hipoglucemia Sumario Introducción La hipoglucemia es una afección que causa que el azúcar en la sangre baje a niveles peligrosos. Esto suele ocurrir mayormente en pacientes diabéticos que toman

Más detalles

NycoCard CRP Single Test

NycoCard CRP Single Test NycoCard CRP Single Test ES DESCRIPCION DEL PRODUCTO Aplicaciones NycoCard CRP Single Test es un test de diagnóstico in vitro para medir de una forma rápida la proteína C reactiva (CRP) en la sangre humana.

Más detalles


IMPORTANTE INSTRUCCIONES GENERALES PARA LA PREPARACIÓN DEL PACIENTE IMPORTANTE Para cualquier ESTUDIO GENÉTICO (EXCEPTO PRUEBA DEL TALÓN ) es imprescindible: La solicitud debe ir acompañada de la hoja de petición, con datos del paciente y motivos de estudio (resumen de

Más detalles

Nacer. en tiempo. Informe anual de prematurez

Nacer. en tiempo. Informe anual de prematurez Nacer 2011 en tiempo Informe anual de prematurez En el marco del Día nacional de prevención de la prematurez, la Fundación Álvarez Caldeyro Barcia presenta Nacer en tiempo, un informe que se propone relevar

Más detalles

Int. Cl. 7 : A61K 38/46

Int. Cl. 7 : A61K 38/46 k 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 k Número de publicación: 2 181 92 21 k Número de solicitud: 01383 1 k Int. Cl. 7 : A61K 38/46 A61P 17/12 k 12 SOLICITUD DE PATENTE A1 22 kfecha de presentación:

Más detalles

Una prueba genética fetal sin riesgos, ni para ti ni para tu bebé

Una prueba genética fetal sin riesgos, ni para ti ni para tu bebé OBSTETRICIA TEST EN SANGRE MATERNA PARA DETECTAR SÍNDROME DE DOWN Una prueba genética fetal sin riesgos, ni para ti ni para tu bebé Salud de la mujer Dexeus ATENCIÓN INTEGRAL EN OBSTETRICIA, GINECOLOGÍA

Más detalles

Calf Notas Acerca de Terneros #39 - Usando el refractómetro

Calf Notas Acerca de Terneros #39 - Usando el refractómetro Calf Notas Acerca de Terneros #39 - Usando el refractómetro Introducción. El medir el grado de transferencia de inmunidad pasiva a los terneros recién nacidos puede decirle mucho acerca del nivel

Más detalles

11 Número de publicación: 2 251 987. 51 Int. Cl. 7 : A61K 31/4188. 72 Inventor/es: Ragab, Mohamed, H. 74 Agente: Tavira Montes-Jovellar, Antonio

11 Número de publicación: 2 251 987. 51 Int. Cl. 7 : A61K 31/4188. 72 Inventor/es: Ragab, Mohamed, H. 74 Agente: Tavira Montes-Jovellar, Antonio 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 21 987 1 Int. Cl. 7 : A61K 31/4188 A61P 3/00 12 TRADUCCIÓN DE PATENTE EUROPEA T3 86 Número de solicitud europea: 0091843.9 86

Más detalles



Más detalles

Enfermedad celíaca. y otras patologías por sensibilidad al gluten

Enfermedad celíaca. y otras patologías por sensibilidad al gluten Enfermedad celíaca y otras patologías por sensibilidad al gluten Qué es la enfermedad celíaca y a quién afecta? La enfermedad celíaca es la patología crónica intestinal más frecuente y está provocada por

Más detalles



Más detalles