Estudio de proteínas musculares por Western blot y técnicas de genética aplicadas a las enfermedades neuromusculares: PCR, RFLP y secuenciación

Tamaño: px
Comenzar la demostración a partir de la página:

Download "Estudio de proteínas musculares por Western blot y técnicas de genética aplicadas a las enfermedades neuromusculares: PCR, RFLP y secuenciación"

Transcripción

1 Estudio de proteínas musculares por Western blot y técnicas de genética aplicadas a las enfermedades neuromusculares: PCR, RFLP y secuenciación Dra. IRENE VIÉITEZ GONZÁLEZ Servicio de Anatomía Patológica y Neuropatología Hospital Meixoeiro Complejo Hospitalario Universitario de Vigo (CHUVI) Instituto de Investigación Biomédica de Vigo Cádiz, Mayo XXVI Congreso Nacional de la SEAP-IAP, XXI Congreso Nacional de la SEC, II Congreso Nacional de la SEPAF

2 Consideraciones generales sobre ácidos nucleicos y proteínas

3 FUNDAMENTO CENTRAL DE LA BIOLOGÍA MOLECULAR La información genética, contenida en el ADN, se mantiene y es trasferida a su descendencia por su capacidad de REPLICACIÓN El ADN transfiere la información al ARN mediante la TRANSCRIPCIÓN en el núcleo. El ARN mensajero se desplaza al citoplasma con la información del ADN y, mediante la TRADUCCIÓN, sintetiza las proteínas Las proteínas son las encargadas de desarrollar las diferentes funciones de las células Núcleo Citoplasma Replicación Transcripción Traducción ADN ARN Proteína Excepciones: - Retrovirus Transcripción inversa (transcriptasa inversa) - Virus de ARN Duplicación del ARN (ARN polimerasa) - Ribozimas: ARN con propiedades autocatalíticas, que son capaces de modificarse y replicarse por si mismos. - Priones: Proteínas que se autoreplican

4 ADN: Ácido didesoxirribonucleico - NUCLEÓTIDOS de desoxirribosa: Adenina (A), Guanina (G), Citosina (C) y Timina (T) - ENLACE FOSFODIÉSTER - Dirección Estructura en DOBLE HÉLICE y ANTIPARALELA - COMPLEMENTARIEDAD: A T (2 puentes de H 2 ) / G C (3 puentes de H 2 ) Nucleótido

5 ARN: Ácido ribonucleico - NUCLEÓTIDOS de ribosa: Adenina (A), Guanina (G), Citosina (C) y Uracilo (U) -De cadena sencilla (5 3 ) : MONOCATENARIO (excepto reovirus) - Complementariedad con el ADN molde (la Adenina se combina con Uracilo) TRANSCRIPCIÓN - Tipos de ARN Distintos papeles en la transmisión de la información ARN Mensajero: sirve de molde para la síntesis de las proteínas y transporta la información desde el DNA (núcleo) hasta el centro de producción de la síntesis proteica (ribosoma) ARN Ribosómico: forma parte de los ribosomas que llevan a cabo la traducción ARN Transferente: sirve para el transporte de los aminoácidos específicos desde las reservas citosólicas hasta los ribosomas y aseguran su correcto alineamiento Otros ARNs se emplean en la elaboración del RNA y en la exportación extracelular de proteínas RNA ribosomal (rrna) RNA mensajero (mrna) RNA de transferencia (trna)

6 LAS PROTEÍNAS - Combinación de AMINOÁCIDOS (20 diferentes) - Compleja organización estructural: Cadena aminoacídica > Estructura cuaternaria (Complejo proteico) - Funciones muy diversas: Estructurales, Enzimas, Receptores, Hormonas, Anticuerpos

7 EL CÓDIGO GENÉTICO Relación entre la secuencia de nucleótidos del ADN y la secuencia de aminoácidos de la proteína Organizado en tripletes o CODONES: cada tres nucleótidos corresponden a un aminoácido. Los codones TAA, TAG y TGA indican la parada de la síntesis proteica. DEGENERADO: existe más de un triplete que codifica por el mismo aminoácido. ESPECÍFICO: ningún codón codifica más de un aminoácido CONTÍNUO: el cuadro de lectura de los tripletes se realiza sin espacios en sentido 5-3 desde el codón de inicio hasta el de parada. UNIVERSAL: el mismo triplete en diferentes especies codifica para el mismo aminoácido.

8 Qué es un Gen? Unidad física y funcional básica de información contenida en el ADN Exón: Región del gen que se mantiene en el ARN mensajero tras su maduración (Splicing). Parte codificante del gen Intrón: Región del gen que no se mantiene en el ARN mensajero tras el proceso de Splicing. Parte no codificante del gen. GEN Maduración del ARNm

9 Qué es un Alelo? En organismos diploides es cada una de las dos copias del gen presente en su genoma ALELO DOMINANTE: Alelo que enmascara la expresión fenotípica del otro alelo del mismo locus. ALELO RECESIVO: Alelo que para expresarse debe estar en ambos locus. HOMOCIGOTO: Los dos alelos iguales para un locus. HETEROCIGOTO: Los dos alelos distintos para un locus.

10 MUTACIÓN: Tipos de mutaciones Cambio en la información genética que puede ser transmitido a la descendencia MUTACIONES PUNTUALES: Se produce el cambio de un único nucleótido Missense : Variación de un nucleótido que conlleva el cambio de un aminoácido por otro distinto. Secuencia normal Secuencia mutada 5 ACTGCATTTAGC 3 5 ACTGCATCTAGC 3 T A F S T A S S Nonsense : Variación de un nucleótido que conlleva el cambio de un aminoácido por un codón de parada (TAG, TAA o TGA). Secuencia normal Secuencia mutada 5 AGCTGCAGCAAT 3 5 AGCTGAAGCAAT 3 S C S N S X MUTACIONES FRAMESHIFT (Cambio en la pauta de lectura): Se produce un cambio total en el sentido del mensaje genético a partir del sitio de la mutación. Se sintetiza una proteína inactiva, a menudo truncada. Se debe a: DELECIONES, INSERCIONES, INDELS, DUPLICACIONES MUTACIONES IN-FRAME: Si el cambio afecta a un triplete o varios, la proteína solo pierde los aminoácidos implicados. MUTACIONES DE SPLICING (de corte y empalme) : Mutaciones que alteran el proceso de maduración de los ARNm generando transcriptos alterados que codifican por proteínas truncadas.

11 Patrones de Herencia Genética Herencia Autosómica Dominante Herencia Autosómica Recesiva Herencia Ligada a X dominante Herencia ligada a X recesiva

12 ANÁLISIS GENÉTICOS: Extracción de ácidos nucleicos PCR y PCR-RFLP Secuenciación

13 Extracción ADN: Método de extracción por Fenol-Cloroformo Biopsia músculo Sangre en EDTA Otros tejidos Lisis de la muestra Tampón de Lisis de Rojos Tampón de lisis de Blancos Protección del ADN y eliminación de material proteico y lipídico Proteinasa K SDS Lavados con Fenol Lavados con Cloroformo Precipitación o concentración Isopropanol NaCl, EtOH Eliminación de inhibidores de las reacciones sucesivas Lavados con EtOH 70% Secado Resuspensión Cuantificación H 2 O o TE Espectrofotometría

14 PCR: Reacción en cadena de la polimerasa Consiste en la replicación de un fragmento de ADN de forma sucesiva Crecimiento exponencial Tras la amplificación resulta mucho más fácil identificar y manipular el fragmento de ADN a análisis

15 PCR: Reacción en cadena de la polimerasa ADN molde (20ng-1μg) Cebadores específicos (Primers) Nucleótidos (dntps 0.8 mm) DNA-Polimerasa MgCl 2 (1.5-4 mm) Tampón ddh 2 O PCR-MULTIPLEX: Amplificación con varios sets de primers de un ADN molde Productos de distintos tamaños. - Detección rápida de deleciones en un gen (Distrofina, 1988)

16 Análisis de una PCR: Electroforesis de Agarosa Técnica para separar fragmentos de ADN mediante la aplicación de un campo eléctrico El ADN tiene carga negativa por lo que se dirigirá al polo positivo Separación de los fragmentos de ADN en función del peso molecular Visualización por unión ADN Bromuro de Etidio También permite cuantificar y/o aislar el producto de PCR PCR SIMPLE PCR MULTIPLEX 1 2 3

17 RFLP: Restriction fragment length polymorphism Estudio de una mutación conocida Identificación de mutaciones en el fragmento amplificado utilizando enzimas de restricción (ER) y analizando los productos en gel de agarosa Las ER cortan la cadena de ADN en sitios específicos dando un patrón de bandas característico La presencia de una mutación modifica este patrón de bandas Fragmento amplificado: 576bp 5 GCGACCTCTTCAACCTCTCGGCGCCCCTGGCCCGGCCGGT GGGCACCAGCCTCTTTCTGCAGACCGCCCTTCGCGGCTGGGC GGTGCAGCTGCTGGACTTGACCTTCGCCGCGGCGCGCCAGCC CCCGCTGGCCACGGCCCACGCGCGCTGGAAGGCTGAGCGCGA GGGACGCGCTCGGCGGGCGGCGCTGCTCCGCGCGCTGGGCAT CCGCCTAGTGAGCTGGGAAGGCGGGCGGCTGGAGTGGTTCGG CTGCAACAAGGAGACCACGCGCTGCTTCGGAACCGTGGTGGG CGACACGCCCGCCTACCTCTACGAGGAGCGCTGGACGCCCCC CTGCTGCCTGCGCGCGCTGCGCGAACCGCCCGCTATGTGGTG GGCGTGCTGGAGGCTGCGGGCGTGCGCTACTGGCTCGAGGGC GGCTCACTGCTGGGGGCCGCCCGCCACGGGGACATCATCCCA TGGGACTACGACGTGGACCTGGGCATCTACTTGGAGGACGTG GGCAACTGCGAGCAGCTGCGGGGGGCAGAGGCCGGCTCGGTG GTGGATGAGCGCGGCTTCGTATGGGAGAAGGC 3 212bp 364bp Bfa I M N HT HM 576 bp 364 bp 212 bp Sustitución de C > A

18 SECUENCIACIÓN DEL ADN La secuenciación permite realizar un análisis en profundidad del ADN y desvelar la información básica presente en el fragmento a estudio La secuenciación automática: Método de Sanger DIDEXOSINUCLEÓTIDOS Pasos de la reacción de Secuencia: I. Purificación del producto PCR Exosap II. Amplificación con un solo primer, ADN polimerasa, dntps + ddntps (Big Dye ) III. Desnaturalización de los fragmentos IV. Separación por electroforesis capilar V. Lectura de la secuencia REACCIÓN DE SECUENCIA ciclos

19 SECUENCIACIÓN DEL DNA

20 SECUENCIACIÓN DEL DNA CÓDIGO DE COLOR: ADENINA TIMINA GUANINA CITOSINA ALELO 1 C ALELO 2 C Normal ALELO 1 T ALELO 2 T ALELO 1 C ALELO 2 T Homocigoto Heterocigoto

21 ANÁLISIS DE PROTEÍNAS: Western Blot

22 WESTERN BLOT Técnica analítica para detectar proteínas específicas en extractos celulares o de tejido Obtención y preparación de la muestra Obtención y preparación de la muestra Etapas: Separación por electroforesis Trasferencia de proteínas Immunoblot Toma de la muestra (músculo 20µg) Lisis (Solución PIK + Inhibidores) Homogenización Sonicación Separación de las fracciones de interés (Centrifugación) Desnaturalización para SDS-Page (Adicción del tampón de Leemli y ebullición) Revelado Análisis de Resultados

23 WESTERN BLOT: Separación por electroforesis Separación de las proteínas aplicando un campo eléctrico Gel de Poliacrilamida Rápido y Versátil (Acrilamida/Bisacrilamida) Gel Desnaturalizante (SDS- Page): Pérdida de la estructura 3D Tampón de Electroforesis Mantener ph constante Las proteínas se separan solamente en función de su PESO MOLECULAR Discontinua Gel Concentrador: < %Acrilm+Bisacrilm ph 6.8 (+ácido) Gel Separador: > %Acrilm+Bisacrilm ph 8.8

24 WESTERN BLOT: Transferencia de proteínas Gel Poliacrilamida Membrana de Nitrocelulosa o PVDF Accesibilidad de las proteínas a su detección con Anticuerpos Electrotransferencia: - Sandwich: Filtro Gel Membrana Filtro - Tampón de Transferencia - Corriente eléctrica: Cátodo (+) Ánodo (-) Gel Poliacrilamida Membrana Nitrocelulosa

25 WESTERN BLOT: Inmunoblot Leche en polvo o BSA en tampón TTBS Bloqueo Anticuerpo primario Monoclonoal o Policlonal Dilución 1:200-1:2000 Tiempo de incubación Anticuerpo secundario Detección Reconoce la inmunoglobulina de la especie en el que se ha producido el primario. Son conjugados con un sistema de revelación (HRP o AP) Reacción de un sustrato (ej. luminol) catalizada por la Horseraddish peroxidase con emisión de luz.

26 WESTERN BLOT: Análisis de Resultados Se compara la altura de la banda obtenida con un marcador de pesos moleculares para confirmar que hemos detectado el producto de interés. Cuando es necesario valorar la cantidad de proteína para comparar la expresión en diferentes tejidos o pacientes es necesario realizar una comparación con una proteína endógena cuya expresión no varia en las diferentes muestras (GAPDH, IgG, Actina).

27 Aplicación al estudio de Enfermedades Neuromusculares

28 ENFERMEDADES NEUROMUSCULARES

29 DIAGNÓSTICO MOLECULAR Biopsia muscular + Historia clínica Datos paraclínicos Disección Orientación Laboratorio Miopatología Banco de Tejidos Sangre M/E Inmunogold Cortes criostato Congelación Extracción de DNA Banco de DNA Histoquímica Inmunohistoquímica Microscopía Confocal Wb Bioquímica PCR multiplex PCR-RFLP Secuenciación Otras DIAGNÓSTICO Consejo genético

30 DISTROFINOPATÍAS Distrofina: Nexo de unión entre citoesqueleto y matriz extracelular 1987: Gen DMD localizado en Xp21 => 79 exones Herencia ligada a X recesiva: Mujeres portadoras y hombres afectos Fenotipos: Distrofia muscular de Duchenne Distrofia muscular de Becker PCR MULTIPLEX PCR I PCR II Estudio de exones de zona caliente del gen PCR multiplex detecta más del 95% de las deleciones en DMD WESTERN BLOT Exón 45 Exón 48 Exón kda Expresión de la Distrofina Exón 44 DMD DMB DMB

31 DISTROFIAS DE CINTURAS

32 LGMD1C: Caveolinopatía Caveolina 3 (21kDa): Proteína integral de membrana para la formación de caveolas en el músculo Gen CAV3 (3p25) => 2 exones Herencia AD: Heterocigoto Afecto SECUENCIACIÓN R26Q (exón 1) A45T (exón 2) Control Heterocigoto Control Heterocigoto

33 LGMD2C: Gamma-sarcoglicanopatía Gen SGCG (13q12) => 8 exones Gamma-sarcoglicano: 35kDa Etnia Gitana: Elevada prevalencia mutación C283Y (mutación fundacional) Población Mediterránea: Elevada prevalencia mutación del521t PCR-RFLP C283Y Rsa I SECUENCIACIÓN del521t (exón 6) Control Homocigoto Heterocigoto

34 GLUCOGENOSIS V: Enfermedad de McArdle Glucogenosis más frecuente Miofosforilasa: Degradación del glucógeno PYGM (11q13) 20 exones Herencia AR Gran heterogeneidad alélica MUTACIONES MÁS FRECUENTES MUTACIÓN Nº Total nonsense R50X ( exón 1) Arginina > Stop (CGA TGA) Mutación más frecuente missense W798R (exón 20) Triptófano > Arginina (TGG CGG) Mutación privada de España (2ª mutación más frecuente) missense G205S ( exón 5) Glicina > Serina (GGC AGC) 2ª mutación más frecuente en la población general Missense/nonsense Splicing Pequeñas Inserciones Pequeñas Deleciones Grandes Deleciones Duplicaciones Indels R50X, W798R y G205S % alelos mutantes en pacientes españoles 2 2 3

35 GLUCOGENOSIS V: Enfermedad de McArdle PCR-RFLP: Análisis de las mutaciones R50X, W798R y G205S Nonsense R50X Exón 1 CGA > TGA Arg > Stop Missense W798R Exón 20 TGG > CGG Trp > Arg Missense G205S Exón 5 GGC > AGC Gly > Ser 1: Marcador peso molecular 4: Caso Homozigoto 2: Producto PCR sin digerir 5: Caso Heterozigoto 3: Caso Normal

36 SECUENCIACIÓN Inserción en el Exón 8 Inserción T entre nucleótidos Alteración pauta de lectura Codón de parada prematuro 35 aminoácidos después Tyr Phe Val Secuencia normal: 5 GAGTATTTCGTGGT 3 Secuencia mutada: 5 GAGTTATTTCGTGG 3 Leu Phe Arg

37 GLUCOGENOSIS II: Enfermedad de Pompe Maltasa ácida (105kDa): Degradación glucógeno lisosomal Gen GAA (17q25) 20 exones Herencia autosómica recesiva Diagnóstico Prenatal:

38 CONCLUSIONES CONFIRMACIÓN Y EXACTITUD EN EL DIAGNÓSTICO MÉTODO DIAGNÓSTICO NO INVASIVO DETECCIÓN PRECOZ DE LA ENFERMEDAD DETECCIÓN DE HETEROCIGOTOS Y FAMILIARES AFECTOS CONSEJO GENÉTICO: - Prevención de futuros casos - Diagnóstico prenatal o preimplantacional CONOCIMIENTO DEL DEFECTO MOLECULAR: - PRONÓSTICO (correlación genotipo fenotipo) - POSIBLES TERAPIAS GÉNICAS

39 Muchas Gracias por su atención Grupo de Neurociencias NC-CHUVI Instituto de Investigación Biomédica de Vigo (IBIV) Coordinadora: Carmen Navarro Investigadores: Saida Ortolano Susana Teijeira Irene Viéitez Beatriz San Millán Carlos Spuch Personal de apoyo: Olga Souto Soraya Barrera TaniaVázquez-Santos

40

41

42 DIAGRAMA GENERAL DE ESTUDIO GENÉTICO Muestra biológica Extracción DNA DNA PCR (Polymerase chain reaction) Análisis por Secuenciación Reacción Secuencia Producto de PCR Digestión (ER) Análisis por RFLP (Restriction fragment length polymorphism) RESULTADO

43 DISTROFIAS DE CINTURAS ENFERMEDAD LOCUS (OMIM) PROTEÍNA MW (kda) LOCALIZACIÓN LGMD1A 5q31 Miotilina 57 Sarcómero LGMD1B 1q21 Laminina A/C 74/65 Membrana Nuclear LGMD1C 3p25 Caveolina 3 17 Transmembrana LGMD1D 7q Desmina 53 Citoplasma LGMD1E 6q23 DNAJB6 37 Citoplasma/Disco Z LGMD1F 7q32.1 TPNO Membrana Nuclear LGMD1G 4q21 (Starling et al. Europ J Hum Genet 2004; 12: )

44 DISTROFIAS DE CINTURAS ENFERMEDAD LOCUS (OMIM) PROTEÍNA MW (kda) LOCALIZACIÓN LGMD2A 15q15 Calpaina 3 94 Citoplasma LGMD2B 2p13 Disferlina 230 Membrana LGMD2C 13q12 - sarcoglicano 35 Transmembrana LGMD2D 17q11-q12 -sarcoglicano 50 Transmembrana LGMD2E 4q12 -sarcoglicano 43 Transmembrana LGMD2F 5q sarcoglicano 35 Transmembrana LGMD2G 17q11-q12 Teletonina 19 Sarcomérica LGMD2H 9q31 TRIM32 72 Citoplasma LGMD2I 19q13 FKRP 60 Aparato de Golgi LGMD2J 2q Titina 4200 Sarcomérica LGMD2K 9q34 POMT1 (Balci et al. Neuromusc Disord 2005; 15: )

45 LGMD2B: Disferlinopatía Disferlina (230kDa): Mantiene la integridad del sarcolema Fenotipos: Gen DYSF (2p13) => 55 exones Cierta correlación Genotipo Fenotipo: LGMD2B Miopatía distal de Miyoshi DMAT WESTERN BLOT 230 kda

46 GLUCOGENOSIS V: Enfermedad de McArdle I83F Y85X R94Q R94W N102Dfs L153R L153P G157V G159R R161C G174D P230R V239del S246P L292P Y298Lfsx35 c g>t A364V A365E W366X T379M E383K A384D E386Afs W388Sfs L397P c G>A G486D T488N T488I R490W R490Q R490Afs R491C W492X V494Sfs 11 mutaciones E541X K543T K543X R570W R570Q Y574X K575E R576X Q577R L587P R650EfsX8 R650X E655K c del Y733X K754Nfs Q755X R771Q E796Vfs W798R T808P S809FfsX6 D815A W826S M1V M1L L5RfsX20 L5Vfs V16Ffs E26Afs L36R H37QfsX33 R50X Y53X A55GfsX21 Q73Hfs 12 mutaciones L116P E125X L132WfsX163 N134Kfs G136D R139W R194W G205S G205D c.681-2a>g R270X c G>C E337R E349K L354P W362X c G>A R428C G449R S450L A452Rfs G455R V456M P454_L464 Hotspots in exons 1, 14 y 17 (32% mutations) 23 nuevas mutaciones D511Tfs D534Vfs c G>A c g>a R590H F599Lfs R602W R602Q K609K A660D D662A Q666E A670V N685Y G686R G686R A687P T692Kfs A704V G705Rfs F710del R715W 14 mutaciones C784X Q785X c g>a

47 SECUENCIACIÓN PYGM Deleción 5 nucleótidos Alteración pauta de lectura Codón de parada prematuro (PTC) 21 aminoácidos después Deleción T14 Alteración pauta de lectura Codón de parada prematuro (PTC) 20 aminoácidos después

48 GLUCOGENOSIS IIb: Enfermedad de Danon LAMP2 Xq24 Herencia dominante ligada a X 9 exones Splicing alternativo exón 9: - Isoforma LAMP2a - Isoforma LAMP2b Músculo estriado y cerebro MUTACIÓN Sustituciones nucleotídicas (Missense/Nonsense) Nº Total 10 Q359PfsX13 (c.1074insc) Pequeñas Inserciones 3 Pequeñas Deleciones 9 Grandes Deleciones 5 Splicing 10 Small Indel 1 Secuencia Normal Viéitez I et al. Human Genetics Secuencia Mutada

Técnicas de Biología Molecular

Técnicas de Biología Molecular Técnicas de Biología Molecular DNA I. Enzimas de restricción Análisis Las enzimas de restricción fueron aisladas de bacterias; su función natural es proteger contra DNA extraño II. Separación electroforética

Más detalles

Análisis en Genética 1

Análisis en Genética 1 Análisis en Genética 1 Análisis Genético FUNCION BIOLOGICA Gen o genes implicados Localización Cartografiado Función Interacciones TIPOS DE MUTACIÓN MUTACIÓN GÉNICA -El alelo de un gen sufre un cambio,

Más detalles

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas ELEMENTOS BÁSICOS DE LA INVESTIGACIÓN EN GENES Análisis

Más detalles

Biología Profundización

Biología Profundización UNIDAD 1: GENÉTICA SUB-UNIDAD 2: TRANSCRIPCIÓN Y TRADUCCIÓN Biología Profundización En esta sesión tú podrás: - Conocer el proceso transcripcional y post-transcripcional. - Reconocer los sucesivos procesos

Más detalles

1. Cuáles son las diferencias en los componentes químicos del ADN y ARN?

1. Cuáles son las diferencias en los componentes químicos del ADN y ARN? ACTIVIDADES TEMA 4 - BIOTECNOLOGÍA 1. Cuáles son las diferencias en los componentes químicos del ADN y ARN? Las cadenas de ADN están formadas por fosfato y desoxirribosa y la del ARN por fosfato y ribosa.

Más detalles

ÁCIDOS NUCLEICOS. Por: Wilfredo Santiago

ÁCIDOS NUCLEICOS. Por: Wilfredo Santiago ÁCIDOS NUCLEICOS Por: Wilfredo Santiago Ácidos Nucleicos Formados por subunidades llamadas nucleótidos; pueden ser un solo nucleótido o una cadena larga de nucleótidos. Ácidos Nucleicos Nucleótidos individuales:

Más detalles

CÓDIGO GENÉTICO Y SÍNTESIS DE PROTEÍNAS

CÓDIGO GENÉTICO Y SÍNTESIS DE PROTEÍNAS CÓDIGO GENÉTICO Y SÍNTESIS DE PROTEÍNAS Sumario Mitosis y meiosis Código genético y síntesis de proteínas: 1. Concepto de gen 2. Estructura del ADN 3. La replicación del ADN 4. La transcripción 5. La traducción

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras METODOLOGIA DEL PCR Lic. Jorge Mato Luis Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras Desnaturalización del DNA 5 A G G T T A G T G G A C C C T T G A T 3 3 T C C A

Más detalles

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri OBJETIVO Desarrollar un banco de datos a partir de plantas de origen indudable y del uso

Más detalles

Clonación molecular. Clonar significa hacer copias idénticas

Clonación molecular. Clonar significa hacer copias idénticas INGENIERÍA GENÉTICA Clonación molecular Clonar significa hacer copias idénticas Este término originalmente fue aplicado al procedimiento de aislar una célula y permitirle reproducirse creando una población

Más detalles

QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA. Julio A. Carrasco Vallejo Julio 2014

QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA. Julio A. Carrasco Vallejo Julio 2014 QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA Julio A. Carrasco Vallejo Julio 2014 Definiciones Biología Molecular: Estudio de los flujos de información genética en una célula Biotecnología: Uso de sistemas

Más detalles

EDUCACION CONTINUADA. Introducción. Caso clínico nº 1

EDUCACION CONTINUADA. Introducción. Caso clínico nº 1 EDUCACION CONTINUADA L. Castaño, J.R. Bilbao, I. Urrutia An Esp Pediatr 1997;46:513-518. Introducción a la biología molecular y aplicación a la pediatría (5): Casos clínicos. Alteraciones genéticas en

Más detalles

TEMA 4 CMC BIOTECNOLOGÍA

TEMA 4 CMC BIOTECNOLOGÍA Conceptos Tema 4 TEMA 4 CMC BIOTECNOLOGÍA Células eucariotas: Células con núcleo. Núcleo: Un compartimento en el interior de la célula que alberga el material genético. Citoplasma: En una célula eucariota,

Más detalles

Jornadas de Actualización de Neurología 22 de Junio 2013 Enfermedades Neuromusculares Miopatías hereditarias en el Uruguay de hoy

Jornadas de Actualización de Neurología 22 de Junio 2013 Enfermedades Neuromusculares Miopatías hereditarias en el Uruguay de hoy Jornadas de Actualización de Neurología 22 de Junio 2013 Enfermedades Neuromusculares Miopatías hereditarias en el Uruguay de hoy Dra. Rosario Gueçaimburú Miopatías hereditarias Distrofias musculares Miopatías

Más detalles

Genética de la distrofia muscular de Duchenne/Becker. Jesús Molano Unidad de Genética Molecular Hospital Universitario La Paz Madrid

Genética de la distrofia muscular de Duchenne/Becker. Jesús Molano Unidad de Genética Molecular Hospital Universitario La Paz Madrid Genética de la distrofia muscular de Duchenne/Becker Jesús Molano Unidad de Genética Molecular Hospital Universitario La Paz Madrid Distrofias musculares hereditarias Definición: Grupo de enfermedades

Más detalles

Los elementos químicos más abundantes en los seres vivos son: Agua y proteínas. Carbono, oxígeno, hidrógeno, nitrógeno, fósforo y azufre.

Los elementos químicos más abundantes en los seres vivos son: Agua y proteínas. Carbono, oxígeno, hidrógeno, nitrógeno, fósforo y azufre. Los elementos químicos más abundantes en los seres vivos son: Agua y proteínas. Carbono, oxígeno, hidrógeno, nitrógeno, fósforo y azufre. Glúcidos, lípidos, proteínas, ácidos nucleicos. Oxígeno, calcio,

Más detalles

EDUCACION CONTINUADA. Introducción. Caso clínico

EDUCACION CONTINUADA. Introducción. Caso clínico EDUCACION CONTINUADA L. Castaño, J.R. Bilbao, B. Calvo An Esp Pediatr 1997;47:201-206. Introducción a la biología molecular y aplicación a la pediatría (6): Caso clínico: Trastorno molecular en la diabetes

Más detalles

ADN ARN Proteínas. La información genética es portada por el ADN y se hereda con él.

ADN ARN Proteínas. La información genética es portada por el ADN y se hereda con él. Todos los organismos contienen información que les permite coordinar sus procesos. Esta información, a fin de poder ser transferida a la descendencia, esta asentada en una molécula capaz de replicarse,

Más detalles

Ácidos nucleicos: ADN y ARN

Ácidos nucleicos: ADN y ARN Unidad I Genética Ácidos nucleicos: ADN y ARN Definición Los ácidos nucleicos son compuestos orgánicos constituidos por unidades llamadas nucleótidos. Su función principal es transmitir las características

Más detalles

DIAGNÓSTICO GENÉTICO DE LA HIPERCOLESTEROLEMIA FAMILIAR POR RFLP Ref.PCRCOLEST(4 prácticas)

DIAGNÓSTICO GENÉTICO DE LA HIPERCOLESTEROLEMIA FAMILIAR POR RFLP Ref.PCRCOLEST(4 prácticas) DIAGNÓSTICO GENÉTICO DE LA HIPERCOLESTEROLEMIA FAMILIAR POR RFLP Ref.PCRCOLEST(4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios

Más detalles

GENES Y MANIPULACIÓN GENÉTICA

GENES Y MANIPULACIÓN GENÉTICA GENES Y MANIPULACIÓN GENÉTICA El ADN, material de los genes La información que controla la aparición de los caracteres hereditarios se localiza en el interior del núcleo celular y se transmite de célula

Más detalles

ADN, ARN E INFORMACIÓN

ADN, ARN E INFORMACIÓN ADN, ARN E INFORMACIÓN LOS ÁCIDOS NUCLEICOS Los ácidos nucleicos fueron descubiertos en 1869 por Miescher, en el pus de los vendajes de heridas, pero su papel en la herencia y control de la actividad celular

Más detalles

CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015

CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 DEFINICIÓN PCR: Constituye la técnica más importante para amplificar ácidos nucleicos in vitro. Ambas hebras del DNA de interés son replicadas

Más detalles

III. Material genético. b. Composición y estructura del RNA.

III. Material genético. b. Composición y estructura del RNA. III. Material genético b. Composición y estructura del RNA. RNA (ácido ribonucléico) Polímero de nucleótidos La pentosa de los nucleótidos es la Ribosa: en la posición 2' del anillo del azúcar hay un grupo

Más detalles

7/13/2009. Breve introducción a la biología molecular y sus aplicaciones. Victoria koala. Queensland koala. Morfología vs. ADN? Phascolarctus cinereus

7/13/2009. Breve introducción a la biología molecular y sus aplicaciones. Victoria koala. Queensland koala. Morfología vs. ADN? Phascolarctus cinereus Morfología vs. ADN? Phascolarctus cinereus Queensland koala Victoria koala New South Wales koala 3 subespecies Morfológicamente: Diferencias en tamaño y color principalmente Molecularmente: Un grupo dividido

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

SESIÓN 7 DUPLICACIÓN Y TRANSMISIÓN DE LA INFORMACIÓN CONTENIDA EN EL ADN

SESIÓN 7 DUPLICACIÓN Y TRANSMISIÓN DE LA INFORMACIÓN CONTENIDA EN EL ADN SESIÓN 7 DUPLICACIÓN Y TRANSMISIÓN DE LA INFORMACIÓN CONTENIDA EN EL ADN I. CONTENIDOS: 1. Centro de control celular. 2. ADN: su estructura y función. 3. ADN y síntesis proteica. II. OBJETIVOS: Al término

Más detalles

BIOMOL-EXOME: Secuenciación y Análisis Bioinformático de Exoma Humano para la detección de enfermedades de origen genético.

BIOMOL-EXOME: Secuenciación y Análisis Bioinformático de Exoma Humano para la detección de enfermedades de origen genético. BIOMOL-EXOME: Secuenciación y Análisis Bioinformático de Exoma Humano para la detección de enfermedades de origen genético. Biomol-Informatics SL BIOMOL-EXOME es un servicio de Biomol-Informatics, compañía

Más detalles

Genómica y transcriptómica para la generación de datos en Evolución

Genómica y transcriptómica para la generación de datos en Evolución recuadro Genómica y transcriptómica para la generación de datos en Evolución Gabriela Bedó Genómica. Sus objetivos Compilar todas las secuencias de un organismo Establecer la localización de los genes

Más detalles

Técnicas descritas en el curso 7.28

Técnicas descritas en el curso 7.28 Técnicas descritas en el curso 7.28 Técnica: Clase 1 Experimento de incorporación de dntps Ensayo de extensión del cebador Ensayo de unión en filtro Electroforesis en gel Análisis de ADN Helicasa Polaridad

Más detalles

Tema 17: PROCESAMIENTO POST-TRANSCRIPCIONAL

Tema 17: PROCESAMIENTO POST-TRANSCRIPCIONAL Tema 17: PROCESAMIENTO POST-TRANSCRIPCIONAL Tipos de ARN: ARNm, ARNr, ARNt, ARNhn, ARNsn, ARNsc Procesamiento en procariotas Procesamiento en eucariotas ARNm: Adición de caperuza y poli(a) Edición Splicing

Más detalles

Preguntas de selectividad en Andalucía. Ácidos nucleicos. Análisis e interpretación de imágenes, esquemas, figuras...

Preguntas de selectividad en Andalucía. Ácidos nucleicos. Análisis e interpretación de imágenes, esquemas, figuras... Año 2001 Describa las funciones más relevantes de los nucleótidos. Cite un ejemplo de nucleótido que participe en cada una de ellas [1,5]. Explique las funciones de los distintos tipos de RNA que participan

Más detalles

Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares. Técnicas Moleculares. Técnicas Moleculares 8/13/13

Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares. Técnicas Moleculares. Técnicas Moleculares 8/13/13 8/13/13 Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares CAF516 O Recursos Genéticos y Biotecnología 14 Agosto 2013 Técnicas Moleculares Aplicaciones en muchas disciplinas Generan

Más detalles

Diagnóstico microbiológico de la infección por HIV

Diagnóstico microbiológico de la infección por HIV Diagnóstico microbiológico de la infección por HIV Juan Carlos Rodríguez Díaz S. Microbiología Hospital General Universitario de Alicante E-mail: rodriguez_juadia@gva.es http://microbiología-alicante.umh.es

Más detalles

PROPUESTA DE TRABAJO PARA LA ACTUALIZACIÓN Y ARMONIZACIÓN DE

PROPUESTA DE TRABAJO PARA LA ACTUALIZACIÓN Y ARMONIZACIÓN DE SEMANA 2 3 PROPUESTA DE TRABAJO PARA LA ACTUALIZACIÓN Y ARMONIZACIÓN DE CONTENIDOS Y TIEMPOS EN LAS ASIGNATURAS DEL DEPARTAMENTO DE CIENCIAS BASICAS DEL PROGRAMA DE MEDICINA - FACULTAD CIENCIAS DE LA SALUD

Más detalles

1) a) En la figura señale, englobando con un trazo continuo, lo siguiente:

1) a) En la figura señale, englobando con un trazo continuo, lo siguiente: CÁTEDRA: BIOQUÍMICA Carreras: Farmacia Profesorado en Química Licenciatura en Química Licenciatura en Alimentos ÁCIDOS NUCLEICOS 1) a) En la figura señale, englobando con un trazo continuo, lo siguiente:

Más detalles

Curs de genètica aplicada a Medicina Fetal

Curs de genètica aplicada a Medicina Fetal Curs de genètica aplicada a Medicina Fetal MA Sánchez Durán Diciembre 2015 Introducción Detección de defectos congénitos Desarrollo Genética 2 7 7 Infecciones Monogénicos 55 25 Cromosómicos Poligénico

Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

cromátidas centrómero cromosoma

cromátidas centrómero cromosoma núcleo en interfase fibra de cromatina cromátidas centrómero cromosoma 2n = 46 cromátidas cromosomas homólogos Los genes están formados por genes alelos segmentos de ADN y se encuentran situados en los

Más detalles

Bases moleculares y estudios genéticos

Bases moleculares y estudios genéticos II Jornada Genética Clínica para Médicos de Familia Bases moleculares y estudios genéticos María García-Barcina Unidad de Genética del H. Universitario de Basurto Osakidetza Sede SVMFIC Valencia, 2 de

Más detalles

Tema 8. Funcionamiento del DNA (I)

Tema 8. Funcionamiento del DNA (I) Tema 8. Funcionamiento del DNA (I) Genética CC. Mar 2004-05 Objetivos Transcripción RNAs y procesamiento Genética CC Mar 2004/5 D. Posada, Universidad de Vigo 2 1 Dogma Central de la Biología Molecular

Más detalles

AMINOÁCIDOS SE PUEDEN UNIR POR ENLACES PEPTÍDICOS

AMINOÁCIDOS SE PUEDEN UNIR POR ENLACES PEPTÍDICOS Tema 4. Proteínas: funciones biológicas y estructura primaria. Enlace peptídico. Péptidos y proteínas. Diversidad de funciones biológicas. Niveles de organización estructural de las proteínas. Separación

Más detalles

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles

DIAGNÓSTICO GENÉTICO DEL CÁNCER HEREDITARIO Ref.PCRCAN(4 prácticas)

DIAGNÓSTICO GENÉTICO DEL CÁNCER HEREDITARIO Ref.PCRCAN(4 prácticas) DIAGNÓSTICO GENÉTICO DEL CÁNCER HEREDITARIO Ref.PCRCAN(4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción

Más detalles

1. Motivación. 2. Introducción. Universidad Técnica Federico Santa María Departamento de Informática Campus Santiago

1. Motivación. 2. Introducción. Universidad Técnica Federico Santa María Departamento de Informática Campus Santiago Universidad Técnica Federico Santa María Departamento de Informática Campus Santiago Classification of Normal and Tumor Colon Tissues Using Linear Classifiers and Microarray Data Análisis Inteligente de

Más detalles

Reacción en cadena de la Polimerasa (PCR)

Reacción en cadena de la Polimerasa (PCR) Explicación de TP Nº 2 Reacción en cadena de la Polimerasa (PCR) Química Biológica Patológica Dra. Mariana L. Ferramola Dra. Gabriela Lacoste 2015 Definición de PCR Es la amplificación enzimática de un

Más detalles

PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH

PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH Blga. Gisely Hijar Guerra Coordinación del Laboratorio de Biotecnología y Biología Molecular. Responsable de los Procesos de la Prueba

Más detalles

Genética molecular (II)

Genética molecular (II) Genética molecular (II) ESTRUCTURA DE UN GEN Cada molécula de ADN está formada por una sucesión de genes. Desde un punto de vista molecular un gen es una unidad de transcripción (desde el punto de vista

Más detalles

- Clonar un gen (molde ADN o ARN)

- Clonar un gen (molde ADN o ARN) APLICACIONES PCR Aplicaciones de la PCR - Clonar un gen (molde ADN o ARN) - Secuencia conocida - Genes homólogos en especies próximas (primers degenerados) - Información de secuencia proteica (primers

Más detalles

Cultura Cientí fica 1 Bachillerato

Cultura Cientí fica 1 Bachillerato Cultura Cientí fica 1 Bachillerato 3. La revolución genética: biotecnología Actividades de consolidación 1. Cualquier molécula de ADN formada por la unión de segmentos de ADN de origen diferente es: a)

Más detalles

Técnicas de Biología Molecular. Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO

Técnicas de Biología Molecular. Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO Técnicas de Biología Molecular Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO 2004 Extracción de ácidos nucleicos o o DNA RNA Tipos de Muestras Sangre total (EDTA) Saliva Líquido Amniótico Bulbo

Más detalles

Qué sabemos de la naturaleza física del gen?

Qué sabemos de la naturaleza física del gen? LAS BASES MOLECULARES DE LA HERENCIA - Genes como entidades abstractas - Se duplican y pasan a la generación siguiente - De algún modo controlan los caracteres hereditarios HERENCIA DE LOS GENES ANÁLISIS

Más detalles

Practica la genética Ficha didáctica del profesorado Bachillerato

Practica la genética Ficha didáctica del profesorado Bachillerato Ficha didáctica del profesorado Bachillerato www.eurekamuseoa.es Extracción de ADN Cuál es la función de cada uno de los ingredientes utilizados para realizar la disolución tampón para la visualización

Más detalles

LOS RETOS DE LA BIOMEDICINA: ENTRE LA CIENCIA Y LA ÉTICA

LOS RETOS DE LA BIOMEDICINA: ENTRE LA CIENCIA Y LA ÉTICA AULA DE MAYORES Y DE LA EXPERIENCIA F.Córdoba, R.Torronteras, A.Canalejo Departamento de Biología Ambiental y Salud Pública LOS RETOS DE LA BIOMEDICINA: ENTRE LA CIENCIA Y LA ÉTICA Tema 1.3. Los sistemas

Más detalles

Comprendiendo una enfermedad hereditaria: Conceptos básicos de genética.

Comprendiendo una enfermedad hereditaria: Conceptos básicos de genética. Comprendiendo una enfermedad hereditaria: Conceptos básicos de genética. Dras. Mª Carmen Valero y Concepción Hernández-Chico C/Reina, 7 28004 Madrid (ESPAÑA) Comprendiendo una enfermedad hereditaria: Conceptos

Más detalles

CAPÍTULO VI. Expresión de genes relacionados con apoptosis

CAPÍTULO VI. Expresión de genes relacionados con apoptosis CAPÍTULO VI Expresión de genes relacionados con apoptosis 1.- Introducción 2.- Protocolos para análisis genéticos 3.- Resultados en MCF-7 4.- Discusión 1.- Introducción Como se ha descrito anteriormente,

Más detalles

Reacción en cadena de la polimerasa (PCR)

Reacción en cadena de la polimerasa (PCR) Dr. Alejandro Leal Reacción en cadena de la polimerasa (PCR) La reacción en cadena de la polimerasa (PCR, por sus siglas en inglés de "polymerase chain reaction") es un método de amplificación in vitro

Más detalles

TEMA 4: DEL DESCUBRIMIENTO DE LOS ÁCIDOS NUCLEICOS A LA BIOTECNOLOGÍA

TEMA 4: DEL DESCUBRIMIENTO DE LOS ÁCIDOS NUCLEICOS A LA BIOTECNOLOGÍA TEMA 4: DEL DESCUBRIMIENTO DE LOS ÁCIDOS NUCLEICOS A LA BIOTECNOLOGÍA EL ADN, LA MOLÉCULA DE LA HERENCIA El ADN (ácido desoxirribonucleico) es la molécula portadora de la información genética que forma

Más detalles

PREGUNTAS TEST CORRESPONDIENTES A LOS TEMAS 1 AL 5

PREGUNTAS TEST CORRESPONDIENTES A LOS TEMAS 1 AL 5 PREGUNTAS TEST CORRESPONDIENTES A LOS TEMAS 1 AL 5 Las preguntas de test que le adjuntamos corresponden a exámenes de las últimas convocatorias. Una vez que finalicen el estudio de los cinco primeros capítulos,

Más detalles

Investigación en genes. Tecnología del ADN recombinante

Investigación en genes. Tecnología del ADN recombinante Investigación en genes Tecnología del ADN recombinante Tecnología del ADN recombinante 1º parte: Conocimientos básicos que posibilitaron su desarrollo 2º parte: Instrumentos básicos 3º parte Ejemplos Conocimientos

Más detalles

3.- TECNOLOGIA EN EL DIAGNOSTICO MOLECULAR

3.- TECNOLOGIA EN EL DIAGNOSTICO MOLECULAR 3.- TECNOLOGIA EN EL DIAGNOSTICO MOLECULAR 3.1.- INTRODUCCIÓN Pocas áreas de la Biología Molecular han permanecido inalteradas con la aparición de una serie de técnicas englobadas dentro del término genérico

Más detalles

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR)

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) Centro de de Microscopía Electrónica Facultad de de Ciencias Médicas Universidad Nacional de de Córdoba

Más detalles

Bases moleculares de la herencia

Bases moleculares de la herencia Bases moleculares de la herencia I. Que moléculas son las portadoras de la información hereditaria? III. Como se preserva y trasmite la información hereditaria? V. Como se expresa esta información. Dogma

Más detalles

el ARN heterogéneo nuclear que cumple diferentes funciones en el núcleo de las células.

el ARN heterogéneo nuclear que cumple diferentes funciones en el núcleo de las células. Tema 4.- Genética microbiana. Elementos genéticos bacterianos. Transferencia horizontal de material genético en microorganismos: transformación, conjugación y transducción. Elementos genéticos de los virus.

Más detalles

Práctico: Genética bacteriana 2007.

Práctico: Genética bacteriana 2007. Práctico: Genética bacteriana 2007. Actividad integrada Departamento de Genética Departamento de Bacteriología y Virología. OBJETIVOS Objetivos generales El estudiante al terminar la actividad práctica

Más detalles

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática.

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Departamento de Bioquímica Médica y Biología Molecular Práctica 3 Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Curso 1 Medicina (Abril) 2012 BIOQUÍMICA

Más detalles

Enfermedades asociadas a mutaciones estructurales

Enfermedades asociadas a mutaciones estructurales Enfermedades asociadas a mutaciones estructurales El cariotipo humano A partir de un cultivo de sangre periférica, y posterior tratamiento con Giemsa para obtener un bandeo G, puede obtenerse el cariotipo

Más detalles

TEMA 5 TEMA 6. 7. La célula tiene que saber la ruta a emplear en cada momento, cómo regula estos procesos de manera primaria?.

TEMA 5 TEMA 6. 7. La célula tiene que saber la ruta a emplear en cada momento, cómo regula estos procesos de manera primaria?. TEMA 1 1. El agua es uno de los principales elementos de los seres vivos, por qué es tan importante?. 2. Las proteínas son polímeros de aminoácidos, cuáles son las características básicas de los aminoácidos

Más detalles

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles

GENÉTICA: Herencia, Expresión génica, Replicación, biotecnología Selectividad: herencia

GENÉTICA: Herencia, Expresión génica, Replicación, biotecnología Selectividad: herencia GENÉTICA: Herencia, Expresión génica, Replicación, biotecnología Selectividad: herencia 5 JUN9.- Existen caracteres que no se comportan típicamente como los Mendelianos y sus patrones de herencia muestran

Más detalles

Microbiología General 2006-2007. Tema 5: Transmisión de la información genética

Microbiología General 2006-2007. Tema 5: Transmisión de la información genética Microbiología General 2006-2007 Tema 5: Transmisión de la información genética Transmisión de la información genética Reparto del material genético en procariontes y eucariontes. Transferencia horizontal

Más detalles

ANIMALES TRANSGENICOS

ANIMALES TRANSGENICOS ANIMALES TRANSGENICOS KNOCK-OUT: disrupción o deleción de un gen o de un dominio funcional del mismo KNOCK-IN: introducción de modificaciones en un gen o de otro gen heterólogo * APLICACIONES Mecanismos

Más detalles

Técnicas moleculares.

Técnicas moleculares. Técnicas moleculares. DMTV Carolina Acevedo Curso de Microbiología 2015 SÍNTESIS IN VITRO DE UNA GRAN CANTIDAD DE COPIAS DE UN SEGMENTO DE ADN EXISTENTE EN UNA MUESTRA. O sea. Amplificamos en forma exponencial

Más detalles

El fin de estas Recomendaciones sobre Portadoras en Hemofilia, es hacer una puesta al día sobre distintos aspectos de este colectivo.

El fin de estas Recomendaciones sobre Portadoras en Hemofilia, es hacer una puesta al día sobre distintos aspectos de este colectivo. INTRODUCCIÓN La Hemofilia es una enfermedad hereditaria, ligada al cromosoma X, causada por una alteración en los genes F8 o F9 que producen, respectivamente, el factor VIII (FVIII) y el factor IX (FIX)

Más detalles

Anillamiento Asociación de dos cadenas de ácido nucleico (ADN o ARN) complementarias para formar una doble hélice.

Anillamiento Asociación de dos cadenas de ácido nucleico (ADN o ARN) complementarias para formar una doble hélice. GLOSARIO DE PATOLOGÍA MOLECULAR ADNc (ADN complementario) ADN sintetizado por el enzima transcriptasa inversa usando el ARNm (ARN mensajero) como molde, ya sea experimentalmente o in vivo. El producto

Más detalles

CURSO DE PRIMAVERA PATOLOGÍA MOLECULAR DEL CÁNCER

CURSO DE PRIMAVERA PATOLOGÍA MOLECULAR DEL CÁNCER CURSO DE PRIMAVERA PATOLOGÍA MOLECULAR DEL CÁNCER Conceptos básicos sobre ADN y ARN Técnicas de amplificación (PCR y variantes) Aplicaciones principales Dr. Juan C. Cigudosa Madrid 29 y 30 de mayo, 2014

Más detalles

EDICIÓN EDICIÓN Nº 123

EDICIÓN EDICIÓN Nº 123 Síntesis de proteínas Colágeno, insulina, hemoglobina, bilirrubina resultan nombres conocidos. Son proteínas que forman parte de la vida cotidiana. De hecho, son uno de los componentes principales de las

Más detalles

BIOQUÍMICA-1º de Medicina Dpto. Biología Molecular Isabel Andrés. Generalidades sobre la transcripción

BIOQUÍMICA-1º de Medicina Dpto. Biología Molecular Isabel Andrés. Generalidades sobre la transcripción . Síntesis y maduración del RNA. Tipos y estructuras de RNAs. RNA polimerasas en los organismos procariotas y eucariotas. Promotores. Mecanismo de iniciación de la transcripción. Elongación. Terminación.

Más detalles

NIVELES DE ORGANIZACIÓN DEL ADN.

NIVELES DE ORGANIZACIÓN DEL ADN. TEMA 4. Modos de información genética. Acidos nucleicos: ADN y ARN. Estructura polarizada del ADN. Cromatina, cromosomas, gen, cistrón, genotipo y fenotipo. Duplicación semiconservativa de la información

Más detalles

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA BIOLOGIA MOLECULAR Hemos elaborado un programa en 3 niveles, en función del tipo de estudiante y las posibilidades del centro educativo: 1. NIVEL BASICO 2. NIVEL MEDIO DANAEXTRACTOR KIT Práctica que constituye

Más detalles

Capítulo 24. Replicación, Transcripción y Traducción

Capítulo 24. Replicación, Transcripción y Traducción Capítulo 24. Replicación, Transcripción y Traducción El dogma central de la Biología involucra esencialmente la duplicación del ADN, la transcripción de la información contenida en el ADN en forma de ARN

Más detalles

Genética de las ENACH

Genética de las ENACH Genética de las ENACH FORMA CLÍNICA GEN FORMA CLÍNICA GEN Neurodegeneración asociada a Neurodegeneración asociada a PANK2 pantotenato quinasa (PKAN) proteína beta -propeller (BPAN) WDR45 Neurodegeneración

Más detalles

P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA"

P.C.R. Técnica de amplificación enzimática de secuencias específicas de DNA P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA" Paso 1: Desnaturalización del DNA Paso 2: Hibridación de los "Primers" Paso 3: Extensión Paso 1: Desnaturalización del DNA

Más detalles

Estrategia y métodos de diagnóstico

Estrategia y métodos de diagnóstico "El diagnóstico de las enfermedades hereditarias Dr. Joan Fibla Palazón Departament de Ciències Mèdicas Bàsiques Facultat de Medicina Universitat de Lleida Introducción El diagnóstico de las enfermedades

Más detalles

CAPÍTULO III. Metodología e instrumentación de análisis celular

CAPÍTULO III. Metodología e instrumentación de análisis celular CAPÍTULO III Metodología e instrumentación de análisis celular 1.- Hemocitómetro y test de exclusión de colorante Trypan blue 2.- Citometría de flujo 3.- PCR 4.- Electroforesis en gel 5.- Secuenciación

Más detalles

Oferta tecnológica: Método para detectar inserciones de espaciadores en estructuras CRISPR

Oferta tecnológica: Método para detectar inserciones de espaciadores en estructuras CRISPR Oferta tecnológica: Método para detectar inserciones de espaciadores en estructuras CRISPR Oferta tecnológica: Método para detectar inserciones de espaciadores en estructuras CRISPR. RESUMEN Las repeticiones

Más detalles

Patrones de Herencia. Dra. María José Suárez Dra. Mariela Solano

Patrones de Herencia. Dra. María José Suárez Dra. Mariela Solano Patrones de Herencia Dra. María José Suárez Dra. Mariela Solano Árbol Genealógico Obtención de información sobre la historia familiar Historia natural, variaciones de expresión y patrón de herencia Diagrama

Más detalles

TEMA 4: LA REVOLUCIÓN GENÉTICA

TEMA 4: LA REVOLUCIÓN GENÉTICA TEMA 4: LA REVOLUCIÓN GENÉTICA 1. Introducción Los seres vivos son capaces de hacer copias de sí mismos, de tal modo que los hijos heredan los caracteres de sus padres. Para lograrlo a) Deben almacenar

Más detalles

PCR. Qué es la PCR? T a de fusión de oligonucleótidos (t m )

PCR. Qué es la PCR? T a de fusión de oligonucleótidos (t m ) % a de fusión de oligonucleótidos (t m ) Qué es la PCR? La reacción en cadena de la polimerasa (PCR: polymerase chain reaction) es una técnica de amplificación de secuencias de DNA in vitro t m = 2 (A

Más detalles

Bioquímica III- 2009

Bioquímica III- 2009 Facultad de Ciencias Exactas, Universidad Nacional de La Plata Bioquímica III- 2009 Trabajo Práctico Nro 4 Extracción de RNA y DNA bacteriano INTRODUCCIÓN El RNA es el ácido nucleico más abundante en la

Más detalles

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante BIOTECNOLOGÍA 1.- Ingeniería Genética, ADN recombinante Técnica del ADN recombinante: es la más usada en ingeniería genética, esta basada en el uso de las enzimas de restricción o endonucleasas de restricción

Más detalles

PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN DE LAS COMPETENCIAS PROFESIONALES CUESTIONARIO DE AUTOEVALUACIÓN PARA LAS TRABAJADORAS Y TRABAJADORES

PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN DE LAS COMPETENCIAS PROFESIONALES CUESTIONARIO DE AUTOEVALUACIÓN PARA LAS TRABAJADORAS Y TRABAJADORES MINISTERIO DE EDUCACIÓN SECRETARÍA DE ESTADO DE EDUCACIÓN Y FORMACIÓN PROFESIONAL DIRECCIÓN GENERAL DE FORMACIÓN PROFESIONAL INSTITUTO NACIONAL DE LAS CUALIFICACIONES PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN

Más detalles

Electroforesis en gel de poliacrilamida y electrotransferencia

Electroforesis en gel de poliacrilamida y electrotransferencia Electroforesis en gel de poliacrilamida y electrotransferencia INDICE ELECTROFORESIS Fundamento y características Tipos de electroforesis: libre y de zona Electroforesis en papel, acetato de celulosa Electroforesis

Más detalles

Tema 11. Herramientas de la genética molecular

Tema 11. Herramientas de la genética molecular Tema 11. Herramientas de la genética molecular Genética CC. Mar 2004-05 Objetivos Técnicas de clonación Construcción de genotecas e identificación de secuencias Mapas de restricción Amplificación (PCR)

Más detalles

MODELO BIOLOGÍA 2º PARCIAL 54

MODELO BIOLOGÍA 2º PARCIAL 54 1) Durante la profase mitótica, una célula humana presenta: a. 92 moléculas de ADN (46 cromosomas de 2 cromátides cada uno). b. 46 moléculas de ADN (46 cromosomas de 1 cromátide cada uno). c. 46 moléculas

Más detalles

Metodologías básicas del procesamiento de Proteinas

Metodologías básicas del procesamiento de Proteinas Metodologías básicas del procesamiento de Proteinas Alejandra Kun Departamento de Proteínas y Ácidos Nucleicos-IIBCE Unidad Asociada Sección Bioquímica Facultad de Ciencias 13 de octubre 2014 Curso Introducción

Más detalles

ELECTROFORESIS WESTERN BLOT ELISA

ELECTROFORESIS WESTERN BLOT ELISA ELECTROFORESIS WESTERN BLOT ELISA INTEGRANTES: Arguelles, Rocío Assandri, Matías Almirón, Marianela Buonanduci, Facundo Gómez, Alan Miller, Florencia López, Rocío Vidal, Sol Sillingardi, Leonardo Soria,

Más detalles

Tecnologías basadas en el ADN

Tecnologías basadas en el ADN Tecnologías de marcadores moleculares para estudios de diversidad genética de plantas: Módulo de aprendizaje Tecnologías basadas en el ADN Fundamentos del ADN Derechos de Autor: IPGRI y Cornell University,

Más detalles

Medicina y Biología Molecular y Celular

Medicina y Biología Molecular y Celular Medicina y Biología Molecular y Celular Molecular Cell Biology is at the center of Modern Medicine Diseases such as cancer, heart disease, diabetes and arthritis all involve molecules and/or cells that

Más detalles