SI TIENES UN SUEÑO INVESTIGA COMO CONSEGUIRLO

Tamaño: px
Comenzar la demostración a partir de la página:

Download "SI TIENES UN SUEÑO INVESTIGA COMO CONSEGUIRLO"

Transcripción

1 Prevalencia de Polimorfismos Naturales en el Dominio 1 de la Proteína NS5A Asociados con Resistencia al Inhibidor de la NS5A, BMS-052, en Pacientes Coinfectados VIH/VHC SI TIENES UN SUEÑO INVESTIGA COMO CONSEGUIRLO Modalidad: Medicina-sanitaria

2 RESUMEN La proteína NS5A del virus de la hepatitis C (VHC), representa una nueva diana terapéutica dentro de los nuevos Agentes Antivirales de acción Directa (DAA) frente a la infección por el VHC. Actualmente, existen diferentes inhibidores de la proteína NS5A en desarrollo. Concretamente, BMS-052 es un inhibidor que se encuentra en fases avanzadas de su desarrollo clínico y ha demostrado una potente actividad antiviral frente pacientes infectados por el genotipo 1 del VHC. La infección por el VHC se caracteriza por presentar una extraordinaria variabilidad genética, debido fundamentalmente a los errores de transcripción de la ARN-polimerasa ARN-dependiente y a la falta de actividad correctora de copia de esta polimerasa. Teniendo en cuenta estas características, el objetivo de este estudio fue evaluar la prevalencia de polimorfismos naturales asociados con resistencia al inhibidor de la proteína NS5A, BMS-052, en el dominio 1 de la proteína NS5A en los diferentes genotipos/subtipos del VHC en pacientes coinfectados VIH/VHC. Se seleccionaron pacientes coinfectados VIH/VHC en seguimiento en nuestra institución, que fueran naïve a INF-Peg/RBV o a cualquier DAA. A partir del plasma de los pacientes se amplificó y se secuenció el dominio 1 de la NS5A (213pb) utilizando oligonucleótidos específicos para cada genotipo/subtipo del VHC. A continuación, se examinaron las mutaciones de resistencias seleccionadas in vitro en variantes genotipo 1a y 1b del VHC después de la exposición al inhibidor BMS-052 (M28T, Q30H/R, L31F/M/V, P32L and Y93C/H/N). 1

3 Se identificaron un total de 64 muestras de plasma de pacientes coinfectados VIH/VHC que cumplía los criterios de inclusión. La distribución de genotipos fue la siguiente: 51.6% G1a, 6.2% G1b, 29.7% G3a and 12.5% G4. La media de carga viral del ARN- VHC fue 6.3 [IQR: ] log IU/ml y el 67.2% presentaban carga viral indetectable para la infección por VIH (ARN-VIH < 50cop/mL). Ninguna de las secuencias de la proteína NS5A de los pacientes infectados con el genotipo 1a del VHC presentó mutaciones asociadas con resistencia a BMS-052. Sin embargo, en un 7% de las secuencias NS5A de pacientes infectados con el genotipo 1b del VHC se observaron mutaciones asociadas a resistencia a BMS-052: Y93H+L31M. Los pacientes con genotipo 1b del VHC también presentaron otros polimorfismos (L28 y R30) relacionados con resistencia a BMS-052 en el genotipo 1a del VHC. Todas las secuencias de NS5A de genotipo 4 mostraron tres polimorfismos: L28, R30 y M31. Finalmente, los pacientes genotipo 3 sólo presentaron un polimorfismo en la posición 30 (presencia de una alanina-a en lugar de una glutamina-q). En conclusión, en pacientes coinfectados VIH/VHC la prevalencia de resistencias primarias al inhibidor de la proteína NS5A, BMS-052, fueron bajas en pacientes infectados con el genotipo 1b del VHC (7%) y no se observaron en ninguna secuencia de NS5A de pacientes con genotipo 1a del VHC. Sin embargo, se identificaron algunos polimorfismos naturales en genotipos 3 y 4 en posiciones asociadas a resistencia en genotipo 1a (L28, A/R30, M31) ó 1b (H93). Estos resultados sugieren que la actividad antiviral de este inhibidor podría ser dependiente del genotipo/subtipo del VHC, como ya se ha demostrado para otras familias de DAA. 2

4 ANTECEDENTES La prevalencia mundial de la infección por el virus de la hepatitis C (VHC) es aproximadamente de 200 millones de personas en todo el mundo(1). En pacientes coinfectados VIH/VHC, la enfermedad hepática causada por el VHC evoluciona más rápidamente que en los pacientes monoinfectados VHC (2). Sin embargo el uso de la terapia antirretroviral frente al VIH parece mejorar el impacto negativo del VIH sobre el hígado (3,4). A diferencia del VIH, la infección por VHC puede erradicarse. (5,6). Sin embargo, la terapia estándar frente a la infección crónica por VHC, basada en la combinación de Interferón Pegilado α y ribavirina (INF-Peg-α/RBV), está asociada con importantes efectos adversos (depresión, anemia) y con tasas de respuesta virológica sostenidas (SVR) limitadas. Estas tasas de respuesta representan el 50% en pacientes infectados con genotipos 1 y 4 del VHC y del 85% para los genotipos 2 y 3 (7,8). Los avances en biología molecular han permitido el diseño y desarrollo clínico de diferentes moléculas, cuyas dianas terapéuticas son proteínas virales específicas del ciclo del VHC (proteasa NS3/4A, NS5B polimerasa, NS5A) (11-13). A estas moléculas se les llama colectivamente Agentes Antivirales de Acción Directa (Directly Acting Antivirals Agents, DAA). Recientemente, la FDA (Food and Drug Administration) ha aprobado dos inhibidores de la proteasa del VHC, Telaprevir y Boceprevir, que se comercializarán bajo el nombre de Incivek y Victrelis respectivamente, para su uso clínico. Además, actualmente existen otros DAA que se encuentran en fases avanzadas de desarrollo clínico que actúan frente a diferentes dianas terapéuticas dentro del ciclo de replicación del VHC (12,14). 3

5 Los resultados de los ensayos clínicos presentados hasta el momento han demostrado la potente actividad de estos nuevos DAA, pero al mismo tiempo han puesto de manifiesto la extraordinaria capacidad del VHC para el rápido desarrollo de mutaciones de resistencias a estos fármacos. (15,16). De manera que el desarrollo de resistencias se presenta como una de las principales limitaciones del tratamiento con estas nuevas moléculas. La terapia combinada utilizando fármacos capaces de bloquear diferentes dianas del ciclo de replicación podría ser una posible estrategia para evitar el rápido desarrollo de resistencias a estos fármacos. Recientemente se ha descrito una nueva familia de inhibidores cuya diana es la proteína no estructural NS5A del VHC. La NS5A es una fosfoproteína asociada a membrana, de 447 aminoácidos, formada por 3 dominios (17). El dominio I (213 aa.) en la región N- terminal, que contiene en su estructura un dominio de unión a zinc (18) y a RNA (19), dominio II ( aa.), en el que existe una zona conocido como ISDR (región sensible a Interferon) y dominio III ( aa.) en la región C-terminal. Presenta una forma basal fosforilada (p56) y una forma hiperfosforilada (p58)(20,21). No se le conoce actividad enzimática. Se cree que puede jugar un papel importante en las altas tasas de replicación de VHC-RNA, puesto que varias mutaciones adaptativas que confieren alta eficiencia en la replicación se encuentran en la NS5A, y algunas de estas mutaciones se ha visto que afectan a la hiperfosforilación de NS5A. De la misma manera NS5A es un componente esencial en el complejo de replicación VHC (CR). (Figura 1), además interacciona con un gran número de proteínas del huésped y está implicada en la resistencia a interferón in vivo (19,22). Actualmente se desconocen los mecanismos específicos mediante los cuales la proteína NS5A realiza estas funciones. 4

6 En los últimos años se ha avanzado en el conocimiento sobre la estructura y funciones del dominio N terminal de la proteína. Se sabe que el papel de los aminoácidos del 1 al 30 es servir de anclaje a la membrana, dirigiendo a la NS5A hacia un compartimento derivado de membranas del retículo endoplasmático, que se ha postulado como el sitio de replicación del VHC (23-25). BMS-052 es una molécula nueva de pequeño tamaño, que inhibe al dominio 1 de la NS5A, de unión a zinc y a RNA y que actúa inhibiendo la hiperfosforilación de la NS5A. Este inhibidor ha demostrado tener una actividad muy potente en todos los genotipos examinados, con unos valores de EC 50 de pm, como se muestra en la tabla 1. La actividad antiviral de BMS-052 se demostró en un ensayo fase I realizado en pacientes con hepatitis crónica C con genotipo 1 que experimentaron descensos de hasta 3.3 log en la carga viral del VHC 24 horas después de la administración de 100mg de BMS-052. Este descenso se mantuvo durante 140 horas (26) (Figura 2). Esta gran actividad antiviral se ve reforzada por la estructura simétrica de la molécula (Figura 3)(27). Posteriormente, en ensayos clínicos en fase II, en los que se ha combinado BMS-052 con otros antivirales contra VHC, el inhibidor ha demostrado tener efectos aditivos/ sinérgicos con el interferon-α /ribavirina, con el inhibidor de la proteasa BMS-032, y con los inhibidores de la polimerasa NS5B tanto análogos y como no análogos de nucleósidos. Estos resultados demuestran el potencial de la molécula para su uso en terapia en combinación con otros agentes antivirales contra el VHC(28). 5

7 La resistencia BMS-052 se caracteriza por la selección de mutaciones en el dominio N- terminal de la NS5A entre los residuos y 93 (Tabla 2), lo que indica que el inhibidor podría actuar interrumpiendo una función desconocida del dominio N- terminal de la NS5A, requerida para la interacción con otras proteínas no estructurales o factores del huésped (27,29). La infección por el VHC se caracteriza por presentar una gran heterogeneidad genética. A esto contribuye la alta tasa de producción diaria de viriones, y la alta tasa de mutación debida a la falta de función correctora de errores de la ARN-polimerasa ARNdependiente. Esta heterogeneidad genética hace que hasta el momento se hayan identificado 6 genotipos diferentes para el VHC, con una homología del 60-70%, y dentro de ellos, en diferentes subtipos, con homología del 78-88% (9)(Simmonds 1993). La distribución de los genotipos varía geográficamente. Los genotipos 1, 2 y 3 se presentan de manera mundial, mientras que el genotipo 4 se localiza preferentemente en África y Oriente Medio, el genotipo 5 en África y el genotipo 6 en el Sudeste asiático (10)(Simmonds 2004). Como ya se ha demostrado en otras familias de DAA, y debido a la alta variabilidad del VHC, la actividad antiviral del inhibidor BMS-052 podría ser dependiente del genotipo/subtipo del VHC. Hasta el momento, los datos sobre la actividad antiviral de este inhibidor se refieren a pacientes VHC monoinfectados. 6

8 OBJETIVO El objetivo del estudio fue: Evaluar la prevalencia de mutaciones naturales en el dominio 1 de la NS5A asociadas con resistencia a BMS-052 en pacientes coinfectados VIH/VHC entre diferentes genotipos y subtipos del VHC y en secuencias NS5A depositadas en la base de datos de Los Alamos. 7

9 PACIENTES Y MÉTODOS Pacientes Se identificaron todos los pacientes coinfectados VIH/VHC en seguimiento en el Hospital Carlos III (Madrid, España) pretratados con INF-peg/RBV y que fueran naïve para cualquier DAA. Extracción de ARN Se extrajo el ARN a partir de 500 µl de suero de los pacientes coinfectados VIH/VHC usando el kit de mini extracción de RNA viral QUIamp (Quiagen, Hamburgo, Alemania) siguiendo las instrucciones del fabricante. Amplificación y secuenciación La carga viral del VIH se determinó mediante el ensayo de Versant 3.0 Bdna (Siemens, Barcelona, España). La viremia del VHC se determinó mediante el ensayo cuantitativo real-time de Abbott (Abbott Laboratorios, Madrid, España). En los pacientes virémicos el genotipo del VHC determinó usando el ensayo de LiPA versión 2.0 (Innogenetics, Gante, Bélgica). Se amplificó y se secuenció el dominio 1 de la región NS5A (213 pb), a partir de plasma y usando oligonucleótidos específicos para cada genotipo y subtipo (Tabla 3). Las condiciones de la RT fueron 48ºC durante 45min, 94ºC,2min, 45ciclos at 94ºC 35s, 53-55ºC durante 30s y 72ºC,1min y 30s, y una fase de extensión a 72ºC,10min. En la nested PCR las condiciones fueron 94ºC durante 3 min, 45 ciclos a 94ºC durante 35s, 53-55ºC, 35s, y 72ºC durante 1 min y 30s, con una fase de extensión final de 72ºC 8

10 durante 10 min. Los amplicones de PCR se purificaron usando el kit de Purificación High Pure PCR (Roche, Mannheim, Alemania) y directamente secuenciados usando el ABI PRISM 3100 Genetyc Analyser usando el kit Terminador de Rodamina de ABI PRISM (Applied Biosystem, Foster City, CA, EEUU) y oligonucleótidos internos para cada región genética. Las secuencias se alinearon y fueron analizadas usando el software SeqScape V2.5 software (Applied Biosystems). 9

11 RESULTADOS Se obtuvieron secuencias de NS5A de 78 pacientes VIH/VHC coinfectados. Las principales características de la población de estudio están resumidas en la Tabla 4. Más de las tres cuartas partes de los pacientes eran hombres con una media de edad de 45 años. Respecto a los parámetros virológicos, la media de carga viral del virus C fue de 6 log [ ]. El 75% de los pacientes estaban en terapia antirretroviral para el VIH y el 80% tenían carga viral indetectable. La distribución de genotipos de la población de estudio se recoge en la figura 4. La prevalencia de mutaciones primarias a BMS-052, se evaluó teniendo en cuenta aquellos cambios de aminoácidos relacionados hasta el momento con resistencia in vitro para genotipo 1a (M28T, Q30R/H, L31M/V, P32L, e Y93C) y genotipo 1b (L31F/V, P32L e Y93H/N) (26). En pacientes infectados con genotipo 1a, no se encontró ninguno de los cambios asociados con resistencia a BMS-052 (Tabla 5). Sin embargo en el resto de genotipos (1b, 3 y 4) si se encontraron cambios en los residuos asociados con resistencias. Así por ejemplo, en los pacientes genotipo 1b, hubo cambios en la posición 28 (Leucina-L en lugar de una Metionina-M en el 100% de los pacientes) y en el residuo 30 donde el 100% de los pacientes presentaban una Arginina-R en lugar de una Glutamina-Q. Además, en un 7% de estos pacientes se encontró un doble mutante L31M+ Y93H asociado con resistencia a BMS-052 en los pacientes genotipo 1b. 10

12 Todos los pacientes genotipo 3 presentaron como único cambio una Alanina-A, en lugar de una Glutamina-Q en la posición 30. Los pacientes infectados con genotipo 4 presentaron el mismo patrón y la misma prevalencia de polimorfismos que en los pacientes de genotipo 1b (L28, R30, M31 y H93), con excepción del cambio Y93H, presente en una proporción ligeramente más alta en los genotipos 4 frente a los 1b (13% vs. 7% respectivamente). La prevalencia de mutaciones asociadas con resistencias a BMS-052, también se evaluaron en secuencias NS5A depositadas en la base de datos de Los Alamos, con el fin de comparar las prevalencias de estos polimorfismos con las observadas en nuestra población de estudio. Se analizaron un total de 635 secuencias NS5A: 153 de genotipo 1a, 155 de genotipo 1b, 282 de genotipo 3 y 45 de genotipo 4. En las 153 secuencias de NS5A de pacientes infectados con genotipo 1a se observó que el 100% de las posiciones estudiadas estaban conservadas al igual que en nuestra población de estudio. En las 155 secuencias NS5A genotipo 1b de Los Alamos, se observó que de forma basal existían polimorfismos en las posiciones 28 (leucina-l en vez de Metionina-M), 30 (arginina-r en lugar de glutamina-q) y en el residuo 31 (Metionina-M en vez de una leucina-l) en un 97.5%, 92.2% y 7% respectivamente. Estas prevalencias son similares a las obtenidas en nuestra población de estudio. Además, se observó la presencia de la mutación Y93H en secuencias NS5A de genotipo 1b con una prevalencia similar a la observada en 78 pacientes coinfectados VIH/VHC incluidos en nuestro estudio (6.1% vs. 7% respectivamente). 11

13 Dentro de las 282 secuencias NS5A genotipo 3 de Los Álamos, un 90.4% tenían un polimorfismo en la posición 30 (cambio de una alanina-a en lugar de un glutámico-q), coincidiendo con la prevalencia encontrada en nuestra población de estudio (100%). Por último, en las 45 secuencias NS5A disponibles de genotipo 4 se observó el mismo patrón de polimorfismos que en las secuencias de genotipo 1b. De la misma forma, las tasas de prevalencia de estas mutaciones fueron similares a las encontradas en nuestra población de estudio, aunque con algunas excepciones. Por ejemplo, mientras que las mutaciones L28 y R30 están representadas en nuestra población de estudio en un 82% y 50% respectivamente, en las secuencias NS5A de Los Álamos, la prevalencia fue del 100% para ambas posiciones. 12

14 DISCUSIÓN El presente estudio evalúa la prevalencia de polimorfismos naturales asociados con resistencia al inhibidor BMS-052 en el dominio 1 de la proteína NS5A del VHC en 78 pacientes VIH/VHC coinfectados, naïve a tratamiento con INF-Peg-α/RBV o con los nuevos DAA. La prevalencia de estas mutaciones de resistencia en las secuencias de NS5A difiere entre los distintos genotipos/subtipos del VHC. Para genotipo 1a, las posiciones asociadas con resistencia (M28, Q30, L31, P32 y Y93) al inhibidor BMS-052 estaban conservadas en todas las secuencias de NS5A. La única mutación asociada con resistencia a BMS-052, fue el cambio Y93H, que se observó en los pacientes infectados con genotipo 1b aunque en una baja proporción (7%). El resto de cambios identificados en pacientes genotipo 1b (R30 y M31), estaban asociados sólo con resistencia a genotipos 1a. Hay que destacar que la mutación Y93H aparece junto con el cambio L31M. A pesar de que en pacientes con genotipo 1b el cambio L31M, confiere una resistencia mínima al inhibidor BMS-052 (incremento de 3- veces), cuando este cambio aparece en combinación con la mutación Y93H, el nivel de resistencia aumenta notablemente (incremento de veces)(29). Por lo tanto, la mutación L31M también podría tener un impacto en la resistencia a BMS-052 en pacientes con genotipo 1b. El 100% de las secuencias de genotipo 3, presentaban un cambio en el residuo 30 de una alanina-a en lugar de una Glutamina-Q mientras que en el 100% de los pacientes 13

15 de genotipo 4 existe una Arginina en esta misma posición. Además existen otros polimorfismos en estos pacientes como son: L28, M31 e H93. Aunque estos polimorfismos están asociados a resistencia en pacientes 1b y/o 1a, hasta el momento no existen datos sobre su posible efecto en la actividad antiviral del inhibidor BMS-052 en pacientes genotipo 3 y 4. Globalmente la prevalencia de los polimorfismos encontrados en las secuencias NS5A de este estudio fue similar a la encontrada en secuencias NS5A de pacientes VHC monoinfectados depositadas en la base de datos de Los Alamos. En resumen, existen polimorfismos naturales asociados a resistencia al inhibidor BMS- 052 de la proteína NS5A del VHC que difieren entre los distintos genotipo/subtipos del VHC. Estos resultados sugieren que la actividad antiviral de este inhibidor podría ser dependiente del genotipo/subtipo del VHC, como ya se ha demostrado para otras familias de DAA. 14

16 CONCLUSIONES No se observaron mutaciones de resistencia primarias en genotipo 1a al inhibidor de la NS5A, BMS-052. La mutación Y93H asociada con resistencia a BMS-052 se encontró en un 7% de los subtipos 1b como polimorfismo natural. Los pacientes con subtipo 1b que presentaban Y93H mostraron también la mutación L31M, asociada con un aumento de la resistencia al inhibidor de la NS5A. Algunos cambios de aminoácidos en posiciones asociadas a resistencia en subtipos 1a (L28, A/R30, M31) o 1b (H93) se han identificado como polimorfismos naturales en genotipos 3 y 4. El impacto de estos polimorfismos en la resistencia a BMS-052 se desconoce hasta el momento. 15

17 BIBLIOGRAFÍA 1. Ray Kim W. Global epidemiology and burden of hepatitis C. Microbes Infect Oct;4(12): Soriano V, Puoti M, Sulkowski M, Cargnel A, Benhamou Y, Peters M, et al. Care of patients coinfected with HIV and hepatitis C virus: 2007 updated recommendations from the HCV-HIV International Panel. AIDS May 31;21(9): Qurishi N, Kreuzberg C, Lüchters G, Effenberger W, Kupfer B, Sauerbruch T, et al. Effect of antiretroviral therapy on liver-related mortality in patients with HIV and hepatitis C virus coinfection. Lancet Nov 22;362(9397): Blanco F, Barreiro P, Ryan P, Vispo E, Martín-Carbonero L, Tuma P, et al. Risk factors for advanced liver fibrosis in HIV-infected individuals: role of antiretroviral drugs and insulin resistance. J. Viral Hepat Ene;18(1): Barreiro P, Labarga P, Martín-Carbonero L, Amor A, Ruiz-Sancho A, Castellares C, et al. Sustained virological response following HCV therapy is associated with non-progression of liver fibrosis in HCV/HIV-coinfected patients. Antivir. Ther. (Lond.). 2006;11(7): Berenguer J, Alvarez-Pellicer J, Martín PM, López-Aldeguer J, Von-Wichmann MA, Quereda C, et al. Sustained virological response to interferon plus ribavirin reduces liver-related complications and mortality in patients coinfected with human immunodeficiency virus and hepatitis C virus. Hepatology Ago;50(2): Hoofnagle JH, Seeff LB. Peginterferon and ribavirin for chronic hepatitis C. N. Engl. J. Med Dic 7;355(23): Pearlman BL. Extended-therapy duration for chronic hepatitis C, genotype 1: the long and the short of it. World J. Gastroenterol Jun 21;14(23):

18 9. Simmonds P, Holmes EC, Cha TA, Chan SW, McOmish F, Irvine B, et al. Classification of hepatitis C virus into six major genotypes and a series of subtypes by phylogenetic analysis of the NS-5 region. J. Gen. Virol Nov;74 ( Pt 11): Simmonds P. Genetic diversity and evolution of hepatitis C virus--15 years on. J. Gen. Virol Nov;85(Pt 11): Moucari R, Marcellin P. Hepatitis C: The role of new interferons in the era of STAT-C. Nat Rev Gastroenterol Hepatol Sep;6(9): Parfieniuk A, Jaroszewicz J, Flisiak R. Specifically targeted antiviral therapy for hepatitis C virus. World J. Gastroenterol Nov 21;13(43): Schinazi RF, Bassit L, Gavegnano C. HCV drug discovery aimed at viral eradication. J. Viral Hepat Feb 1;17(2): De Francesco R, Migliaccio G. Challenges and successes in developing new therapies for hepatitis C. Nature Ago 18;436(7053): Kieffer TL, Kwong AD, Picchio GR. Viral resistance to specifically targeted antiviral therapies for hepatitis C (STAT-Cs). Journal of Antimicrobial Chemotherapy. 2009;65(2): Sarrazin C, Zeuzem S. Resistance to Direct Antiviral Agents in Patients With Hepatitis C Virus Infection. Gastroenterology. 2010;138(2): Tellinghuisen TL, Marcotrigiano J, Gorbalenya AE, Rice CM. The NS5A protein of hepatitis C virus is a zinc metalloprotein. J. Biol. Chem Nov 19;279(47): Tellinghuisen TL, Marcotrigiano J, Rice CM. Structure of the zinc-binding domain of an essential component of the hepatitis C virus replicase. Nature May 19;435(7040):

19 19. Huang Y. Phosphorylation of hepatitis C virus NS5A nonstructural protein: A new paradigm for phosphorylation-dependent viral RNA replication? Virology. 2007;364(1): Kaneko T, Tanji Y, Satoh S, Hijikata M, Asabe S, Kimura K, et al. Production of two phosphoproteins from the NS5A region of the hepatitis C viral genome. Biochem. Biophys. Res. Commun Nov 30;205(1): Tanji Y, Kaneko T, Satoh S, Shimotohno K. Phosphorylation of hepatitis C virus-encoded nonstructural protein NS5A. J. Virol Jul;69(7): Macdonald A, Harris M. Hepatitis C virus NS5A: tales of a promiscuous protein. J. Gen. Virol Sep;85(Pt 9): Brass V, Bieck E, Montserret R, Wölk B, Hellings JA, Blum HE, et al. An amino-terminal amphipathic alpha-helix mediates membrane association of the hepatitis C virus nonstructural protein 5A. J. Biol. Chem Mar 8;277(10): Chevaliez S, Pawlotsky J-M. Hepatitis C virus: virology, diagnosis and management of antiviral therapy. World J. Gastroenterol May 7;13(17): Combet C, Garnier N, Charavay C, Grando D, Crisan D, Lopez J, et al. euhcvdb: the European hepatitis C virus database. Nucleic Acids Res Ene;35(Database issue):d Gao M, Nettles RE, Belema M, Snyder LB, Nguyen VN, Fridell RA, et al. Chemical genetics strategy identifies an HCV NS5A inhibitor with a potent clinical effect. Nature. 2010;465(7294): Lemm JA, O Boyle D, Liu M, Nower PT, Colonno R, Deshpande MS, et al. Identification of Hepatitis C Virus NS5A Inhibitors. Journal of Virology. 2009;84(1):

20 28. Lok A, Gardiner D, Lawitz E, Martorell C, Everson G, Ghalib R. Combination therapy with BMS and BMS alone or with pegifn/rbv results in undetectable HCV RNA through 12 weeks of therapy in HCV genotype 1 null responders. Hepatology (Baltimore, Md.) Fridell RA, Qiu D, Wang C, Valera L, Gao M. Resistance Analysis of the Hepatitis C Virus NS5A Inhibitor BMS in an In Vitro Replicon System. Antimicrobial Agents and Chemotherapy. 2010;54(9):

21 Figura 1: Complejo de replicación VHC 20

22 Tabla 1: BMS-052 ha demostrado una actividad antiviral muy potente en diversos genotipos. Ensayo VHC replicón genotipo 1a, H77 VHC replicón genotipo 1b, Con1 VHC replicón genotipo 2a, JFH VHC replicón genotipo 2a, JFH* VHC replicón genotipo 3a* VHC replicón genotipo 4a* VHC replican genotipo 5a* VHC infeccioso, genotipo 2a,JFH EC50 50 ± 13 pm 9 ± 4 pm 71 ± 17 pm 103 ± 36 pm 146 ± 34 pm 12 ± 4 pm 33 ± 10 pm 28± 24 pm Adaptado de Gao et al., Nature

23 Figura 2: Estudio en fase I donde se representa la media de cambio de log VHC-RNA después de la administración de dosis únicas de BMS-052 a pacientes infectados por VHC. Gao et al., Nature

24 Figura 3: Estructura bioquímica de la molécula BMS-052 Gao et al., Nature

25 Tabla 2: Mutaciones asociadas a resistencia in vitro al inhibidor BMS-052 en genotipo 1a y 1b EC50 fold-change Capacidad de replicación (%) WT 1b replico L31F/V 5/23 146±44/145±44 P32L 17 18±6 Y93H/N 19/28 20±7/21±6 1 a replicón M28T ±23 Q30H/R 1,475/1,237 75±31/41±16 L31M/V 356/3, ±29/11±7 P32L ±5 Y93C 1,864 11±7 Adaptado de Gao et al., Nature 2010; Fridell et al., Antimicrob Agents Chemother

26 Tabla 3. Secuencias de primers empleados en la amplificación de la NS5A específicos para cada genotipo/subtipo GENOTIPO NOMBRE POLARIDAD SECUENCIA EF1a Forward 5 GTTGGCCCGGGCGAGGG 3 ER1a Reverse 5 CGCCCATCTCCTGCCTCCA 3 1 a IF1a Forward 5 TCCCCCACGCACTACGTG 3 IR1a Reverse 5 GTGCAAGTTGCCTTGAGAGA 3 EF1b Forward 5 TGGATGAACCGGCTGATAG 3 ER1b Reverse 5 CCACARGAGGTTGGCCTC 3 1b IF1b Forward 5 TCCCCCACGCACTATGTG 3 IR1b Reverse 5 CTAGCYGARGAGCTGGCC 3 EF3 Forward 5 GAGTTCTTYACTGAGGTGGG 3 ER3 Reverse 5 GAYTCTGAGTCRGACTC 3 3 IF3 Forward 5 GTRCTGACCTCGATGTTRAG 3 IR3 Reverse 5 CCGAGGRGGRGGCACC 3 EF4 Forward 5 GGCAAYCACGTGKCTCCCAC 3 ER4 Reverse 5 CTGGCTMGCCGAGGA 3 4 IF4 Forward 5 CACAAGTGGAYCAATGARGA 3 IR4 Reverse 5 GAGGGTGGTGACCC 3 25

27 Tabla 4: Principales características de la población de estudio Número de pacientes 78 Sexo masculino (%) 75 Media de edad 45 Media VHC-RNA log UI/ml [IQR] 6.1 [IQR: ] Pacientes en HAART (%) 75 VIH-RNA <50 cop/ml (%) 80 26

28 Figura 4: Distribución de genotipos en la población de estudio. 27

29 Tabla 5: Prevalencia de mutaciones de resistencia al inhibidor BMS-052 Genotipos/subtipos analizados M28T Mutaciones de Resistencia a BMS-052 1a 1b Q30H/R L31M/V P32L Y93C L31F/V P32L Y93H/N 1a (%, N=36) 1b (%, N=15) (% LA =155) L(100) (97.5) R (100) (92.2) M (7)* (7) H (7)* (6.1) 3 (% N=19) (% LA N=282) A (100) (90.4) 4 (% N=8) (% LA N=45) L 100) (82.0) R (100) (50.0) M (100) (93.3) H (13) (10) LA ; Base de datos de Los Alamos para VHC 28

Controversias en hepatitis Viral II

Controversias en hepatitis Viral II Controversias en hepatitis Viral II Dra. Ángeles Castro Iglesias Servicio de Medicina Interna B Hospital Universitario de A Coruña VI Curso de Biología Molecular para Clínicos Vigo, 3-4 de Febrero de 2012

Más detalles

BIBLIOGRAFÍA INTERNACIONAL

BIBLIOGRAFÍA INTERNACIONAL BIBLIOGRAFÍA INTERNACIONAL Antiviral Therapy Predicted effect of direct acting antivirals in the current HIV HCV coinfected Predicción del efecto de los agentes antivirales de acción directa en la población

Más detalles

BIBLIOGRAFÍA COMENTADA

BIBLIOGRAFÍA COMENTADA BIBLIOGRAFÍA COMENTADA GUT HCV substitutions and IL-28B polymorphisms on outcome of peg-interferon plus ribavirin combination therapy Efecto de las variantes del VHC y los polimorfismos del gen IL-28B

Más detalles

Hospital General Universitario Valle Hebron

Hospital General Universitario Valle Hebron TRATAMIENTO DE LA S HEPATITIS VIRALES Maria Buti. Servicio de Hepatología- Medicina Interna Hospital General Universitario Valle de Hebrón. Barcelona. Dirección. Dra Maria Buti Servicio de Hepatología

Más detalles

Efectos Secundarios Telaprevir Boceprevir. Anemia 32% 49% Neutropenia 5 % grado 3-4 29 % grado 3-4. Molestias anorrectales 27 % - Rash 55 % 15-18 %

Efectos Secundarios Telaprevir Boceprevir. Anemia 32% 49% Neutropenia 5 % grado 3-4 29 % grado 3-4. Molestias anorrectales 27 % - Rash 55 % 15-18 % FARMACOTERAPIA Manejo del tratamiento de la Hepatitis C Crónica Genotipo 1 María Pérez Abánades 1 y Concepción Martínez Nieto 1 La infección por el virus de la hepatitis C (VHC) es un problema de salud

Más detalles

Grupo de Estudio de Hepatitis. GEHEP Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica SOLICITUD DE PROYECTO DE INVESTIGACION

Grupo de Estudio de Hepatitis. GEHEP Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica SOLICITUD DE PROYECTO DE INVESTIGACION SOLICITUD DE PROYECTO DE INVESTIGACION 1. Datos del proyecto Título del proyecto: Eficacia y seguridad del tratamiento con Simeprevir para Hepatitis crónica C genotipo 4 en la práctica clínica habitual.

Más detalles

Boletín de la SEICV, nueva época

Boletín de la SEICV, nueva época Boletín de la Sociedad de Enfermedades Infecciosas de la Comunidad Valenciana VOLUMEN 2 NÚMER O 1 MAYO 2013 En este número: 1. Presentación nueva época 2. Resúmenes del 48th Annual Meeting of the European

Más detalles

ACADEMIA DE FARMACIA DE CASTILLA Y LEÓN

ACADEMIA DE FARMACIA DE CASTILLA Y LEÓN Resumen de la conferencia pronunciada por la Dra. Dª. Cristina Arenas Departamento Médico. Laboratorios Gilead con el título Situación actual del tratamiento farmacológico " Salamanca, 1 de Junio de 2015

Más detalles

25 años de progreso HEPATITIS C. Innovación Biofarmacéutica: Una nueva esperanza para los pacientes

25 años de progreso HEPATITIS C. Innovación Biofarmacéutica: Una nueva esperanza para los pacientes 25 años de progreso HEPATITIS C Innovación Biofarmacéutica: Una nueva esperanza para los pacientes HEPATITIS C Causa principal de cáncer y trasplante hepático en Chile La Hepatitis C es una enfermedad

Más detalles

MUTAGÉNESIS LETAL COMO NUEVA ESTRATEGIA ANTIVIRAL. Investigador principal: Miguel Ángel Martínez de la Sierra. Centro: Fundació irsicaixa

MUTAGÉNESIS LETAL COMO NUEVA ESTRATEGIA ANTIVIRAL. Investigador principal: Miguel Ángel Martínez de la Sierra. Centro: Fundació irsicaixa MUTAGÉNESIS LETAL COMO NUEVA ESTRATEGIA ANTIVIRAL Investigador principal: Miguel Ángel Martínez de la Sierra Centro: Fundació irsicaixa Duration: 3 years MEMORIA FINAL 1. Resumen del proyecto La variabilidad

Más detalles

Coinfección VIH / VHC Juan E. Losa Hospital U. F. Alcorcón. Universidad Rey Juan Carlos Madrid

Coinfección VIH / VHC Juan E. Losa Hospital U. F. Alcorcón. Universidad Rey Juan Carlos Madrid Coinfección VIH / VHC Juan E. Losa Hospital U. F. Alcorcón. Universidad Rey Juan Carlos Madrid Coinfección y Hepatitis víricas: Nuevas soluciones. Guión 1.- Nuevos tratamientos antivhc: un cambio en la

Más detalles

Herramientas para el diagnóstico, seguimiento y tratamiento en Hepatitis B. Fabián Fay CIBIC Rosario Argentina ffay@cibic.com.ar

Herramientas para el diagnóstico, seguimiento y tratamiento en Hepatitis B. Fabián Fay CIBIC Rosario Argentina ffay@cibic.com.ar Herramientas para el diagnóstico, seguimiento y tratamiento en Hepatitis B Fabián Fay CIBIC Rosario Argentina ffay@cibic.com.ar HBV - Marcadores Serológicos HBsAg: Antígeno de Superficie Anti-HBc (total):

Más detalles

PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH

PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH Blga. Gisely Hijar Guerra Coordinación del Laboratorio de Biotecnología y Biología Molecular. Responsable de los Procesos de la Prueba

Más detalles

FARMACOTERAPIA DE LA COINFECCIÓN VIH/VHC

FARMACOTERAPIA DE LA COINFECCIÓN VIH/VHC CASOS CLINICOS FARMACOTERAPIA DE LA COINFECCIÓN VIH/VHC Dra. Leonor Santos Morín Hospital Universitario Insular de G. C. Las Palmas de G.C Dra. Lourdes García Reina Hospital Universitario Insular de G.

Más detalles

Como monitorizar y manejar la resistencia del VHB a antivirales

Como monitorizar y manejar la resistencia del VHB a antivirales Como monitorizar y manejar la resistencia del VHB a antivirales Juan Francisco Sánchez Ávila Departamento de Gastroenterología. INCMNSZ Fundación Clínica Médica Sur. Nomenclatura de Resistencia Antiviral

Más detalles

Hepatitis C Manejo del Paciente Vírgen a Tratamiento David Kershenobich, MD, PhD Instituto Nacional de Ciencias Médicas y Nutrición, Salvador Zubirán

Hepatitis C Manejo del Paciente Vírgen a Tratamiento David Kershenobich, MD, PhD Instituto Nacional de Ciencias Médicas y Nutrición, Salvador Zubirán Hepatitis C Manejo del Paciente Vírgen a Tratamiento David Kershenobich, MD, PhD Instituto Nacional de Ciencias Médicas y Nutrición, Salvador Zubirán México, Distrito Federal Hepatitis C La FDA aprobo

Más detalles

Informe Breve. Interferon Pegilado alfa 2 a y alfa 2b

Informe Breve. Interferon Pegilado alfa 2 a y alfa 2b Informe Breve Interferon Pegilado alfa 2 a y alfa 2b Enero 2009 El día 16 de enero de 2009, el Area de Evaluación de Tecnologías en Salud de la Comisión Nacional Salud, Ciencia y Tecnologìa recibió una

Más detalles

ESQUEMAS DE TRATAMIENTO

ESQUEMAS DE TRATAMIENTO V. Tratamiento C. Esquemas de tratamiento Óscar Beltrán Galvis MD, 1 Mónica Tapias, MD, 2 Víctor Idrovo, MD. 3 1 Internista, Gastroenterólogo y Hepatólogo. UIS y Universidad Nacional de Colombia. Grupo

Más detalles

Documento acordado por la Comisión Permanente de Farmacia del Consejo Interterritorial del Sistema Nacional de Salud

Documento acordado por la Comisión Permanente de Farmacia del Consejo Interterritorial del Sistema Nacional de Salud Estrategia terapéutica de priorización para el uso de antivirales de acción directa para el tratamiento de la hepatitis crónica por virus C (VHC) en el ámbito del Sistema Nacional de Salud Documento acordado

Más detalles

Aproximación terapéutica a la hepatitis por virus C

Aproximación terapéutica a la hepatitis por virus C COLUMNA DE HÍGADO Aproximación terapéutica a la hepatitis por virus C Therapeutic approach to hepatitis for virus C Víctor Idrovo C. MD. 1 RESUMEN La hepatitis C (VHC) es producida por un virus RNA perteneciente

Más detalles

EVOLUCIÓN DEL VIRUS DE LA INMUNODEFICIENCIA HUMANA (VIH-1): MUTACIONES REVERTANTES EN EL GEN DE LA TRANSCRIPTASA REVERSA

EVOLUCIÓN DEL VIRUS DE LA INMUNODEFICIENCIA HUMANA (VIH-1): MUTACIONES REVERTANTES EN EL GEN DE LA TRANSCRIPTASA REVERSA EVOLUCIÓN DEL VIRUS DE LA INMUNODEFICIENCIA HUMANA (VIH-1): MUTACIONES REVERTANTES EN EL GEN DE LA TRANSCRIPTASA REVERSA Liliana Gómez Flores Ramos 1, Martha Escoto Delgadillo 2, Eduardo Vázquez Valls

Más detalles

APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR. Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina

APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR. Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina BiologÍa Molecular: es una disciplina que se enfoca principalmente en el estudio

Más detalles

Informe de la Comisión de Farmacia Hospital Universitario Reina Sofía TELAPREVIR

Informe de la Comisión de Farmacia Hospital Universitario Reina Sofía TELAPREVIR Informe de la Comisión de Farmacia Hospital Universitario Reina Sofía TELAPREVIR 1.- Identificación del fármaco Nombre genérico: Telaprevir. Nombre comercial: Incivo. 375 mg. 168 comp. / envase PVL + IVA:

Más detalles

ESTRATEGIA TERAPÉUTICA PARA LA HEPATITIS CRÓNICA CAUSADA POR EL VIRUS DE LA HEPATITIS C EN EL SISTEMA NACIONAL DE SALUD

ESTRATEGIA TERAPÉUTICA PARA LA HEPATITIS CRÓNICA CAUSADA POR EL VIRUS DE LA HEPATITIS C EN EL SISTEMA NACIONAL DE SALUD ESTRATEGIA TERAPÉUTICA PARA LA HEPATITIS CRÓNICA CAUSADA POR EL VIRUS DE LA HEPATITIS C EN EL SISTEMA NACIONAL DE SALUD Recomendaciones generales y pautas actuales de tratamiento Plan Estratégico para

Más detalles

Diversidad Genética del VIH: Importancia para la Salud Pública Global

Diversidad Genética del VIH: Importancia para la Salud Pública Global Diversidad Genética del VIH: Importancia para la Salud Pública Global Alvaro Carrascal, MD, MPH Director, División de Atención de Salud Instituto del SIDA Departamento de Salud del Estado de Nueva York

Más detalles

Resistencia a los antivirales de acción directa contra el virus de la hepatitis C

Resistencia a los antivirales de acción directa contra el virus de la hepatitis C Antivirales contra el vhc y resistencia Picchio G. 87 revisión crítica Resistencia a los antivirales de acción directa contra el virus de la hepatitis C Recibido: 15/03/2012 Aceptado: 08/06/2012 Gastón

Más detalles

Nuevos fármacos en el abordaje terapéutico de la hepatitis C

Nuevos fármacos en el abordaje terapéutico de la hepatitis C Farm Hosp. 2014;38(3):231-247 REVISIÓN Nuevos fármacos en el abordaje terapéutico de la hepatitis C R. Jiménez Galán, Á. Albacete Ramírez, P. Monje Agudo, Y. Borrego Izquierdo y R. Morillo Verdugo Hospital

Más detalles

Relación entre diabetes y VHC antes y después del transplante hepático

Relación entre diabetes y VHC antes y después del transplante hepático Relación entre diabetes y VHC antes y después del transplante hepático Dr Xavier Xiol Hospital Universitari de Bellvitge L Hospitalet de Llobregat Barcelona Definiciones Diabetes tipo 1 Secundaria déficit

Más detalles

Edward Cachay MD, MAS Associate Professor of Medicine UCSD Owen Clinic La Coruña Febrero 2013

Edward Cachay MD, MAS Associate Professor of Medicine UCSD Owen Clinic La Coruña Febrero 2013 Edward Cachay MD, MAS Associate Professor of Medicine UCSD Owen Clinic La Coruña Febrero 2013 Agenda Importancia y caracterización de las reacciones adversas asociadas al tratamiento de la hepatitis C

Más detalles

Informe de Posicionamiento Terapéutico de Sofosbuvir (Sovaldi )

Informe de Posicionamiento Terapéutico de Sofosbuvir (Sovaldi ) INFORME DE POSICIONAMIENTO TERAPÉUTICO PT-SOFOSBUVIR/V1/01112014 Informe de Posicionamiento Terapéutico de Sofosbuvir (Sovaldi ) Fecha de publicación: 18 de noviembre de 2014 Fecha de corrección: 20 de

Más detalles

OMBITASVIR/PARITAPREVIR/RITONAVIR (VIEKIRAX, DASABUVIR (EXVIERA, Abbvie)

OMBITASVIR/PARITAPREVIR/RITONAVIR (VIEKIRAX, DASABUVIR (EXVIERA, Abbvie) OMBITASVIR/PARITAPREVIR/RITONAVIR (VIEKIRAX, Abbvie) DASABUVIR (EXVIERA, Abbvie) RESUMEN Viekirax es una combinación a dosis fijas de ombitasvir (12,5 mg), paritaprevir (75 mg) y ritonavir (50 mg), en

Más detalles

SIMEPREVIR Infección por el virus de la hepatitis C

SIMEPREVIR Infección por el virus de la hepatitis C GENESIS-SEFH Versión: 4.0 Programa MADRE versión 4.0 Fecha: 10-12-2012 Informe Base Página: 1 SIMEPREVIR Infección por el virus de la hepatitis C (Informe para la CURMP) Fecha: Septiembre 2014 Glosario:

Más detalles

BIBLIOGRAFÍA COMENTADA

BIBLIOGRAFÍA COMENTADA BIBLIOGRAFÍA COMENTADA Gastroenterology An IL-28B polymorphism determines treatment response of hepatitis C virus genotype 2 or 3 patients who do not achieve a rapid virologic response Un polimorfismo

Más detalles

Herramientas de laboratorio aplicadas al diagnóstico y el monitoreo del tratamiento de la infección por VIH (Virus

Herramientas de laboratorio aplicadas al diagnóstico y el monitoreo del tratamiento de la infección por VIH (Virus Herramientas de laboratorio aplicadas al diagnóstico y el monitoreo del tratamiento de la infección por VIH (Virus Inmunodeficiencia Humana) Fabián Fay CIBIC. Rosario. Argentina Test de laboratorio para

Más detalles

Efectividad de la triple terapia con telaprevir en la hepatitis C crónica en pacientes monoinfectados y coinfectados

Efectividad de la triple terapia con telaprevir en la hepatitis C crónica en pacientes monoinfectados y coinfectados Vol. 24 Nº 2 2014 Efectividad de la triple terapia con telaprevir en la hepatitis C crónica en pacientes monoinfectados y coinfectados Rev. O.F.I.L. 2014, 24;2:80-85 SANGRADOR PELLUZ C 1, SOLER COMPANY

Más detalles

BIBLIOGRAFÍA INTERNACIONAL

BIBLIOGRAFÍA INTERNACIONAL BIBLIOGRAFÍA INTERNACIONAL Clinical infectious diseases HIV infection is associated with decreased thrombin generation La infección por VIH se asocia con disminución de la generación de trombina Hsue PY

Más detalles

A TODOS LOS GASTROENTERÓLOGOS E INFECTÓLOGOS PARTICIPANTES DE TRIPLE-S SALUD

A TODOS LOS GASTROENTERÓLOGOS E INFECTÓLOGOS PARTICIPANTES DE TRIPLE-S SALUD CARTA CIRCULAR #M1312239 30 de diciembre de 2013 A TODOS LOS GASTROENTERÓLOGOS E INFECTÓLOGOS PARTICIPANTES DE TRIPLE-S SALUD REVISIÓN DE POLÍTICA SOBRE HEPATITIS C Esta carta sustituye la carta circular

Más detalles

NUEVOS ENFOQUES PARA EL TRATAMIENTO DE LA HEPATITIS C EN PACIENTES CON HEMOFILIA

NUEVOS ENFOQUES PARA EL TRATAMIENTO DE LA HEPATITIS C EN PACIENTES CON HEMOFILIA TRATAMIENTO DE LA HEMOFILIA Diciembre de 2012 No. 54 NUEVOS ENFOQUES PARA EL TRATAMIENTO DE LA HEPATITIS C EN PACIENTES CON HEMOFILIA Fabien Zoulim François Bailly Departamento de hepatología Hospices

Más detalles

Daclatasvir en pacientes con Hepatitis C Crónica Eficacia y Seguridad

Daclatasvir en pacientes con Hepatitis C Crónica Eficacia y Seguridad Febrero 215 Daclatasvir en pacientes con Hepatitis C Crónica Eficacia y Seguridad AETSA 215 Índice 1. Medicamento/ Descripción/ Indicación autorizada... 2 2. Descripción de la enfermedad... 3 3. Tratamiento

Más detalles

INTERFERON. Efectos Inmunomoduladores Induce expresión de MHC clase I Activa macrófagos Células asesinas naturales Linfocitos T citotóxicos

INTERFERON. Efectos Inmunomoduladores Induce expresión de MHC clase I Activa macrófagos Células asesinas naturales Linfocitos T citotóxicos INTERFERON Efectos antivirales directos Reclutamiento de células inmunes Efectos Inmunomoduladores Induce expresión de MHC clase I Activa macrófagos Células asesinas naturales Linfocitos T citotóxicos

Más detalles

Coinfección VIH / VHC /VHB. Aspectos relevantes de su seguimiento.

Coinfección VIH / VHC /VHB. Aspectos relevantes de su seguimiento. Coinfección VIH / VHC /VHB. Aspectos relevantes de su seguimiento. VIH VHC VHB Porque es importante tener en cuenta la coinfección por VHC y por VHB en el paciente VIH? Importancia epidemiológica 1ª) Alta

Más detalles

TELAPREVIR (Incivo ) Tratamiento de la Hepatitis C crónica Informe técnico de Evaluación de nuevos medicamentos

TELAPREVIR (Incivo ) Tratamiento de la Hepatitis C crónica Informe técnico de Evaluación de nuevos medicamentos TELAPREVIR (Incivo ) Tratamiento de la Hepatitis C crónica Informe técnico de Evaluación de nuevos medicamentos Fecha: Enero de 2012 1.- IDENTIFICACIÓN DEL FÁRMACO Y AUTORES DEL INFORME... 2 2.- ÁREA DESCRIPTIVA

Más detalles

@ Artículo disponible en:

@ Artículo disponible en: @ Artículo disponible en: www.sietediasmedicos.com Solicitada acreditación TEMA 3 HEPATITIS C Tratamiento actual de la hepatitis C Rosa María Morillas, Marga Sala, Helena Masnou, Esther Soler Unidad de

Más detalles

Guias Terapeuticas Hepatitis C. Rafael ESteban Hospital Valle de Hebron Barcelona

Guias Terapeuticas Hepatitis C. Rafael ESteban Hospital Valle de Hebron Barcelona Guias Terapeuticas Hepatitis C Rafael ESteban Hospital Valle de Hebron Barcelona JORNADAS DE OTOÑO A.E.E.H. Coordinador Rafael Esteban Documento del II Consenso español sobre tratamiento de la hepatitis

Más detalles

Informe de Posicionamiento Terapéutico de Sofosbuvir (Sovaldi )

Informe de Posicionamiento Terapéutico de Sofosbuvir (Sovaldi ) INFORME DE POSICIONAMIENTO TERAPÉUTICO PT-SOFOSBUVIR/V1/01112014 Informe de Posicionamiento Terapéutico de Sofosbuvir (Sovaldi ) Fecha de publicación: 18 de Noviembre de 2014 La infección por el virus

Más detalles

COMISIÓNCLÍNICA DE FARMACIA Y TERAPÉUTICA INFORME DE INCLUSIÓN DE MEDICAMENTOS EN LA GUÍA FARMACOTERAPÉUTICA CENTRO DE INFORMACIÓN DE MEDICAMENTOS

COMISIÓNCLÍNICA DE FARMACIA Y TERAPÉUTICA INFORME DE INCLUSIÓN DE MEDICAMENTOS EN LA GUÍA FARMACOTERAPÉUTICA CENTRO DE INFORMACIÓN DE MEDICAMENTOS COMISIÓNCLÍNICA DE FARMACIA Y TERAPÉUTICA INFORME DE INCLUSIÓN DE MEDICAMENTOS EN LA GUÍA FARMACOTERAPÉUTICA CENTRO DE INFORMACIÓN DE MEDICAMENTOS 1. SOLICITUD DEL FÁRMACO Principio activo solicitado:

Más detalles

Hepatitis aguda C en pacientes VIH. Montserrat Laguno Centeno Hospital Clínico. Barcelona 08/10/2015

Hepatitis aguda C en pacientes VIH. Montserrat Laguno Centeno Hospital Clínico. Barcelona 08/10/2015 Hepatitis aguda C en pacientes VIH Montserrat Laguno Centeno Hospital Clínico. Barcelona 08/10/2015 Situación actual de la Hepatitis Aguda C (HAC) en el paciente VIH Experiencia en HAC en el paciente VIH

Más detalles

Nuevos ensayos moleculares de la tecnología SUMA para el diagnóstico de las hepatitis B y C

Nuevos ensayos moleculares de la tecnología SUMA para el diagnóstico de las hepatitis B y C Nuevos ensayos moleculares de la tecnología SUMA para el diagnóstico de las hepatitis B y C MSc. Anny Armas Cayarga Laboratorio de Biología Molecular Centro de Inmunoensayo Octubre 16, 2015 Qué es el diagnóstico

Más detalles

PORQUE BUSCAMOS LA HEPATITIS C?

PORQUE BUSCAMOS LA HEPATITIS C? PORQUE BUSCAMOS LA HEPATITIS C? ESTE INDIVIDUO TIENE HCV? ESTA PERSONA (POTENCIAL DONANTE DE SANGRE) PUEDE ESTAR EXPUESTO A HCV? QUE EFECTOS TIENE LA INFECCION POR HCV EN EL HIGADO? CUAL ES LA PROBABILIDAD

Más detalles

Systematic review: Evaluation of adherence among treatment naïve patients with hepatitis C

Systematic review: Evaluation of adherence among treatment naïve patients with hepatitis C ARTÍCULO DE REVISIÓN Revisión sistemática: Evaluación de la adherencia del tratamiento de pacientes Systematic review: Evaluation of adherence among treatment naïve patients with hepatitis C 1 Servicio

Más detalles

POLIMORFISMOS EN EL locus IL28B SU IMPLICANCIA CLINICA EN LA INFECCION POR HCV. Artículos de actualización del área de difusión médica Octubre 2012

POLIMORFISMOS EN EL locus IL28B SU IMPLICANCIA CLINICA EN LA INFECCION POR HCV. Artículos de actualización del área de difusión médica Octubre 2012 POLIMORFISMOS EN EL locus IL28B SU IMPLICANCIA CLINICA EN LA INFECCION POR HCV Se estima según datos del CDC, que alrededor del 3% de la población mundial padece una infección crónica por el Virus de la

Más detalles

Artículo original. Manuel Manzano Luque, Médico, Hospital Universitario de la Princesa, Madrid, España

Artículo original. Manuel Manzano Luque, Médico, Hospital Universitario de la Princesa, Madrid, España Artículo original Salud(i)Ciencia 20 (2014) 357-361 Características de una población coinfectada por el VIH y los virus de las hepatitis B y C por medio de los resultados de la elastografía de transición

Más detalles

Resultados de la práctica clínica en. Miguel A von Wichmann

Resultados de la práctica clínica en. Miguel A von Wichmann Resultados de la práctica clínica en la coinfección ió VIH/VHC Miguel A von Wichmann Hosp Univ Donostia, San Sebastián RVS con AAD en pacientes coinfectados Gt-1 sin tratamiento previo (EC) TVR BOC Distribución

Más detalles

NUEVOS MEDICAMENTOS PARA EL TRATAMIENTO DE LA HEPATITIS C CRÓNICA. BOCEPREVIR (VICTRELIS ) Y TELAPREVIR (INCIVO )

NUEVOS MEDICAMENTOS PARA EL TRATAMIENTO DE LA HEPATITIS C CRÓNICA. BOCEPREVIR (VICTRELIS ) Y TELAPREVIR (INCIVO ) NUEVOS MEDICAMENTOS PARA EL TRATAMIENTO DE LA HEPATITIS C CRÓNICA. BOCEPREVIR (VICTRELIS ) Y TELAPREVIR (INCIVO ) Informe de evaluación de tecnologías sanitarias elaborado por el Servicio de Evaluación

Más detalles

BIBLIOGRAFÍA COMENTADA

BIBLIOGRAFÍA COMENTADA BIBLIOGRAFÍA COMENTADA American Journal of Transplantation Donor and recipient IL-28B polymorphisms in HCV-infected patients undergoing antiviral therapy before and after liver transplantation Polimorfismos

Más detalles

CONSEJERÍA DE IGUALDAD, SALUD Y POLÍTICAS SOCIALES

CONSEJERÍA DE IGUALDAD, SALUD Y POLÍTICAS SOCIALES ctualización tras la CONSEJERÍA DE IGUALDAD, SALUD Y POLÍTICAS SOCIALES AGENCIA DE EVALUACIÓN DE TECNOLOGÍAS SANITARIAS DE ANDALUCÍA (AETSA) Criterios de selección de Agentes Antivirales Directos para

Más detalles

TRATAMIENTO COMBINADO DE INTERFERON Y RIBAVIRINA

TRATAMIENTO COMBINADO DE INTERFERON Y RIBAVIRINA TRATAMIENTO COMBINADO DE INTERFERON Y RIBAVIRINA INDICACIONES ACTUALES Dr.C.MarlenI. Castellanos Fernández Instituto de Gastroenterología Interferonespegilados Peg Interferon alfa-2a estructura ramificada,

Más detalles

ENFERMEDAD HEPÁTICA EN PACIENTES INFECTADOS POR EL VIRUS DE LA INMUNODEFICIENCIA HUMANA

ENFERMEDAD HEPÁTICA EN PACIENTES INFECTADOS POR EL VIRUS DE LA INMUNODEFICIENCIA HUMANA 289 30 ENFERMEDAD HEPÁTICA EN PACIENTES INFECTADOS POR EL VIRUS DE LA INMUNODEFICIENCIA HUMANA R Rodríguez-Rosado M Pérez-Olmeda J García-Samaniego V Soriano Entre las manifestaciones clínicas que pueden

Más detalles

UNIVERSIDAD COMPLUTENSE DE MADRID

UNIVERSIDAD COMPLUTENSE DE MADRID UNIVERSIDAD COMPLUTENSE DE MADRID FACULTAD DE MEDICINA Departamento de Inmunología TESIS DOCTORAL Resistencia a los nuevos antivirales frente al virus de la hepatitis C MEMORIA PARA OPTAR AL GRADO DE DOCTOR

Más detalles

GENOTIPO 1. Hepatitis Crónica por Virus C. Recomendaciones para el tratamiento de la

GENOTIPO 1. Hepatitis Crónica por Virus C. Recomendaciones para el tratamiento de la Recomendaciones para el tratamiento de la Hepatitis Crónica por Virus C GENOTIPO 1 Asociación Argentina para el Estudio de las Enfermedades del Hígado Subcomisión de Expertos en Hepatitis Virales Integrantes:

Más detalles

HEPATITIS C RECURRENTE DESPUÉS DEL TRASPLANTE HEPÁTICO

HEPATITIS C RECURRENTE DESPUÉS DEL TRASPLANTE HEPÁTICO 477 47 HEPATITIS C RECURRENTE DESPUÉS DEL TRASPLANTE HEPÁTICO M Berenguer M Prieto La cirrosis secundaria a la infección crónica por el virus de la hepatitis C (VHC) es la principal indicación de trasplante

Más detalles

Hepatitis C al 2014: Tractar o esperar ALTRES GENOTIPS (NO 1)

Hepatitis C al 2014: Tractar o esperar ALTRES GENOTIPS (NO 1) Hepatitis C al 2014: Tractar o esperar ALTRES GENOTIPS (NO 1) XXIII Congrés de la Societat Catalana de Digestologia 31 de gener, Palau de Congressos de Lleida.La Llotja Dr. Joan Carles Quer Htal. Universitari

Más detalles

Blga. Gisely Hijar Guerra. Responsable de los Procesos de la Prueba de Genotipificación de VIH Centro Nacional de Salud Publica

Blga. Gisely Hijar Guerra. Responsable de los Procesos de la Prueba de Genotipificación de VIH Centro Nacional de Salud Publica Genotipificación de VIH en el INS: técnica local y técnicas convencionales Blga. Gisely Hijar Guerra Coordinación del Laboratorio de Biotecnología y Biología Molecular. lar Responsable de los Procesos

Más detalles

Historia natural de la infección por HCV

Historia natural de la infección por HCV Historia natural de la infección por HCV HCV aguda Resuelta 15% to 45% HCV Crónica 55% to 85% Estable 75% to 95% Cirrosis 5% to 25% Estable 97% to 99%/yr HCC o Decompensación 1% to 3%/año Thomas DL, et

Más detalles

Enfermedades Infecciosas y Microbiología Clínica www.elsevier.es/eimc

Enfermedades Infecciosas y Microbiología Clínica www.elsevier.es/eimc Volumen 31, Extraordinario 1, Febrero 2013 Publicación mensual www.elsevier.es/eimc PUBLICACIÓN OFICIAL DE LA SOCIEDAD ESPAÑOLA DE ENFERMEDADES INFECCIOSAS Y MICROBIOLOGÍA CLÍNICA Programa de Control Externo

Más detalles

Farmacogenetica y avances en el tratamiento de la hepatitis C

Farmacogenetica y avances en el tratamiento de la hepatitis C Nuevas Perspectivas en el Tratamiento de las Enfermedades Hepáticas Farmacogenetica y avances en el tratamiento de la hepatitis C Enrique Ortega.Unidad de Enfermedades Infecciosas. Hospital General Universitario

Más detalles

CONTENIDO O Volumen 15, número 1 O Enero - Febrero 2014 NÚMERO MONOGRÁFICO DEDICADO A LA INFECCIÓN POR EL VIRUS DE LA HEPATITIS C

CONTENIDO O Volumen 15, número 1 O Enero - Febrero 2014 NÚMERO MONOGRÁFICO DEDICADO A LA INFECCIÓN POR EL VIRUS DE LA HEPATITIS C AVANCES EN ENFERMEDADES INFECCIOSAS Publicado por la Sociedad Andaluza de Enfermedades Infecciosas (http://www.saei.org/) Depósito Legal SE-99-2000. ISSN 1576-3129. Todos los derechos reservados CONTENIDO

Más detalles

Coinfección por el VIH y el virus de la hepatitis C

Coinfección por el VIH y el virus de la hepatitis C Servicio de Enfermedades Infecciosas. Hospital Carlos III. Madrid. España. Puntos clave Un tercio de los pacientes con infección por el VIH están coinfectados por el virus de la hepatitis C (VHC). Entre

Más detalles

A principios de los años ochentas el desarrollo de nuevas tecnologías para la

A principios de los años ochentas el desarrollo de nuevas tecnologías para la Nuevos marcadores para la detección temprana y predicción de sobrevida en blancos terapéuticos. A principios de los años ochentas el desarrollo de nuevas tecnologías para la identificación del ADN del

Más detalles

HEPATITIS C, EPIDEMIA SILENTE

HEPATITIS C, EPIDEMIA SILENTE PILDORAS EPIDEMIOLOGICAS Hepatitis C en el Mundo Se estima una prevalencia de 200 millones de portadores a nivel mundial con una mortalidad anual de 350 mil personas como consecuencia del efecto crónico

Más detalles

6º Curso-Taller de Casos Clínicos para Farmacéuticos de Hospital. Sevilla, 7 y 8 de Marzo de 2013

6º Curso-Taller de Casos Clínicos para Farmacéuticos de Hospital. Sevilla, 7 y 8 de Marzo de 2013 6º Curso-Taller de Casos Clínicos para Farmacéuticos de Hospital Sevilla, 7 y 8 de Marzo de 2013 DESHIDRATACIÓN SEVERA CON ACIDOSIS METABÓLICA EN PACIENTE CON INFECCIÓN POR VIRUS DE LA HEPATITIS C Estrella

Más detalles

2. La coinfección por el VIH acelera la progresión de la hepatitis crónica C y/o B.

2. La coinfección por el VIH acelera la progresión de la hepatitis crónica C y/o B. CONSECUENCIAS A LARGO PLAZO DE LA HEPATITIS C Y B EN DROGADICTOS INTRAVENOSOS INFECTADOS POR EL VIH Investigadores principales: Dr. Robert Muga Bustamante Hospital Universitari Germans Trias i Pujol Dr.

Más detalles

Nuevas herramientas para la cuantificación del coste de tratamiento con IPs en pacientes con hepatitis C crónica

Nuevas herramientas para la cuantificación del coste de tratamiento con IPs en pacientes con hepatitis C crónica Nuevas herramientas para la cuantificación del coste de tratamiento con IPs en pacientes con hepatitis C crónica 58 Congreso Nacional de la Sociedad de Farmacia Hospitalaria Actualidad en la Gestión Clínica

Más detalles

Año 2012, Volumen 28 nº 2 http://dx.doi.org/10.11119/bta2012-28-02 EN ESTE NÚMERO 1 Utilización de medicamentos

Año 2012, Volumen 28 nº 2 http://dx.doi.org/10.11119/bta2012-28-02 EN ESTE NÚMERO 1 Utilización de medicamentos Año 2012, Volumen 28 nº 2 http://dx.doi.org/10.11119/bta2012-28-02 Redacción: CADIME Escuela Andaluza de Salud Pública. Cuesta del Observatorio, n.º 4 Aptdo. 2070. 18080 Granada. España. Tfno. 958 027

Más detalles

Seguridad en la práctica clínica de la triple terapia con telaprevir en la hepatitis C crónica

Seguridad en la práctica clínica de la triple terapia con telaprevir en la hepatitis C crónica Farm Hosp. 2013;37(6):489-493 ORIGINALES Seguridad en la práctica clínica de la triple terapia con telaprevir en la hepatitis C crónica C. Sangrador Pelluz, F. J. Maiques Llácer y E. Soler Company Servicio

Más detalles

COMISIÓN DE FARMACIA Y TERAPÉUTICA INFORME DE INCLUSIÓN DE MEDICAMENTOS EN LA GUÍA FARMACOTERAPÉUTICA CENTRO DE INFORMACIÓN DE MEDICAMENTOS

COMISIÓN DE FARMACIA Y TERAPÉUTICA INFORME DE INCLUSIÓN DE MEDICAMENTOS EN LA GUÍA FARMACOTERAPÉUTICA CENTRO DE INFORMACIÓN DE MEDICAMENTOS COMISIÓN DE FARMACIA Y TERAPÉUTICA INFORME DE INCLUSIÓN DE MEDICAMENTOS EN LA GUÍA FARMACOTERAPÉUTICA CENTRO DE INFORMACIÓN DE MEDICAMENTOS 1. SOLICITUD DEL FÁRMACO Principio activo solicitado: fosamprenavir.

Más detalles

SIMEPREVIR. OLYSIO (Janssen Cilag) HEPATITIS C

SIMEPREVIR. OLYSIO (Janssen Cilag) HEPATITIS C SIMEPREVIR OLYSIO (Janssen Cilag) HEPATITIS C La hepatitis es un cuadro inflamatorio del hígado cuyo origen puede ser infeccioso (tanto viral como bacteriano), inmunológico (hepatitis autoinmune) o tóxico

Más detalles

Tratamiento de la hepatitis C recurrente post-trasplante. Cuando y Como. Victoria Aguilera XXVI Congreso SETH 2-4 Octubre de 2013 Córdoba

Tratamiento de la hepatitis C recurrente post-trasplante. Cuando y Como. Victoria Aguilera XXVI Congreso SETH 2-4 Octubre de 2013 Córdoba Tratamiento de la hepatitis C recurrente post-trasplante. Cuando y Como Victoria Aguilera XXVI Congreso SETH 2-4 Octubre de 2013 Córdoba Indicación de TH por cirrosis VHC y Supervivencia post-th Historia

Más detalles

Hepatitis viral tipo C (HCV) RT-PCR

Hepatitis viral tipo C (HCV) RT-PCR Hepatitis viral tipo C (HCV) RT-PCR Celía, Alejandro Fabián Taborda, Florencia Ines Características Generales del HCV Agente etiológico de las HNANB transmitidas por transfusiones Flia: Flaviviridae Género:

Más detalles

Tratamiento del paciente cirrótico por Hepatitis C.

Tratamiento del paciente cirrótico por Hepatitis C. Dr. Francisco Bosques 1 Tratamiento del paciente cirrótico por Hepatitis C. Dr. Francisco Bosques Padilla Profesor Asociado C. Facultad de Medicina y Hospital Universitario J.E. González. UANL. Monterrey

Más detalles

HEPATITIS C. Dr. Alfredo Martínez CEMIC

HEPATITIS C. Dr. Alfredo Martínez CEMIC HEPATITIS C Dr. Alfredo Martínez Laboratorio de Virología Clínica CEMIC PORQUE BUSCAMOS LA HEPATITIS C? ESTE INDIVIDUO TIENE HCV? ESTA PERSONA (POTENCIAL DONANTE DE SANGRE) PUEDE ESTAR EXPUESTO A HCV?

Más detalles

Tesis Doctoral. Facultad de Ciencias Exactas y Naturales Universidad de Buenos Aires. www.digital.bl.fcen.uba.ar. Contacto: digital@bl.fcen.uba.

Tesis Doctoral. Facultad de Ciencias Exactas y Naturales Universidad de Buenos Aires. www.digital.bl.fcen.uba.ar. Contacto: digital@bl.fcen.uba. Coinfección HIV-Hepatitis C: análisis molecular de factores genéticos del HCV que influyen sobre la respuesta al interferón Bolcic, Federico Martín 2012 Tesis Doctoral Facultad de Ciencias Exactas y Naturales

Más detalles

Situación del VHC en Uruguay

Situación del VHC en Uruguay Situación del VHC en Uruguay Agosto 2014 Dra. Nelia Hernández Montevideo - Uruguay ... 1989 se identifica el VHC como el principal agente de las hepatitis no A no B Se estiman 170 millones de infectados

Más detalles

Documento del II Consenso español sobre tratamiento de la hepatitis C

Documento del II Consenso español sobre tratamiento de la hepatitis C Versión final del documento 12 de Abril del 2015 El documento de consenso ha sido elaborado por un jurado compuesto por Miguel Bruguera (presidente), Rafael Bañares, María Buti, Fernando Carballo, Xavier

Más detalles

III CONGRESO NACIONAL DE ATENCIÓN FARMACÉUTICA

III CONGRESO NACIONAL DE ATENCIÓN FARMACÉUTICA Adherencia a la terapia antirretroviral en pacientes infectados con el virus de la inmunodeficiencia humana que asisten a una clínica universitaria de enfermedades infecciosas en Venezuela. III CONGRESO

Más detalles

PEG-INTERFERON alfa 2 b Informe para la Comisión de Farmacia y Terapéutica Pere Ventayol, Francesc Puigventós 25-6-2001

PEG-INTERFERON alfa 2 b Informe para la Comisión de Farmacia y Terapéutica Pere Ventayol, Francesc Puigventós 25-6-2001 PEG-INTERFERON alfa 2 b Informe para la Comisión de Farmacia y Terapéutica Pere Ventayol, Francesc Puigventós 25-6-2001 SOLICITUD: Dr. Obrador/ Dra. Bonet. Servicio de Digestivo. 1-6-01. PRESENTACIONES:

Más detalles

VHB Y VHC EN EL EMBARAZO. Senador Morán Sánchez Servicio de Digestivo HUSL

VHB Y VHC EN EL EMBARAZO. Senador Morán Sánchez Servicio de Digestivo HUSL VHB Y VHC EN EL EMBARAZO Senador Morán Sánchez Servicio de Digestivo HUSL IMPORTANCIA DE LA INFECCION CONSECUENCIAS CLINICAS VHC MORBILIDAD Y MORTALIDAD VHC HIV Accidente trafico 12 muertes al dia 3 muertes

Más detalles

Tratamiento de la hepatitis crónica C genotipo 2 y 3 en 2015

Tratamiento de la hepatitis crónica C genotipo 2 y 3 en 2015 Tratamiento de la hepatitis crónica C genotipo 2 y 3 en 2015 Ricard Solà Hospital del Mar Barcelona 22 de Mayo de 2015 Med Clin (Barc) 2002; 119: 90-95. Prevalencia de los distintos genotipos del virus

Más detalles

CRITERIOS Y RECOMENDACIONES PARA EL ACCESO PRECOZ AL TRATAMIENTO CON INHIBIDORES DE LA PROTEASA DEL VIRUS DE LA HEPATITIS C (VHC)

CRITERIOS Y RECOMENDACIONES PARA EL ACCESO PRECOZ AL TRATAMIENTO CON INHIBIDORES DE LA PROTEASA DEL VIRUS DE LA HEPATITIS C (VHC) CRITERIOS Y RECOMENDACIONES PARA EL ACCESO PRECOZ AL TRATAMIENTO CON INHIBIDORES DE LA PROTEASA DEL VIRUS DE LA HEPATITIS C (VHC) Información dirigida a profesionales sanitarios Grupo de Expertos Hepatitis

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

GUIA DE PRÁCTICA CLINICA HEPATITIS VIRAL C

GUIA DE PRÁCTICA CLINICA HEPATITIS VIRAL C I. CIE 10: B15-B19 GUIA DE PRÁCTICA CLINICA HEPATITIS VIRAL C II. DEFINICIÓN: Es una inflamación del hígado debida a una infección crónica por el virus C. Tras el contacto con el virus, aparece una hepatitis

Más detalles

Complicaciones hematologicas del tratamiento de las hepatitis virales

Complicaciones hematologicas del tratamiento de las hepatitis virales Complicaciones hematologicas del tratamiento de las hepatitis virales JL López Banco Municipal de Sangre SOCIEDAD VENEZOLANA DE HEMATOLOGÍA EDUCACIÓN MÉDICA CONTÍNUA DECLARACIÓN DE POTENCIALES CONFLICTOS

Más detalles

6 INFECCIÓN POR EL VIRUS DE LA INMUNODEFICIENCIA HUMANA (VIH) Y SIDA. TRATAMIENTO Y PREVENCIÓN DE LAS INFECCIONES OPORTUNISTAS ASOCIADAS

6 INFECCIÓN POR EL VIRUS DE LA INMUNODEFICIENCIA HUMANA (VIH) Y SIDA. TRATAMIENTO Y PREVENCIÓN DE LAS INFECCIONES OPORTUNISTAS ASOCIADAS 6 INFECCIÓN POR EL VIRUS DE LA INMUNODEFICIENCIA HUMANA (VIH) Y SIDA. TRATAMIENTO Y PREVENCIÓN DE LAS INFECCIONES OPORTUNISTAS ASOCIADAS Introducción.................... 663 Clasificación de la infección

Más detalles

Facultad de Medicina. Departamento de Medicina Interna

Facultad de Medicina. Departamento de Medicina Interna UNIVERSIDAD AUTÓNOMA DE BARCELONA Facultad de Medicina Departamento de Medicina Interna UTILIDAD DE LA MONITORIZACIÓN DEL ARN DEL VIRUS DE LA HEPATITIS C DURANTE EL TRATAMIENTO ANTIVIRAL COMO FACTOR PREDICTOR

Más detalles

EVALUACIÓN DE FÁRMACOS SEGÚN METODOLOGÍA GINF (GUÍA DE INCORPORACIÓN DE NUEVOS FÁRMACOS A LOS HOSPITALES DE LA RED SANITARIA PÚBLICA EN ANDALUCIA)

EVALUACIÓN DE FÁRMACOS SEGÚN METODOLOGÍA GINF (GUÍA DE INCORPORACIÓN DE NUEVOS FÁRMACOS A LOS HOSPITALES DE LA RED SANITARIA PÚBLICA EN ANDALUCIA) EVALUACIÓN DE FÁRMACOS SEGÚN METODOLOGÍA GINF (GUÍA DE INCORPORACIÓN DE NUEVOS FÁRMACOS A LOS HOSPITALES DE LA RED SANITARIA PÚBLICA EN ANDALUCIA) DATOS DEL EVALUADOR NOMBRE: PUESTO DE TRABAJO: TFNO. Y

Más detalles

TRANSCRIPCIÓN Y REPLICACIÓN DEL RNA DEL VIRUS DE LA GRIPE

TRANSCRIPCIÓN Y REPLICACIÓN DEL RNA DEL VIRUS DE LA GRIPE TRANSCRIPCIÓN Y REPLICACIÓN DEL RNA DEL VIRUS DE LA GRIPE Juan Ortín Resumen Los virus de la gripe tienen gran incidencia en la salud humana, ya que disponen de un amplio reservorio animal y reaparecen

Más detalles

Boletín Informativo. Grupo de Trabajo sobre Tratamientos del VIH (gtt).

Boletín Informativo. Grupo de Trabajo sobre Tratamientos del VIH (gtt). Boletín Informativo no técnico sobre el Encuentro de la Asociación Americana para el Estudio de las Enfermedades Hepáticas (AASLD 2013) Diciembre de 2013. Grupo de Trabajo sobre Tratamientos del VIH (gtt).

Más detalles

trasplante hepático y la recidiva de la hepatitis C en el embargo, la historia natural de la recidiva de la hepatitis C es

trasplante hepático y la recidiva de la hepatitis C en el embargo, la historia natural de la recidiva de la hepatitis C es Evoluciones atípicas de la recidiva de la hepatitis C en el trasplante hepático. Dra. Teresa Serrano. Hospital de Bellvitge. Barcelona. La cirrosis por hepatitis C es la principal indicación de trasplante

Más detalles

EFICACIA Y SEGURIDAD DE TELAPREVIR PARA EL TRATAMIENTO DE HEPATITIS C CRÓNICA DE GENOTIPO 1 IP-02-013-040

EFICACIA Y SEGURIDAD DE TELAPREVIR PARA EL TRATAMIENTO DE HEPATITIS C CRÓNICA DE GENOTIPO 1 IP-02-013-040 EFICACIA Y SEGURIDAD DE TELAPREVIR PARA EL TRATAMIENTO DE HEPATITIS C CRÓNICA DE GENOTIPO 1 IP-02-013-040 Junio 2014 La siguiente evaluación se elaboró a solicitud de la Dirección General de la Salud,

Más detalles

Familia: Retroviridae. Género: Lentivirus. Diámetro: 120 nm. Especies: HIV 1, HIV 2. Genoma: 2 ARN monocatenarios positivos.

Familia: Retroviridae. Género: Lentivirus. Diámetro: 120 nm. Especies: HIV 1, HIV 2. Genoma: 2 ARN monocatenarios positivos. 30 de Agosto 2010 Bioq. Alvarez, Juliana Bioq. Archuby, Daniela El Síndrome S Inflamatorio de Reconstitución Inmunológica (IRIS), ocurre en una subpoblación n de pacientes infectados por HIV (10-30%) durante

Más detalles