DIFERENCIACIÓN ANALÍTICA DE GENOTIPOS DE CERDO IBERICO

Tamaño: px
Comenzar la demostración a partir de la página:

Download "DIFERENCIACIÓN ANALÍTICA DE GENOTIPOS DE CERDO IBERICO"

Transcripción

1 Proyecto Nº SC DIFERENCIACIÓN ANALÍTICA DE GENOTIPOS DE CERDO IBERICO Equipo Investigador: Mª Carmen Rodríguez Valdovinos (Dra. C.B.) Carmen Castellanos Sánchez (I.T.A.) Jaime Rodrigáñez Bustos (I.A.) Julián Pérez Pérez (Dr. C.B.) Equivalente de jornada completa: 2,60 Centro de Investigación: Centro de Investigación y Tecnología. (SGIT). INIA. Duración: Coste: Enero Diciembre 1997 Miles de pesetas: Financiación INIA 100% 1

2 PLANTEAMIENTO Y OBJETIVOS En la actualidad la producción de cerdos Ibéricos está orientada mayoritariamente al mercado de productos curados de alta calidad, como son jamones, paletas y lomos. Debido al lento crecimiento de los cerdos Ibéricos puros y al bajo rendimiento de sus canales, la mayor parte de los animales sacrificados proceden de cruzamientos con otras razas, fundamentalmente Duroc. La generalización del cruzamiento con esta raza ha originado que, según el censo realizado en 1995 por la asociación de ganaderos de cerdo Ibérico (AECERIBER), mas de 1/3 de las reproductoras censadas de tipo Ibérico sean híbridas Ibérico x Duroc. Se estima que menos del 25% de los animales sacrificados son Ibéricos puros, el 35% de las canales son de animales Ibéricos al 50% y el 40% restante de animales al 75%. Hasta el momento la caracterización de los animales de tipo Ibérico se ha basado exclusivamente en criterios de tipo morfológico que, si bien pueden ser de cierta utilidad en animales cruzados al 50%, pueden ser de escasa utilidad en animales con un 25% o menos de genes Duroc. Por otra parte, aunque las reglamentaciones de las Denominaciones de Origen existentes exigen una proporción mínima del 75% de genes de Ibérico para sus productos elite, no existe ningún procedimiento que permitan determinar la existencia de genes Duroc en las canales o en los productos elaborados, aunque tradicionalmente se asocia óptima calidad con cerdos Ibéricos puros. Los objetivos del proyecto estaban dirigidos a: ƒ1. Establecimiento de un sistema analítico de diferenciación de los tipos genéticos: Ibérico, 50% Duroc/50% Ibérico y 25% Duroc/75% Ibérico. Basado en un mínimo de 7 marcadores RAPD diagnóstico del genotipo Duroc ƒ2. Aplicación del sistema a lomos y jamones en sangre y curados. ƒ3. Extensión del método a la diferenciación de líneas de Ibérico. 1. Obtención de marcadores específicos del genomio Duroc El desarrollo experimentado en los últimos años por las técnicas de biología molecular ha permitido disponer de polimorfismos basados en la detección de diferencias moleculares a nivel de ADN. El avance ha sido aún mayor a partir del hallazgo de la técnica PCR. Los marcadores elegidos para esta parte del proyecto han sido los RAPD (Random Amplified Polimorphic DNA) por su facilidad de obtención y abundancia. 2. Aplicación del sistema a lomos y jamones Para ello se ha dispuesto de muestras de carne y de productos elaborados de larga duración (jamones de 2 años de curación). El método de trabajo fue análogo al empleado para las muestras de sangre, previa liofilización y trituración de las muestras de músculo. 3. Diferenciación de líneas de Ibérico Para la consecución de este tercer objetivo se han empleado, además de los marcadores RAPD, otros dos tipos de marcadores: RDA y AFLP RDA (Representational Difference Analysis) 2

3 El objetivo de esta parte del proyecto era la obtención de marcadores específicos de raza mediante la técnica RDA, que permite detectar diferencias específicas entre genomas de dos individuos (Lisitsyn et el., 1993; Myers, 1993). El objetivo de la técnica es buscar RFLPs entre el ADN de dos individuos, mediante ciclos sucesivos de hibridación selectiva y amplificación. Con el fin de facilitar la puesta apunto de la técnica se escogieron en una primera fase dos razas de cerdos muy alejadas: Landrace e Ibérico. Como método de constatar la eficacia de la técnica se emplearon muestras de ADN tanto de machos como de hembras. Si el método funcionaba deberíamos obtener fragmentos específicos del Cromosoma Y Marcadores AFLP Este tipo de marcadores son fragmentos de restricción obtenidos mediante digestión del ADN genómico y posterior amplificación PCR. Debido a sus especiales cualidades pueden resultar muy útiles para la caracterización de poblaciones. En este proyecto se han empleado para caracterizar 2 poblaciones de cerdos Ibéricos tradicionales del tipo Negro Lampiño: Guadyerbas y Coronado. El número total de animales utilizados ha sido de catorce, de los cuales diez correspondían a la primera de las estirpes (5 machos y 5 hembras) mientras que de la segunda se emplearon 4 machos. Los productos de amplificación se analizaron mediante geles de poliacrilamida desnaturalizados, visualizando posteriormente por autorradiografía los patrones AFLP. Las similaridades genéticas entre líneas se analizaron mediante el programa NTSYS-PC Versión 1.8, para lo cual los fragmentos polimórficos fueron identificados con la clave 1 para presencia y 0 para ausencia. Para el cálculo de las matrices de similaridad se usó el coeficiente de Jaccard: donde: S = N XY / (N XY +N X +N Y ) N XY : es el número de fragmentos de ADN comunes a los individuos comparados (X e Y). N X y N Y : es el número total de fragmentos existentes en los individuos X e Y respectivamente. Las matrices así definidas son analizadas mediante el método UPGMA y los resultados usados para la construcción de dendogramas. A fin de constatar la utilidad de los AFLP para la construcción de dendogramas se calculó otro, para los individuos de la estirpe Guadyerbas, utilizando la matriz de coeficientes de parentesco. Para la estirpe Coronado no fue posible esto por carecer de genealogía controlada. La similitud entre los dendogramas construidos a partir de los 2 tipos de información nos permitirá constatar la validez de estos marcadores para estudiar las relaciones filogenéticas. RESULTADOS Marcadores Ibérico Duroc A lo largo de los tres años de duración del proyecto se han identificado los siguientes marcadores específicos: ƒ7 marcadores del genomio Ibérico. Estos marcadores, presentes en animales Ibéricos, no han sido detectados en ninguna de las otras razas analizadas (Duroc, Landrace, L. White). La frecuencia de aparición de estos marcadores específicos del genomio Ibérico está siendo analizada en la actualidad. 3

4 ƒ6 marcadores del Cromosoma Y Se han detectado 6 marcadores de cromosoma sexual masculino, que son específicos de genomio porcino pues no han podido ser detectados en el genomio de las otras especies analizadas: Vacuno, Ovino, Ratón y Humano. ƒ9 marcadores del genomio Duroc, presentes en las poblaciones muestreadas. Estos marcadores se encuentran a frecuencias muy variables, comprendidas entre el 13 y el 93%, siendo los tamaños de los fragmentos de amplficación de 500 a 1700 pb. Uno de los marcadores ha resultado ser específico de una de las líneas Duroc. Estos marcadores no aparecen en las otras razas de cerdos disponibles (Landrace y Large White). Este conjunto de marcadores específicos permite la discriminación de muestras procedentes de animales puros y cruzados hasta el 75%, siendo la probabilidad de error despreciable. Sin embargo la detección de marcadores diagnóstico no se da por totalmente finalizada, ya que la discriminación de muestras individuales de genotipos con menor proporción de genes Duroc, de gran interés para proteger el Libro Genealógico de la Raza, requiere disponer de un mayor número de marcadores. Los resultados se han verificado con las muestras disponibles de animales cruzados Ib x D. Se ha comprobado asimismo su aplicación a muestras de jamones de dos años de curación. Comparación de líneas de Ibérico La comparación molecular de líneas de Ibérico, mediante AFLP y RAPD, ha permitido detectar: Marcadores RAPD 5 específicos de la línea Coronado (y por tanto ausentes en Guadyerbas) 2 específicos de Guadyerbas (ausentes en Coronado Sin embargo solamente 3 de los 5 marcadores de Coronado y uno de los 2 de la línea Guadyerbas, están ausentes de las otras líneas de cerdo Ibérico que se han analizado. Marcadores AFLP El análisis mediante las 12 combinaciones analizadas produjo aproximadamente 1733 bandas, lo que representa una media de 140 bandas por combinación. Sólo un 6% del total de bandas encontradas resultó ser polimórfico. De estas bandas 26 se encontraban presentes en todos los individuos de una de las líneas y ausentes en los individuos de la otra línea. Hemos encontrado 12 marcadores específicos de la estirpe Coronado y 14 de la estirpe Guadyerbas, así como 8 marcadores específicos del cromosoma Y. INFORMACION CIENTIFICA Y TECNICA PROPORCIONADA POR EL PROYECTO. POSIBLES APLICACIONES El ADN utilizado procedía de muestras de sangre obtenidas a partir de animales de origen conocido. El ADN genómico se extrajo a partir de muestras de 2 ml. De sangre,usando precicipatión con fenol-cloroformo y etanol. El precipitado se resuspendió en buffer TE ph 7.4 (10mM Tris-HCl, 1mM EDTA). La composición del banco de ADN disponible aparece en la siguiente Tabla: Raza Nº. Líneas/Ganaderías Nº. De Animales 4

5 Ibérico Duroc 8 82 Ibérico x Duroc 1 13 Landrace 1 76 Large White 1 6 TOTAL Marcadores RAPD Para la detección de este tipo de marcadores se han empleado 295 oligonucleótidos de 10 pares de bases, correspondientes a los kits A, B, C, E, F, H, N, R, T, W, X, Y, Z, AA y AB ( Operon Technologies Inc). En primer lugar se realizó un bulked analysis, para lo cual se mezclaron cantidades iguales de ADN genómico. El nº de animales empleado para las mezclas estuvo en función de las disponibilidades de ADN de cada línea/raza, con un máximo de diez. Como testigo del genomio Ibérico se utilizó una muestra de ADN de animales de l estirpe Torbiscal. Una vez detectado un posible marcador de línea se hizo análisis individual con las muestras disponibles. Las condiciones experimentales utilizadas en la PCR se indican en las dos Tablas siguientes: Volumen de Reacción: 25 µl; Tampón PCR 1x Cebador DNTPs Cl 2 Mg ADN Taq 0.2 µl 0.2 mm 2.0 mm 15 ng 1.0 U Programa (Termociclador Perkin - Elmer 2400) Temperatura 94º C 42º C 72º C 5 Ciclos 1 min. 1 min. 2 min. 35 Ciclos 30 seg. 30 seg. 75 seg. Extensión Final min. Aplicación del sistema a lomos y jamones. Se ha dispuesto de muestras de carne y de productos elaborados de larga duración (jamones de 2 años de curación). El método de extracción fue análogo al empleado para la sangre, previa liofilización y trituración de las muestras de músculo. Diferenciación de líneas de Ibérico. Para la consecución de este tercer objetivo se han empleado, además de los marcadores RAPD, otros dos tipos de marcadores: RDA y AFLP. RDA (Representational Difference Analysis) El objetivo era la obtención de marcadores específicos de raza mediante la técnica RDA, que permite detectar diferencias específicas entre genomas de dos individuos (Lisitsyn et el., 1993; Myers, 1993). El objetivo de la técnica es buscar RFLPs entre el ADN de dos individuos, mediante ciclos sucesivos de hibridación selectiva y amplificación. Con el fin de facilitar la puesta apunto de la técnica se escogieron en una primera fase dos razas de cerdos muy alejadas: Landrace e Ibérico empleandose muestras de ADN tanto de machos como de hembras. Si el método funcionaba deberíamos obtener fragmentos específicos del Cromosoma Y. 5

6 El protocolo experimental utilizado fue el descrito por Lisitsyn y col. (1993), utilizando oligonucleótidos BamHI y tres ciclos PCR de amplificación PCR e hibridación selectivas. Los productos PCR RDA se digirieron con BamHI, previamente defosforilada para evitar las insercciones múltiples y ligada al plásmido puc18 cortado con BamHI. EL sistema de marcaje utilizado fue no-radiactivo (Amersham; Fluorescein Gene Images:RPN 3510). El ADN se fijó a una membrana de nylon durante 2 horas a 80ºC, realizandose las hibridaciones a 65ºC. Como se ha indicado este método consiste en la búsqueda de secuencias de ADN distintas entre dos genomas de partida, denominados generalmente "Tester" y "Driver" y requiere las siguientes fases: a) Preparación de amplicones: El primer paso es la preparación de representaciones de los dos genomas a analizar para reducir su complejidad. Para ello las dos muestras de ADN se digieren con un enzima de restricción y a continuación se ligan unos adaptadores específicos de secuencia conocida que permiten la amplificación por PCR (de este modo trabajamos con una porción del genoma consistente en los fragmentos de ADN de tamaño amplificable por PCR). b) Hibridación sustractiva: Esta segunda fase de la técnica consiste en varios ciclos con los pasos siguientes: b.1.-desnaturalización de las muestras b.2.-hibridación competitiva entre una mínima cantidad de ADN Tester y una cantidad considerable de ADN Driver, de modo que aseguramos que las secuencias que sean comunes a los dos genomas formen híbridos tipo Tester-Driver o Driver-Driver. b.3.-amplificación por PCR utilizando como cebadores secuencias complementarias a los adaptadores del ADN Tester. De este modo, en los ciclos sucesivos se produce un enriquecimiento gradual de las secuencias que están presentes en el ADN Tester (híbridos tipo Tester-Tester), pero no en el Driver, que serán por lo tanto las secuencias específicas de ADN Tester que diferencian ambos genomas. Marcadores AFLP Estos marcadores son fragmentos de restricción obtenidos mediante digestión del ADN genómico y posterior amplificación PCR. Por sus cualidades pueden resultar muy útiles para la caracterización de poblaciones. En este proyecto se han empleado para caracterizar 2 poblaciones de cerdos Ibéricos tradicionales del tipo Negro Lampiño: Guadyerbas y Coronado. El número total de animales utilizados ha sido de catorce, de los cuales diez correspondían a la primera de las estirpes (5 machos y 5 hembras) mientras que de la segunda se emplearon 4 machos. Para esta técnica se ha empleado el protocolo descrita por Vo y col (1995), aunque con ligeras modificaciones. La amplificación de los fragmentos de ADN tuvo lugar en dos etapas. Primero se realizó una preamplificación, con las combinaciones de primers siguientes: EcoRI+A/MseI+C, EcoRI+A/MseI+G, EcoRI+A/MseI+T, EcoRI+C/MseI+C y EcoRI+C/MseI+T. Las condiciones PCR se describen en las Tablas siguientes: Volumen de Reacción: 20 µl; Tampón PCR 1x Primer EcoRI Primer MseI DNTPs Cl 2 Mg ADN diluido Taq 30 ng. 30 ng. 4 mm 2.0 mm 3 µl 0.4 U Programa (Termociclador Perkin Elmer 9600) Temperatura 94º C 60º C 72º C 28 Ciclos 30 seg. 60 seg. 60 seg. 6

7 La segunda etapa es la amplificación selectiva y se realiza con un primer de la misma secuencia que los usados en la preamplificación, pero que contienen tres nucleótidos selectivos en la posición 3. Las condiciones en esta segunda etapa fueron: Volumen de Reacción: 20 µl; Tampón PCR 1x Primer EcoRI * Primer MseI dntps Productos de la preamplificación ( diluidos) 5 ng. 30 ng. 2 mm 5 µl *Marcado radiactivamente con [ γ 33 P]ATP Programa(Termociclador Perkin Elmer 9600) Temperatura 94º C 65º C 72º C 1 ciclo 30 seg. 30 seg. 60 seg. 12 ciclos En ellos la Tª de annealing baja 0.7ªC por ciclo 23 Ciclos 60 seg. 30 seg #. 60 seg. # La temperatura en esta fase fue de 56º C. Los productos de amplificación se analizaron mediante geles de poliacrilamida desnaturalizados, visualizando posteriormente por autorradiografía los patrones AFLP. Las similaridades genéticas entre líneas se analizaron mediante el programa NTSYS-PC Versión 1.8, para lo cual los fragmentos polimórficos fueron identificados con la clave 1 para presencia y 0 para ausencia. Para el cálculo de las matrices de similaridad se usó el coeficiente de Jaccard: S = N XY / (N XY +N X +N Y ) N XY es el número de fragmentos de ADN comunes a los individuos comparados (X e Y) N X y N Y es el número total de fragmentos existentes en los individuos X e Y respectivamente. Las matrices así definidas son analizadas mediante el método UPGMA y los resultados usados para la construcción de dendogramas. A fin de constatar la utilidad de los AFLP para la construcción de dendogramas se calculó otro, para los individuos de la estirpe Guadyerbas, utilizando la matriz de coeficientes de parentesco. Para la estirpe Coronado no fue posible esto por carecer de genealogía controlada. PUBLICACIONES Artículos científicos Castellanos, C., Rodríguez, C Identificación de líneas de cerdo Ibérico mediante marcadores RAPD. ITEA, Extra.16.I Castellanos, C., Barragán, C., Rodríguez, M.C Detection of four porcine Y - specific markers by RAPD. Animal Genetics, Ovilo, C., Rodríguez, C Caracterización molecular en poblaciones porcinas de las razas Landrace e Ibérica mediante marcadores RAPD. ITEA, 92 A pp. 7

8 Castellanos, C., Barragán, C., Rodríguez, M.C Utilización de RAPD para la detección de marcadores del cromosoma Y en cerdos. ITEA, 92 A pp. Castellanos, C., Ovilo, C., Silió, L Caracterización de dos líneas de cerdo ibérico negro lampiño mediante marcadores PCR RAPD. ITEA, Extra.18I Trabajos presentados a congresos, reuniones o simposios Ovilo, C., Castellanos, C., Rodriguez, C., Silió, L. Differentiation of Iberian pig genotypes using RAPD and AFLP markers. Pig Breeders RoundTable. Wye, Kent (Gran Bretaña). Abril, Castellanos, C., Barragán, C., Rodriguez, M.C. Toro, M., Silió, L. Identification of Duroc and Iberian pigs using RAPD as diagnostic markers. 48 th Annual Meeting of teh EAAP. Viena (Austria). Agosto,

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. info@atgen.com.uy www.atgen.com.uy

Más detalles

Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala

Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala IICA/Red SICTA-CIAT INFORME DE AVANCE Gerardo Gallego - Harold

Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

MEJORA GENÉTICA EN EL GANADO PORCINO

MEJORA GENÉTICA EN EL GANADO PORCINO MEJORA GENÉTICA EN EL GANADO PORCINO PORCINO Elevada eficacia productiva Ciclo productivo y reproductivo intenso + - elevado nº de crías/parto - intervalo generacional corto -elevada h 2 de caracteres

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR)

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) Centro de de Microscopía Electrónica Facultad de de Ciencias Médicas Universidad Nacional de de Córdoba

Más detalles

5. MATERIALES Y MÉTODOS

5. MATERIALES Y MÉTODOS 5. MATERIALES Y MÉTODOS 5.1 Equipos Los siguientes termocicladores se emplearon para la amplificación por PCR: - Perkin Elmer, GeneAmp PCR System 2400. - Perkin Elmer, GeneAmp PCR System 9600. - Applied

Más detalles

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras METODOLOGIA DEL PCR Lic. Jorge Mato Luis Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras Desnaturalización del DNA 5 A G G T T A G T G G A C C C T T G A T 3 3 T C C A

Más detalles

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

Materiales para la secuenciación de ADN

Materiales para la secuenciación de ADN Introduccion La Secuenciación Sanger es un método de secuenciación de ADN en el que el ADN diana se desnaturaliza y se hibrida con un cebador de oligonucleótidos, que se extiende entonces gracias a la

Más detalles

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN 5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN Materiales - Eppendorf de 1,5 ml estériles - Eppendorf de pared fina para PCR - Puntas de pipeta estériles desechables - Guantes

Más detalles

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles

Practica la genética Ficha didáctica del profesorado Bachillerato

Practica la genética Ficha didáctica del profesorado Bachillerato Ficha didáctica del profesorado Bachillerato www.eurekamuseoa.es Extracción de ADN Cuál es la función de cada uno de los ingredientes utilizados para realizar la disolución tampón para la visualización

Más detalles

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa?

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa? 2º BIOQUÍMICA CUESTIONES 1. Por qué la PCR convencional no es cuantitativa? En la PCR convencional, la cuantificación del ADN de la muestra es complicada debido a que la eficacia de amplificación va disminuyendo

Más detalles

CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015

CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 DEFINICIÓN PCR: Constituye la técnica más importante para amplificar ácidos nucleicos in vitro. Ambas hebras del DNA de interés son replicadas

Más detalles

TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO

TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO TEST de PATERNIDAD Este experimento introduce a los alumnos en el uso del ADN y la PCR para simular una determinación de paternidad. Los estudiantes

Más detalles

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática.

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Departamento de Bioquímica Médica y Biología Molecular Práctica 3 Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Curso 1 Medicina (Abril) 2012 BIOQUÍMICA

Más detalles

Reacción en cadena de la Polimerasa (PCR)

Reacción en cadena de la Polimerasa (PCR) Explicación de TP Nº 2 Reacción en cadena de la Polimerasa (PCR) Química Biológica Patológica Dra. Mariana L. Ferramola Dra. Gabriela Lacoste 2015 Definición de PCR Es la amplificación enzimática de un

Más detalles

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR Módulo 1 Amplificación de un fragmento de ADN genómico por PCR En este primer módulo se amplificará por PCR, mediante el uso de oligonucleótidos específicos, un fragmento de ADN genómico de Aspergillus

Más detalles

CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA. Grado en Medicina

CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA. Grado en Medicina DEPARTAMENTO DE BIOQUÍMICA Y BIOLOGÍA MOLECULAR III FACULTAD DE MEDICINA UNIVERSIDAD COMPLUTENSE DE MADRID CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA Grado en Medicina CURSO ACADÉMICO 2014/2015 INDICE

Más detalles

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN.

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. PROGRAMA CONTROL DE CALIDAD DE MUESTRAS El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. El programa completo de control de calidad de muestras de ADN y ARN engloba diferentes

Más detalles

PCR. Técnica inventada por Kary Mullis :1987. Premio Nobel 1993. Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN

PCR. Técnica inventada por Kary Mullis :1987. Premio Nobel 1993. Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN PCR PCR Técnica inventada por Kary Mullis :1987 Premio Nobel 1993 Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN Aprovecha los requerimientos de la replicación Templete ADN Nucleótidos

Más detalles

EDUCACION CONTINUADA. Introducción. Caso clínico nº 1

EDUCACION CONTINUADA. Introducción. Caso clínico nº 1 EDUCACION CONTINUADA L. Castaño, J.R. Bilbao, I. Urrutia An Esp Pediatr 1997;46:513-518. Introducción a la biología molecular y aplicación a la pediatría (5): Casos clínicos. Alteraciones genéticas en

Más detalles

Técnicas de Biología Molecular

Técnicas de Biología Molecular Técnicas de Biología Molecular DNA I. Enzimas de restricción Análisis Las enzimas de restricción fueron aisladas de bacterias; su función natural es proteger contra DNA extraño II. Separación electroforética

Más detalles

POLIMORFISMO HhaI DEL GEN DE LA HORMONA DE CRECIMIENTO EN CERDOS IBÉRICOS: RELACIÓN CON CARACTERES PRODUCTIVOS

POLIMORFISMO HhaI DEL GEN DE LA HORMONA DE CRECIMIENTO EN CERDOS IBÉRICOS: RELACIÓN CON CARACTERES PRODUCTIVOS POLIMORFISMO HhaI DEL GEN DE LA HORMONA DE CRECIMIENTO EN CERDOS IBÉRICOS: RELACIÓN CON CARACTERES PRODUCTIVOS Ana Fernández, Cristina Óvilo, Carmen Rodríguez, Luis Silió Dpto. Mejora Genética y Biotecnología

Más detalles

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS Prácticas docentes en la COD: 10-71 APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS FUNDAMENTO TEÓRICO La PCR es una técnica que permite llevar a cabo la síntesis in vitro de fragmentos de ADN. Está basada

Más detalles

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica TÉCNICAS GENÓMICAS Utilidad/Objetivos: 1) Detección de microorganismos directamente en muestras clínicas identificando un fragmento específico del genoma del microorganismo concreto 2) Cuantificación del

Más detalles

DETERMINACIÓN DEL FACTOR Rh por PCR

DETERMINACIÓN DEL FACTOR Rh por PCR Ref.PCRRh DETERMINACIÓN DEL FACTOR Rh por PCR 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

7/13/2009. Breve introducción a la biología molecular y sus aplicaciones. Victoria koala. Queensland koala. Morfología vs. ADN? Phascolarctus cinereus

7/13/2009. Breve introducción a la biología molecular y sus aplicaciones. Victoria koala. Queensland koala. Morfología vs. ADN? Phascolarctus cinereus Morfología vs. ADN? Phascolarctus cinereus Queensland koala Victoria koala New South Wales koala 3 subespecies Morfológicamente: Diferencias en tamaño y color principalmente Molecularmente: Un grupo dividido

Más detalles

LECCIÓN 3. Caracterización mediante marcadores moleculares - ADN. Lección 3 1

LECCIÓN 3. Caracterización mediante marcadores moleculares - ADN. Lección 3 1 LECCIÓN 3. Caracterización mediante marcadores moleculares - ADN. Lección 3 1 Nociones generales sobre Marcadores Moleculares -ADN Analizan directamente la molécula de ADN. Detectan ciertas variaciones

Más detalles

Tema 11. Herramientas de la genética molecular

Tema 11. Herramientas de la genética molecular Tema 11. Herramientas de la genética molecular Genética CC. Mar 2004-05 Objetivos Técnicas de clonación Construcción de genotecas e identificación de secuencias Mapas de restricción Amplificación (PCR)

Más detalles

Comprobando la calidad del DNA genómico mediante electroforesis en gel

Comprobando la calidad del DNA genómico mediante electroforesis en gel Comprobando la calidad del DNA genómico mediante electroforesis en gel GELES 1 Y 2 Agarosa 0.8 %, electroforesis a 1 V/cm Muestras: Se ha cargado muestras de DNA genómico no digerido, antes (líneas impares)

Más detalles

Técnicas moleculares.

Técnicas moleculares. Técnicas moleculares. DMTV Carolina Acevedo Curso de Microbiología 2015 SÍNTESIS IN VITRO DE UNA GRAN CANTIDAD DE COPIAS DE UN SEGMENTO DE ADN EXISTENTE EN UNA MUESTRA. O sea. Amplificamos en forma exponencial

Más detalles

DIAGNÓSTICO GENÉTICO DE LA HIPERCOLESTEROLEMIA FAMILIAR POR RFLP Ref.PCRCOLEST(4 prácticas)

DIAGNÓSTICO GENÉTICO DE LA HIPERCOLESTEROLEMIA FAMILIAR POR RFLP Ref.PCRCOLEST(4 prácticas) DIAGNÓSTICO GENÉTICO DE LA HIPERCOLESTEROLEMIA FAMILIAR POR RFLP Ref.PCRCOLEST(4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios

Más detalles

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas ELEMENTOS BÁSICOS DE LA INVESTIGACIÓN EN GENES Análisis

Más detalles

Clonación molecular. Clonar significa hacer copias idénticas

Clonación molecular. Clonar significa hacer copias idénticas INGENIERÍA GENÉTICA Clonación molecular Clonar significa hacer copias idénticas Este término originalmente fue aplicado al procedimiento de aislar una célula y permitirle reproducirse creando una población

Más detalles

Reacción en cadena de la polimerasa (PCR)

Reacción en cadena de la polimerasa (PCR) Dr. Alejandro Leal Reacción en cadena de la polimerasa (PCR) La reacción en cadena de la polimerasa (PCR, por sus siglas en inglés de "polymerase chain reaction") es un método de amplificación in vitro

Más detalles

Práctico: Genética bacteriana 2007.

Práctico: Genética bacteriana 2007. Práctico: Genética bacteriana 2007. Actividad integrada Departamento de Genética Departamento de Bacteriología y Virología. OBJETIVOS Objetivos generales El estudiante al terminar la actividad práctica

Más detalles

Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez

Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez 1 Objetivos Entender la técnica: Reacción de Polimerasa en Cadena (PCR por sus siglas en inglés)

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

Análisis en Genética 1

Análisis en Genética 1 Análisis en Genética 1 Análisis Genético FUNCION BIOLOGICA Gen o genes implicados Localización Cartografiado Función Interacciones TIPOS DE MUTACIÓN MUTACIÓN GÉNICA -El alelo de un gen sufre un cambio,

Más detalles

Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares. Técnicas Moleculares. Técnicas Moleculares 8/13/13

Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares. Técnicas Moleculares. Técnicas Moleculares 8/13/13 8/13/13 Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares CAF516 O Recursos Genéticos y Biotecnología 14 Agosto 2013 Técnicas Moleculares Aplicaciones en muchas disciplinas Generan

Más detalles

(aislado directamente de células o tejidos) de otros tipos de ADN, como el

(aislado directamente de células o tejidos) de otros tipos de ADN, como el Glosario admixtura: se refiere al estado de estar mezclado (del inglés admixture). Ocurre cuando se entrecruzan individuos de dos o más poblaciones que se encontraban previamente separadas y el resultado

Más detalles

3/22/2010. Iván Ferrer Rodríguez, PhD Catedrático. En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR.

3/22/2010. Iván Ferrer Rodríguez, PhD Catedrático. En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR. Iván Ferrer Rodríguez, PhD Catedrático En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR. Síntesis "in vitro" de secuencias específicas de ADN son amplificadas.

Más detalles

DIAGNÓSTICO GENÉTICO DEL CÁNCER HEREDITARIO Ref.PCRCAN(4 prácticas)

DIAGNÓSTICO GENÉTICO DEL CÁNCER HEREDITARIO Ref.PCRCAN(4 prácticas) DIAGNÓSTICO GENÉTICO DEL CÁNCER HEREDITARIO Ref.PCRCAN(4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción

Más detalles

Cultura Cientí fica 1 Bachillerato

Cultura Cientí fica 1 Bachillerato Cultura Cientí fica 1 Bachillerato 3. La revolución genética: biotecnología Actividades de consolidación 1. Cualquier molécula de ADN formada por la unión de segmentos de ADN de origen diferente es: a)

Más detalles

CAPÍTULO 3: ANÁLISIS DE MARCADORES MICROSATÉLITES SELECCIÓN DE MARCADORES

CAPÍTULO 3: ANÁLISIS DE MARCADORES MICROSATÉLITES SELECCIÓN DE MARCADORES CAPÍTULO 3: ANÁLISIS DE MARCADORES MICROSATÉLITES SELECCIÓN DE MARCADORES Todo nuestro trabajo basado en el análisis de microsatélites se realizó con un panel de 8 de los 29 microsatélites descritos en

Más detalles

CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL

CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL LIBRO DE MEMORIAS 2 CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL Santiago de Cali, 23 al 28 de agosto de 2010 3 Libro de memorias

Más detalles

Análisis de paternidad y parentesco en alpacas (Vicugna pacos) mediante marcadores moleculares

Análisis de paternidad y parentesco en alpacas (Vicugna pacos) mediante marcadores moleculares Análisis de paternidad y parentesco en alpacas (Vicugna pacos) mediante marcadores moleculares MSc. Juan Agapito Panta Laboratorio de Genómica y Biología Molecular Instituto Peruano de Energía Nuclear

Más detalles

Tecnologías basadas en la PCR

Tecnologías basadas en la PCR Tecnologías de marcadores moleculares para estudios de diversidad genética de plantas: Módulo de aprendizaje Tecnologías basadas en el ADN Tecnologías basadas en la PCR Fundamentos de la PCR Derechos de

Más detalles

P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA"

P.C.R. Técnica de amplificación enzimática de secuencias específicas de DNA P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA" Paso 1: Desnaturalización del DNA Paso 2: Hibridación de los "Primers" Paso 3: Extensión Paso 1: Desnaturalización del DNA

Más detalles

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G.

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G. C825T Sistema para la detección de la mutación C825T en el gene de la proteína G. Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. Info@atgen.com.uy www.atgen.com.uy

Más detalles

Miguel Dita (1) Einar Martínez de la Parte (2) Monica Blanco (3)

Miguel Dita (1) Einar Martínez de la Parte (2) Monica Blanco (3) Generalidades de la PCR: MÉTODO DE DIAGNÓSTICO MOLECULAR DE Foc RT4 Miguel Dita (1) Einar Martínez de la Parte (2) Monica Blanco (3) 1) Bioversity International, Costa Rica 2) INISAV Cuba. 3) Universidad

Más detalles

Catálogo de Servicios GenXPro

Catálogo de Servicios GenXPro Catálogo de Servicios GenXPro Aplicando las mejores y más sensibles técnicas de preparación de muestras, en combinación con las técnicas más modernas de secuenciación de última generación, GenXPro ofrece

Más detalles

MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR)

MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) OBJETIVOS - Definir PCR, conocer los reactivos que

Más detalles

11 knúmero de publicación: 2 153 359. 51 kint. Cl. 7 : C12Q 1/68

11 knúmero de publicación: 2 153 359. 51 kint. Cl. 7 : C12Q 1/68 k 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 knúmero de publicación: 2 13 39 1 kint. Cl. 7 : C12Q 1/68 C12P 19/34 C07H 1/12 12 k TRADUCCION DE PATENTE EUROPEA T3 86 knúmero de solicitud europea:

Más detalles

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri OBJETIVO Desarrollar un banco de datos a partir de plantas de origen indudable y del uso

Más detalles

COMPLEJO MAYOR DE HISTOCOMPATIBILIDAD. Molecular

COMPLEJO MAYOR DE HISTOCOMPATIBILIDAD. Molecular COMPLEJO MAYOR DE HISTOCOMPATIBILIDAD Dra.. Flora Calzadilla Lugo Laboratorio de Genética Molecular POLIMORFISMO GENETICO Presencia en una población de múltiples un gen y que debe estar presente en el

Más detalles

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA BIOLOGIA MOLECULAR Hemos elaborado un programa en 3 niveles, en función del tipo de estudiante y las posibilidades del centro educativo: 1. NIVEL BASICO 2. NIVEL MEDIO DANAEXTRACTOR KIT Práctica que constituye

Más detalles

Comprar un semental, con una fiabilidad del 99%, a una compañía de prestigio.

Comprar un semental, con una fiabilidad del 99%, a una compañía de prestigio. 1 1. Un director de agricultura de una comunidad autónoma que dispone de 20.000 vacas de leche cuya producción no está controlada quiere mejorar la calidad genética de los animales de su región, qué debe

Más detalles

Fisiogenética Vegetal

Fisiogenética Vegetal Fisiogenética Vegetal USO DE MARCADORES MOLECULARES, aplicaciones y ejemplos Cecilia Baginsky - Tradicionalmente los marcadores moleculares utilizados en estudios genéticos y de mejoramiento eran aquellos

Más detalles

PROCEDIMIENTO PARA LA UTILIZACIÓN DEL POLIMORFISMO DEL GEN COMT (CATECOL-OXI-METILTRANSFERASA) EN EL DIAGNÓSTICO DEL SÍNDROME DE FIBROMIALGIA

PROCEDIMIENTO PARA LA UTILIZACIÓN DEL POLIMORFISMO DEL GEN COMT (CATECOL-OXI-METILTRANSFERASA) EN EL DIAGNÓSTICO DEL SÍNDROME DE FIBROMIALGIA 2 PROCEDIMIENTO PARA LA UTILIZACIÓN DEL POLIMORFISMO DEL GEN COMT (CATECOL-OXI-METILTRANSFERASA) EN EL DIAGNÓSTICO DEL SÍNDROME DE FIBROMIALGIA D E S C R I P C I Ó N OBJETO DE LA INVENCIÓN La presente

Más detalles

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada La PCR La Reacción en Cadena de la Polimerasa es la herramienta más utilizada PCR- Ventajas y Usos Amplificación ilimitada de secuencias de interés. Rápida, Sencilla y Eficaz. Técnica altamente sensible

Más detalles

GUÍA PARA LA SECUENCIACIÓN AUTOMÁTICA DE DNA

GUÍA PARA LA SECUENCIACIÓN AUTOMÁTICA DE DNA Página 1 de 16 GUÍA PARA LA SECUENCIACIÓN AUTOMÁTICA DE DNA SERVICIO DE SECUENCIACIÓN-S.C.S.I.E. UNIVERSITAT DE VALÈNCIA Página 2 de 16 CONTENIDOS: 1.- Secuenciación automática de DNA 2.- Tipos de molde

Más detalles

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml)

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml) PCR SIMULADA Ref.PCR Simulada (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón

Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón Reacción en Cadena de la INTRODUCCION: Polimerasa (RCP) Década de los 70: Grandes

Más detalles

Actualización en nuevas técnicas de diagnóstico genético molecular disponibles en Chile

Actualización en nuevas técnicas de diagnóstico genético molecular disponibles en Chile Actualización en nuevas técnicas de diagnóstico genético molecular disponibles en Chile Dra. Teresa Aravena Clínica INDISA Hospital Clínico de la Universidad de Chile Hospital Dr. Sótero del Río Exámenes

Más detalles

EDUCACION CONTINUADA. Introducción. Caso clínico

EDUCACION CONTINUADA. Introducción. Caso clínico EDUCACION CONTINUADA L. Castaño, J.R. Bilbao, B. Calvo An Esp Pediatr 1997;47:201-206. Introducción a la biología molecular y aplicación a la pediatría (6): Caso clínico: Trastorno molecular en la diabetes

Más detalles

Protocolos de secuenciación de ADN

Protocolos de secuenciación de ADN 1 Protocolos de secuenciación de ADN Introducción El método de secuenciación utilizado aquí es el desarrollado por Sanger en 1975. Este consiste en la incorporación de didesixinucleótidos marcados fluorescentemente

Más detalles

M.B.N. Lara-Chávez, H. Guillén-Andrade, J. A. Vidales-Fernández, M. Gutiérrez- Contreras, J. López-Medina, M. E. Ángel-Palomares y T. Chávez-Bárcenas.

M.B.N. Lara-Chávez, H. Guillén-Andrade, J. A. Vidales-Fernández, M. Gutiérrez- Contreras, J. López-Medina, M. E. Ángel-Palomares y T. Chávez-Bárcenas. Proceedings VI World Avocado Congress (Actas VI Congreso undial del Aguacate) 2007. Viña Del ar, Chile. 12 16 Nov. 2007. ISBN No 978-956-17-0413-8. CARACTERIZACIÓN DE AISLADOS DE Phytophthora cinnamomi

Más detalles

Actividades de clase para realizar con ordenador: http://iessuel.org/ccnn/

Actividades de clase para realizar con ordenador: http://iessuel.org/ccnn/ 4º E.S.O. Biología y Geología - Unidad 5.- La herencia biológica Actividades de clase para realizar con ordenador: http://iessuel.org/ccnn/ Alumno/a... Fecha... 1.- Completa: Todos los seres vivos tienen

Más detalles

Características del kit:

Características del kit: ! La detección de clonalidad mediante análisis molecular por PCR de reordenamientos de los genes de las inmunoglobulinas (Ig) y TCR, es un instrumento de gran valor en el diagnóstico de los procesos linfoproliferativos

Más detalles

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now.

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now. Unidad Curricular: Virología y Micología Veterinaria 1 TRABAJO PRÁCTICO No. 3 AMPLIFICACIÓN DE GENES VIRALES Reacción en Cadena de la Polimerasa, conocida como PCR (por sus siglas en inglés: Polimerase

Más detalles

PCR. Qué es la PCR? T a de fusión de oligonucleótidos (t m )

PCR. Qué es la PCR? T a de fusión de oligonucleótidos (t m ) % a de fusión de oligonucleótidos (t m ) Qué es la PCR? La reacción en cadena de la polimerasa (PCR: polymerase chain reaction) es una técnica de amplificación de secuencias de DNA in vitro t m = 2 (A

Más detalles

TaqMan GMO Maize Quantification Kit. Part No: 4481972

TaqMan GMO Maize Quantification Kit. Part No: 4481972 TaqMan GMO Maize Quantification Kit Part No: 4481972 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan

Más detalles

Tema 12. Estructura genética de las poblaciones. Genética CC.MM.

Tema 12. Estructura genética de las poblaciones. Genética CC.MM. Tema 12. Estructura genética de las poblaciones Genética CC.MM. Contenidos Estructura genética de las poblaciones Cuantificación de la variabilidad genética en las poblaciones Equilibrio Hardy-Weinberg

Más detalles

OLIMPÍADA ARGENTINA DE BIOLOGÍA APEB ÁREA DE ACTUALIZACIÓN Y PERFECCIONAMIENTO EN LA ENSEÑANZA DE LA BIOLOGÍA CONTINUIDAD Y CAMBIO DE LAS ESPECIES I:

OLIMPÍADA ARGENTINA DE BIOLOGÍA APEB ÁREA DE ACTUALIZACIÓN Y PERFECCIONAMIENTO EN LA ENSEÑANZA DE LA BIOLOGÍA CONTINUIDAD Y CAMBIO DE LAS ESPECIES I: MINISTERIO DE EDUCACIÓN, CIENCIA Y TECNOLOGIA UNIVERSIDAD NACIONAL DE RIO CUARTO FACULTAD DE CIENCIAS EXACTAS, FÍSICO - QUÍMICAS Y NATURALES DEPARTAMENTO DE CIENCIAS NATURALES OLIMPÍADA ARGENTINA DE BIOLOGÍA

Más detalles

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082 Página 1 de 5 1. OBJETIVO Detectar la presencia de Campylobacter jejuni en hamburguesa de pollo mediante técnica de PCR. 2. CAMPO DE APLICACIÓN Y ALCANCE Aplicar este procedimiento a muestras de hamburguesa

Más detalles

MATERIALES Y MÉTODOS. Cepas Utilizadas

MATERIALES Y MÉTODOS. Cepas Utilizadas MATERIALES Y MÉTODOS Cepas Utilizadas Para el presente trabajo se utilizaron tres cepas Tipo: Mycobacterium aviumintracellulare (proporcionada al Laboratorio Estatal de Salud Pública por el Instituto Nacional

Más detalles

Evaluación de tres estrategias de diagnóstico para el Huanglongbing de los cítricos en la zona de Cuitláhuac, Ver.

Evaluación de tres estrategias de diagnóstico para el Huanglongbing de los cítricos en la zona de Cuitláhuac, Ver. UNIVERSIDAD VERACRUZANA Facultad de Ciencias Biológicas y Agropecuarias Campus Peñuela Zona Orizaba-Córdoba Evaluación de tres estrategias de diagnóstico para el Huanglongbing de los cítricos en la zona

Más detalles

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental.

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Gemma Saucedo. Laboratorio Aguas de Barcelona 22-23 de noviembre de 2006 Introducción PCR: Polymerase Chain Reaction

Más detalles

OBTENCIÓN DE MUTANTES

OBTENCIÓN DE MUTANTES OBTENCIÓN DE MUTANTES parp::hyg DE Fusarium oxysporum f. sp. lycopersici MEDIANTE LA TÉCNICA PCR DE DOBLE FUSIÓN. Gallegos Almanza I. A. (1) ; Martínez Cadena M. G. (2) ; Ferrel Cano L. E. (2). (1) Facultad

Más detalles

Mapeo genómico: Determinación de la localización de elementos en un genoma, con respecto de marcadores identificados

Mapeo genómico: Determinación de la localización de elementos en un genoma, con respecto de marcadores identificados Mapeo genómico: Determinación de la localización de elementos en un genoma, con respecto de marcadores identificados Tipos de mapas: MAPAS FISICOS (de restricción, citogenéticos, de híbridos de radiación...)

Más detalles

Esquema de 2 razas. No se utilizan líneas especializadas. Ahorro económico Líbido superior Resistencia al medio No en España

Esquema de 2 razas. No se utilizan líneas especializadas. Ahorro económico Líbido superior Resistencia al medio No en España Esquema de 2 razas USA y gran parte de Europa Empresas de Mejora Genética La conformación no es importante Landrace y Large White Buenos rendimientos en: IC, Velocidad crecimiento y cantidad de carne Machos

Más detalles

Técnica de CGH-array. María Rodríguez-Rivera

Técnica de CGH-array. María Rodríguez-Rivera Técnica de CGH-array María Rodríguez-Rivera Laboratori de Citogenètica Molecular. Servei de Patologia. Hospital del Mar. Programa de Càncer-IMIM. Barcelona Índice Introducción a los microarrays Arrays

Más detalles

Índice. 4. Protocolo de envío de muestras 9 5. Problemas más frecuentes durante la secuenciación 10 6. Algunos datos y formulas de utilidad 17

Índice. 4. Protocolo de envío de muestras 9 5. Problemas más frecuentes durante la secuenciación 10 6. Algunos datos y formulas de utilidad 17 Índice Introducción 1 1. Modalidades de secuenciación 2 a. Secuenciación de una sola cadena 2 b. Secuenciación analítica 3 c. Secuenciación diagnóstica 3 2. Oligonucleótidos disponibles 5 3. Protocolo

Más detalles

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Para la purificación de ADN genómico de todos los kits de colección Oragene y ORAcollect. Visite nuestro sitio

Más detalles

TIPIFICACION HLA. Bioq. Eliana Palomino Lab. De Histocompatibilidad Hospital Privado

TIPIFICACION HLA. Bioq. Eliana Palomino Lab. De Histocompatibilidad Hospital Privado TIPIFICACION HLA Bioq. Eliana Palomino Lab. De Histocompatibilidad Hospital Privado Tipificación HLA: Estudio mediante el cual se determina cuales de todas las variantes conocidas del locus HLA están presentes

Más detalles

MEMORIA DE PRÁCTICAS SILVIA PÉREZ SOLANA

MEMORIA DE PRÁCTICAS SILVIA PÉREZ SOLANA MEMORIA DE PRÁCTICAS SILVIA PÉREZ SOLANA DATOS DE LA EMPRESA Instituto de Biotecnología y Biomedicina de Cantabria (CSIC-UC- SODERCAN), Avda. Herrera Oria s/n. Santander. El tutor CSIC fue Raúl Fernández

Más detalles

J.H. Calvo, A. Martínez-Royo, P. Sánchez, J.L. Alabart, J. Folch SEXAJE DE EMBRIONES EN OVINO MEDIANTE PCR ESPECÍFICA Y PCR-DUPLEX.

J.H. Calvo, A. Martínez-Royo, P. Sánchez, J.L. Alabart, J. Folch SEXAJE DE EMBRIONES EN OVINO MEDIANTE PCR ESPECÍFICA Y PCR-DUPLEX. J.H. Calvo, A. Martínez-Royo, P. Sánchez, J.L. Alabart, J. Folch SEXAJE DE EMBRIONES EN OVINO MEDIANTE PCR ESPECÍFICA Y PCR-DUPLEX Separata ITEA INFORMACIÓN TÉCNICA ECONÓMICA AGRARIA, VOL. 102 N.º 4 (354-359),

Más detalles

Northern blot control

Northern blot control TRANSCRIPTOMA - Northern blot - Aporta información sobre la presencia de un transcrito, su abundancia y su tamaño - Electroforesis: Se realiza en condiciones desnaturalizantes, Gel: agarosa 0,8-1,4% y

Más detalles

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico.

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. AQUAGESTION ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. Noviembre 2011 ACTUALIDAD Este año Sernapesca confirma

Más detalles

CAPÍTULO VI. Expresión de genes relacionados con apoptosis

CAPÍTULO VI. Expresión de genes relacionados con apoptosis CAPÍTULO VI Expresión de genes relacionados con apoptosis 1.- Introducción 2.- Protocolos para análisis genéticos 3.- Resultados en MCF-7 4.- Discusión 1.- Introducción Como se ha descrito anteriormente,

Más detalles

Reacción en cadena de la polymerasa (PCR)

Reacción en cadena de la polymerasa (PCR) Reacción en cadena de la polymerasa (PCR) 1 PCR Que es? Es una técnica in vitro diseñada para amplificar una región específica de DNA. Es extremadamente sensible, con la capacidad de amplificar millones

Más detalles

Método de extracción de adn en nematodos para su aplicación en el diagnóstico por técnicas moleculares.

Método de extracción de adn en nematodos para su aplicación en el diagnóstico por técnicas moleculares. Método de extracción de adn en nematodos para su aplicación en el diagnóstico por técnicas moleculares. INTRODUCCIÓN La determinación morfológica y morfométrica de nematodos fitopatógenos en los laboratorios

Más detalles

Equivalente de jornada completa: 2,0

Equivalente de jornada completa: 2,0 Proyecto Nº SC93-031 ESTUDIO DE UNA EXPLOTACION DE GANADO OVINO DE RAZA MANCHEGA EN REGIMEN EXTENSIVO Y ANALISIS DE LOS FACTORES PRODUCTIVOS Equipo Investigador: Vicente Gómez Martínez (L.V.) Julio Otal

Más detalles

Mutaciones asociadas a resistencia a estreptomicina y etambutol en Mycobacterium tuberculosis - secuenciación y desarrollo de cebadores.

Mutaciones asociadas a resistencia a estreptomicina y etambutol en Mycobacterium tuberculosis - secuenciación y desarrollo de cebadores. Mutaciones asociadas a resistencia a estreptomicina y etambutol en Mycobacterium tuberculosis - secuenciación y desarrollo de cebadores. Dr. Jaeson S. Calla Choque Universidad Peruana Cayetano Heredia

Más detalles

Técnicas descritas en el curso 7.28

Técnicas descritas en el curso 7.28 Técnicas descritas en el curso 7.28 Técnica: Clase 1 Experimento de incorporación de dntps Ensayo de extensión del cebador Ensayo de unión en filtro Electroforesis en gel Análisis de ADN Helicasa Polaridad

Más detalles