CIENCIA Y VIDA COTIDIANA

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamaño: px
Comenzar la demostración a partir de la página:

Download "CIENCIA Y VIDA COTIDIANA"

Transcripción

1 CIENCIA Y VIDA COTIDIANA Genética para andar por casa. Santiago Torres Martínez Catedrático de Genética Departamento de Genética y Microbiología Murcia, 7 de octubre de 2013 Genética: Parte de la biología que trata de la herencia y de lo relacionado con ella. DRAE

2 Genética Transmisión Genes Semejanza entre progenitores y descendientes Genética Transmisión Genes Variación porqué nos parecemos? porqué nos diferenciamos?

3 Porqué nos parecemos a nuestros padres? Porqué nos parecemos a nuestros hermanos, pero no somos iguales?

4 Hay personas genéticamente idénticas? SI, los gemelos idénticos (monocigóticos) Idénticos (monocigóticos) No idénticos (dicigóticos) esperma óvulo (Placenta compartida) (Placentas separadas) (En el 60-70% de los casos comparten la misma placenta aunque en separados sacos amnióticos)

5 Los gemelos monocigóticos son genéticamente idénticos, pero son indistinguibles? Los hermanos Bryan

6 zurdo? diestro Huellas dactilares Gemelos monocigóticos (= idénticos)

7 Qué quiere decir ser genéticamente idénticos? tener el mismo genoma Qué es el genoma? La totalidad de la información genética que tiene un organismo Dónde está la información genética? en el ADN El ADN es el material hereditario en humanos y en casi todos los organismos

8 Dónde está el ADN? huesos pulmones cerebro sangre corazón hígado músculo riñones páncreas esperma óvulos Dónde está el ADN? Célula humana Núcleo Cromosomas

9 Qué es el ADN? Ácido DesoxirriboNucléico Qué es el ADN? Molécula de ADN (cromosoma) Bases químicas A T G C

10 El ADN es una molécula química Formada por dos cadenas como esta: Nucleótidos Molécula de ADN

11 Watson y Crick propusieron en 1953 la estructura del ADN Watson y Crick con su modelo del ADN

12 El modelo de Watson y Crick requisitos fundamentales: cumplía tres 1. Potencial informativo (libertad de secuencia a lo largo de la cadena) egadlmncadcenuynorennrae uomqirnoemoaclobrudahare, enunlugardelamancha,decuy onombrenoquieroacordarme yanomeacuerdonuncadelama dredebruno,micolega

13 El modelo de Watson y Crick requisitos fundamentales: cumplía tres 2. Capacidad de autorreplicación (complementariedad de las bases) Cuando una célula se divide, cada célula hija recibe una réplica del ADN ADN ADN ADN Célula ADN ADN El ADN se duplica ADN Cada célula hija recibe una réplica del ADN ADN Se separan las células hijas

14 El modelo de Watson y Crick requisitos fundamentales: cumplía tres 3. Capacidad de mutación (posibilidad de cambios en la secuencia) enunlugardelamancha,decuyonom brenoquieroacordarme en un lugar de la mancha, de cuyo nombre no quiero acordarme en un lugar de la lancha, de cuyo nombre no quiero acordarme en un lugar de la mkncha, de cuyo nombre no quiero acordarme

15 El ADN está en el núcleo celular Célula humana Núcleo Cromosomas Cariotipo Cromosomas sexuales

16 Gametos Óvulo recién fertilizado

17 espermatozoide óvulo Óvulo recién fertilizado (44 cromosomas + X + X ) (22 cromosomas + X ) (44 cromosomas + X + Y ) (22 cromosomas + X ó Y) Cuántas combinaciones distintas de cromosomas maternos y paternos se pueden dar a la hora de producir gametos? Cada gameto, al azar, puede contener, por cada pareja de cromosomas, uno del padre o de la madre. Por tanto, una combinación posible puede ser: En total: 2 23 = combinaciones distintas de gametos, y 2 23 x 2 23 = combinaciones distintas de cigotos

18 Las posibles combinaciones son infinitas El Proyecto Genoma Humano Febrero 2001

19 En qué consiste el Proyecto Genoma Humano Identificar todos los genes humanos Determinar la secuencia de los más de 3 mil millones de nucleótidos del DNA humano Almacenar toda esta información en bases de datos públicas Célula Tres mil millones de nucleótidos ( letras ) llenarían unas 400 guías telefónicas de 500 páginas cada una

20 Nuestro genoma tiene unos tres mil millones de bases (unos genes) Los genes están en los cromosomas Gen 1 Proteína 1 Región intergénica (sin información para proteína) Gen 2 Proteína 2 Región intergénica (sin información para proteína)

21 Los genes llevan información cifrada para fabricar proteínas Gen 2 Gen 3 Gen 4 Gen 1 Proteína 2 Proteína 3 Proteína 4 Proteína 1 Los genes llevan información cifrada para fabricar proteínas Gen 2 Gen 3 Gen 4 Gen 1 Lactasa Una enzima que procesa un azúcar presente en la leche Miosina Una proteína mecánica que hace que los músculos se contraigan Colágeno Una proteína estructural que se encuentra en la piel y cartílagos Hemoglobina Una proteína de transporte que hace que los glóbulos rojos transporten oxígeno

22 nucleótidos GCAACTTCGGGATTCACTGCCACCT CGTTGAAGCCCTAAGTGACGGTGGA.. ADN GCAACUUCGGGAUUCACUGCCACCU ARN aminoácidos aa 1 aa 2 aa 3 aa 4 aa Código genético proteína El código genético

23 ADN ARN PROTEÍNA AAAAA núcleo citoplasma plantas bacterias animales humanos El ADN es básicamente el mismo en todos los organismos

24 Bacterias Levaduras Gusanos Moscas Gallo Ratón Perros Chimpancé Humanos Plantas ( genes) ( genes) ( genes) ( genes) ( genes) ( genes) ( genes) ( genes) ( genes) ( genes) Y después de la secuencia, qué?

25 Nuestros genomas no son iguales Persona 1 Persona 2 = Variaciones en el ADN Qué tipo de variaciones? Secuencia estándar Variaciones: Cambios de una base por otra: Polimorfismos Deleciones ó pérdidas Inserciones

26 Hay variaciones que no causan cambios aparentes Hay variaciones que causan cambios inocuos Altura Color de ojos Forma de la cabeza

27 Hay variaciones que causan cambios perjudiciales No Disease Diabetes, Cáncer, Cardiopatías, Hemofilia Hemophilia Hay variaciones que causan cambios latentes Estas variaciones no son perjudiciales por sí mismas, pero pueden conferir un cierto riesgo, que puede acrecentarse en ciertas condiciones (ambiente, hábitos, etc..). Estas variaciones también pueden explicar porqué unas personas responden bien a ciertos tratamientos con fármacos y otras no. En el ejemplo, los dos son fumadores y bebedores, pero sólo uno de ellos desarrollará cáncer. Las variaciones que tienen en su ADN no son las que causan el cáncer, sino que confieren un riesgo, que puede manifestarse frente a ciertas situaciones ambientales, como el tabaco (o el humo) o la ingesta de alcohol

28 adn Información Genética Personal Santiago Torres-Martínez

CIENCIA Y VIDA COTIDIANA

CIENCIA Y VIDA COTIDIANA CIENCIA Y VIDA COTIDIANA Dieta genética para prevenir enfermedades? La clonación, el ADN y otras cosas Genética para andar por casa. Santiago Torres Martínez Catedrático de Genética Departamento de Genética

Más detalles

Y después de la secuencia, qué?

Y después de la secuencia, qué? Y después de la secuencia, qué? Nuestros genomas no son iguales Persona 1 Persona 2 = Variaciones en el ADN Qué tipo de variaciones? Secuencia estándar Variaciones: Cambios de una base por otra: Polimorfismos

Más detalles

CIENCIA Y VIDA COTIDIANA

CIENCIA Y VIDA COTIDIANA CIENCIA Y VIDA COTIDIANA La clonación, el ADN y cosas de la genética Santiago Torres Martínez Departamento Genética y Microbiología Universidad de Murcia Murcia 25 febrero y 3 marzo, 2008 . Genética. Gen.

Más detalles

Una vez que el espermatozoide ha penetrado en el óvulo, su cola es rápidamente destruida.

Una vez que el espermatozoide ha penetrado en el óvulo, su cola es rápidamente destruida. TEMA 1 BIOLOGIA SEMEJANZAS Y DIFERENCIAS Una especie es un grupo de organismos que pueden reproducirse entre ellos y cuyos descendientes son fértiles. Características especificas: todas las personas pertenecemos

Más detalles

TEMA 4: ADN Y PROTEÍNAS. LA BIOTECNOLOGÍA

TEMA 4: ADN Y PROTEÍNAS. LA BIOTECNOLOGÍA TEMA 4: ADN Y PROTEÍNAS. LA BIOTECNOLOGÍA ADN e información genética Genes y control celular Mutaciones y su importancia biológica La biotecnología y sus aplicaciones La ingeniería genética Modificación

Más detalles

SESIÓN 5 ESTRUCTURA DE LOS ÁCIDOS NUCLEICOS. Los Ácidos Nucleicos. Moléculas Esenciales Para La Vida

SESIÓN 5 ESTRUCTURA DE LOS ÁCIDOS NUCLEICOS. Los Ácidos Nucleicos. Moléculas Esenciales Para La Vida SESIÓN 5 ESTRUCTURA DE LOS ÁCIDOS NUCLEICOS Los Ácidos Nucleicos. Moléculas Esenciales Para La Vida La secuencia de aminoácidos de un polipéptido está programada en una unidad heredable denominada gen.

Más detalles

TEMA 2 LA INFORMACIÓN GENÉTICA COLEGIO LEONARDO DA VINCI BIOLOGÍA Y GEOLOGÍA 4º ESO CURSO 2014/15

TEMA 2 LA INFORMACIÓN GENÉTICA COLEGIO LEONARDO DA VINCI BIOLOGÍA Y GEOLOGÍA 4º ESO CURSO 2014/15 TEMA 2 LA INFORMACIÓN GENÉTICA COLEGIO LEONARDO DA VINCI BIOLOGÍA Y GEOLOGÍA 4º ESO CURSO 2014/15 OBJETIVOS DEL TEMA * Ácidos nucleicos. Composición. Estructura. Tipos. Funciones. * Procesos del dogma

Más detalles

LOS RETOS DE LA BIOMEDICINA: ENTRE LA CIENCIA Y LA ÉTICA

LOS RETOS DE LA BIOMEDICINA: ENTRE LA CIENCIA Y LA ÉTICA AULA DE MAYORES Y DE LA EXPERIENCIA F.Córdoba, R.Torronteras, A.Canalejo Departamento de Biología Ambiental y Salud Pública LOS RETOS DE LA BIOMEDICINA: ENTRE LA CIENCIA Y LA ÉTICA Tema 1.3. Los sistemas

Más detalles

Ácidos nucleicos: ADN y ARN

Ácidos nucleicos: ADN y ARN Unidad I Genética Ácidos nucleicos: ADN y ARN Definición Los ácidos nucleicos son compuestos orgánicos constituidos por unidades llamadas nucleótidos. Su función principal es transmitir las características

Más detalles

TEORIA CELULAR. En el mundo vivo, la unidad fundamental es la célula. DECUBRIMIENTO DE LAS CELULAS

TEORIA CELULAR. En el mundo vivo, la unidad fundamental es la célula. DECUBRIMIENTO DE LAS CELULAS TEORIA CELULAR En el mundo vivo, la unidad fundamental es la célula. DECUBRIMIENTO DE LAS CELULAS El nombre de célula significa celda, así las llamo Robert Hooke. En 1839 el zoólogo alemán Theodore Schwann

Más detalles

EL A.D.N. Existen 2 tipos de Acidos Nucleicos : ADN (Acido Desoxirribonucleico) y ARN (Acido Ribonucleico) Diferencias entre ADN y ARN

EL A.D.N. Existen 2 tipos de Acidos Nucleicos : ADN (Acido Desoxirribonucleico) y ARN (Acido Ribonucleico) Diferencias entre ADN y ARN EL A.D.N Existen 2 tipos de Acidos Nucleicos : ADN (Acido Desoxirribonucleico) y ARN (Acido Ribonucleico) Diferencias entre ADN y ARN Hay tres tipos netamente diferenciados de ARN, tanto en su estructura

Más detalles

UNIVERSITÀ PONTIFICIA REGINA APOSTOLORUM

UNIVERSITÀ PONTIFICIA REGINA APOSTOLORUM Genética humana Ramón Lucas Lucas, LC lucas@unigre.it www.ramonlucas.org UNIVERSITÀ PONTIFICIA REGINA APOSTOLORUM P Años 30: descubrimiento de los defectos congénitos del metabolismo P Años 30-45: proyecto

Más detalles

PRUEBA SOBRE GENÉTICA MOLECULAR PRUEBA SOBRE GENÉTICA MOLECULAR. Nombre:.

PRUEBA SOBRE GENÉTICA MOLECULAR PRUEBA SOBRE GENÉTICA MOLECULAR. Nombre:. PRUEBA SOBRE GENÉTICA MOLECULAR PRUEBA SOBRE GENÉTICA MOLECULAR 1. En la anafase de la mitosis humana viajan 23 cromosomas 2. El fragmoplasto contiene celulosa. V F 3. En la telofase desaparece la membrana

Más detalles

Iván Ferrer Rodríguez, Ph.D. Catedrático

Iván Ferrer Rodríguez, Ph.D. Catedrático Iván Ferrer Rodríguez, Ph.D. Catedrático Meiosis y el ciclo de vida sexual Capítulo 13 Reece, Urry, Cain, Wasserman, Minorsky, Jackson, 2009 Campbell Biology 9 th Edition Objetivos Semejanza entre familiares

Más detalles

ESTRUCTURA DEL ADN. Prof. Luis Jiménez Robles

ESTRUCTURA DEL ADN. Prof. Luis Jiménez Robles UNIVERSIDAD INTERAMERICANA DE PUERTO RICO Recinto Universitario de Fajardo Departamento de Ciencias y Tecnología Título II, Parte B - Mathematics and Science Partnership Sufragado con fondos de Titulo

Más detalles

UNIDAD 5: LA REPRODUCCIÓN CELULAR. GENÉTICA TRADICIONAL

UNIDAD 5: LA REPRODUCCIÓN CELULAR. GENÉTICA TRADICIONAL UNIDAD 5: LA REPRODUCCIÓN CELULAR. GENÉTICA TRADICIONAL Los seres vivos se reproducen, es decir, hacen copias de sí mismos. A partir de una sola célula similar en todas las especies, se pueden formar organismos

Más detalles

CAPÍTULO 13 DIVISIÓN CELULAR

CAPÍTULO 13 DIVISIÓN CELULAR DIVISIÓN CELULAR 1. FISIÓN BINARIA Ocurre en procariontes: tras la duplicación del ADN, se segregan las moléculas hijas y se divide el citoplasma. Bacteria en Fisión Binaria Esquema de la Fisión Binaria

Más detalles

Pensamiento: Científico tecnológico

Pensamiento: Científico tecnológico Subdirección de Educación Departamento de Educación Contratada Colegio CAFAM Bellavista CED GUIA DE APRENDIZAJE Guía No: 6 Pensamiento: Fecha: Docente: Vicente Castellanos Castro Científico tecnológico

Más detalles

FUNDAMENTOS BIOLÓGICOS DEL APRENDIZAJE Y LA MEMORIA

FUNDAMENTOS BIOLÓGICOS DEL APRENDIZAJE Y LA MEMORIA Departamento de Biología Ambiental y Salud Pública FUNDAMENTOS BIOLÓGICOS DEL APRENDIZAJE Y LA MEMORIA INTRODUCCIÓN. Genes y ambiente. Las cualidades heredadas y los efectos de la experiencia. El sustrato

Más detalles

AVANCES DE LA MEDICINA Y ORIGEN DE LA BIOÉTICA (SIGLO XX)

AVANCES DE LA MEDICINA Y ORIGEN DE LA BIOÉTICA (SIGLO XX) Avances en el campo de la biología con repercusiones éticas Fermín J. González Melado Colegio Diocesano San Atón Tema 4 de 4º ESO AVANCES DE LA MEDICINA Y ORIGEN DE LA BIOÉTICA (SIGLO XX) Expansión de

Más detalles

UNIVERSIDAD DE EL SALVADOR FACULTAD DE AGRONOMÍA DEPARTAMENTO DE FITOTECNIA BIOLOGÍA GENERAL REPRODUCCIÓN SEXUAL: MEIOSIS

UNIVERSIDAD DE EL SALVADOR FACULTAD DE AGRONOMÍA DEPARTAMENTO DE FITOTECNIA BIOLOGÍA GENERAL REPRODUCCIÓN SEXUAL: MEIOSIS UNIVERSIDAD DE EL SALVADOR FACULTAD DE AGRONOMÍA DEPARTAMENTO DE FITOTECNIA BIOLOGÍA GENERAL REPRODUCCIÓN SEXUAL: MEIOSIS INTRODUCCIÓN El proceso reproductivo varía mucho entre los diferentes tipos de

Más detalles

División Celular. Departamento de Biología y Geología IES Trassierra (Córdoba)

División Celular. Departamento de Biología y Geología IES Trassierra (Córdoba) División Celular Departamento de Biología y Geología IES Trassierra (Córdoba) Recuerda que: Cada molécula de ADN incluye la información de una serie de características de la célula que la contiene (básicamente

Más detalles

Unidad 3: Organización molecular de la célula Proteínas

Unidad 3: Organización molecular de la célula Proteínas Proteínas Las proteínas son las biomoléculas más abundantes de las células, constituyendo el 50% de su peso seco aproximadamente. Estructuralmente, son polímeros de aminoácidos. Existe una enorme variedad

Más detalles

DOGMA CENTRAL DE LA BIOLOGIA

DOGMA CENTRAL DE LA BIOLOGIA La única diferencia entre las moléculas de ADN de distintos individuos es el orden en el que se disponen sus nucleótidos; lo que se denomina secuencia. Los nucleótidos se ordenan a modo de palabras que

Más detalles

Guía Teórica Genética. Med. Díaz, Alejandra Inés

Guía Teórica Genética. Med. Díaz, Alejandra Inés Med. Díaz, Alejandra Inés Guía Teórica Genética 1 LEY DE MENDEL HERENCIA MENDELIANA 2 LEY DE MENDEL HERENCIA CODOMINANCIA HERENCIA NO MENDELIANA DOMINANCIA INCOMPLETA LIGAMIENTO AL SEXO Genética BASES

Más detalles

CONCEPTOS GENERALES EN GENÉTICA

CONCEPTOS GENERALES EN GENÉTICA CONCEPTOS GENERALES EN GENÉTICA 1. Genetica clásica Genética molecular 1.1. La genética clásica o formal parte del estudio del fenotipo (de lo que observamos) y deduce el genotipo (gen o genes que determinan

Más detalles

GENÉTICA MOLECULAR. El ADN, LA MOLÉCULA DE LA HERENCIA

GENÉTICA MOLECULAR. El ADN, LA MOLÉCULA DE LA HERENCIA GENÉTICA MOLECULAR El ADN, LA MOLÉCULA DE LA HERENCIA INTRODUCCIÓN: COMENCEMOS PREGUNTÁNDONOS Qué significan estas dos palabras? GENÉTICA MOLECULAR Estudio de la genética (genes) desde el punto de vista

Más detalles

MITOSIS Y MEIOSIS. Es el tipo de división celular, donde cada célula hija recibe el mismo número de cromosomas que tenía la célula madre. (Fig.1.1).

MITOSIS Y MEIOSIS. Es el tipo de división celular, donde cada célula hija recibe el mismo número de cromosomas que tenía la célula madre. (Fig.1.1). MITOSIS Y MEIOSIS MITOSIS Es el tipo de división celular, donde cada célula hija recibe el mismo número de cromosomas que tenía la célula madre. (Fig.1.1). CARACTERÍSTICAS DE LA FASE DE LA MITOSIS. INTERFASE:

Más detalles

CÓDIGO GENÉTICO Y SÍNTESIS DE PROTEÍNAS

CÓDIGO GENÉTICO Y SÍNTESIS DE PROTEÍNAS CÓDIGO GENÉTICO Y SÍNTESIS DE PROTEÍNAS Sumario Mitosis y meiosis Código genético y síntesis de proteínas: 1. Concepto de gen 2. Estructura del ADN 3. La replicación del ADN 4. La transcripción 5. La traducción

Más detalles

Lab.10: Meiosis BIOL 3013-LABORATORIO DE BIOLOGÍA GENERAL I DRA. O. HERNÁNDEZ VALE

Lab.10: Meiosis BIOL 3013-LABORATORIO DE BIOLOGÍA GENERAL I DRA. O. HERNÁNDEZ VALE Lab.10: Meiosis BIOL 3013-LABORATORIO DE BIOLOGÍA GENERAL I DRA. O. HERNÁNDEZ VALE Objetivos: Describir las fases de meiosis y mencionar los eventos que la caracterizan, así como la secuencia de los mismos.

Más detalles

ACIDOS NUCLEICOS. Dra. Elena Alvarado León Área de Genética y Biología Celular Depto. De Morfología Humana Fac. de Medicina UNT

ACIDOS NUCLEICOS. Dra. Elena Alvarado León Área de Genética y Biología Celular Depto. De Morfología Humana Fac. de Medicina UNT ACIDOS NUCLEICOS Dra. Elena Alvarado León Área de Genética y Biología Celular Depto. De Morfología Humana Fac. de Medicina UNT ÁCIDOS NUCLEICOS Son las biomoléculas esenciales de un organismo Monómero:

Más detalles

LA REVOLUCIÓN GENÉTICA: DESVELANDO LOS SECRETOS DE LA VIDA

LA REVOLUCIÓN GENÉTICA: DESVELANDO LOS SECRETOS DE LA VIDA LA REVOLUCIÓN GENÉTICA: DESVELANDO LOS SECRETOS DE LA VIDA YA DEBERÍAS SABER Todos los seres vivos tenemos células. Nuestras células son eucariotas (núcleo verdadero) Todas tienen: membrana, citoplasma

Más detalles

Niveles de Organización de la Materia Genética Mendeliana

Niveles de Organización de la Materia Genética Mendeliana Niveles de Organización de la Materia Genética Mendeliana Cátedra de Biología Facultad de Ciencias Médicas UNR Los niveles de organización y el comienzo de la vida Características de los seres vivos: Están

Más detalles

Actividades de clase para realizar con ordenador: http://iessuel.org/ccnn/

Actividades de clase para realizar con ordenador: http://iessuel.org/ccnn/ 4º E.S.O. Biología y Geología - Unidad 5.- La herencia biológica Actividades de clase para realizar con ordenador: http://iessuel.org/ccnn/ Alumno/a... Fecha... 1.- Completa: Todos los seres vivos tienen

Más detalles

NUESTRO MATERIAL GENETICO

NUESTRO MATERIAL GENETICO NUESTRO MATERIAL GENETICO Curso de Biología humana, salud y hábitos saludables Molina de Segura, Noviembre 2010 Rafael Peñafiel García Las células de nuestro organismo portan en su núcleo un manual de

Más detalles

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. BANCO DE PREGUNTAS BIOLOGÍA 7-2 -2013 1) Si se examinan el Universo, la Tierra y el cuerpo humano, cuál de las siguientes combinaciones de elementos serán las más comunes de encontrar? A) S, P, O, N, H,

Más detalles

dentro y hacia afuera de la célula (secreción) Metabolismo de lípidos.

dentro y hacia afuera de la célula (secreción) Metabolismo de lípidos. BIOLOGÍA GUÍA DE EJERCITACIÓN 1 RESPUESTAS PREGUNTA 1 Nombre Función 1 Nucléolo Síntesis de ribosomas 2 Núcleo Almacena la información genética (ADN en la forma de cromosomas). Lugar donde ocurre la síntesis

Más detalles

La verdad sobre óvulos y espermatozoides

La verdad sobre óvulos y espermatozoides La verdad sobre óvulos y espermatozoides Materia: Ciencias Nivel: 7-9 Ciencias Biología Nivel Superior Concepto Principal: División Celular: Meiosis Concepto/s Secundario/s: Cromosomas Homólogos Diploide

Más detalles

ADN MATERIAL GENÉTICO

ADN MATERIAL GENÉTICO ADN MATERIAL GENÉTICO Qué es el ADN? Ácido desoxirribonucleico Responsable de la transmisión de la herencia en los seres vivos. Macromolécula orgánica formada por dos hebras antiparalelas. Cada hebra está

Más detalles

cromátidas centrómero cromosoma

cromátidas centrómero cromosoma núcleo en interfase fibra de cromatina cromátidas centrómero cromosoma 2n = 46 cromátidas cromosomas homólogos Los genes están formados por genes alelos segmentos de ADN y se encuentran situados en los

Más detalles

CÓMO SE PUEDE DETERMINAR LA SECUENCIA DEL DNA A PARTIR DE UNA PROTEÍNA? DR. MANUEL E. AQUINO

CÓMO SE PUEDE DETERMINAR LA SECUENCIA DEL DNA A PARTIR DE UNA PROTEÍNA? DR. MANUEL E. AQUINO Alianza para el Aprendizaje de Ciencias y Matemáticas CÓMO SE PUEDE DETERMINAR LA SECUENCIA DEL DNA A PARTIR DE UNA PROTEÍNA? DR. MANUEL E. AQUINO GUÍA DEL MAESTRO ESTÁNDARES ATENDIDOS: 1. LA NATURALEZA

Más detalles

PRUEBA SOBRE GENÉTICA MOLECULAR PRUEBA SOBRE GENÉTICA MOLECULAR CINETOCORO FRAGMOPLASTO MITOSIS. Nombre:.

PRUEBA SOBRE GENÉTICA MOLECULAR PRUEBA SOBRE GENÉTICA MOLECULAR CINETOCORO FRAGMOPLASTO MITOSIS. Nombre:. PRUEBA SOBRE GENÉTICA MOLECULAR PRUEBA SOBRE GENÉTICA MOLECULAR 1. En la anafase de la mitosis humana viajan 23 cromosomas 2. El fragmoplasto contiene celulosa. V F 3. En la telofase desaparece la membrana

Más detalles

M E I O S I S La MEIOSIS es un proceso que ocurre en las gónadas de los organismos eucariotas,

M E I O S I S La MEIOSIS es un proceso que ocurre en las gónadas de los organismos eucariotas, Tema 4 Genética Tema 4. Genética 1) La meiosis. 2) Ciclos de vida (con reproducción sexual). 3) Las leyes de la herencia de Mendel. 4) DNA: la molécula de la herencia. M E I O S I S La MEIOSIS es un proceso

Más detalles

CONTENIDOS PRUEBA DE CIENCIA

CONTENIDOS PRUEBA DE CIENCIA CONTENIDOS PRUEBA DE CIENCIA CONTENIDOS DE BIOLOGÍA PRIMERO MEDIO I Organización, Estructura y Actividad Celular 1 La célula como unidad funcional a. Estructuras y funciones comunes a células animales

Más detalles

Lectura para aprender más

Lectura para aprender más Lectura para aprender más Estructura del ADN. Al ácido desoxirribonucleico (ADN) se le considera la base molecular de la vida, ya que constituye las unidades hereditarias que llamamos genes. El color de

Más detalles

MODULO 3 Tema 13: Genética

MODULO 3 Tema 13: Genética MODULO 3 Tema 13: Genética Genética y herencia. Los experimentos y las leyes de Mendel. Concepto de genotipo, fenotipo, dominancia y recesividad.. Teoría a cromosómica mica de la herencia. Concepto de

Más detalles

GUÌA DE APOYO 4º MEDIO NOMBRE CURSO 4º MEDIO. I.- Complete las siguientes aseveraciones, utilizando los términos adecuados.

GUÌA DE APOYO 4º MEDIO NOMBRE CURSO 4º MEDIO. I.- Complete las siguientes aseveraciones, utilizando los términos adecuados. Royal American School Asignatura: Biología Profesor Mario Navarrete Formando personas: Respetuosos, Responsables, Honestos y Leales GUÌA DE APOYO 4º MEDIO NOMBRE CURSO 4º MEDIO I.- Complete las siguientes

Más detalles

GUÍA DE ESTUDIO N 8 TEMA: REPRODUCCIÓN CELULAR: MEIOSIS y CICLOS DE VIDA

GUÍA DE ESTUDIO N 8 TEMA: REPRODUCCIÓN CELULAR: MEIOSIS y CICLOS DE VIDA GUÍA DE ESTUDIO N 8 TEMA: REPRODUCCIÓN CELULAR: MEIOSIS y CICLOS DE VIDA OBJETIVOS: - Identificar las etapas del Ciclo celular - Describir la meiosis y establecer las diferencias con mitosis - Identificar

Más detalles

UNIDAD 1. D. Borja Blanco Vives. Profesor de Biología y Geología 4ºESO

UNIDAD 1. D. Borja Blanco Vives. Profesor de Biología y Geología 4ºESO UNIDAD 1. D. Borja Blanco Vives. Profesor de Biología y Geología 4ºESO 1. LA COMPOSICIÓN DE LOS SERES VIVOS. Todos los seres vivos están formados por: - materia inorgánica: agua y sales minerales - materia

Más detalles

UD 3. La Revolución Genética

UD 3. La Revolución Genética UD 3. La Revolución Genética 1. INTRODUCCIÓN: El ADN, la genética. 2. La ingeniería genética 3. Para qué sirve la ingeniería genética? Aplicaciones 4. Transgénicos 5.El Proyecto Genoma Humano (PGH) 6.

Más detalles

5.2. NITRÓGENO Y AZUFRE.

5.2. NITRÓGENO Y AZUFRE. 5.2. NITRÓGENO Y AZUFRE. 5.2.1. PROTEÍNAS. Si hidratos de carbono y lípidos están formados únicamente por átomos de carbono, oxígeno e hidrógeno, las proteínas tienen en su composición, además, nitrógeno

Más detalles

En un organismo unicelular, como una bacteria o un protista, la célula única debe realizar todas las funciones necesarias para la vida.

En un organismo unicelular, como una bacteria o un protista, la célula única debe realizar todas las funciones necesarias para la vida. HISTOLOGIA ANIMAL En un organismo unicelular, como una bacteria o un protista, la célula única debe realizar todas las funciones necesarias para la vida. Tejidos Los animales pueden alcanzar grandes tallas

Más detalles

GENÉTICA: Herencia, Expresión génica, Replicación, biotecnología Selectividad: herencia

GENÉTICA: Herencia, Expresión génica, Replicación, biotecnología Selectividad: herencia GENÉTICA: Herencia, Expresión génica, Replicación, biotecnología Selectividad: herencia 5 JUN9.- Existen caracteres que no se comportan típicamente como los Mendelianos y sus patrones de herencia muestran

Más detalles

CICLO CELULAR División celular

CICLO CELULAR División celular CICLO CELULAR - División celular: - org. unicelulares: aumentan el número de individuos en la población - org. Multicelulares: crecimiento y reparación de tejidos - Se inicia por señales reproductivas

Más detalles

TEMA 5.- LA HERENCIA BIOLÓGICA.

TEMA 5.- LA HERENCIA BIOLÓGICA. TEMA 5.- LA HERENCIA BIOLÓGICA. 1 Hay caracteres que no se transmiten a la descendencia, es decir no son heredables. (ej : el corte de orejas a los perros). Otros caracteres si son heredables, es decir

Más detalles

Prof. Juan A. Vera Méndez Universidad Interamericana Recinto Metropolitano

Prof. Juan A. Vera Méndez Universidad Interamericana Recinto Metropolitano Prof. Juan A. Vera Méndez Universidad Interamericana Recinto Metropolitano La presente investigación se refiere a la clonación, tema muy abarcador en teoría y el cual es muy controversial hoy día, tendríamos

Más detalles

Genética del comportamiento: Análisis de los Trastornos del Espectro Autista desde la perspectiva del DSM-5. 1ª Parte

Genética del comportamiento: Análisis de los Trastornos del Espectro Autista desde la perspectiva del DSM-5. 1ª Parte Genética del comportamiento: Análisis de los Trastornos del Espectro Autista desde la perspectiva del DSM-5. 1ª Parte Departamento de Genética Universidad de Córdoba Etiología de los Trastornos del Espectro

Más detalles

Labs # 9. División (Reproducción) Celular Somática: Mitosis. BIOL Laboratorio de Biología General Dra. O. Hernández Vale

Labs # 9. División (Reproducción) Celular Somática: Mitosis. BIOL Laboratorio de Biología General Dra. O. Hernández Vale Labs # 9 División (Reproducción) Celular Somática: Mitosis BIOL 3013- Laboratorio de Biología General Dra. O. Hernández Vale Objetivos Conocer porque se dividen las células Identificar y contrastar las

Más detalles

Biotecnología y su aplicación a las ciencias agropecuarias. Oris Sanjur Instituto Smithsonian de Investigaciones Tropicales

Biotecnología y su aplicación a las ciencias agropecuarias. Oris Sanjur Instituto Smithsonian de Investigaciones Tropicales Biotecnología y su aplicación a las ciencias agropecuarias Oris Sanjur Instituto Smithsonian de Investigaciones Tropicales Niveles de organización en seres vivos Organismo Organo Tejido Celula La Célula:

Más detalles

Por: Wilfredo Santiago

Por: Wilfredo Santiago Por: Wilfredo Santiago Un bebe recién nacido, antes era una sola célula. Una sola semilla produce un inmenso árbol. Por qué la grama crece tan rápido? Todo se debe a la Reproducción Celular Todos los organismos

Más detalles

SESIÓN 7 DUPLICACIÓN Y TRANSMISIÓN DE LA INFORMACIÓN CONTENIDA EN EL ADN

SESIÓN 7 DUPLICACIÓN Y TRANSMISIÓN DE LA INFORMACIÓN CONTENIDA EN EL ADN SESIÓN 7 DUPLICACIÓN Y TRANSMISIÓN DE LA INFORMACIÓN CONTENIDA EN EL ADN I. CONTENIDOS: 1. Centro de control celular. 2. ADN: su estructura y función. 3. ADN y síntesis proteica. II. OBJETIVOS: Al término

Más detalles

+ Expresión de Genes

+ Expresión de Genes + Expresión de Genes Si todas las células de un organismo contienen el mismo genoma, cómo y por qué las células de la piel son diferentes de las células del cerebro o de las células del hígado? + Expresión

Más detalles

ÁCIDOS NUCLEICOS. Por: Wilfredo Santiago

ÁCIDOS NUCLEICOS. Por: Wilfredo Santiago ÁCIDOS NUCLEICOS Por: Wilfredo Santiago Ácidos Nucleicos Formados por subunidades llamadas nucleótidos; pueden ser un solo nucleótido o una cadena larga de nucleótidos. Ácidos Nucleicos Nucleótidos individuales:

Más detalles

La síntesis de proteínas

La síntesis de proteínas La síntesis de proteínas La Transcripción La información para fabricar todas las proteínas está almacenada en las moléculas de ADN de los cromosomas. La sucesión de bases en las moléculas de ADN es un

Más detalles

INTRODUCCIÓN REPRODUCCIÓN NECESARIA PARA PERPETUAR SU ESPECIE

INTRODUCCIÓN REPRODUCCIÓN NECESARIA PARA PERPETUAR SU ESPECIE INTRODUCCIÓN REPRODUCCIÓN NECESARIA PARA PERPETUAR SU ESPECIE CARACTERISTICA MAS IMPORTANTE DE LOS SERES VIVOS, DE ELLO DEPENDE LA EXISTENCIA DE LAS ESPECIES. ES FUNCIÓN DEL ADN, CONSIDERADA MOLECULA DE

Más detalles

GENES Y MANIPULACIÓN GENÉTICA

GENES Y MANIPULACIÓN GENÉTICA GENES Y MANIPULACIÓN GENÉTICA El ADN, material de los genes La información que controla la aparición de los caracteres hereditarios se localiza en el interior del núcleo celular y se transmite de célula

Más detalles

LA REVOLUCIÓN GENÉTICA

LA REVOLUCIÓN GENÉTICA LA REVOLUCIÓN GENÉTICA HERENCIA GENÉTICA En 1866, Mendel publica las leyes de la herencia tras estudiar en el huerto de su monasterio como se transmitían distintos caracteres en los guisantes. Observó

Más detalles

Autosomas. Son los cromosomas no sexuales. En la especie humana hay 22 pares de autosomas en el núcleo celular y un par de cromosomas sexuales.

Autosomas. Son los cromosomas no sexuales. En la especie humana hay 22 pares de autosomas en el núcleo celular y un par de cromosomas sexuales. GENOMA HUMANO: GLOSARIO BÁSICO Ácido nucleico. Macromolécula formada por nucleótidos, que son moléculas compuestas por fosfato, un azúcar de cinco carbonos y una base. Los ácidos nucleicos son el ADN,

Más detalles

TEMA 5 ACIDOS NUCLEICOS

TEMA 5 ACIDOS NUCLEICOS Bioquímica-Lic. En Enfermería TEMA 5 ACIDOS NUCLEICOS Dra. María Gabriela Lacoste Área de Química Biológica FQByF-UNSL 2016 DESCUBRIMIENTO El descubrimiento de los ácidos nucleicos se debe a Friedrich

Más detalles

TEMA 5: LOS ÁCIDOS NUCLEICOS

TEMA 5: LOS ÁCIDOS NUCLEICOS TEMA 5: LOS ÁCIDOS NUCLEICOS 1. Características químicas 2. Nucleósidos y Nucleótidos 3. Estructura del ADN 4. Estructura y tipos de ARN 5. Importancia biológica de estos compuestos 1. CARACTERÍSTICAS

Más detalles

GLOSARIO. Ácido Desoxirribonucleico (ADN).- Molécula almacenadora de información hereditaria

GLOSARIO. Ácido Desoxirribonucleico (ADN).- Molécula almacenadora de información hereditaria GLOSARIO Ácido Desoxirribonucleico (ADN).- Molécula almacenadora de información hereditaria que se encuentra en el núcleo de la célula. Las bases del ADN son 4: Adenina, Timina, Citosina y Guanina representadas

Más detalles

Genoma bacteriano. Cromosoma circular 1 ó 2 moléculas/bacteria

Genoma bacteriano. Cromosoma circular 1 ó 2 moléculas/bacteria ADN Dogma BC Genoma bacteriano Cromosoma circular 1 ó 2 moléculas/bacteria Plásmidos: Ciculares ó Lineales 1 a 600 moléculas por bacteria Cromosoma lineal 1 ó 2 moléculas/bacteria Es haploide (n). Formado

Más detalles

ADN, ARN Y SÍNTESIS DE PROTEÍNAS

ADN, ARN Y SÍNTESIS DE PROTEÍNAS UNIVERSIDAD DEL VALLE DE GUATEMALA CU125 - CIENCIAS NATURALES FLOR DE MARÍA PELÁEZ ADN, ARN Y SÍNTESIS DE PROTEÍNAS DIEGO FERNANDO GODOY RECKHOLDER #09602 OSCAR ALESSANDRO REYES LICO #09565 10 de marzo

Más detalles

EL CUERPO HUMANO (Anatomía, fisiología, higiene y salud para maestros)

EL CUERPO HUMANO (Anatomía, fisiología, higiene y salud para maestros) Departamento de Biología Ambiental y Salud Pública EL CUERPO HUMANO (Anatomía, fisiología, higiene y salud para maestros) Acabo de nacer: Qué haya suerte! Todo se lo debo a mis padres: fecundación y formación

Más detalles

Proteínas y Ácidos Nucleicos

Proteínas y Ácidos Nucleicos Proteínas y Ácidos Nucleicos Mapa conceptual Biomoléculas. Biomoléculas inorgánicas: Moléculas que no presentan carbono en su estructura. Biomoléculas orgánicas: Moléculas que presentan carbono en su estructura.

Más detalles

LA NUTRICIÓN CELULAR

LA NUTRICIÓN CELULAR LA NUTRICIÓN CELULAR La composición química de los seres vivos Todos los seres vivos estamos formados por células y constituidos por el mismo tipo de sustancias químicas, las biomoléculas. Estas biomoléculas

Más detalles

Ácidos nucléicos. Los ácidos nucleicos fueron descubiertos por Freidrich Miescher en Mirel Nervenis

Ácidos nucléicos. Los ácidos nucleicos fueron descubiertos por Freidrich Miescher en Mirel Nervenis Ácidos nucléicos Los ácidos nucleicos fueron descubiertos por Freidrich Miescher en 1869 La información genética o genoma, está contenida en unas moléculas llamadas ácidos nucleicos. Existen dos tipos

Más detalles

1 sesión: Presentación de la asignatura y criterios de evaluación. 1 sesión: Prueba inicial. UNIDAD DIDÁCTICA I LAS MOLÉCULAS DE LA VIDA

1 sesión: Presentación de la asignatura y criterios de evaluación. 1 sesión: Prueba inicial. UNIDAD DIDÁCTICA I LAS MOLÉCULAS DE LA VIDA PRIMER TRIMESTRE TOTAL TRIMESTRE 42 SESIONES 1 sesión: Presentación de la asignatura y criterios de evaluación. 1 sesión: Prueba inicial. UNIDAD DIDÁCTICA I LAS MOLÉCULAS DE LA VIDA TEMA 1. BIOELEMENTOS

Más detalles

TEMA 4 CMC BIOTECNOLOGÍA

TEMA 4 CMC BIOTECNOLOGÍA Conceptos Tema 4 TEMA 4 CMC BIOTECNOLOGÍA Células eucariotas: Células con núcleo. Núcleo: Un compartimento en el interior de la célula que alberga el material genético. Citoplasma: En una célula eucariota,

Más detalles

Herencia Ligada al Cromosoma X

Herencia Ligada al Cromosoma X 12 Su clínica local: www.aegh.org/docs/encuesta-aegh-2005-centros-y-personasde-contacto.pdf Herencia Ligada al Cromosoma X www.aegh.org/docs/encue sta-aegh-2005-servicios-degenetica-clinica.pdf Elaborado

Más detalles

Qué es la Genética? La Genética es el estudio de la Herencia Biológica GENETICA GENETICA HUMANA caracteres biológicos GENETICA MEDICA

Qué es la Genética? La Genética es el estudio de la Herencia Biológica GENETICA GENETICA HUMANA caracteres biológicos GENETICA MEDICA Qué es la Genética? La Genética es el estudio de la Herencia Biológica Estudio de la unidad de la herencia: GEN Los mecanismos y patrones de herencia de los caracteres biológicos La variabilidad entre

Más detalles

PRUEBA DE ACCESO A LA UNIVERSIDAD CONVOCATORIA DE JUNIO DE EJERCICIO DE: BIOLOGÍA TIEMPO DISPONIBLE: 1 hora 30 minutos

PRUEBA DE ACCESO A LA UNIVERSIDAD CONVOCATORIA DE JUNIO DE EJERCICIO DE: BIOLOGÍA TIEMPO DISPONIBLE: 1 hora 30 minutos PRUEBA DE ACCESO A LA UNIVERSIDAD CONVOCATORIA DE JUNIO DE 2012 EJERCICIO DE: BIOLOGÍA TIEMPO DISPONIBLE: 1 hora 30 minutos PUNTUACIÓN QUE SE OTORGARÁ A ESTE EJERCICIO: (véanse las distintas partes del

Más detalles

GENÉTICA MOLECULAR 1865 MENDEL PRESENTA SU PUBLICACIÓN SOBRE LAS LEYES DE LA HERENCIA 1928 GRIFFITH DESCUBRE EL PRINCIPIO TRANSFORMANTE

GENÉTICA MOLECULAR 1865 MENDEL PRESENTA SU PUBLICACIÓN SOBRE LAS LEYES DE LA HERENCIA 1928 GRIFFITH DESCUBRE EL PRINCIPIO TRANSFORMANTE 1865 MENDEL PRESENTA SU PUBLICACIÓN SOBRE LAS LEYES DE LA HERENCIA 1928 GRIFFITH DESCUBRE EL PRINCIPIO TRANSFORMANTE 1 9 4 4 A V E R Y Y M C L E O D D E S C U B R E N Q U E P R I N C I P I O TRANSFORMANTE

Más detalles

INICIACIÓN A LA GENÉTICA.

INICIACIÓN A LA GENÉTICA. INICIACIÓN A LA GENÉTICA. INTRODUCCIÓN. Evaluación previa: 1. Por qué un hijo tiene parecido con el padre y la madre?. 2. Subraya los conceptos que creas relacionados con la herencia biológica: gen, cloroplasto,

Más detalles

TP: Herencia Mendeliana

TP: Herencia Mendeliana TP: Herencia Mendeliana Introducción a la biología (FHYCS - UNPSJB) Por Lic. Damián G. Gil (2009) Objetivos del TP Aplicar los mecanismos de transmisión de los caracteres hereditarios, según la leyes de

Más detalles

SECRETARÍA DE EDUCACIÓN DE TAMAULIPAS SUBSECRETARÍA DE EDUCACIÓN BÁSICA DIRECCIÓN DE EDUCACIÓN SECUNDARIAS CIENCIAS I ÉNFASIS EN BIOLOGIA.

SECRETARÍA DE EDUCACIÓN DE TAMAULIPAS SUBSECRETARÍA DE EDUCACIÓN BÁSICA DIRECCIÓN DE EDUCACIÓN SECUNDARIAS CIENCIAS I ÉNFASIS EN BIOLOGIA. SECRETARÍA DE EDUCACIÓN DE TAMAULIPAS SUBSECRETARÍA DE EDUCACIÓN BÁSICA DIRECCIÓN DE EDUCACIÓN SECUNDARIAS CIENCIAS I ÉNFASIS EN BIOLOGIA. BLOQUE IV ESPECIFICACIÓN: A partir de un listado de características

Más detalles

Taller de ejercitación para la evaluación del 7 de junio.

Taller de ejercitación para la evaluación del 7 de junio. Taller de ejercitación para la evaluación del 7 de junio. 1. En un organismo multicelular que se reproduce sexualmente; luego de la unión de las células sexuales que lo originan; las células no sexuales

Más detalles

Capítulo 1. La célula Dra. Millie L. González ISBN-13: 978-0321689634 ISBN-10: 0321689631. 8va edición

Capítulo 1. La célula Dra. Millie L. González ISBN-13: 978-0321689634 ISBN-10: 0321689631. 8va edición Capítulo 1 La célula Dra. Millie L. González ISBN-13: 978-0321689634 ISBN-10: 0321689631 8va edición Lectures by Kathleen Fitzpatrick Simon Fraser University Actividad de aprendizaje activo Grupos QUE

Más detalles

SUMARIO Ácidos nucleicos. Estructura general. Tipos principales: ADN y ARN. ADN. Estructura primaria. Estructura secundaria o modelo de Watson y Crick

SUMARIO Ácidos nucleicos. Estructura general. Tipos principales: ADN y ARN. ADN. Estructura primaria. Estructura secundaria o modelo de Watson y Crick COFERENCIA 5 TÍTULO: COMPONENTES MOLECULARES: MACROMOLÉCULAS. ÁCIDOS NUCLEICOS Autor: Dr. Daniel Sánchez Serrano SUMARIO Ácidos nucleicos. Estructura general. Tipos principales: ADN y ARN. ADN. Estructura

Más detalles

Clase Teórico-Práctica N 1. Cromatina y cromosomas

Clase Teórico-Práctica N 1. Cromatina y cromosomas 1 Clase Teórico-Práctica N 1 Tema: Ácidos nucléicos. Estructura. Cromatina. Cromosomas. Tipos de secuencias y su organización en el genoma. Cariotipo. Objetivos: Repasar y profundizar los conocimientos

Más detalles

En un organismo unicelular, como una bacteria o un protista, la célula única debe realizar todas las funciones necesarias para la vida.

En un organismo unicelular, como una bacteria o un protista, la célula única debe realizar todas las funciones necesarias para la vida. HISTOLOGIA HUMANA OBJETIVOS: Conocer los diferentes tipos de tejido que posee el cuerpo humano. Aprender a diferenciar los 4 tipos de tejidos fundamentales y conocer sus funciones. Conocer superficialmente

Más detalles

Cultura Cientí fica 1 Bachillerato

Cultura Cientí fica 1 Bachillerato Cultura Cientí fica 1 Bachillerato 3. La revolución genética: biotecnología Actividades de consolidación 1. Cualquier molécula de ADN formada por la unión de segmentos de ADN de origen diferente es: a)

Más detalles

EL DISFRAZ DE VINCENT

EL DISFRAZ DE VINCENT Tema: 2 GENÉTICA EL DISFRAZ DE VINCENT En grupos de 3, vamos a debatir las siguientes cuestiones: Cómo consigue Vincent, el protagonista, un niño que ha nacido de forma clásica con todos sus problemas

Más detalles

El ADN como material genético Estructura de los ácidos nucleicos

El ADN como material genético Estructura de los ácidos nucleicos El ADN como material genético Estructura de los ácidos nucleicos Bibliografía: Lehninger Principles of Biochemistry 4ª, 5ª o 6ª Ed. (2004, 2008, 2012). Griffiths Introduction to Genetic Analysis 8a Ed.

Más detalles

Herencia Ligada al Cromosoma X

Herencia Ligada al Cromosoma X 12 Herencia Ligada al Cromosoma X Elaborado a partir de folletos originales de Guy s and St Thomas Hospital, Londres y London IDEAS Genetic Knowledge Park. Enero de 2008 Este trabajo se ha realizado bajo

Más detalles

UNIDAD II ANATOMÍA Y FISIOLOGÍA DE LA CÉLULA. Prof. Glamil Acevedo Anatomía y Fisiología

UNIDAD II ANATOMÍA Y FISIOLOGÍA DE LA CÉLULA. Prof. Glamil Acevedo Anatomía y Fisiología UNIDAD II ANATOMÍA Y FISIOLOGÍA DE LA CÉLULA Prof. Glamil Acevedo Anatomía y Fisiología La Célula Es la unidad funcional y estructural más pequeña de los organismos vivos. Se compone de partes características,

Más detalles

Repaso: Química celular (biomoléculas)

Repaso: Química celular (biomoléculas) Repaso: Química celular (biomoléculas) Hay 4 tipos principales de biomoléculas: 1) glúcidos o hidratos de carbono, 2) lípidos o grasas, 3) proteínas y 4) ácidos nucleicos. Las biomoléculas más grandes,

Más detalles

Genética humana UNIVERSITÀ PONTIFICIA REGINA APOSTOLORUM. Ramón Lucas Lucas, LC

Genética humana UNIVERSITÀ PONTIFICIA REGINA APOSTOLORUM. Ramón Lucas Lucas, LC Genética humana UNIVERSITÀ PONTIFICIA REGINA APOSTOLORUM Ramón Lucas Lucas, LC lucas@unigre.it www.ramonlucas.org 1 Historia 2 3 Historia P Sindrome de Down (J. Lejeune: 1959): presenza de un cromosoma

Más detalles

Formación de una nueva vida:concepción,herencia y ambiente. Janette Orengo Puig,Ed.D.

Formación de una nueva vida:concepción,herencia y ambiente. Janette Orengo Puig,Ed.D. Formación de una nueva vida:concepción,herencia y ambiente Janette Orengo Puig,Ed.D. Cambios en la teoría de concepción Concepción- (fertilización)-es el proceso por medio del cual el espermatozoide y

Más detalles

Jesús G.C. Colegio Claret Segovia

Jesús G.C. Colegio Claret Segovia 1 UNIDAD 8 Documento elaborado por del de LA R E VO LU CI Ó N G EN É TI CA 1.- El ADN La célula es la unidad morfológica, funcional y genética de todos los seres vivos Todos los seres vivos están formados

Más detalles