MÓDULO 1 BIOQUÍMICA ANALÍTICA. Unidad de Bioquímica Analítica Centro de Investigaciones Nucleares - Fcien

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamaño: px
Comenzar la demostración a partir de la página:

Download "MÓDULO 1 BIOQUÍMICA ANALÍTICA. Unidad de Bioquímica Analítica Centro de Investigaciones Nucleares - Fcien"

Transcripción

1 MÓDULO 1 BIOQUÍMICA ANALÍTICA Unidad de Bioquímica Analítica Centro de Investigaciones Nucleares - Fcien

2 OBJETIVOS DEL MÓDULO 1 Adquirir conocimientos teórico-prácticos para la preparación y desarrollo de las actividades experimentales del Laboratorio Móvil (LAM) Desarrollar la habilidad expositiva de los estudiantes, en función del público objetivo de las actividades del LAM Aplicar los conocimientos adquiridos al entorno en donde se desarrollen

3 ACTIVIDADES DEL MÓDULO 1 Determinación de proteínas en alimentos

4 ACTIVIDADES DEL MÓDULO 1 Determinación de iones calcio y magnesio en muestras de agua

5 ACTIVIDADES DEL MÓDULO 1 Fabricación de un indicador ácido base

6 MÓDULO 2 MICROBIOLOGÍA Cátedra de Microbiología Facultad de Química Unidad Asociada Instituto Química Biológica, Facultad de Ciencias

7 Microorganismos, por qué? Diversidad, abundancia, esenciales para la vida en la Tierra Muy diversos aplicaciones Patógenos, causantes de enfermedades

8 ACTIVIDADES DEL MÓDULO 2 Cazadores de microbios Investigar la presencia de microorganismos en diferentes lugares de nuestro entorno

9 ACTIVIDADES DEL MÓDULO 2 Sin levadura no hay pan ni vino Comprender cómo actúa la levadura de panificación en la producción de Investigar alimentos la presencia de microorganismos en diferentes lugares de nuestro entorno Sacharomyces cerevisiae

10 ACTIVIDADES DEL MÓDULO 2 Potabilización del agua Potabilizar agua de cañada, contribuyendo Investigar la a presencia entender el de proceso microorganismos de potabilización en en diferentes sus aspectos físicos, lugares químicos de nuestro y microbiológicos entorno

11 MÓDULO 3 GENÉTICA Sección Genética Instituto de Biología - Fcien

12 OBJETIVOS DEL MÓDULO 3 Se propone preparar a los estudiantes para acompañar las actividades diseñadas para trabajar en las escuelas partiendo de preguntas tales como: Por qué eres parecido a tus padres? Cómo los descendientes reciben información de su parentales que define su aspecto y funcionamiento? Cómo lo vemos en plantas y animales y qué importancia tiene? Cómo se explican las semejanzas? cómo se explica la variabilidad?

13 ACTIVIDADES DEL MÓDULO 3 Caracteres hereditarios y variabilidad genética Trabajamos la idea de semejanza y diferencias entre los rasgos de los organismos, el concepto de variación y el aporte de ambos parentales. definición del concepto de herencia. conceptos de carácter, gen, alelo. Qué parte de esa variabilidad es genética y qué parte es ambiental? Qué heredamos de nuestros padres? Realizar una prueba del gusto con feniltiocarbamida (PTC) para analizar el fenotipo a distintos niveles

14 ACTIVIDADES DEL MÓDULO 3 Organización del material hereditario Material hereditario (ADN y ARN) Célula eucariota animal y vegetal: Trabajamos con maquetas de células. Modelo de célula animal y vegetal. El papel del núcleo en la herencia y la importancia de la división de la célula (mitosis y meiosis). Se harán y visualización preparaciones l. Modelar el comportamiento cromosómico utilizando modelos

15 ACTIVIDADES DEL MÓDULO 3 Material hereditario: estructura y replicación Relación de los ácidos nucleicos, su estructura y replicación, con la trasmisión de los caracteres Se trabajará con modelos de ADN y juegos de armar Flujo de la información genética: genes, ARN y proteínas, relación de genotipo y fenotipo. Utilizando fichas se asociarán genes a proteínas Obtener y visualizar el ADN

16 ACTIVIDADES DEL MÓDULO 3 Cómo se transmiten los rasgos: las reglas de la herencia Leyes de Mendel con el comportamiento cromosómico. Manejo del modelo Drosophila: ciclo de vida, identificación de sexo y características fenotípicas, etc. Se identificará el fenotipo salvaje y su comparación con varios mutantes (color de ojos o cuerpo, morfología de alas, etc). Se harán cruzamientos y análisis de descendencia.. Observación de parentales, F1 y descendencia. Concepto de Dominancia y recesividad.

17 MÓDULO 4 FÍSICA Instituto de Física- Fcien

18 MÓDULO 5 QUÍMICA Química d+ - FQ

19 MÓDULO 6 GEOLOGÍA Instituto de Ciencias Geológicas- Fcien

20 OBJETIVOS DEL MÓDULO 6 Adquirir conocimientos teórico-prácticos para la preparación y desarrollo de las actividades experimentales del Laboratorio Móvil (LAM) Desarrollar la habilidad expositiva de los estudiantes, en función del público objetivo de las actividades del LAM Aplicar los conocimientos adquiridos al entorno en donde se desarrollen

21 ACTIVIDADES DEL MÓDULO 6 Determinación de minerales por sus propiedades

22 ACTIVIDADES DEL MÓDULO 6 Reconocimiento de minerales en rocas

23 ACTIVIDADES DEL MÓDULO 6 Formación de los diferentes tipos de rocas

24 ACTIVIDADES DEL MÓDULO 6 Utilidad de los minerales en la vida diaria

25 MÓDULO 7 CRISTALOGRAFÍA FQ

26 MÓDULO 8 CON LAS MANOS EN LA MASA FQ

TEMA 1: LA CÉLULA. UNIDAD DE VIDA

TEMA 1: LA CÉLULA. UNIDAD DE VIDA TEMA 1: LA CÉLULA. UNIDAD DE VIDA a) Exponer y comprender los distintos postulados de la teoría celular, así como las aportaciones realizadas a la misma. b) Enumerar los distintos niveles de organización

Más detalles

UNIVERSIDAD DE COSTA RICA ESCUELA DE BIOLOGIA SECCIÓN DE GENÉTICA Y BIOTECNOLOGÍA

UNIVERSIDAD DE COSTA RICA ESCUELA DE BIOLOGIA SECCIÓN DE GENÉTICA Y BIOTECNOLOGÍA UNIVERSIDAD DE COSTA RICA ESCUELA DE BIOLOGIA SECCIÓN DE GENÉTICA Y BIOTECNOLOGÍA B-345 Genética General para Biología I Semestre del 2014 Créditos: 3 Horario: Lunes y martes de 2 a 4 p.m., Aula 180 Requisitos:

Más detalles

PROGRAMACIÓN DE BIOLOGÍA DE 2º BACHILLERATO UNIDAD DIDÁCTICA I LAS MOLÉCULAS DE LA VIDA TEMA 1.BIOELEMENTOS Y BIOMOLÉCULAS INORGÁNICAS

PROGRAMACIÓN DE BIOLOGÍA DE 2º BACHILLERATO UNIDAD DIDÁCTICA I LAS MOLÉCULAS DE LA VIDA TEMA 1.BIOELEMENTOS Y BIOMOLÉCULAS INORGÁNICAS PROGRAMACIÓN DE BIOLOGÍA DE 2º BACHILLERATO UNIDAD DIDÁCTICA I LAS MOLÉCULAS DE LA VIDA TEMA 1.BIOELEMENTOS Y BIOMOLÉCULAS INORGÁNICAS Los bioelementos Las biomoléculas o Las biomoléculas inorgánicas:

Más detalles

PLAN DE MEJORAMIENTO PRIMER PERIODO NOMBRE DE ESTUDIANTE: GRADO: 7 NOMBRE DEL DOCENTE: Carlos Rueda AREA: Ciencias Naturales

PLAN DE MEJORAMIENTO PRIMER PERIODO NOMBRE DE ESTUDIANTE: GRADO: 7 NOMBRE DEL DOCENTE: Carlos Rueda AREA: Ciencias Naturales PLAN DE PRIMER PERIODO NOMBRE DE ESTUDIANTE: GRADO: 7 COMPETENCIA: RECONOCER LAS ESTRUCTURAS CELULARES EN EL PROCESO DE DIVISION CELULAR (MITOSIS Y MEIOSIS) COG. Identifica los conceptos, procesos, semejanzas

Más detalles

BIOLOGÍA PRUEBA DE ACCESO A LA UNIVERSIDAD (PAU)

BIOLOGÍA PRUEBA DE ACCESO A LA UNIVERSIDAD (PAU) BIOLOGÍA PRUEBA DE ACCESO A LA UNIVERSIDAD (PAU) http://portal.uned.es/pls/portal/docs/page/uned_main/oferta/selectividad/mod_logs E/ASIGNATURAS_LOGSE/BIOLOG%C3%8DA_0.PDF Coordinadora: Mónica Morales Camarzana

Más detalles

Introducción Genética

Introducción Genética Introducción Genética Cát. Genética. FAZ - UNT. Algunas imágenes fueron extraídas de internet. 1 Genética. Definición. Objetivos de la materia. Herencia y variación. Concepto. Genotipo y Fenotipo. Relación

Más detalles

1 sesión: Presentación de la asignatura y criterios de evaluación. 1 sesión: Prueba inicial. UNIDAD DIDÁCTICA I LAS MOLÉCULAS DE LA VIDA

1 sesión: Presentación de la asignatura y criterios de evaluación. 1 sesión: Prueba inicial. UNIDAD DIDÁCTICA I LAS MOLÉCULAS DE LA VIDA PRIMER TRIMESTRE TOTAL TRIMESTRE 42 SESIONES 1 sesión: Presentación de la asignatura y criterios de evaluación. 1 sesión: Prueba inicial. UNIDAD DIDÁCTICA I LAS MOLÉCULAS DE LA VIDA TEMA 1. BIOELEMENTOS

Más detalles

Guía para el docente

Guía para el docente Guía para el docente Descripción curricular: - Nivel: 2.º Medio - Subsector: Ciencias biológicas - Unidad temática: - Palabras claves: recesivo, dominante, experimentos de Mendel, variación, herencia,

Más detalles

II. INDICADORES DE EVALUACIÓN Y RELACIÓN CON COMPETENCIAS BÁSICAS CRITERIOS DE EVALUACIÓN

II. INDICADORES DE EVALUACIÓN Y RELACIÓN CON COMPETENCIAS BÁSICAS CRITERIOS DE EVALUACIÓN UNIDAD Nº. LA CÉLULA I. CONTENIDOS Teoría celular. * Funciones y estructura de las células. * Tipos de células. * Célula eucariótica: estructura y tipos. * Reproducción de las células: mitosis. * Meiosis.

Más detalles

Colegio San Patricio. Biología. 2 0 Año

Colegio San Patricio. Biología. 2 0 Año Colegio San Patricio Biología 2 0 Año Año 2016 Fundamentos La enseñanza de la Biología implica procesos dinámicos y que pueda enriquecer los intereses de los alumnos, y que tengan la posibilidad de preguntarse

Más detalles

PROGRAMA DEL ESTUDIANTE POR MATERIA PRIMER PERIODO DE TRABAJO DEL PRIMER SEMESTRE DEL CICLO ESCOLAR

PROGRAMA DEL ESTUDIANTE POR MATERIA PRIMER PERIODO DE TRABAJO DEL PRIMER SEMESTRE DEL CICLO ESCOLAR EPO 11 ESCUELA PREPARATORIA OFICIAL NÚM. 11 CUAUTITLAN IZCALLI, MEX. PROGRAMA DEL ESTUDIANTE POR MATERIA PRIMER PERIODO DE TRABAJO DEL PRIMER SEMESTRE DEL CICLO ESCOLAR 2016-2017 Materia: _Biología General

Más detalles

UNIDAD 5: LA REPRODUCCIÓN CELULAR. GENÉTICA TRADICIONAL

UNIDAD 5: LA REPRODUCCIÓN CELULAR. GENÉTICA TRADICIONAL UNIDAD 5: LA REPRODUCCIÓN CELULAR. GENÉTICA TRADICIONAL Los seres vivos se reproducen, es decir, hacen copias de sí mismos. A partir de una sola célula similar en todas las especies, se pueden formar organismos

Más detalles

PLANIFICACIÓN DE LA UNIDAD DIDÁCTICA 5

PLANIFICACIÓN DE LA UNIDAD DIDÁCTICA 5 PLANIFICACIÓN DE LA UNIDAD DIDÁCTICA 5 Grado: Cuarto Área: Ciencia, Tecnología y Ambiente TÍTULO DE LA UNIDAD Comprendiendo a la herencia SITUACIÓN SIGNIFICATIVA Los estudiantes de 4 grado de secundaria

Más detalles

Genética II: el ligamiento y la teoría cromosómica

Genética II: el ligamiento y la teoría cromosómica Genética II: el ligamiento y la teoría cromosómica (Continuación de la 2º Ley de Mendel) Cada individuo tiene dos copias de cada unidad de herencia (gen). Estas dos copias se separan durante la formación

Más detalles

BIOLOGÍA DIVISIÓN CELULAR

BIOLOGÍA DIVISIÓN CELULAR BIOLOGÍA DIVISIÓN CELULAR Comparación de las características generales de la división celular y la formación de gametos: mitosis y meiosis El núcleo es una de las estructuras más importantes de la célula,

Más detalles

RESUMEN INFORMATIVO PROGRAMACIÓN DIDÁCTICA CURSO 2008/2009 DEPARTAMENTO: BIOLOGÍA Y GEOLOGÍA. MATERIA: BIOLOGÍA CURSO 2º

RESUMEN INFORMATIVO PROGRAMACIÓN DIDÁCTICA CURSO 2008/2009 DEPARTAMENTO: BIOLOGÍA Y GEOLOGÍA. MATERIA: BIOLOGÍA CURSO 2º RESUMEN INFORMATIVO PROGRAMACIÓN DIDÁCTICA CURSO 2008/2009 DEPARTAMENTO: BIOLOGÍA Y GEOLOGÍA. MATERIA: BIOLOGÍA CURSO 2º bachillerato. OBJETIVOS: 1. Relacionar la experiencia cotidiana con la científica

Más detalles

Prof.: Cabral L, Chirino M., Muñoz S., Puebla P., Schottenheim E. 1 de 6

Prof.: Cabral L, Chirino M., Muñoz S., Puebla P., Schottenheim E. 1 de 6 Ciencias Naturales 3 año Colegio N 11 Benito Juárez Actividades Curso: 3er Año División: I, II, III, IV, V, VI Primer Trimestre UNIDAD I LA MATERIA Y SUS CAMBIOS. Elementos químicos. Clasificación. Uso

Más detalles

Guía docente. Biología. Llaves. Recursos para la planificación. Origen, evolución y herencia en los seres vivos. Serie

Guía docente. Biología. Llaves. Recursos para la planificación. Origen, evolución y herencia en los seres vivos. Serie Guía docente Recursos para la planificación Biología 2 Origen, evolución y herencia en los seres vivos Distribución de contenidos según los Núcleos de Aprendizajes Prioritarios (NAP) Expectativas de logro

Más detalles

ASIGNATURA: BIOLOGÍA. MATERIA: Biología MÓDULO: Fundamental ESTUDIOS: Grado en Química CARACTERÍSTICAS GENERALES* DESCRIPCIÓN. Página 1 de 5.

ASIGNATURA: BIOLOGÍA. MATERIA: Biología MÓDULO: Fundamental ESTUDIOS: Grado en Química CARACTERÍSTICAS GENERALES* DESCRIPCIÓN. Página 1 de 5. Página 1 de 5 CARACTERÍSTICAS GENERALES* Tipo: DESCRIPCIÓN Formación básica, Obligatoria, Optativa Trabajo de fin de grado, Prácticas externas Duración: Semestral Semestre/s: 1 Número de créditos ECTS:

Más detalles

UNIVERSIDAD AUTÓNOMA DE SINALOA FACULTAD DE AGRONOMÍA FASE PROFESIONALIZANTE LICENCIATURA EN INGENIERIA AGRONOMICA ÁREA DE GENÉTICA

UNIVERSIDAD AUTÓNOMA DE SINALOA FACULTAD DE AGRONOMÍA FASE PROFESIONALIZANTE LICENCIATURA EN INGENIERIA AGRONOMICA ÁREA DE GENÉTICA UNIVERSIDAD AUTÓNOMA DE SINALOA FACULTAD DE AGRONOMÍA FASE PROFESIONALIZANTE LICENCIATURA EN INGENIERIA AGRONOMICA ÁREA DE GENÉTICA PROGRAMA ANALÍTICO DE: GENÉTICA BÁSICA TERCER SEMESTRE Elaboró Carlos

Más detalles

INSTITUCIÓN EDUCATIVA CASD ARMENIA Q GESTIÓN ACADÉMICA DISEÑO PEDAGÓGICO- PLAN DE ÁREA

INSTITUCIÓN EDUCATIVA CASD ARMENIA Q GESTIÓN ACADÉMICA DISEÑO PEDAGÓGICO- PLAN DE ÁREA INSTITUCIÓN EDUCATIVA CASD ARMENIA Q GESTIÓN ACADÉMICA DISEÑO PEDAGÓGICO- PLAN DE ÁREA GA-DP-R20 ÁREA: CIENCIAS NATURALES ASIGNATURA: BIOLOGÍA GRADO: 11 CICLO: FECHA: ENERO 21 A MAYO 17 DE DOCENTES RESPONSABLES:

Más detalles

BIOLOGÍA Y GEOLOGÍA 4º DE E.S.O.

BIOLOGÍA Y GEOLOGÍA 4º DE E.S.O. BIOLOGÍA Y GEOLOGÍA 4º DE E.S.O. CUADERNILLO DE ACTIVIDADES PARA LA PREPARACIÓN DE LA PRUEBA EXTRAORDINARIA DATOS DEL ALUMNO/A: NOMBRE: CURSO: 4º TEMA 1.- ESTRUCTURA Y DINÁMICA DE LA TIERRA 1.) Qué es

Más detalles

Planificación didáctica de PRUEBA DE ACCESO A: GRADO SUPERIOR

Planificación didáctica de PRUEBA DE ACCESO A: GRADO SUPERIOR Planificación didáctica de PRUEBA DE ACCESO A: GRADO SUPERIOR PARTE ESPECÍFICA: OPCIÓN C, BIOLOGÍA Julio de 2016 Rev.: 0 Índice 1.- CONTENIDOS... 1 1.1.- LA BASE FÍSICO QUÍMICA DE LA VIDA... 1 1.2.- ORGANIZACIÓN

Más detalles

Tema 3 (2) Meiosis Reproducción sexual

Tema 3 (2) Meiosis Reproducción sexual Tema 3 (2) Meiosis Reproducción sexual Similitud y variación hereditaria Los organismo vivos se distinguen por su capacidad para perpetuar su propia especie La herencia es la transmisión de los rasgos

Más detalles

Clave de la materia Horas de teoría Horas de práctica Total de horas Valor en créditos

Clave de la materia Horas de teoría Horas de práctica Total de horas Valor en créditos 1. DATOS DE IDENTIFICACIÓN Centro Universitario: Universidad de Sonora, Unidad Regional Centro Departamento: Agricultura y Ganadería Programa Académico Licenciatura en Agronomía: Ingeniero Agrónomo (plan

Más detalles

Unidad 1. LA REPRODUCCIÓN: DE LA CÉLULA AL ORGANISMO.

Unidad 1. LA REPRODUCCIÓN: DE LA CÉLULA AL ORGANISMO. Unidad 1. LA REPRODUCCIÓN: DE LA CÉLULA AL ORGANISMO. 1. Conocer e identificar los niveles de organización celular. 2. Explicar los postulados de la teoría celular. 3. Conocer la morfología y los principales

Más detalles

DEPARTMENTO DE CIENCIAS NATURALES HOSTOS COMMUNITY COLLEGE of THE CITY UNIVERSITY OF NEW YORK

DEPARTMENTO DE CIENCIAS NATURALES HOSTOS COMMUNITY COLLEGE of THE CITY UNIVERSITY OF NEW YORK DEPARTMENTO DE CIENCIAS NATURALES HOSTOS COMMUNITY COLLEGE of THE CITY UNIVERSITY OF NEW YORK PROGRAMA DE PRINCIPIOS DE LA BIOLOGÍA - BIO 110 - TEORÍA 4 créditos, 3-hr. teoría/2-hr. lab. Pre/corequisito:

Más detalles

Departamento de Ciencias Naturales curso Contenidos y aprendizajes mínimos. Biología y Geología 4º ESO. Unidad 1: La célula.

Departamento de Ciencias Naturales curso Contenidos y aprendizajes mínimos. Biología y Geología 4º ESO. Unidad 1: La célula. Departamento de Ciencias Naturales curso 2013-2014 Biología y Geología 4º ESO Unidad 1: La célula. Unidad de vida Conocer los principios de la teoría celular, diferenciar entre células procariotas y eucariotas

Más detalles

Herencia y transmisión de caracteres

Herencia y transmisión de caracteres Herencia y transmisión de caracteres Herencia, trasmisión de caracteres, reproducción y leyes de Mendel La herencia y la trasmisión de caracteres es una característica bien marcada entre los seres vivos.

Más detalles

Gen Genética Cromosomas

Gen Genética Cromosomas Gen En el interior de toda célula existen unos corpúsculos filamentosos llamados cromosomas los cuales son los portadores de las minúsculas estructuras que conocemos como genes. Los cromosomas y los genes

Más detalles

UNIVERSIDAD JUÁREZ AUTÓNOMA DE TABASCO DIVISIÓN ACADÉMICA DE CIENCIAS BIOLÓGICAS LICENCIATURA EN ECOLOGIA

UNIVERSIDAD JUÁREZ AUTÓNOMA DE TABASCO DIVISIÓN ACADÉMICA DE CIENCIAS BIOLÓGICAS LICENCIATURA EN ECOLOGIA UNIVERSIDAD JUÁREZ AUTÓNOMA TABASCO DIVISIÓN ACADÉMICA CIENCIAS BIOLÓGICAS LICENCIATURA EN ECOLOGIA ASIGNATURA: BIOLOGÍA AREA: SUSTANTIVA PROFESIONAL HORAS TEORICAS: 3 HORAS PRACTICAS:3 CREDITOS:9 ASIGNATURAS

Más detalles

Dra. Tzvetanka Dimitrova Dinkova Lab 103, Depto. Bioquimica, Conjunto E, Fac. Quimica Tel: ; correo electronico:

Dra. Tzvetanka Dimitrova Dinkova Lab 103, Depto. Bioquimica, Conjunto E, Fac. Quimica Tel: ; correo electronico: GENETICA y BIOLOGIA MOLECULAR Dra. Tzvetanka Dimitrova Dinkova Lab 103, Depto. Bioquimica, Conjunto E, Fac. Quimica Tel: 56225277; correo electronico: cesy@unam.mx Apoyo material audiovisual, referencias

Más detalles

BIOLOGÍA 2º BACHILLERATO

BIOLOGÍA 2º BACHILLERATO BIOLOGÍA 2º BACHILLERATO CRITERIOS DE EVALUACIÓN BLOQUE 1. LA BASE MOLECULAR Y FÍSICO-QUÍMICA DE LA VIDA Relacionar las propiedades biológicas de los oligoelementos con sus características físicoquímicas.

Más detalles

Materia: Biología 2 Año

Materia: Biología 2 Año Materia: Biología 2 Año I. Fundamentación del Espacio curricular Las ciencias naturales aportan sus conocimientos, sus teorías y metodologías a la comprensión de los fenómenos naturales, y constituyen

Más detalles

CARTA DESCRIPTIVA (FORMATO MODELO EDUCATIVO UACJ VISIÓN 2020)

CARTA DESCRIPTIVA (FORMATO MODELO EDUCATIVO UACJ VISIÓN 2020) CARTA DESCRIPTIVA (FORMATO MODELO EDUCATIVO UACJ VISIÓN 2020) I. Identificadores de la asignatura Instituto: Ciencias Biomédicas Modalidad: Presencial Departamento: Materia: Ciencias Químico Biológicas

Más detalles

TEMA 6: LA HERENCIA. Pág.1

TEMA 6: LA HERENCIA. Pág.1 TEMA 6: LA HERENCIA EL CICLO CELULAR: Toda célula procede de otra célula. La célula al dividirse transmite el material genético o hereditario, es decir las moléculas de ADN a sus células hijas Toda célula

Más detalles

MODULO 3 Tema 13: Genética

MODULO 3 Tema 13: Genética MODULO 3 Tema 13: Genética Genética y herencia. Los experimentos y las leyes de Mendel. Concepto de genotipo, fenotipo, dominancia y recesividad.. Teoría a cromosómica mica de la herencia. Concepto de

Más detalles

TEMA 2 LA INFORMACIÓN GENÉTICA COLEGIO LEONARDO DA VINCI BIOLOGÍA Y GEOLOGÍA 4º ESO CURSO 2014/15

TEMA 2 LA INFORMACIÓN GENÉTICA COLEGIO LEONARDO DA VINCI BIOLOGÍA Y GEOLOGÍA 4º ESO CURSO 2014/15 TEMA 2 LA INFORMACIÓN GENÉTICA COLEGIO LEONARDO DA VINCI BIOLOGÍA Y GEOLOGÍA 4º ESO CURSO 2014/15 OBJETIVOS DEL TEMA * Ácidos nucleicos. Composición. Estructura. Tipos. Funciones. * Procesos del dogma

Más detalles

Pontificia Universidad Católica del Ecuador Facultad de Ciencias Exactas y Naturales Escuela de Ciencias Biológicas

Pontificia Universidad Católica del Ecuador Facultad de Ciencias Exactas y Naturales Escuela de Ciencias Biológicas Apartado postal 17-01-218 1. DATOS INFORMATIVOS: FACULTAD: Ciencias Exactas y Naturales CARRERA: : Ciencias Biológicas Asignatura/módulo: Genética I Código: 186 Plan de estudios 011 Nivel: Tercero Prerrequisitos:

Más detalles

PROGRAMA DE LA MATERIA: (403) Genética Básica. Resol. (CD) Nº 645/14

PROGRAMA DE LA MATERIA: (403) Genética Básica. Resol. (CD) Nº 645/14 PROGRAMA DE LA MATERIA: (403) Genética Básica Resol. (CD) Nº 645/14 1. Datos generales a. Denominación: 403 - Genética Básica b. Carrera: Veterinaria c. Ubicación en el plan de estudios: Asignatura perteneciente

Más detalles

Universidad Central Del Este U C E Facultad de Ciencias de la Salud Escuela de Medicina Veterinaria

Universidad Central Del Este U C E Facultad de Ciencias de la Salud Escuela de Medicina Veterinaria Universidad Central Del Este U C E Facultad de Ciencias de la Salud Escuela de Medicina Veterinaria Programa de la Asignatura: BIO-041-Genética Animal. Total de Créditos: 3 H. Teórico: 2 H. Práctico: 2

Más detalles

LA HERENCIA BIOLÓGICA!

LA HERENCIA BIOLÓGICA! LA HERENCIA BIOLÓGICA! Atecedentes históricos! S. XVIII-XIX! " Kolreuter (1760) y Gaertner (1820)! - Experimentos de hibridación animal y vegetal; los híbridos presentan características de un progenitor

Más detalles

PONTIFICIA UNIVERSIDAD CATOLICA DEL ECUADOR ESCUELA DE CIENCIAS QUIMICAS

PONTIFICIA UNIVERSIDAD CATOLICA DEL ECUADOR ESCUELA DE CIENCIAS QUIMICAS 1 PONTIFICIA UNIVERSIDAD CATOLICA DEL ECUADOR ESCUELA DE CIENCIAS QUIMICAS 1. DATOS INFORMATIVOS: MATERIA O MODULO: Biología General CARRERA: Química Analítica NIVEL: Primero No. DE CREDITOS: Cuatro PROFESORA:

Más detalles

BIOQUIMICA Y GENETICA MOLECULAR APLICADA A LA VETERINARIA

BIOQUIMICA Y GENETICA MOLECULAR APLICADA A LA VETERINARIA BIOQUIMICA Y GENETICA MOLECULAR APLICADA A LA VETERINARIA PROFESORADO CURSO 1994-1995: Dr. J. Ariño (Unidad de Bioquímica) Dra. F. Bosch (Unidad de Bioquímica) Dr. A. Sánchez (Unidad de Genética y Mejora)

Más detalles

CIENCIAS NATURALES 4º ESPA CRITERIOS EVALUACIÓN, COMPETENCIAS BÁSICAS CONTENIDOS Y CRITERIOS DE EVALUACIÓN MÍNIMOS POR UNIDADES

CIENCIAS NATURALES 4º ESPA CRITERIOS EVALUACIÓN, COMPETENCIAS BÁSICAS CONTENIDOS Y CRITERIOS DE EVALUACIÓN MÍNIMOS POR UNIDADES CIENCIAS NATURALES 4º ESPA CRITERIOS EVALUACIÓN, COMPETENCIAS BÁSICAS CONTENIDOS Y CRITERIOS DE EVALUACIÓN MÍNIMOS POR UNIDADES CIENCIAS NATURALES CUARTO MÓDULO ESPA UNIDAD 1: HISTORIA DE LA TIERRA Y DE

Más detalles

Unidad 1: La Tierra cambia

Unidad 1: La Tierra cambia Unidad 1: La Tierra cambia 1. Distinguir entre actualismo, catastrofismo y neocatastrofismo, como teorías que tratan de explicar el mecanismo de los cambios geológicos. 2. Valorar las explicaciones que

Más detalles

EJE D: Aplicaciones biomédicas de la biología

EJE D: Aplicaciones biomédicas de la biología UNIVERSIDAD NACIONAL DE CORDOBA FACULTAD DE ODONTOLOGIA CATEDRA A DE BIOLOGIA CELULAR 2008 EJE D: Aplicaciones biomédicas de la biología Trabajo Práctico Nº 7: Proliferación Celular y reproducción humana.

Más detalles

Acerca del libro Nada en la biología tiene sentido, si no se considera a la luz de la evolución. El origen de la vida.

Acerca del libro Nada en la biología tiene sentido, si no se considera a la luz de la evolución. El origen de la vida. Acerca del libro Los contenidos de Biología 2 responden a la nueva currícula del programa de biología para segundo año del Gobierno de la Ciudad de Buenos Aires. La evolución constituye el hilo conductor

Más detalles

AUTOR/PRODUCCIÓN: España. Ministerio de Educación y Ciencia

AUTOR/PRODUCCIÓN: España. Ministerio de Educación y Ciencia TÍTULO DEL VIDEO: NÚCLEO CELULAR AUTOR/PRODUCCIÓN: España. Ministerio de Educación y Ciencia DURACIÓN: 00:00:54 GÉNERO: Ficción AÑO: DESCRIPCIÓN: El video trata sobre el núcleo celular, el cual se encuentra

Más detalles

BIOLOGÍA 2º DE BACHILLERATO a. Planificación temporal

BIOLOGÍA 2º DE BACHILLERATO a. Planificación temporal BIOLOGÍA 2º DE BACHILLERATO a. Planificación temporal El curso está dividido en tres evaluaciones, de acuerdo con la programación general del Colegio, temporalizadas con la siguiente distribución: 1ª EVALUACIÓN

Más detalles

TRABAJO PRÁCTICO Nº 3 GENÉTICA

TRABAJO PRÁCTICO Nº 3 GENÉTICA TRABAJO PRÁCTICO Nº 3 GENÉTICA Objetivos: Diferenciar los niveles de organización y compactación del material genético. Comprender los principios básicos de herencia, basados en la genética mendeliana.

Más detalles

EDUCACIÓN PARA LA SALUD

EDUCACIÓN PARA LA SALUD EDUCACIÓN PARA LA SALUD Curso: 4to cuatrimestre Turno: Mañana/Noche Profesores: Alejandra Iwachow E-mail: a_iwachow@hotmail.com Bachillerato para Adultos con orientación en computación RM 240/91 PROGRAMA

Más detalles

Gen. Locus. El lugar donde se localiza el gen en el cromosoma.

Gen. Locus. El lugar donde se localiza el gen en el cromosoma. GENÉTICA MENDELIANA Griffiths A., Wessler S., Lewontin R., Gelbart W., Suzuki D., Miller J. (2005) Introduction to Genetic Analysis (8 th ed). W.H. Freeman and Company, New York. (también ediciones recientes)

Más detalles

Qué estudia la genética? Qué importancia tiene la Genética Molecular para la arqueología?

Qué estudia la genética? Qué importancia tiene la Genética Molecular para la arqueología? Qué estudia la genética? Qué importancia tiene la Genética Molecular para la arqueología? Todos los seres vivos somos herederos de un bien fundamental, el material genético, que se transmite de generación

Más detalles

Propuesta Reforma Curricular 2008

Propuesta Reforma Curricular 2008 Propuesta Reforma Curricular 2008 ASIGNATURA: BIOLOGÍA Dirección de Ciencias Naturales Área de: BIOLOGÍA CÓDIGO: Mnemónico: BIOL Numérico: 1. OBJETIVOS GENERALES Crear en el estudiante interés por adquirir

Más detalles

Metodología de Enseñanzaaprendizaje. -Moderación de Exposiciones grupales

Metodología de Enseñanzaaprendizaje. -Moderación de Exposiciones grupales PLANIFICACIÓN ANALÍTICA DATOS GENERALES DEL CURSO Centro Regional o Asociado: San Pedro Sula. Asignatura: BIOLOGIA Modalidad: Presencial: Lunes a Jueves 10:00 a 10:50 a.m. y 4:00 a 4:50 p.m. Período Académico:

Más detalles

PRINCIPIOS DE GENÉTICA CUANTITATIVA

PRINCIPIOS DE GENÉTICA CUANTITATIVA PRINCIPIOS DE GENÉTICA CUANTITATIVA CARACTERES ANALIZADOS POR MENDEL Pisum sativum CARACTERES CUALITATIVOS CARACTERES QUE SE PUEDEN DESCRIBIR LOS INDIVIDUOS SE CLASIFICAN CLARAMENTE EN CATEGORIAS EL ESTUDIO

Más detalles

Guía Teórica Genética. Med. Díaz, Alejandra Inés

Guía Teórica Genética. Med. Díaz, Alejandra Inés Med. Díaz, Alejandra Inés Guía Teórica Genética 1 LEY DE MENDEL HERENCIA MENDELIANA 2 LEY DE MENDEL HERENCIA CODOMINANCIA HERENCIA NO MENDELIANA DOMINANCIA INCOMPLETA LIGAMIENTO AL SEXO Genética BASES

Más detalles

GENÉTICA: Herencia, Expresión génica, Replicación, biotecnología Selectividad: herencia

GENÉTICA: Herencia, Expresión génica, Replicación, biotecnología Selectividad: herencia GENÉTICA: Herencia, Expresión génica, Replicación, biotecnología Selectividad: herencia 5 JUN9.- Existen caracteres que no se comportan típicamente como los Mendelianos y sus patrones de herencia muestran

Más detalles

FACULTAD DE CIENCIAS NATURALES DEPARTAMENTO DE BIOLOGIA

FACULTAD DE CIENCIAS NATURALES DEPARTAMENTO DE BIOLOGIA FACULTAD DE CIENCIAS NATURALES DEPARTAMENTO DE BIOLOGIA Código-Materia: 21000 - Biología general y Laboratorio Programa: Biología, Química, Química farmacéutica - Primer semestre Período académico: 2016-2

Más detalles

CRITERIOS GENERALES DE EVALUACION

CRITERIOS GENERALES DE EVALUACION CICLO BASICO Y ORIENATADO (CIENCIAS NATURALES Y CIENCIAS SOCIALES) JEFE DE DEPARTAMENTO: Corbalán Iramain, Maribel CRITERIOS GENERALES DE EVALUACION: CARPETA COMPLETA UTILIZACION DE VOCABULARIO CIENTIFICO

Más detalles

TEMA 2 TEORÍA CROMOSÓMICA DE LA HERENCIA

TEMA 2 TEORÍA CROMOSÓMICA DE LA HERENCIA TEMA 2 TEORÍA CROMOSÓMICA DE LA HERENCIA Número cromosómico de algunas especies Especie 2n Lombriz intestinal (Ascaris lumbricoides) Mosca fruta (Drosophila melanogaster) Guisante (Pisum sativum) Grillo

Más detalles

TALLER (Evaluación 20 de abril). C E R T A A P R I N C I P I O D E S E G R E G A C I O N I

TALLER (Evaluación 20 de abril). C E R T A A P R I N C I P I O D E S E G R E G A C I O N I I. SOPA DE LETRAS TALLER (Evaluación 20 de abril). C E R T A A P R I N C I P I O D E S E G R E G A C I O N I A R D C Z F J Ñ V H I R A J V U B W L G B A C O R P I X P C D G N Z Q E H U L M F A F J A C

Más detalles

INSTITUTO SUPERIOR PORTEÑO. ESPACIO CURRICULAR DE CIENCIAS BIOLÓGICAS 2º año Prof. Adriana Ospina Correa

INSTITUTO SUPERIOR PORTEÑO. ESPACIO CURRICULAR DE CIENCIAS BIOLÓGICAS 2º año Prof. Adriana Ospina Correa INSTITUTO SUPERIOR PORTEÑO ESPACIO CURRICULAR DE CIENCIAS BIOLÓGICAS 2º año 2016 Prof. Adriana Ospina Correa FUNDAMENTACIÓN: La biología, en particular, es una ciencia relacionada con el hombre en varias

Más detalles

ASIGNATURA: BIOLOGÍA CELULAR Y GENÉTICA

ASIGNATURA: BIOLOGÍA CELULAR Y GENÉTICA Página 1 de 5 CARACTERÍSTICAS GENERALES* Tipo: Formación básica, Obligatoria, Optativa Trabajo de fin de grado, Prácticas externas Duración: Cuatrimestral Semestre/s: 1 Número de créditos ECTS: 6 Idioma/s:

Más detalles

Tema 1 La célula: PVA.

Tema 1 La célula: PVA. Tema 1 La célula: 2(5) Cuál es la importancia del descubrimiento de ramón y Cajal acerca de la individualidad de la neurona? - Tiene una gran importancia porque descubre que las neuronas no están unidas,

Más detalles

PROGRAMA. 2. MATERIA/ SEMINARIO/OBLIGACION ACADEMICA: Genética. 4. SEDE: Delegación Provincia de Corrientes Campus San Roque González de Santa Cruz

PROGRAMA. 2. MATERIA/ SEMINARIO/OBLIGACION ACADEMICA: Genética. 4. SEDE: Delegación Provincia de Corrientes Campus San Roque González de Santa Cruz UNIVERSIDAD DEL SALVADOR Delegación Provincia de Corrientes Campus San Roque González de Santa Cruz Plan. Res. Rec. 260/2006 PROGRAMA 1. CARRERA: Agronomía 2. MATERIA/ SEMINARIO/OBLIGACION ACADEMICA: Genética

Más detalles

La herencia de los caracteres

La herencia de los caracteres Genética La herencia de los caracteres Se denomina genética a la ciencia que se encarga de estudiar la herencia de los caracteres entre padres e hijos Las leyes que rigen ese traspaso de información entre

Más detalles

SÍLABO DE BIOLOGÍA I. INFORMACIÓN GENERAL:

SÍLABO DE BIOLOGÍA I. INFORMACIÓN GENERAL: MARINA DE GUERRA DEL PERU DIRECCION GENERAL DE EDUCACION INSTITUTO DE EDUCACIÒN SUPERIOR TECNOLOGICO PÚBLICO NAVAL - CITEN SÍLABO DE BIOLOGÍA I. INFORMACIÓN GENERAL: Programa de Formación Profesional Técnica

Más detalles

GENÉTICA CUANTITATIVA Y LAS BASES MOLECULARES DE LOS RASGOS MULTIFACTORIALES.

GENÉTICA CUANTITATIVA Y LAS BASES MOLECULARES DE LOS RASGOS MULTIFACTORIALES. GENÉTICA CUANTITATIVA Y LAS BASES MOLECULARES DE LOS RASGOS MULTIFACTORIALES. GENÉTICA CUANTITATIVA 1) Tipos de características cuantitativas 2) Relación entre: genotipo y fenotipo en características cuantitativas

Más detalles

FACULTAD DE CIENCIAS DE LA SALUD ESCUELA PROFESIONAL DE ENFERMERIA SILABO

FACULTAD DE CIENCIAS DE LA SALUD ESCUELA PROFESIONAL DE ENFERMERIA SILABO FACULTAD DE CIENCIAS DE LA SALUD ESCUELA PROFESIONAL DE ENFERMERIA SILABO 1. DATOS INFORMATIVOS 1.1 Nombre de la Asignatura : BIOLOGÍA CELULAR Y MOLECULAR 1.2 Código de la Asignatura : EGCS 209 1.3 Número

Más detalles

FACULTAD DE CIENCIAS DE LA SALUD ESCUELA PROFESIONAL DE OBSTETRICIA SILABO

FACULTAD DE CIENCIAS DE LA SALUD ESCUELA PROFESIONAL DE OBSTETRICIA SILABO 1. DATOS INFORMATIVOS. FACULTAD DE CIENCIAS DE LA SALUD ESCUELA PROFESIONAL DE OBSTETRICIA SILABO 1.1 Nombre de la Asignatura : BIOLOGÍA CELULAR Y MOLECULAR 1.2 Código de la Asignatura : EGCS 209 1.3 Número

Más detalles

1º Y 2º BACHILLERATO INTERNACIONAL BIOLOGÍA NIVEL SUPERIOR PROGRAMACIÓN DIDÁCTICA DEPARTAMENTO DE CIENCIAS NATURALES I.E.S.

1º Y 2º BACHILLERATO INTERNACIONAL BIOLOGÍA NIVEL SUPERIOR PROGRAMACIÓN DIDÁCTICA DEPARTAMENTO DE CIENCIAS NATURALES I.E.S. 1º Y 2º BACHILLERATO INTERNACIONAL BIOLOGÍA NIVEL SUPERIOR PROGRAMACIÓN DIDÁCTICA 2014-15 DEPARTAMENTO DE CIENCIAS NATURALES I.E.S. BACHILLER SABUCO 1 Programa a impartir en dos cursos: Nivel Medio (NM)

Más detalles

MEDICINA Primer Cuatrimestre

MEDICINA Primer Cuatrimestre U.N.P.S.J. B. BIOLOGÍA MEDICINA Primer Cuatrimestre 2017 REPASAMOS 1. En el siguiente esquema aparecen desordenadas las fases de la meiosis. Indica qué imagen corresponde a: a. Anafase I. b. Anafase II.

Más detalles

POLÍTICAS DEL CURSO DE BIOLOGÍA

POLÍTICAS DEL CURSO DE BIOLOGÍA POLÍTICAS DEL CURSO DE BIOLOGÍA OBJETIVO GENERAL Introducir a los estudiantes en la era biológica OBJETIVOS ESPECIFICOS TERMINALES Al finalizar el curso el estudiante será capaz de: Entender los diferentes

Más detalles

CURSO DE PREPARACIÓN DE LAS PRUEBAS LIBRES PARA LA OBTENCIÓN DEL TÍTULO DE BACHILLER PARA PERSONAS MAYORES DE VEINTE AÑOS BIOLOGÍA

CURSO DE PREPARACIÓN DE LAS PRUEBAS LIBRES PARA LA OBTENCIÓN DEL TÍTULO DE BACHILLER PARA PERSONAS MAYORES DE VEINTE AÑOS BIOLOGÍA CURSO DE PREPARACIÓN DE LAS PRUEBAS LIBRES PARA LA OBTENCIÓN DEL TÍTULO DE BACHILLER PARA PERSONAS MAYORES DE VEINTE AÑOS BIOLOGÍA DISTRIBUCIÓN DE LOS CONTENIDOS POR BLOQUES TEMÁTICOS Y CRITERIOS DE EVALUACIÓN

Más detalles

PREGUNTAS DE LA PRUEBA DE ACCESO A LA UNIVERSIDAD

PREGUNTAS DE LA PRUEBA DE ACCESO A LA UNIVERSIDAD TEORÍA 1.- Defina cruzamiento prueba [0,5] y herencia intermedia [0,5]. Explíquelos mediante cruzamientos utilizando los símbolos A y a [1]. TEORÍA 2.- Un incendio ha producido grandes cambios en el fenotipo,

Más detalles

TÉCNICO SUPERIOR UNIVERSITARIO EN PROCESOS ALIMENTARIOS EN COMPETENCIAS PROFESIONALES ASIGNATURA DE BIOLOGÍA

TÉCNICO SUPERIOR UNIVERSITARIO EN PROCESOS ALIMENTARIOS EN COMPETENCIAS PROFESIONALES ASIGNATURA DE BIOLOGÍA TÉCNICO SUPERIOR UNIVERSITARIO EN PROCESOS ALIMENTARIOS EN COMPETENCIAS PROFESIONALES ASIGNATURA DE BIOLOGÍA 1. Competencias Industrializar materias primas, a través de procesos tecnológicos, para producir

Más detalles

CUESTIONES DE SELECTIVIDAD BLOQUE IV GENÉTICA

CUESTIONES DE SELECTIVIDAD BLOQUE IV GENÉTICA CUESTIONES DE SELECTIVIDAD BLOQUE IV GENÉTICA MENDELISMO 1. En relación con las aportaciones de Mendel al estudio de la herencia: a) Explique brevemente el tipo de herencia de una enfermedad hereditaria

Más detalles

Genética. Qué entendemos por genética?

Genética. Qué entendemos por genética? GCCGGGTAGGGAGGCCGGTCCCGCGGGCGGGGGCGGGGCCGGCTCCGCGGCTTCTCCCGCCGCCGCCGCCGCCAAGGGGAGTTTCCAGGAAGTGGCCA TATTGGATCCATTCAGCCGCAGCCGCCCGGGCGGAGCGCGTCCCGCAGCCGGCTCATCCCCGCCGCGGCCCCGGCGTTCCCCGCAACCCGCCCGCCCG GTGCGCAGCTCGCCATGGCGGCCACCGACTTGGAACGCGTCTCGAACGCAGAGCCTGAGCCCCGGAGCCTGTCCCTGGGCGGCCATGTTGGGTTTGAC

Más detalles

Tablas de contenidos Ciencias Naturales, Biología, Física y Química PDN primer semestre 2017

Tablas de contenidos Ciencias Naturales, Biología, Física y Química PDN primer semestre 2017 Primero básico 1 Tablas de contenidos Ciencias Naturales, Biología, Física y Química PDN primer semestre 2017 Ciencias de la vida: cuerpo humano y salud Ciencias de la vida Órganos de los sentidos Hábitos

Más detalles

INTRODUCCI~N: LA GENÉTICA COMO ESFUERZO HUMANO 1

INTRODUCCI~N: LA GENÉTICA COMO ESFUERZO HUMANO 1 Prefacio xvii INTRODUCCI~N: LA GENÉTICA COMO ESFUERZO HUMANO 1 Conceptos antiguos de la genética 1 El cultivo de la tierra y la doma de los animales 1 Mitos y mutantes 3 Los griegos: El origen de la tradición

Más detalles

PONTIFICIA UNIVERSIDAD CATOLICA DEL ECUADOR ESCUELA DE CIENCIAS QUIMICAS

PONTIFICIA UNIVERSIDAD CATOLICA DEL ECUADOR ESCUELA DE CIENCIAS QUIMICAS PONTIFICIA UNIVERSIDAD CATOLICA DEL ECUADOR ESCUELA DE CIENCIAS QUIMICAS 1 1. DATOS INFORMATIVOS: MATERIA O MODULO: Biología General: Teoría y Laboratorio CODIGO: 12792 CARRERA: Ciencias Químicas: Mención

Más detalles

USO DE LEVADURAS COMO PRODUCTORES DE PROTEINAS DE INTERES FARMACEUTICO

USO DE LEVADURAS COMO PRODUCTORES DE PROTEINAS DE INTERES FARMACEUTICO USO DE LEVADURAS COMO PRODUCTORES DE PROTEINAS DE INTERES FARMACEUTICO INTRODUCCION Un microoganismo de uso industrial debe producir la sustancia de interés; estar disponible en cultivo puro; debe ser

Más detalles

Drosophila melanogaster. Organismo modelo

Drosophila melanogaster. Organismo modelo Drosophila melanogaster Organismo modelo LOS ESTUDIOS GENÉTICOS CONFÍAN EN LA UTILIZACIÓN DE ORGANISMOS MODELOS Organismo Modelo Organismos ultilizados para el estudio de procesos biológicos básicos Mus

Más detalles

PONTIFICIA UNIVERSIDAD CATOLICA DEL ECUADOR ESCUELA DE CIENCIAS QUIMICAS

PONTIFICIA UNIVERSIDAD CATOLICA DEL ECUADOR ESCUELA DE CIENCIAS QUIMICAS 1 PONTIFICIA UNIVERSIDAD CATOLICA DEL ECUADOR ESCUELA DE CIENCIAS QUIMICAS 1. DATOS INFORMATIVOS: MATERIA O MODULO: Biología General: Teoría y Laboratorio CODIGO: 12792 CARRERA: Ciencias Químicas: Mención

Más detalles

I. INTRODUCCIÓN. A/LINKS.

I. INTRODUCCIÓN. A/LINKS. I. INTRODUCCIÓN. N. II. OBJETIVOS. III. CONTENIDOS: CONCEPTOS PROCEDIMIENTOS ACTITUDES I. ACTIVIDADES. II. METODOLOGÍA. III. CRITERIOS DE EVALUACIÓN. IV. BIBLIOGRAFÍA/LINKS. A/LINKS. La programación que

Más detalles

GENÉTICA MENDELIANA TEMA 4 (2)

GENÉTICA MENDELIANA TEMA 4 (2) GENÉTICA MENDELIANA TEMA 4 (2) DOMINANCIA INCOMPLETA Boca de dragon (Antirrhinum majus) DOMINANCIA INCOMPLETA P: F 1 : 100% F 2 : 25% 50% 25% 1 : 2 : 1 DOMINANCIA INCOMPLETA P: RR BB F 1 : 100% RB RB RB

Más detalles

ACCESO ESTUDIOS UNIVERSITARIOS MAYORES DE 25 AÑOS. UNIVERSIDAD DE ALCALÁ.

ACCESO ESTUDIOS UNIVERSITARIOS MAYORES DE 25 AÑOS. UNIVERSIDAD DE ALCALÁ. ACCESO ESTUDIOS UNIVERSITARIOS MAYORES DE 25 AÑOS. UNIVERSIDAD DE ALCALÁ. ORIENTACIÓN DE LOS CONTENIDOS PARA EL EXAMEN DE LA ASIGNATURA DE BIOLOGÍA. (2007-2008) Para superar esta prueba, el alumno deberá

Más detalles

FICHA DE BIOLOGÍA Nº 9 Profesor Mauricio Hernández Fonseca Biología 3 Medio

FICHA DE BIOLOGÍA Nº 9 Profesor Mauricio Hernández Fonseca Biología 3 Medio FICHA DE BIOLOGÍA Nº 9 Profesor Mauricio Hernández Fonseca Biología 3 Medio Nombre del Estudiante : Curso : Revisión MEIOSIS LOS CROMOSOMAS Y EL NÚMERO CROMOSÓMICO Cada estudiante en tu clase de biología

Más detalles

TEMA 4: ADN Y PROTEÍNAS. LA BIOTECNOLOGÍA

TEMA 4: ADN Y PROTEÍNAS. LA BIOTECNOLOGÍA TEMA 4: ADN Y PROTEÍNAS. LA BIOTECNOLOGÍA ADN e información genética Genes y control celular Mutaciones y su importancia biológica La biotecnología y sus aplicaciones La ingeniería genética Modificación

Más detalles

IES EL GALEÓN 2015/2016 CONTENIDOS MÍNIMOS

IES EL GALEÓN 2015/2016 CONTENIDOS MÍNIMOS DEPARTAMENTO DE: MATERIA: MÍNIMOS IES EL GALEÓN 2015/2016 BIOLOGÍA Y GEOLOGÍA BIOLOGÍA Y GEOLOGÍA Estos contenidos mínimos han sido obtenidos de los Criterios de Evalución de las materias adscritas al

Más detalles

DOCUMENTO 1: QUÉ ES EL ADN?

DOCUMENTO 1: QUÉ ES EL ADN? DOCUMENTO 1: QUÉ ES EL ADN? Los seres vivos estamos formados por estructuras microscópicas conocidas como células. Algunos organismos, como las bacterias y las amebas, están formados por una sola célula.

Más detalles

DISTRIBUCIÓN TEMPORAL DE LOS CONTENIDOS, CONTENIDOS DEL CUARTO CURSO, CONTENIDOS MÍNIMOS (*) Y CRITERIOS DE EVALUACIÓN MÍNIMOS

DISTRIBUCIÓN TEMPORAL DE LOS CONTENIDOS, CONTENIDOS DEL CUARTO CURSO, CONTENIDOS MÍNIMOS (*) Y CRITERIOS DE EVALUACIÓN MÍNIMOS 4ºESO BIOLOGÍA Y GEOLOGÍA DISTRIBUCIÓN TEMPORAL DE LOS CONTENIDOS, CONTENIDOS DEL CUARTO CURSO, CONTENIDOS MÍNIMOS Y MÍNIMOS Boque 1. La evolución de la vida Tema1. La célula, unidad de vida CONTENIDOS

Más detalles

MÍNIMOS 4º ESO: BIOLOGÍA Y GEIOLOGÍA

MÍNIMOS 4º ESO: BIOLOGÍA Y GEIOLOGÍA MÍNIMOS 4º ESO: BIOLOGÍA Y GEIOLOGÍA UNIDAD DIDÁCTICA 1: TECTÓNICA DE PLACAS Composición y estructura del interior terrestre. Métodos de estudio de la tierra. Teorías orogénicas; la deriva continental.

Más detalles

Titulación(es) Titulación Centro Curso Periodo M.U. en Bioinformática 12-V.1 ESCOLA TÈCNICA SUPERIOR D'ENGINYERIA

Titulación(es) Titulación Centro Curso Periodo M.U. en Bioinformática 12-V.1 ESCOLA TÈCNICA SUPERIOR D'ENGINYERIA FICHA IDENTIFICATIVA Datos de la Asignatura Código 42600 Nombre Genética Ciclo Máster Créditos ECTS 9.0 Curso académico 2015-2016 Titulación(es) Titulación Centro Curso Periodo 2116 - M.U. en Bioinformática

Más detalles

UNIDAD 5: LA REPRODUCCIÓN CELULAR. GENÉTICA TRADICIONAL

UNIDAD 5: LA REPRODUCCIÓN CELULAR. GENÉTICA TRADICIONAL UNIDAD 5: LA REPRODUCCIÓN CELULAR. GENÉTICA TRADICIONAL Los seres vivos se reproducen, es decir, hacen copias de sí mismos. A partir de una sola célula similar en todas las especies, se pueden formar organismos

Más detalles

TRANSMISIÓN DEL MATERIAL HEREDITARIO

TRANSMISIÓN DEL MATERIAL HEREDITARIO BLOQUE 3: LA HERENCIA. GENÉTICA MOLECULAR. III. RECOMENDACIONES TRANSMISIÓN DEL MATERIAL HEREDITARIO Tema 8.- Herencia Mendeliana y teoría cromosómica. 1.- Leyes de Mendel (Uniformidad de la primera generación

Más detalles

5.La replicación del ADN se realiza de forma continua en una cadena y discontinua en la otra. Cuál es la razón? (1) (2008-5B)

5.La replicación del ADN se realiza de forma continua en una cadena y discontinua en la otra. Cuál es la razón? (1) (2008-5B) Defina el concepto de mutación (0.6). Diferencie entre mutación espontánea e inducida (0.5). Cite un ejemplo de agente mutagénico físico, químico y uno biológico (0.3). Indique y defina otro mecanismo

Más detalles