Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática.

Save this PDF as:

Tamaño: px
Comenzar la demostración a partir de la página:

Download "Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática."


1 Departamento de Bioquímica Médica y Biología Molecular Práctica 3 Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Curso 1 Medicina (Abril) 2012 BIOQUÍMICA Y BIOLOGÍA MOLECULAR HUMANA Mohammed Rafii-El-Idrissi Benhnia Ph.D. Phone: Departamento de Bioquímica Médica y Biología Molecular 1. Familiarizarse con el proceso de amplificación mediante polimerasas 2. Identificar los parámetros críticos de una PCR y familiarizarse con el fundamento de la electroforesis de ácidos nucleicos 3. Secuenciación de ADN. OBJETIVOS 4. Identificar en el laboratorio virtual una especie patógena mediante PCR 5. Retrotranscripción-amplificación en cadena de la polimerasa (RT- PCR) 6. Caso práctico: uso de las bases de datos de genes (BLAST) y familiarizarse con la notación 1

2 Departamento de Bioquímica Médica y Biología Molecular OBJETIVOS 1. Familiarizarse con el proceso de amplificación mediante polimerasas 2. Identificar los parámetros críticos de una PCR y familiarizarse con el fundamento de la electroforesis de ácidos nucleicos 3. Secuenciación de ADN. 4. Identificar en el laboratorio virtual una especie patógena mediante PCR 5. Retrotranscripción-amplificación en cadena de la polimerasa (RT- PCR) 6. Caso práctico: uso de las bases de datos de genes (BLAST) y familiarizarse con la notación Qué es la PCR? PCR: Reacción en cadena de la polimerasa (Polymerase Chain Reaction, Kary Mullis-1985) Amplificación selectiva de un segmento particular de ADN El segmento puede representar una parte pequeña de entre una mezcla heterogénea de AND: e.g. un exón específico de un gen humano 2

3 Qué es la PCR? Herramienta muy poderosa de amplificar y/o detección de fragmentos de ADN de interés ~2 horas. La técnica de la PCR tiene multitud de aplicaciones: Ø Diagnóstico (prenatal, infecciones microbianas, mutaciones de oncogenes, etc) Ø Medicina forense Ø Antropología o Arqueología molecular Ø Microbiología ambiental Qué hay en la reacción? Molde de ADN Tampón or buffer de la reacción mantener ph adecuado para el funcionamiento de ADN polimerasa (Tris, iones amonio, iones magnesio, albúmina bovina sérica) 4 nucleótidos trifosfato (dntps): datp, dctp, dttp y dgtp Cebadores (primers) ADN polimerasa (normalmente Taq) 3

4 Qué hay en la reacción? Reagent for PCR Volume (µl) for each (25 µl total) Final concentration Taq DNA polymerase U/ml (added last) 10x buffer 2.5 1x dntps (10 mm each, µm combined) Forward primer µm Reverse primer µm dh2o (nuclease free) or Template (AND) 1 Qué hay en la reacción? CONTROLES EN LA REACCIÓN DE PCR CONTROL NEGATIVO TaqPol, dntps, buffer, cebadores + H 2 O CONTROL POSITIVO TaqPol, dntps, buffer, cebadores + DNA conocido FALSOS POSITIVOS CONTROL DE LA AMPLIFICACIÓN MUESTRA PROBLEMA TaqPol, dntps, buffer, cebadores + DNA desconocido DIAGNÓSTICO SEGURO 4

5 Termocicladores Gran variedad de suministradores. Gran variedad de formatos. Reacciones se llevan a cabo en tubos o en placas de 96. Cebadores Oligonucleótidos deben tener ~20 bases. El contenido G/C debe ser del 45 55%. La base en el extremo 3 debe ser G o C. Los cebadores no deben ser complementarios entre ellos o formar bucles consigo mismo. 5

6 Cebadores Cebadores que forman bucles 5 -GTTGACTTGATA T 3 -GAACTCT Cebadores Un cebador puede formar un dímero consigo mismo o con otro cebador. 5 -ACCGGTAGCCACGAATTCGT-3 3 -TGCTTAAGCACCGATGGCCA-5 Los cebadores pueden ser excelentes, pero no deseados, substratos para la Taq polimerasa. 6

7 Etapas de un ciclo de PCR 1- Desnaturalización denaturation 95 C, 30 sec. 2- Alineamiento Annealing C, 30 sec. 3- Extensión extension/elongation 72 C, 45 sec. Tiempo depende del tamaño del producto ciclos Etapas de un ciclo de PCR 1. Desnaturalización (denaturation) 95º C 7

8 Etapas de un ciclo de PCR 2. Alineamiento o unión de los cebadores (Annealing) 5 Cebadores (primers) º C 3 5 La PCR amplifica una zona de ADN flanqueada entre dos cebadores Etapas de un ciclo de PCR 3. Extensión (extension/elongation) Polimerasa Taq 72º C 72º C 8

9 Etapas de un ciclo de PCR ciclos: Desnaturalización. Alineamiento. Extensión. Cuántas copias se generan? No hay amplificación de la secuencia deseada hasta el tercer ciclo. La acumulación no es estrictamente el doble tras cada ciclo en las primeras fases. Tras 30 ciclos, hay 1,073,741,764 copias específicas (~ ). Hay también otras 60 copias de ADN. 9

10 Comprueba las etapas de PCR 1. Visita la página web que se indica abajo 2. Entra en el apartado Amplification 3. Observa cómo se comportan los parámetros siguientes: Temperatura, número de ciclos y etapas de PCR Nota cómo en el ciclo 3 hay 8 copias de ADN y 2 copias de la secuencia diana Video Ha funcionado PCR? Electroforesis de ADN Comprobación mediante una electroforesis (densidad eléctrica K) Es el tamaño del producto el esperado? Hay más de una banda? Quizás haya que optimizar la reacción. Video 10

11 Optimización de PCR T de alineamiento Cebadores tienen una temperatura de alineamiento de 54 C). La T debe confirmarse empíricamente. Saltos de T de 2 C arriba y abajo. Uso de cicladores con gradiente Optimización de PCR Concentración de Mg 2+ La fidelidad de la PCR depende [Mg 2+ ]. Variaciones de [Mg 2+ ] de 0.5 mm

12 Cómo es la longitud del fragmento amplificado? Típicamente entre bp. Es posible amplificar >25 kb. Requiere modificar el tampón de la reacción, tiempo de extensión y tipo de polimerasa Limitación por la integridad del material de partida. Cuántos ciclos? Acerca de la sensibilidad Saturación: Los reactivos se agotan Los productos se alinean La polimerasa se degrada Los productos no deseables se acumulan. 12

13 Son importantes los errores? Sí, si quieres clonar el fragmento amplificado de ADN una molécula individual puede tener varias mutaciones. No, si quieres secuenciar el fragmento amplificado o digerirlo con enzimas de restricción. Usa un enzima con capacidad correctora. Departamento de Bioquímica Médica y Biología Molecular 1. Familiarizarse con el proceso de amplificación mediante polimerasas 2. Identificar los parámetros críticos de una PCR y familiarizarse con el fundamento de la electroforesis de ácidos nucleicos 3. Secuenciación de ADN. OBJETIVOS 4. Identificar en el laboratorio virtual una especie patógena mediante PCR 5. Retrotranscripción-amplificación en cadena de la polimerasa (RT- PCR) 6. Caso práctico: uso de las bases de datos de genes (BLAST) y familiarizarse con la notación 13

14 Método de Sanger para secuenciación de nucleótidos Método enzimático El ADN molde. Un enzima que replique el ADN. Un cebador o "primer" marcado radiactivamente. Los cuatro nucleótidos trifosfato (datp, dctp, dgtp y dttp). Nucleótidos dideoxi (ddatp, ddttp, ddctp y ddgtp). Son nucleótidos modificados que han perdido el grupo hidroxilo de la posición 3' de la desoxirribosa. Método de Sanger para secuenciación de nucleótidos Deben realizarse en 4 tubos diferentes, 4 mezclas de reacción. Cada mezcla de reacción contiene 4 nucleótidos trifosfato (datp, dctp, de dttp y dgtp), ADN polimerasa I, un cebador marcado radiactivamente y un nucleótido dideoxi, por ejemplo ddgtp, a una concentración baja. El nucleótido dideoxi utilizado (ddgtp) competirá con su homólogo (dgtp) por incorporarse a la cadena de ADN que se está sintetizando, produciendo la terminación de la síntesis en el momento y lugar donde se incorpora. 14


16 G A T C - A continuación, las cuatro mezclas se someten a electroforesis en poliacrilamida-sds. Este método separa polinucleótidos en función de su tamaño, de forma que los más cortos se desplazan más rápidamente. Como el cebador está marcado Radioactiva-mente, revelamos la plancha de electroforesis por autorradiografía. Con esto leemos directamente la secuencia complementaria del polinucleótido inicial: 5 -AAGGCACATTCGATGCAAT- CGAATCGAACGTCCCAAAAG- GATTCCGGGAAAATG-3 + SECUENCIACIÓN AUTOMÁTICA DE ADN Detección al mismo tiempo 16

17 Aplicación de la PCR identificación de bacterias Entra en The bacterial identification lab Elección del caso práctico Departamento de Bioquímica Médica y Biología Molecular OBJETIVOS 1. Familiarizarse con el proceso de amplificación mediante polimerasas 2. Identificar los parámetros críticos de una PCR y familiarizarse con el fundamento de la electroforesis de ácidos nucleicos 3. Secuenciación de ADN. 4. Identificar en el laboratorio virtual una especie patógena mediante PCR 5. Retrotranscripción-amplificación en cadena de la polimerasa (RT- PCR) 6. Caso práctico: uso de las bases de datos de genes (BLAST) y familiarizarse con la notación 17

18 Podemos amplificar por PCR ARN? No directamente la ADN polimerasa necesita un molde de ADN y no copia ARN. mrna puede copiarse antes en ADN complementario al ARN (cdna) usando la transcriptasa inversa. cdna es un molde para la PCR Retrotranscripción-amplificación en cadena de la polimerasa (RT-PCR) RT PCR master mixes Reagent for PCR Volume (µl) for each (25 µl total) Final concentration Quiagen RT PCR buffer 5x 5 1x One step RT PCR enzyme 1 Mix dntps (10 mm each, µm each dntp combined) Primers A µm Primers B µm dh2o (nuclease free) 5.75 Template (mrna) 10 18

19 Retrotranscripción-amplificación en cadena de la polimerasa (RT-PCR) er paso: retrotranscripción a partir del ARN. 2º paso: amplificación a partir de la primera hebra de ADNc. 5 PCR 5 5.3er paso: PCR estándar. RT A Retrotranscripción-amplificación en cadena de la polimerasa (RT-PCR) 7 kb exon 1 intron 1 exon 2 B 7 kb exon 1 intron 1 exon 2 exon 3 M A B 1200 pb 600 pb 19

20 Trabajando con secuencias Caso práctico: BLAST 1. Localiza en la base de datos el gen para óxido nítrico sintasa inducible, inos, NM_ Familiarizarse con la notación la secuencia de nt pertenece a ARN o es genómica? Dónde comienza y acaba la proteína? Entra en la base de datos NCBI para ver el gen de la inos murine Videos 20

21 Caso práctico: BLAST Identifica los cebadores en la secuencia usando BLAST contra el gen (NOS2) Seq 1 introduce en GI el número del gen NM_ Seq 2 introduce (copy-paste) el oligo 5 y el oligo 3 Oligo 5 CAgCTCATCCggTACgCTggCTAC Oligo 3 ACTTCCTCCAggATgTTgTAgCg Cuál es el tamaño amplificado tras RT-PCR? 397 pb Video Departamento de Bioquímica Médica y Biología Molecular Mohammed Rafii-El-Idrissi Benhnia Ph.D. Scientist Infectious diseases and vaccine discovery Gracias Thanks 21

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now.

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now. Unidad Curricular: Virología y Micología Veterinaria 1 TRABAJO PRÁCTICO No. 3 AMPLIFICACIÓN DE GENES VIRALES Reacción en Cadena de la Polimerasa, conocida como PCR (por sus siglas en inglés: Polimerase

Más detalles

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas ELEMENTOS BÁSICOS DE LA INVESTIGACIÓN EN GENES Análisis

Más detalles



Más detalles

Reacción en cadena de la polymerasa (PCR)

Reacción en cadena de la polymerasa (PCR) Reacción en cadena de la polymerasa (PCR) 1 PCR Que es? Es una técnica in vitro diseñada para amplificar una región específica de DNA. Es extremadamente sensible, con la capacidad de amplificar millones

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles


ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles

PCR. Técnica inventada por Kary Mullis :1987. Premio Nobel 1993. Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN

PCR. Técnica inventada por Kary Mullis :1987. Premio Nobel 1993. Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN PCR PCR Técnica inventada por Kary Mullis :1987 Premio Nobel 1993 Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN Aprovecha los requerimientos de la replicación Templete ADN Nucleótidos

Más detalles

P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA"

P.C.R. Técnica de amplificación enzimática de secuencias específicas de DNA P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA" Paso 1: Desnaturalización del DNA Paso 2: Hibridación de los "Primers" Paso 3: Extensión Paso 1: Desnaturalización del DNA

Más detalles

Tipos de Muestras. Técnicas de Biología Molecular. Extracción de ácidos nucleicos. Extracción de DNA genómico. Muestra de sangre en papel filtro

Tipos de Muestras. Técnicas de Biología Molecular. Extracción de ácidos nucleicos. Extracción de DNA genómico. Muestra de sangre en papel filtro Técnicas de Biología Molecular Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO 2004 Tipos de Muestras Extracción de ácidos nucleicos o DNA o RNA Sangre total (EDTA) Saliva Líquido Amniótico Bulbo

Más detalles

3/22/2010. Iván Ferrer Rodríguez, PhD Catedrático. En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR.

3/22/2010. Iván Ferrer Rodríguez, PhD Catedrático. En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR. Iván Ferrer Rodríguez, PhD Catedrático En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR. Síntesis "in vitro" de secuencias específicas de ADN son amplificadas.

Más detalles


FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa?

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa? 2º BIOQUÍMICA CUESTIONES 1. Por qué la PCR convencional no es cuantitativa? En la PCR convencional, la cuantificación del ADN de la muestra es complicada debido a que la eficacia de amplificación va disminuyendo

Más detalles

Técnicas moleculares.

Técnicas moleculares. Técnicas moleculares. DMTV Carolina Acevedo Curso de Microbiología 2015 SÍNTESIS IN VITRO DE UNA GRAN CANTIDAD DE COPIAS DE UN SEGMENTO DE ADN EXISTENTE EN UNA MUESTRA. O sea. Amplificamos en forma exponencial

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

Reacción en cadena de la polimerasa (PCR)

Reacción en cadena de la polimerasa (PCR) Dr. Alejandro Leal Reacción en cadena de la polimerasa (PCR) La reacción en cadena de la polimerasa (PCR, por sus siglas en inglés de "polymerase chain reaction") es un método de amplificación in vitro

Más detalles

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras METODOLOGIA DEL PCR Lic. Jorge Mato Luis Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras Desnaturalización del DNA 5 A G G T T A G T G G A C C C T T G A T 3 3 T C C A

Más detalles

Materiales para la secuenciación de ADN

Materiales para la secuenciación de ADN Introduccion La Secuenciación Sanger es un método de secuenciación de ADN en el que el ADN diana se desnaturaliza y se hibrida con un cebador de oligonucleótidos, que se extiende entonces gracias a la

Más detalles

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR Módulo 1 Amplificación de un fragmento de ADN genómico por PCR En este primer módulo se amplificará por PCR, mediante el uso de oligonucleótidos específicos, un fragmento de ADN genómico de Aspergillus

Más detalles


CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 DEFINICIÓN PCR: Constituye la técnica más importante para amplificar ácidos nucleicos in vitro. Ambas hebras del DNA de interés son replicadas

Más detalles

Técnicas de Biología Molecular

Técnicas de Biología Molecular Técnicas de Biología Molecular DNA I. Enzimas de restricción Análisis Las enzimas de restricción fueron aisladas de bacterias; su función natural es proteger contra DNA extraño II. Separación electroforética

Más detalles


APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS Prácticas docentes en la COD: 10-71 APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS FUNDAMENTO TEÓRICO La PCR es una técnica que permite llevar a cabo la síntesis in vitro de fragmentos de ADN. Está basada

Más detalles

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml)

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml) PCR SIMULADA Ref.PCR Simulada (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental.

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Gemma Saucedo. Laboratorio Aguas de Barcelona 22-23 de noviembre de 2006 Introducción PCR: Polymerase Chain Reaction

Más detalles

Reacción en cadena de la Polimerasa (PCR)

Reacción en cadena de la Polimerasa (PCR) Explicación de TP Nº 2 Reacción en cadena de la Polimerasa (PCR) Química Biológica Patológica Dra. Mariana L. Ferramola Dra. Gabriela Lacoste 2015 Definición de PCR Es la amplificación enzimática de un

Más detalles


FACULTAD REGIONAL ROSARIO FACULTAD REGIONAL ROSARIO CATEDRA BIOTECNOLOGIA ROFESOR: Ing. Eduardo Santambrosio JTP: Ing. Marta Ortega AUX 1ª : Ing. Pablo Garibaldi PCR (Polymerase chain reaction) Reacción en cadena de la polimerasa

Más detalles

Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez

Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez 1 Objetivos Entender la técnica: Reacción de Polimerasa en Cadena (PCR por sus siglas en inglés)

Más detalles

PCR. Qué es la PCR? T a de fusión de oligonucleótidos (t m )

PCR. Qué es la PCR? T a de fusión de oligonucleótidos (t m ) % a de fusión de oligonucleótidos (t m ) Qué es la PCR? La reacción en cadena de la polimerasa (PCR: polymerase chain reaction) es una técnica de amplificación de secuencias de DNA in vitro t m = 2 (A

Más detalles

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica TÉCNICAS GENÓMICAS Utilidad/Objetivos: 1) Detección de microorganismos directamente en muestras clínicas identificando un fragmento específico del genoma del microorganismo concreto 2) Cuantificación del

Más detalles

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri OBJETIVO Desarrollar un banco de datos a partir de plantas de origen indudable y del uso

Más detalles



Más detalles


DETERMINACIÓN DEL FACTOR Rh por PCR Ref.PCRRh DETERMINACIÓN DEL FACTOR Rh por PCR 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles

Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón

Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón Reacción en Cadena de la INTRODUCCION: Polimerasa (RCP) Década de los 70: Grandes

Más detalles

Técnicas de Biología Molecular. Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO

Técnicas de Biología Molecular. Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO Técnicas de Biología Molecular Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO 2004 Extracción de ácidos nucleicos o o DNA RNA Tipos de Muestras Sangre total (EDTA) Saliva Líquido Amniótico Bulbo

Más detalles



Más detalles

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada La PCR La Reacción en Cadena de la Polimerasa es la herramienta más utilizada PCR- Ventajas y Usos Amplificación ilimitada de secuencias de interés. Rápida, Sencilla y Eficaz. Técnica altamente sensible

Más detalles

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante BIOTECNOLOGÍA 1.- Ingeniería Genética, ADN recombinante Técnica del ADN recombinante: es la más usada en ingeniería genética, esta basada en el uso de las enzimas de restricción o endonucleasas de restricción

Más detalles


TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO TEST de PATERNIDAD Este experimento introduce a los alumnos en el uso del ADN y la PCR para simular una determinación de paternidad. Los estudiantes

Más detalles

Clonación molecular. Clonar significa hacer copias idénticas

Clonación molecular. Clonar significa hacer copias idénticas INGENIERÍA GENÉTICA Clonación molecular Clonar significa hacer copias idénticas Este término originalmente fue aplicado al procedimiento de aislar una célula y permitirle reproducirse creando una población

Más detalles

Metodologías basadas en la identificación del ADN: PCR, hibridación, secuenciación y análisis de secuencias.

Metodologías basadas en la identificación del ADN: PCR, hibridación, secuenciación y análisis de secuencias. Metodologías basadas en la identificación del ADN: PCR, hibridación, secuenciación y análisis de secuencias. Dra. Sonia Arduino Dep. de Clínica Estomatología Facultad de Postgrado en Ciencias de la Salud

Más detalles

Practica la genética Ficha didáctica del profesorado Bachillerato

Practica la genética Ficha didáctica del profesorado Bachillerato Ficha didáctica del profesorado Bachillerato Extracción de ADN Cuál es la función de cada uno de los ingredientes utilizados para realizar la disolución tampón para la visualización

Más detalles

- Clonar un gen (molde ADN o ARN)

- Clonar un gen (molde ADN o ARN) APLICACIONES PCR Aplicaciones de la PCR - Clonar un gen (molde ADN o ARN) - Secuencia conocida - Genes homólogos en especies próximas (primers degenerados) - Información de secuencia proteica (primers

Más detalles

Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional

Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional BIOQ. LILIANA DI TULLIO BUDASSI FAC. CS.BIOQUÍMICAS Y FARMACÉUTICAS UNIVERSIDAD NACIONAL DE ROSARIO

Más detalles

Tema 11. Herramientas de la genética molecular

Tema 11. Herramientas de la genética molecular Tema 11. Herramientas de la genética molecular Genética CC. Mar 2004-05 Objetivos Técnicas de clonación Construcción de genotecas e identificación de secuencias Mapas de restricción Amplificación (PCR)

Más detalles

Amplificación de ácidos nucleicos in vitro.

Amplificación de ácidos nucleicos in vitro. Amplificación de ácidos nucleicos in vitro. El principal objetivo de las técnicas de amplificación de ácidos nucleicos in vitro, es mejorar la sensibilidad de los test basados en ácidos nucleicos y simplificarlos

Más detalles

PCR Punto de No Retorno de la Biología Molecular

PCR Punto de No Retorno de la Biología Molecular TÉCNICAS DE ANÁLISIS EN BIOLOGÍA MOLECULAR CURSO DE BIOTECNOLOGÍA ELEMENTAL Biotechnology Explorer Julio 2012 PCR Punto de No Retorno de la Biología Molecular Qué es un gen Técnicas de aislamiento y estudio

Más detalles

Criterios para diseñar primers. Iván Ferrer Rodríguez, Ph.D. Catedrático

Criterios para diseñar primers. Iván Ferrer Rodríguez, Ph.D. Catedrático Criterios para diseñar primers Iván Ferrer Rodríguez, Ph.D. Catedrático 1 Qué es un primer? Es una cadena corta de nucleótidos, un oligonucleótido. Sirve como punto de partida para la replicación del DNA.

Más detalles

Técnica de PCR. Beatriz Bellosillo. Servei de Patologia, Hospital del Mar, Barcelona, Spain

Técnica de PCR. Beatriz Bellosillo. Servei de Patologia, Hospital del Mar, Barcelona, Spain Técnica de PCR Beatriz Bellosillo Servei de Patologia, Hospital del Mar, Barcelona, Spain Biología Molecular Estudio de los procesos que se desarrollan en los seres vivos desde un punto de vista molecular

Más detalles


PRÁCTICAS DE MICROBIOLOGIA CLINICA PRÁCTICAS DE MICROBIOLOGIA CLINICA Juan Carlos Rodríguez Hospital General Universitario de Alicante E-mail: CASO CLINICO: Rubéola Evolución

Más detalles

Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares. Técnicas Moleculares. Técnicas Moleculares 8/13/13

Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares. Técnicas Moleculares. Técnicas Moleculares 8/13/13 8/13/13 Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares CAF516 O Recursos Genéticos y Biotecnología 14 Agosto 2013 Técnicas Moleculares Aplicaciones en muchas disciplinas Generan

Más detalles


DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino DIAGNOSTICO VIROLOGICO MOLECULAR Dr. Gerardo Andino DIAGNÓSTICO MOLECULAR La tecnología empleada para la detección de genomas virales mediante la amplificación de secuencias específicas (PCR y reacciones

Más detalles

Análisis en Genética 1

Análisis en Genética 1 Análisis en Genética 1 Análisis Genético FUNCION BIOLOGICA Gen o genes implicados Localización Cartografiado Función Interacciones TIPOS DE MUTACIÓN MUTACIÓN GÉNICA -El alelo de un gen sufre un cambio,

Más detalles

Práctico: Genética bacteriana 2007.

Práctico: Genética bacteriana 2007. Práctico: Genética bacteriana 2007. Actividad integrada Departamento de Genética Departamento de Bacteriología y Virología. OBJETIVOS Objetivos generales El estudiante al terminar la actividad práctica

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60.

Más detalles

Polymerase Chain Reaction (PCR)

Polymerase Chain Reaction (PCR) Polymerase Chain Reaction (PCR) Un poco de historia La técnica de PCR fue inventada por Kary B. Mullis en 1983. La primer publicación sobre PCR apareció en 1985, aunque el principio básico de replicar

Más detalles

Introducción al diseño de primers

Introducción al diseño de primers Introducción al diseño de primers INTRODUCCIÓN Esta guía es una breve aproximación al diseño de primers, utilizando programas bioinformáticos y pretende dar una orientación a aquellas personas que están

Más detalles

N 1 Reacción n en Cadena de la Polimerasa

N 1 Reacción n en Cadena de la Polimerasa Trabajo Práctico N 1 Reacción n en Cadena de la Polimerasa Definición n e importancia. Usos y aplicaciones. Optimización. Tipos de PCR. Electroforesis. Fundamentos. Asociado al Programa Teórico: Tema 2.

Más detalles

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN.

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. PROGRAMA CONTROL DE CALIDAD DE MUESTRAS El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. El programa completo de control de calidad de muestras de ADN y ARN engloba diferentes

Más detalles


DIAGNÓSTICO GENÉTICO DEL CÁNCER HEREDITARIO Ref.PCRCAN(4 prácticas) DIAGNÓSTICO GENÉTICO DEL CÁNCER HEREDITARIO Ref.PCRCAN(4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción

Más detalles

Tecnologías basadas en la PCR

Tecnologías basadas en la PCR Tecnologías de marcadores moleculares para estudios de diversidad genética de plantas: Módulo de aprendizaje Tecnologías basadas en el ADN Tecnologías basadas en la PCR Fundamentos de la PCR Derechos de

Más detalles

Enzimas de restricción

Enzimas de restricción BIOTECNOLOGIA Enzimas de restricción Endonucleasas que reconocen dianas específicas en el ADN Protegen a cada cepa de bacterias de otro ADN que no pertenece al sistema El ADN propio está protegido porque

Más detalles

Investigación en genes. Tecnología del ADN recombinante

Investigación en genes. Tecnología del ADN recombinante Investigación en genes Tecnología del ADN recombinante Tecnología del ADN recombinante 1º parte: Conocimientos básicos que posibilitaron su desarrollo 2º parte: Instrumentos básicos 3º parte Ejemplos Conocimientos

Más detalles

REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Microbiología de los Alimentos Ingeniería en alimentos

REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Microbiología de los Alimentos Ingeniería en alimentos REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Microbiología de los Alimentos Ingeniería en alimentos 2015 Desarrollada por Kary Mullis en 1986 Técnica in vitro que permite amplificar enzimáticamente una región

Más detalles

PCR a tiempo real. Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia

PCR a tiempo real. Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia PCR a tiempo real Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia PCR a tiempo real (PCRrt) Aplicaciones: - Cuantificación de ácidos nucleicos (AQ). - Estudio

Más detalles

1) a) En la figura señale, englobando con un trazo continuo, lo siguiente:

1) a) En la figura señale, englobando con un trazo continuo, lo siguiente: CÁTEDRA: BIOQUÍMICA Carreras: Farmacia Profesorado en Química Licenciatura en Química Licenciatura en Alimentos ÁCIDOS NUCLEICOS 1) a) En la figura señale, englobando con un trazo continuo, lo siguiente:

Más detalles

Bases Moleculares. Efrén Santos

Bases Moleculares. Efrén Santos Bases Moleculares Efrén Santos ADN, ARN, proteínas ADN, contiene la información genética ARN, muy similar al ADN. (1) Copia temporal del ADN (2) Parte funcional y estructural del aparato traductor Proteinas,

Más detalles



Más detalles



Más detalles

Técnicas descritas en el curso 7.28

Técnicas descritas en el curso 7.28 Técnicas descritas en el curso 7.28 Técnica: Clase 1 Experimento de incorporación de dntps Ensayo de extensión del cebador Ensayo de unión en filtro Electroforesis en gel Análisis de ADN Helicasa Polaridad

Más detalles

Biotina: se usa uno de los dntps biotinilado. Detección: Streptavidina conjugada con enzima (ALP) o anti-biotina. Usos: NB, SB, hibridación in situ

Biotina: se usa uno de los dntps biotinilado. Detección: Streptavidina conjugada con enzima (ALP) o anti-biotina. Usos: NB, SB, hibridación in situ Northern blot Marcación no radioactiva: Digoxigenina: se usa uno de los dntps marcado con digoxigenina Detección: Anticuerpo conjugado con enzima (ALP) o fluorocromo Biotina: se usa uno de los dntps

Más detalles


5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN 5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN Materiales - Eppendorf de 1,5 ml estériles - Eppendorf de pared fina para PCR - Puntas de pipeta estériles desechables - Guantes

Más detalles



Más detalles


EVALUACION EXTERNA DEL DESEMPEÑO PARA LA DETECCION DEL VIRUS DE INFLUENZA TIPO A MEDIANTE LA TÉCNICA DE RT- PCR PANEL x (20xx) 1. OBJETIVO Evaluar el desempeño de los Laboratorios de Salud Pública participantes en cuanto a la detección del virus de la Influenza A mediante la técnica de RT PCR. 2. ALCANCE Este documento se tomo

Más detalles

Miguel Dita (1) Einar Martínez de la Parte (2) Monica Blanco (3)

Miguel Dita (1) Einar Martínez de la Parte (2) Monica Blanco (3) Generalidades de la PCR: MÉTODO DE DIAGNÓSTICO MOLECULAR DE Foc RT4 Miguel Dita (1) Einar Martínez de la Parte (2) Monica Blanco (3) 1) Bioversity International, Costa Rica 2) INISAV Cuba. 3) Universidad

Más detalles

Caracteristicas del ADN. Se rompen con las siguientes condiciones -Temperaturas >90 - ph >10.5

Caracteristicas del ADN. Se rompen con las siguientes condiciones -Temperaturas >90 - ph >10.5 PCR Caracteristicas del ADN Se rompen con las siguientes condiciones -Temperaturas >90 C - ph >10.5 Baja astringencia tiene uniones parciales o imperfectas. Renaturalización Dependiendo de: -Contenido

Más detalles


REACCIÓN EN CADENA DE LA POLIMERASA (PCR) REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Microbiología General Microbiología M de los Alimentos Licenciatura en Bioquímica i Ingeniería en alimentos c Microbiología r 2015 Licenciatura en Biotecnología

Más detalles

El laboratorio de Microbiología y Parasitología en el diagnóstico de las enfermedades tropicales importadas

El laboratorio de Microbiología y Parasitología en el diagnóstico de las enfermedades tropicales importadas El laboratorio de Microbiología y Parasitología en el diagnóstico de las enfermedades tropicales importadas Juan Carlos Rodríguez S. Microbiología Hospital General Universitario de Alicante Universidad

Más detalles

EDUCACION CONTINUADA. Introducción. Caso clínico

EDUCACION CONTINUADA. Introducción. Caso clínico EDUCACION CONTINUADA L. Castaño, J.R. Bilbao, B. Calvo An Esp Pediatr 1997;47:201-206. Introducción a la biología molecular y aplicación a la pediatría (6): Caso clínico: Trastorno molecular en la diabetes

Más detalles

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico.

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. AQUAGESTION ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. Noviembre 2011 ACTUALIDAD Este año Sernapesca confirma

Más detalles

CAPÍTULO VI. Expresión de genes relacionados con apoptosis

CAPÍTULO VI. Expresión de genes relacionados con apoptosis CAPÍTULO VI Expresión de genes relacionados con apoptosis 1.- Introducción 2.- Protocolos para análisis genéticos 3.- Resultados en MCF-7 4.- Discusión 1.- Introducción Como se ha descrito anteriormente,

Más detalles



Más detalles

(aislado directamente de células o tejidos) de otros tipos de ADN, como el

(aislado directamente de células o tejidos) de otros tipos de ADN, como el Glosario admixtura: se refiere al estado de estar mezclado (del inglés admixture). Ocurre cuando se entrecruzan individuos de dos o más poblaciones que se encontraban previamente separadas y el resultado

Más detalles

LECCIÓN 3. Caracterización mediante marcadores moleculares - ADN. Lección 3 1

LECCIÓN 3. Caracterización mediante marcadores moleculares - ADN. Lección 3 1 LECCIÓN 3. Caracterización mediante marcadores moleculares - ADN. Lección 3 1 Nociones generales sobre Marcadores Moleculares -ADN Analizan directamente la molécula de ADN. Detectan ciertas variaciones

Más detalles

Química Biológica Patológica Técnicas de Biología Molecular aplicadas a Bioquímica Clínica Tema 2 Dra. Silvia Varas Tema 2 PCR Historia Bases Optimización de una reacción de

Más detalles



Más detalles

Mutaciones asociadas a resistencia a estreptomicina y etambutol en Mycobacterium tuberculosis - secuenciación y desarrollo de cebadores.

Mutaciones asociadas a resistencia a estreptomicina y etambutol en Mycobacterium tuberculosis - secuenciación y desarrollo de cebadores. Mutaciones asociadas a resistencia a estreptomicina y etambutol en Mycobacterium tuberculosis - secuenciación y desarrollo de cebadores. Dr. Jaeson S. Calla Choque Universidad Peruana Cayetano Heredia

Más detalles

7.012 Serie de ejercicios 5

7.012 Serie de ejercicios 5 Nombre Grupo 7.012 Serie de ejercicios 5 Pregunta 1 Al estudiar los problemas de esterilidad, usted intenta aislar un hipotético gen de conejo que explique la prolífica reproducción de estos animales.

Más detalles



Más detalles

Northern blot control

Northern blot control TRANSCRIPTOMA - Northern blot - Aporta información sobre la presencia de un transcrito, su abundancia y su tamaño - Electroforesis: Se realiza en condiciones desnaturalizantes, Gel: agarosa 0,8-1,4% y

Más detalles

CAPÍTULO III. Metodología e instrumentación de análisis celular

CAPÍTULO III. Metodología e instrumentación de análisis celular CAPÍTULO III Metodología e instrumentación de análisis celular 1.- Hemocitómetro y test de exclusión de colorante Trypan blue 2.- Citometría de flujo 3.- PCR 4.- Electroforesis en gel 5.- Secuenciación

Más detalles



Más detalles

Genómica y transcriptómica para la generación de datos en Evolución

Genómica y transcriptómica para la generación de datos en Evolución recuadro Genómica y transcriptómica para la generación de datos en Evolución Gabriela Bedó Genómica. Sus objetivos Compilar todas las secuencias de un organismo Establecer la localización de los genes

Más detalles


FUNDAMENTOS DE LA TÉCNICA PCR FUNDAMENTOS DE LA TÉCNICA PCR 1 2 PCR Qué es? REACCIÓN EN CADENA DE LA POLIMERASA Técnica que nos permite amplificar selectivamente un segmento específico de DNA, hasta obtener una cantidad suficiente

Más detalles

Tipos de Muestras. Técnicas de Biología Molecular. Extracción de ácidos nucleicos. Extracción de DNA genómico. Muestra de sangre en papel filtro

Tipos de Muestras. Técnicas de Biología Molecular. Extracción de ácidos nucleicos. Extracción de DNA genómico. Muestra de sangre en papel filtro Técnicas de Biología Molecular Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO 2004 Tipos de Muestras Extracción de ácidos nucleicos o DNA o RNA Sangre total (EDTA) Saliva Líquido Amniótico Bulbo

Más detalles

Guía de PCR en tiempo real

Guía de PCR en tiempo real Guía de PCR en tiempo real Michelle C. Chirinos-Arias Índice Introducción. 2 Algunos conceptos. 2 PCR (reacción en cadena de la polimerasa)... 2 PCR en tiempo real (qpcr)..

Más detalles

TaqMan GMO Maize Quantification Kit. Part No: 4481972

TaqMan GMO Maize Quantification Kit. Part No: 4481972 TaqMan GMO Maize Quantification Kit Part No: 4481972 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan

Más detalles


MEMORIA DE PRÁCTICAS SILVIA PÉREZ SOLANA MEMORIA DE PRÁCTICAS SILVIA PÉREZ SOLANA DATOS DE LA EMPRESA Instituto de Biotecnología y Biomedicina de Cantabria (CSIC-UC- SODERCAN), Avda. Herrera Oria s/n. Santander. El tutor CSIC fue Raúl Fernández

Más detalles



Más detalles