Leche. Martin Gotteland, PhD. Dpto. de Nutrición Fac. de Medicina. Congreso Chileno de Osteología y Metabolismo Mineral

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamaño: px
Comenzar la demostración a partir de la página:

Download "Leche. Martin Gotteland, PhD. Dpto. de Nutrición Fac. de Medicina. mgottela@med.uchile.cl. Congreso Chileno de Osteología y Metabolismo Mineral"

Transcripción

1 Leche Martin Gotteland, PhD. Dpto. de Nutrición Fac. de Medicina Congreso Chileno de Osteología y Metabolismo Mineral 10 Abril 2015

2 Composición nutricional de la leche de varios mamíferos Por 100ml Oveja Cabra Vaca Humana Energía (Kcal) Proteína (g) 5,4 3,1 3,2 1,1 Grasa (g) 6,0 3,5 3,9 5,0 HdC (lactosa) (g) 5,1 4,4 4,8 7 (+0,5 OS) Calcio (mg)

3 1 porción de leche (200ml) aporta el 24% del ADR de calcio para un adulto

4 Muchos otros alimentos contienen calcio Sin embargo, hay que considerar : 1- la eventual presencia, en estos alimentos, de factores que pueden afectar la absorción de calcio y su biodisponibilidad Compuestos dietarios que disminuyen la absorción intestinal de calcio Fitatos Celulosa Ácido urónico Algínato de sodio Oxalato Ácidos grasos saturados Alcohol 2- La real relevancia de estos alimentos en la dieta

5 En el contexto de los hábitos alimentarios actuales, cumplir los aportes diarios recomendados de calcio es difícilmente compatible con el consumo de fuentes de calcio que no sean productos lácteos.

6 El principal factor que limita el consumo de leche (y eventualmente de productos lácteos) es la intolerancia a la lactosa

7 Digestión y absorción intestinal de la lactosa Lactasa florizina hidrolasa (LPH) Lactosa LPH

8 Glucosidos (florizina, Glicosil-ceramidas) Phlorizin hydrolase domain Lactase domain Galatosidos (Lactosa) LPH

9 Lactasa en el periodo post-natal La actividad lactasa es alta durante la infancia, cuando la leche es el principal alimento; luego, en la mayoría de los seres humanos, declina con la edad hasta llegar a niveles equivalentes al 10% de lo observado en el recién nacido Hipolactasia primaria del adulto. Es genéticamente determinado y ocurre a pesar del consumo continuo de lactosa (es decir que en el humano, la enzima no es inducible por su substrato)

10 Prevalencia de la Hipolactasia primaria del adulto en el mundo

11 Sujetos de todas las poblaciones/razas/etnias pueden ser hipolactásicos, pero la prevalencia es mayor en los asiáticos, africanos, latino-americanos, particularmente en las poblaciones indígenas. La edad de aparición es variable (1-2 años en la población Thai hasta años en los finlandés). No hay diferencias por sexo

12 Correlación baja entre intolerancia a la lactosa e hipolactasia: 11 a 32% de los sujetos hipolactasicos no reportan síntomas digestivos después del consumo de alimentos con lactosa 57% de los sujetos que auto-reportan síntomas después del consumo de alimentos con lactosa son negativos para el HBT.

13 Prevalencia Intolerancia a la lactosa en E.U.

14 A que se debe la persistencia de la lactasa en ciertas poblaciones humanas? La persistencia de la lactasa ha surgido en forma independiente en distintas partes del mundo, a partir de mutaciones puntuales (SNPs) en secuencias cis-reguladoras adyacentes al gen de la lactasa. Factores de Transcripción Secuencias Cis-reguladoras Gen de la Lactasa agataatgtagtccctggcctca agataatgtagcccctggcctca Africanos (G C) (-14,000) Europeos (C T) (-13,900)

15 Hipótesis del calcio Ventajas selectivas de los sujetos LP en la evolución Los sujetos LP tienen mayor aportes de calcio en zonas de norte de Europa con baja exposición solar gran parte del año y mayor riesgo de deficiencia en vitamina D y de raquitismo Hipótesis de la deshidratación La glucosa y galactosa liberado en el intestino por la LPH estimulan SGLT-1 y la reabsorción intestinal de agua, disminuyendo el riesgo de deshidratación en zonas tropicales. Hipótesis cultural-historica Correlación con focos de desarrollo de cultura lechera en el periodo neolítico. Aquellos sujetos LP aprovechan mejor las ventajas nutricionales de la leche (proteínas) Ventaja selectiva frente a aquellos sujetos LNP. La % de sujetos LP en la población. La mas aceptada actualmente

16 Actualmente, existen a lo menos 5 mutaciones (SNP) descritas en distintas regiones del mundo (Europa del Norte, África occidental, Medio Oriente, India, China): C>G G>A T>G G>C T>G En poblaciones amerindias de Brasil y Colombia, la frecuencia de LP es cercana a 0 mientras que en las poblaciones mestizas de estos países, varia entre 43 y 20%

17 (Morales et al. BMJ Open 2011)) (Morales et al BMJ Open 2011) Silvestre Lactasa-persistente Silvestre Lactasa-persistente

18 Por qué el sujeto hipolactásico puede presentar síntomas digestivos cuando consume lactosa? Dolor abdominal Distensión abdominal Borborigmos Gases Diarrea En el sujeto hipolactasico, la lactosa puede ser considerado como una fibra dietética. Contribuye a la acidificación del medio colonico, aumentando la solubilidad de Calcio y su absorción

19 La sintomatología es variable según los sujetos Depende de : - Cantidades de lactosa en la dieta - Velocidad de vaciamiento gástrico - Velocidad de transito

20 Adaptación colónica en sujetos hipolactasicos Sujetos hipolactasicos 2 periodos randomizados de 10 días de consumo de dextrosa o de lactosa (0,6 a 1g/kg/d en forma creciente) H2BT al final de cada periodo + muestra de deposición Al final del periodo con lactosa: - ß-galactodidasa fecal (Hertzler and Savaiano AJCN 1996)

21 Se observa una adaptación colonica a la mayor llegada de lactosa no-digerida, la cual se traduce por la disminución de la sintomatología digestiva adaptación dela MI a la producción de H2 de manera a reducirla

22 El consumo regular de lactosa modifica la MI: adaptación colonica Sujetos HL y LP 25g lactosa dos veces al dia por 2 semanas (Szilaghyi et al, Can J Gastro 2010)

23 Malabsorción de lactosa en alteraciones funcionales del TD -La importancia de la intolerancia a la lactosa en los síntomas de IBS ha sido -sobreestimado, la exclusión de la lactosa de la dieta rara vez mejora la sintomatología en forma importante Estudio sobre más de 1000 pacientes con IBS la prevalencia de hipolactasia era la misma que en la población control La prevalencia de IBS no es mayor en los países con alta prevalencia de hipolactasia que en aquellos con baja prevalencia

24 Estrategias que permiten a los individuos intolerantes a la lactosa de incorporar exitosamente productos lácteos a su dieta. 1. Consumir pequeñas cantidades de productos con lactosa. 2. El consumo crónico/repetido de alimentos con lactosa permite la adaptación de la microbiota colónica y un metabolismo más eficiente de la lactosa. 3. Consumir los alimentos con lactosa con una comida más completa 4. Considerar la forma del alimento que contiene la lactosa; los quesos, chocolate, leche entera y helados son mejor tolerados. 5. Consumir yogures con fermentos vivos. 6. Consumir leche sin lactosa

25 El consumo de yogurt mejora la tolerancia a la lactosa en sujetos intolerantes H2 (ppm) Lactosa en agua Lactosa en leche Lactosa en yogurt con bacterias vivas Tiempo (h) Excreción de H 2 en aire espirado de sujetos hipolactásicos después de la ingestión de lactosa en agua o de la misma cantidad de lactosa en forma de leche o de yogurt con bacterias lácticas vivas.

26 El efecto se observa solo cuando las bacterias del yogurt son vivas H2 (ppm) Yogurt termizado Yogurt con bacterias vivas Tiempo (h) Excreción de H 2 en aire espirado de sujetos hipolactásicos después de la ingestión de yogurt con bacterias lácticas vivas ( ) o de yogurt termizado ((con bacterias muertas).

27 Flujo ileal de actividad lactasa después de la ingestión de 450 g de yogurt o de yogurt termizado (18g lactosa) en 8 sujetos hipolactasicos. -Transito oro-cecal del yogurt fresco y termizado > al de la leche (165±17; 206 ±19 y 103±19 min, p< 0.01). -Menos lactosa es recogida en el ileon terminal después de la ingestión de yoghurt que de yogurt termizado (1.74±0.26g vs ±0.46g, p<0.05) - 20% de la actividad lactasa del yogurt logra el ileo terminal. - Mas del 90% de la lactosa del yoghurt esta digerida en el intestino del sujeto hipolactasico

28 Conclusión La leche y los productos lácteos representan la principal fuente de calcio de la dieta La hipolactasia es la condición normal mientras que la persistencia representa la variante No existen evidencias claras de la relación entre hipolactasia y desordenes funcionales del TD Los individuos hipolactasicos pueden generalmente soportar alrededor de 250 ml de leche sin molestias En estos sujetos, la lactosa puede ser considerada como una fibra Existen numerosos productos lácteos disponibles con bajos contenidos en lactosa Una actividad lactasa exógena puede ser agregada al alimento con lactosa para aumentar su digestibilidad

29 Muchas gracias

La lactosa es el principal azúcar de la leche y únicamente

La lactosa es el principal azúcar de la leche y únicamente C a p í t u l o 1 6 Intolerancia a la lactosa Mercedes Ruiz Moreno La lactosa es el principal azúcar de la leche y únicamente se produce, de forma natural, en la glándula mamaria. Es un disacárido que,

Más detalles

Azúcares de la dieta

Azúcares de la dieta Azúcares de la dieta Ingresan como poli, mono o disacáridos (el principal polisacárido de la dieta humana es el almidón) Enzimas salivares y pancreáticos y de la leche materna (amilasas) HIDRÓLISIS Disacáridos

Más detalles

GUÍA DE PRÁCTICA CLÍNICA GPC Diagnóstico y Tratamiento de la INTOLERANCIA A LA LACTOSA en Niños Guía de Referencia Rápida Catálogo Maestro de Guías de Práctica Clínica: IMSS-733-14 Índice 1. Clasificación...

Más detalles

1. INTOLERANCIA A LA LACTOSA.

1. INTOLERANCIA A LA LACTOSA. La lactosa es un disacárido formado por la unión de una glucosa y una galactosa. Concretamente intervienen una ß-galactopiranosa y una ß-glucopiranosa unidas por los carbonos 1 y 4 respectivamente. Al

Más detalles

TECNICATURA OPERADOR DE ALIMENTOS ALIMENTACION EN COLECTIVIDADES SANAS Y ENFERMAS

TECNICATURA OPERADOR DE ALIMENTOS ALIMENTACION EN COLECTIVIDADES SANAS Y ENFERMAS TECNICATURA OPERADOR DE ALIMENTOS ALIMENTACION EN COLECTIVIDADES SANAS Y ENFERMAS PATOLOGIAS INTESTINALES Enfermedad diverticular Intolerancia a la lactosa Enfermedad celíaca Diarrea Constipación Cuidados

Más detalles

Higiénico-Dietéticas para Ulcerosa

Higiénico-Dietéticas para Ulcerosa Recomendaciones Higiénico-Dietéticas para los Pacientes con Colitis Ulcerosa 13 Dra. Laura Sempere Robles Unidad de Gastroenterología. Hospital General Universitario de Alicante Qué son las medidas higiénico-dietéticas?

Más detalles

Recomendaciones para pacientes con Enfermedad Inflamatoria Intestinal

Recomendaciones para pacientes con Enfermedad Inflamatoria Intestinal Recomendaciones para pacientes con Enfermedad Inflamatoria Intestinal Información conjunta GETECCU / ACCU nº 1 año 2002 Nutrición, dieta y EII E. Cabré Gelada Recomendaciones para pacientes con Enfermedad

Más detalles

Manual de Nutrición y Dietética. La fibra dietética o alimentaria es un componente importante de la dieta y debe consumirse en cantidades adecuadas.

Manual de Nutrición y Dietética. La fibra dietética o alimentaria es un componente importante de la dieta y debe consumirse en cantidades adecuadas. 8. Fibra dietética La fibra dietética o alimentaria es un componente importante de la dieta y debe consumirse en cantidades adecuadas. Bajo la denominación de fibra dietética se incluyen un amplio grupo

Más detalles

LÁCTEOS Y DERIVADOS CHARLAS PARA LA COMUNIDAD

LÁCTEOS Y DERIVADOS CHARLAS PARA LA COMUNIDAD CHARLAS PARA LA COMUNIDAD LÁCTEOS Y DERIVADOS Después del periodo natural de lactancia materna, el hombre incorpora progresivamente variedad de alimentos con los que conforma una alimentación completa

Más detalles

Es en verdad la leche una buena fuente de calcio y otros nutrimentos?

Es en verdad la leche una buena fuente de calcio y otros nutrimentos? Por: Mtra. Mariana Alvarez Aceves. Sección: Nutrición Tags: Alimentos Cáncer Enfermedades Desde tiempo atrás se ha dado a la leche un gran valor dentro de la dieta saludable. Incluso se le ha llegado a

Más detalles

FACTORES ALIMENTICIOS DETERMINANTES PARA PADECER INTOLERANCIA A LA LACTOSA EN UNA PERSONA.

FACTORES ALIMENTICIOS DETERMINANTES PARA PADECER INTOLERANCIA A LA LACTOSA EN UNA PERSONA. FACTORES ALIMENTICIOS DETERMINANTES PARA PADECER INTOLERANCIA A LA LACTOSA EN UNA PERSONA. Luis Matías Morales García Edgar Mendivil Borbón Ramón Manuel Ochoa Domínguez Armando Enrique Valle Nieblas José

Más detalles

GUÍA MARKET DIETAS. DIETA Y NUTRICIÓN EN LA ENFERMEDAD DE CROHN

GUÍA MARKET DIETAS. DIETA Y NUTRICIÓN EN LA ENFERMEDAD DE CROHN GUÍA MARKET DIETAS. DIETA Y NUTRICIÓN EN LA ENFERMEDAD DE CROHN Dieta y nutrición. Es posible que se esté preguntando si ciertas comidas contribuyeron o causaron la enfermedad de Crohn. La respuesta es

Más detalles

eleva hasta un 30% (4). En cuando a América Latina, se estima que el porcentaje de personas con intolerancia a la lactosa ya excede el 50%.

eleva hasta un 30% (4). En cuando a América Latina, se estima que el porcentaje de personas con intolerancia a la lactosa ya excede el 50%. [ Ingredientes] Productos deslactosados: más sabor y salud con menos azúcar El uso de lactasa líquida natural estandarizada Ha-Lactase de Chr. Hansen favorece la reducción del agregado de azúcar en productos

Más detalles

FIBRA DIETETICA Y SALUD Gloria Jury Jamis. Directora NUT, Centro de Psiconutrición. San Pascual 736 - Las Condes. Fono: 208-73 51 / 207-48 06. http://www.psiconutricion.cl La deficiencia de fibra dietética

Más detalles

Ciencia que te cuida de la celulitis

Ciencia que te cuida de la celulitis CELULITIS Ciencia que te cuida de la celulitis La celulitis es un problema originado por la deficiente digestión de grasas, originando así la acumulación de la misma. La mala digestión produce también

Más detalles

Mitos y Realidades de la leche

Mitos y Realidades de la leche Mitos y Realidades de la leche 1 er Congreso Nacional Producción, Calidad, Transformación, Comercialización y Nutrición de Leche y Derivados Junio 2013 Mito: La leche deslactosada contiene azúcar, por

Más detalles

Intolerancia a la lactosa y otros disacáridos

Intolerancia a la lactosa y otros disacáridos Gastr Latinoam 2007; Vol 18, Nº 2: 152-156 XXVIII CURSO DE AVANCES EN GASTROENTEROLOGÍA Intolerancia a la lactosa y otros disacáridos Francisco Alliende G. (1) LACTOSE AND OTHER DISACCHARIDES INTOLERANCE

Más detalles

Enfermería de la Infancia y la Adolescencia

Enfermería de la Infancia y la Adolescencia María Jesús Agudo Tirado María Paz Zulueta Departamento de Enfermería Este tema se publica bajo Licencia: Crea9ve Commons BY- NC- SA 3.0 Malabsorción de los hidratos de carbono de la leche C.P.: paro respiratorio

Más detalles

Beneficios de los lácteos. en las diferentes etapas de la vida

Beneficios de los lácteos. en las diferentes etapas de la vida Beneficios de los lácteos en las diferentes etapas de la vida La Campaña panamericana de consumo de lácteos Sí a la leche! busca fomentar el consumo de lácteos y contribuir a revertir la realidad de la

Más detalles

QUÉ SON LOS PROBIÓTICOS? PARA QUÉ SIRVEN?

QUÉ SON LOS PROBIÓTICOS? PARA QUÉ SIRVEN? QUÉ SON LOS PROBIÓTICOS? PARA QUÉ SIRVEN? Los alimentos aportan energía, nutrientes, agua y otros compuestos fundamentales para la vida. Los alimentos que en forma natural o procesada, contienen componentes

Más detalles

EL CUERPO HUMANO (Anatomía, fisiología, higiene y salud para maestros)

EL CUERPO HUMANO (Anatomía, fisiología, higiene y salud para maestros) Departamento de Biología Ambiental y Salud Pública EL CUERPO HUMANO (Anatomía, fisiología, higiene y salud para maestros) Los sistemas de nutrición (2): comiendo, transformando y absorbiendo... Alimentos

Más detalles

ALERGIA A LAS PROTEÍNAS DE LECHE DE VACA

ALERGIA A LAS PROTEÍNAS DE LECHE DE VACA ALERGIA A LAS PROTEÍNAS DE LECHE DE VACA Distinguir: Reacciones tóxicas. Reacciones inmunológicas: IgE mediadas (clínica atópica) IgE no mediadas Reacciones no inmunológicas o intolerancia. Alergia a Proteínas

Más detalles

Todo lo bueno de la leche, con 0% lactosa y el refuerzo de calcio necesario

Todo lo bueno de la leche, con 0% lactosa y el refuerzo de calcio necesario Todo lo bueno de la leche, con 0% lactosa y el refuerzo de calcio necesario Asegura el consumo de calcio a través de una leche digestiva y apta para cualquier grado de intolerancia a la lactosa Intolerancia

Más detalles

www.centraldesalud.es - www.lecheconfibra.es

www.centraldesalud.es - www.lecheconfibra.es Mejora la función intestinal de tus pacientes www.centraldesalud.es - www.lecheconfibra.es Fibra de Central Lechera Asturiana lo ha demostrado clínicamente* Su fórmula exclusiva con Regulaplus a base de

Más detalles

Revista Pediatría Electrónica. Intolerancia a la lactosa Dra. Licarallén Quevedo C 1, Dras Marianela Rojas 2 y Marcela Soto 3

Revista Pediatría Electrónica. Intolerancia a la lactosa Dra. Licarallén Quevedo C 1, Dras Marianela Rojas 2 y Marcela Soto 3 REVISION Universidad de Chile Intolerancia a la lactosa Dra. Licarallén Quevedo C 1, Dras Marianela Rojas 2 y Marcela Soto 3 1 Becaria (APS) 2º año Programa de Pediatría. Departamento de Pediatría. Campus

Más detalles

Gas Intestinal Definición

Gas Intestinal Definición Gas Intestinal Definición Las flatulencias, los eructos y el paso del gas es algo natural. Sin embargo, muchas personas piensan que tienen mucho gas cuando realmente tienen cantidades normales. La mayoría

Más detalles

ORGANIZACIÓN MUNDIAL DE GASTROENTEROLOGÍA SOCIEDAD VENEZOLANA DE GASTROENTEROLOGÍA UNIVERSIDAD DEL ZULIA FACULTAD DE MEDICINA

ORGANIZACIÓN MUNDIAL DE GASTROENTEROLOGÍA SOCIEDAD VENEZOLANA DE GASTROENTEROLOGÍA UNIVERSIDAD DEL ZULIA FACULTAD DE MEDICINA ORGANIZACIÓN MUNDIAL DE GASTROENTEROLOGÍA SOCIEDAD VENEZOLANA DE GASTROENTEROLOGÍA UNIVERSIDAD DEL ZULIA FACULTAD DE MEDICINA CAMPAÑA MUNDIAL DE LA SALUD DIGESTIVA PRIMER FORO: SÍNDROME DE INTESTINO IRRITABLE

Más detalles

EL LABORATORIO PROFECO REPORTA

EL LABORATORIO PROFECO REPORTA EL LABORATORIO PROFECO REPORTA La intolerancia a la lactosa y otros padecimientos gastrointestinales ya no son motivo para renunciar a los beneficios que aporta un vaso de leche. Contrario a lo que muchos

Más detalles

Alimentos funcionales

Alimentos funcionales 1. Qué son? 2. Su origen... 3. Qué hace funcional a un alimento? 4. Los hay naturales y modificados 5. Son indispensables? 6. Atención a las etiquetas 7. Situación actual: Marco legal Qué son? Huevos Omega-3,

Más detalles

Diferencias y similitudes entre intolerancias y alergias alimentarias

Diferencias y similitudes entre intolerancias y alergias alimentarias Diferencias y similitudes entre intolerancias y alergias alimentarias Apellidos, nombre Fernández Segovia, Isabel (isferse1@tal.upv.es Fuentes López, Ana (anfuelo@upv.es) Departamento Centro García Martínez,

Más detalles

Definición. Clasificación. Epidemiología. desarrollo":" lactosa'!" Esta frecuencia varía según la raza, debido a

Definición. Clasificación. Epidemiología. desarrollo: lactosa'! Esta frecuencia varía según la raza, debido a Intolerancia aspectos claves a la lactosa: Definición La intolerancia a la lactosa es un síndrome causado por deficiencia de la enzima lactasa y caracterizado por la aparición de uno o más de los siguientes

Más detalles

Una mirada interactiva al. del tracto gastrointestinal (GI) Bienvenido a esta guía interactiva

Una mirada interactiva al. del tracto gastrointestinal (GI) Bienvenido a esta guía interactiva Una mirada interactiva al tracto gastrointestinal (GI) Bienvenido a esta guía interactiva del tracto gastrointestinal (GI) Haga clic sobre el nombre del órgano para obtener información sobre las zonas

Más detalles

Las fibras: distintos tipos, distintos beneficios

Las fibras: distintos tipos, distintos beneficios 20.nutrición Las fibras: distintos tipos, distintos beneficios Gemma Baciero Comunicación Científica Royal Canin Ibérica, S.A. Las fibras, uno de los ingredientes fundamentales en cualquier alimento, pertenecen

Más detalles

ALERGIAS ALIMENTARIAS E INTOLERANCIA A LOS ALIMENTOS

ALERGIAS ALIMENTARIAS E INTOLERANCIA A LOS ALIMENTOS Toxicología alimentaria Diplomatura de Nutrición humana y dietética Curso 2010-2011 E INTOLERANCIA A LOS ALIMENTOS Dr. Jesús Miguel Hernández-Guijo Dpto. Farmacología y Terapéutica Facultad de Medicina

Más detalles

ACTUACIÓN DE ENFERMERÍA EN LOS TEST DE ALIENTO PARA DIAGNÓSTICO DE INTOLERANCIA A HIDROCARBONADOS

ACTUACIÓN DE ENFERMERÍA EN LOS TEST DE ALIENTO PARA DIAGNÓSTICO DE INTOLERANCIA A HIDROCARBONADOS ACTUACIÓN DE ENFERMERÍA EN LOS TEST DE ALIENTO PARA DIAGNÓSTICO DE INTOLERANCIA A HIDROCARBONADOS Ana Chaves Helena Diplomada Universitaria de Enfermería Medicina: Ángeles Pérez Aisa Especialista en Aparato

Más detalles

LECHE Y PRODUCTOS LÁCTEOS. María Jesús Periago Castón Catedrática de Nutrición y Bromatología

LECHE Y PRODUCTOS LÁCTEOS. María Jesús Periago Castón Catedrática de Nutrición y Bromatología LECHE Y PRODUCTOS LÁCTEOS María Jesús Periago Castón Catedrática de Nutrición y Bromatología Desde el campo.. A la mesa DEFINICIÓN, DENOMINACIÓN Y CLASIFICACIÓN Se entiende por leche natural el producto

Más detalles

Alimentos funcionales Investigación de mercado

Alimentos funcionales Investigación de mercado Investigación de mercado J. Ignacio Fernández Andrés Pintaluba S. A. Que la comida sea tu alimento y el alimento tu medicina Hipócrates (460 377 a.c.) 1 Hechos constatados Creciente costo sanitario en

Más detalles

DERIVADOS LÁCTEOS. Idoia Campos Laura Civera Sandra Córdoba Esperanza Del Amo Aida Díaz Alba Díaz Sara Ferri

DERIVADOS LÁCTEOS. Idoia Campos Laura Civera Sandra Córdoba Esperanza Del Amo Aida Díaz Alba Díaz Sara Ferri DERIVADOS LÁCTEOS Idoia Campos Laura Civera Sandra Córdoba Esperanza Del Amo Aida Díaz Alba Díaz Sara Ferri Derivados lácteos CARACTERÍSTICAS Presentan una amplia gama de nutrientes, por lo que pueden

Más detalles

Son productos que, manteniendo las características organolépticas de los tradicionales y consumidos dentro de una dieta variada y equilibrada, además

Son productos que, manteniendo las características organolépticas de los tradicionales y consumidos dentro de una dieta variada y equilibrada, además ALIMENTOS Son productos que, manteniendo las características organolépticas de los tradicionales y consumidos dentro de una dieta variada y equilibrada, además de satisfacer las necesidades nutricionales

Más detalles

REQUERIMIENTOS NUTRICIONALES Y PLAN DE ALIMENTACIÓN PARA LECHONES

REQUERIMIENTOS NUTRICIONALES Y PLAN DE ALIMENTACIÓN PARA LECHONES REQUERIMIENTOS NUTRICIONALES Y PLAN DE ALIMENTACIÓN PARA LECHONES Volver a: Producción porcina INTRODUCCIÓN Sebastián Danura*. 2010. Universoporcino.com *Técnico de Vetifarma. www.produccion-animal.com.ar

Más detalles

Qué propiedades tiene el sorbitol?

Qué propiedades tiene el sorbitol? El sorbitol es un azúcar alcohol que se encuentra de forma natural en las algas rojas y en las hojas y frutos de las plantas de la familia rosaceae como son las peras, manzanas, ciruelas, membrillos, melocotones

Más detalles

Especialista en Nutrición Deportiva

Especialista en Nutrición Deportiva Para más información: distancia@iusc.es www.iusc.es c/ Ronda San Pedro 70 08010 Barcelona fax: 93 310 61 03 tel. 93 310 60 22 Especialista en Nutrición Deportiva Programa co-organizado por IUSC y la Fundación

Más detalles

Alimentación sana y crecimiento en niños y adolescentes. Guía para padres

Alimentación sana y crecimiento en niños y adolescentes. Guía para padres Alimentación sana y crecimiento en niños y adolescentes Guía para padres Consulte nuestra página web: www.sintesis.com En ella encontrará el catálogo completo y comentado Alimentación sana y crecimiento

Más detalles

Test de aliento de hidrógeno espirado (TAHE)

Test de aliento de hidrógeno espirado (TAHE) Test de aliento de hidrógeno espirado (TAHE) Qué es el test del aliento del hidrógeno espirado? Es un test para valorar la intolerancia a azúcares. Mide muestras de aire espirado buscando un exceso de

Más detalles

El calcio y la vitamina D: importantes a toda edad

El calcio y la vitamina D: importantes a toda edad El calcio y la vitamina D: importantes a toda edad Institutos Nacionales de la Salud Centro Nacional de Información sobre la Osteoporosis y las Enfermedades Óseas 2 AMS Circle Bethesda, MD 20892-3676 Teléfono:

Más detalles

Guía básica de la alimentación para las personas sanas

Guía básica de la alimentación para las personas sanas Guía básica de la alimentación para las personas sanas Introducción En las últimas décadas se ha experimentado un espectacular avance en las ciencias de la alimentación y nutrición. Cada vez más la población

Más detalles

LECHE Y PRODUCTOS LÁCTEOS. María Jesús Periago Castón Catedrática de Nutrición y Bromatología

LECHE Y PRODUCTOS LÁCTEOS. María Jesús Periago Castón Catedrática de Nutrición y Bromatología LECHE Y PRODUCTOS LÁCTEOS María Jesús Periago Castón Catedrática de Nutrición y Bromatología Desde el campo.. A la mesa DEFINICIÓN, DENOMINACIÓN Y CLASIFICACIÓN Se entiende por leche natural el producto

Más detalles

Ficha Técnica. Categoría. Contenido del Pack. Sinopsis. Dietética y Nutrición. - 1 CDROM - 1 Manual Teórico - 1 Cuaderno de Ejercicios

Ficha Técnica. Categoría. Contenido del Pack. Sinopsis. Dietética y Nutrición. - 1 CDROM - 1 Manual Teórico - 1 Cuaderno de Ejercicios Ficha Técnica Categoría Dietética y Nutrición Contenido del Pack - 1 CDROM - 1 Manual Teórico - 1 Cuaderno de Ejercicios Sinopsis La nutrición infantil es una cuestión de especial relevancia, ya que tendrá

Más detalles

MITOS SOBRE EL CONSUMO DE LECHE DE VACA. Dra. JESSIE NIKLITSCHEK PEDIATRA

MITOS SOBRE EL CONSUMO DE LECHE DE VACA. Dra. JESSIE NIKLITSCHEK PEDIATRA MITOS SOBRE EL CONSUMO DE LECHE DE VACA Dra. JESSIE NIKLITSCHEK PEDIATRA LOS CHILENOS NO CONSUMIMOS LECHE Consumo de Leche. Chile FAO/OMS recomienda 182 lt/percápita INE. Producción pecuaria 2007-2012

Más detalles

Ficha Técnica. Categoría. Contenido del Pack. Sinopsis. Dietética y Nutrición. - 2 Manual Teórico - 1 Cuaderno de Ejercicios - 1 CDROM

Ficha Técnica. Categoría. Contenido del Pack. Sinopsis. Dietética y Nutrición. - 2 Manual Teórico - 1 Cuaderno de Ejercicios - 1 CDROM Ficha Técnica Categoría Dietética y Nutrición Contenido del Pack - 2 Manual Teórico - 1 Cuaderno de Ejercicios - 1 CDROM Sinopsis Materiales didácticos dirigidos a profesionales y encaminados a la adquisición

Más detalles

DIABETES MELLITUS. Dra. Luz Don Centro de Nutrición

DIABETES MELLITUS. Dra. Luz Don Centro de Nutrición DIABETES MELLITUS Dra. Luz Don Centro de Nutrición DEFINICIÓN ENFERMEDAD CRÓNICA METABÓLICA PRESENCIA DE HIPERGLUCEMIA DEFECTO EN LA SECRECIÓN DE INSULINA O EN LA ACCÍON DE LA INSULINA O DE AMBAS DIAGNÓSTICO

Más detalles

Alimentación de 2 a 18 años

Alimentación de 2 a 18 años Actividad Informar sobre la pirámide de alimentación (anexo 1). Comentar la importancia de establecer hábitos dietéticos adecuados a cada etapa del niño o adolescente. Ofrecer consejo nutricional (anexos

Más detalles

Qué son los alimentos?

Qué son los alimentos? Qué son los alimentos? Los alimentos son productos naturales o transformados que contienen numerosas sustancias químicas. Unas sustancias desempeñan un papel conocido en la nutrición humana. Son los nutrientes:

Más detalles

MANUAL DE. nutrición deportiva. Manuel Arasa Gil EDITORIAL PAIDOTRIBO

MANUAL DE. nutrición deportiva. Manuel Arasa Gil EDITORIAL PAIDOTRIBO MANUAL DE nutrición deportiva Manuel Arasa Gil EDITORIAL PAIDOTRIBO 1. INTRODUCCIÓN GENERAL EXPLICATIVA DEL MANUAL...7 ÍNDICE 2. ALIMENTOS Y NUTRIENTES...9 2.1. Concepto de alimento...9 2.1.1. Tipos de

Más detalles

"LÁCTEOS Y SALUD" PRESENTACIÓN NÚMERO 0 BOLETÍN "LÁCTEOS Y SALUD" CUALIDADES NUTRICIONALES DE LA LECHE [p 2-3] EL CALCIO Y LA LECHE [p 4-5]

LÁCTEOS Y SALUD PRESENTACIÓN NÚMERO 0 BOLETÍN LÁCTEOS Y SALUD CUALIDADES NUTRICIONALES DE LA LECHE [p 2-3] EL CALCIO Y LA LECHE [p 4-5] "LÁCTEOS Y SALUD" Nº0 Federación Nacional de Industrias Lácteas c/ Ayala, 10-1º Izda. 28001 Madrid Telf.: +34 91 576 21 00 - Fax: +34 91 576 21 17 info@fenil.org - www.fenil.org PRESENTACIÓN NÚMERO 0 BOLETÍN

Más detalles

Pruebas diagnósticas y Manejo de la Intolerancia a la Lactosa, Sobrecrecimiento Bacteriano e Insuficiencia Pancreática Exocrina

Pruebas diagnósticas y Manejo de la Intolerancia a la Lactosa, Sobrecrecimiento Bacteriano e Insuficiencia Pancreática Exocrina Pruebas diagnósticas y Manejo de la Intolerancia a la Lactosa, Sobrecrecimiento Bacteriano e Insuficiencia Pancreática Exocrina Dra. Eva Marín Serrano Médico Adjunto del Servicio de Aparato Digestivo del

Más detalles

ALERGIAS ALIMENTARIAS. Microbiología Aplicada Pamela I. Brenes

ALERGIAS ALIMENTARIAS. Microbiología Aplicada Pamela I. Brenes ALERGIAS ALIMENTARIAS Microbiología Aplicada Pamela I. Brenes Qué son las alergias? Es una respuesta inmunitaria exagerada, cuando el sistema inmune reacciona frente a una sustancia concreta (alérgeno)

Más detalles

El cáncer es la segunda causa más frecuente de mortalidad en los países desarrollados y subdesarrollados cuando no se realiza una prevención a

El cáncer es la segunda causa más frecuente de mortalidad en los países desarrollados y subdesarrollados cuando no se realiza una prevención a El cáncer es la segunda causa más frecuente de mortalidad en los países desarrollados y subdesarrollados cuando no se realiza una prevención a tiempo. Además el paciente enfrenta los múltiples dolores

Más detalles

Lacti Deli con Omega 3 DHA

Lacti Deli con Omega 3 DHA Lacti Deli con mega 3 DHA Dirección Nacional de Nutrición y Salud Escolar Para Cerebro, huesos, dientes y cuerpos sanos Niños bien nutridos rinden mejor Qué es Lacti Deli? Lacti Deli es el nombre de la

Más detalles

EResumen. Metabolismo Colónico de la Fibra. Panorama

EResumen. Metabolismo Colónico de la Fibra. Panorama Panorama Metabolismo Colónico de la Fibra P. García Peris, I. Bretón Lesmes, C. de la Cuerda Compes y M. Camblor Álvarez grasos de cadena corta, con funciones importantes a nivel del colon, y a nivel sistémico.

Más detalles

La Importancia de los Servicios Agrarios en el Valor de la Marca

La Importancia de los Servicios Agrarios en el Valor de la Marca La Importancia de los Servicios Agrarios en el Valor de la Marca Mitos y Falsedades Sobre el Consumo de Leche y Productos Lácteos Sergio Calsamiglia Dpt. Ciencia Animal i dels Aliments Universitat Autonoma

Más detalles

Nutrición. Cómo mantener una vida saludable? Lípidos:

Nutrición. Cómo mantener una vida saludable? Lípidos: Nutrición La salud física y mental depende de muchos factores, uno de ellos es nuestra forma de alimentarnos. Los alimentos nos dan la energía y los nutrientes que necesitamos para una vida saludable.

Más detalles

TEMA 17: ALIMENTACIÓN EN EDADES AVANZADAS EFECTOS FISIOLÓGICOS DEL ENVEJECIMIENTO PROBLEMAS NUTRICIONALES EN EL ANCIANO

TEMA 17: ALIMENTACIÓN EN EDADES AVANZADAS EFECTOS FISIOLÓGICOS DEL ENVEJECIMIENTO PROBLEMAS NUTRICIONALES EN EL ANCIANO TEMA 17: ALIMENTACIÓN EN EDADES AVANZADAS EFECTOS FISIOLÓGICOS DEL ENVEJECIMIENTO PROBLEMAS NUTRICIONALES EN EL ANCIANO NECESIDADES NUTRITIVAS Y CUIDADOS ALIMENTARIOS EN LA EDAD AVANZADA 1. EFECTOS FISIOLÓGICOS

Más detalles

ETIQUETADO NUTRICIONAL DE PRODUCTOS ALIMENTICIOS PRE-ENVASADOS PARA CONSUMO HUMANO PARA POBLACIÓN A PARTIR DE 3 AÑOS

ETIQUETADO NUTRICIONAL DE PRODUCTOS ALIMENTICIOS PRE-ENVASADOS PARA CONSUMO HUMANO PARA POBLACIÓN A PARTIR DE 3 AÑOS ETIQUETADO NUTRICIONAL DE PRODUCTOS ALIMENTICIOS PRE-ENVASADOS PARA CONSUMO HUMANO PARA POBLACIÓN A PARTIR DE 3 AÑOS N 37295-COMEX-MEIC-S Dr. Wesley Esquivel Miranda Nutricionista DEFINICIÓN Etiquetado

Más detalles

TALLER: LECHES INFANTILES

TALLER: LECHES INFANTILES I EXPOCongreso Nutrición desde la Farmacia TALLER: LECHES INFANTILES CASOS CLÍNICOS Dra. MONTSERRAT RIVERO Directora General Científica Grupo Ordesa Ex-Vocal Nacional del Consejo General de Colegios de

Más detalles

LA LECHE DE VACA EN LA ALIMENTACIÓN INFANTIL

LA LECHE DE VACA EN LA ALIMENTACIÓN INFANTIL LA LECHE DE VACA EN LA ALIMENTACIÓN INFANTIL PRESENTACIÓN ACADEMICA: ALVAREZ MIREYA ESQUIVEL NORMA ANGELICA PEREZ LIZA MARÍA VAZQUEZ ITZEL GRUPO HEMISEMESTRE 1-08 3002 OCTUBRE NOVIEMBRE 007 La leche bovina

Más detalles

Asociación Argentina de Neuroentrenamiento www.neuroentrenamiento.com.ar

Asociación Argentina de Neuroentrenamiento www.neuroentrenamiento.com.ar 1 2 NUTRIENTES II Minerales A diferencia de las vitaminas, que tienen una función exclusivamente reguladora del metabolismo, los minerales pueden tener tanto una función reguladora (forman parte de hormonas

Más detalles

CEREALES Y LEGUMBRES

CEREALES Y LEGUMBRES CHARLAS PARA LA COMUNIDAD CEREALES Y LEGUMBRES La base de una alimentación sana En los últimos años, la ciencia de la nutrición puso mayor énfasis en el estudio de la alimentación orientada a preservar

Más detalles

Mario Carballo de la Espriella, gerente y director de la Academia Internacional de la Salud.

Mario Carballo de la Espriella, gerente y director de la Academia Internacional de la Salud. Por una vida óptima Su contacto con otras culturas, especialmente de Europa y Asia, alimentaron los deseos de Mario Carballo de la Espriella de entender mejor sus propios problemas de salud y los del ser

Más detalles

LIGNOCELULOSA EUBIÓTICA

LIGNOCELULOSA EUBIÓTICA EUBIÓTICA UNA NUEVA HERRAMIENTA PARA LOS NUTRICIONISTAS DE PORCINO Y AVICULTURA PROCESOS DIGESTIVOS Y MECANISMO DE ACCIÓN Para asegurar el óptimo contenido de fibra en cada etapa de la alimentación porcina

Más detalles

Intolerancia a la Lactosa Lactose Intolerance

Intolerancia a la Lactosa Lactose Intolerance REVISIÓN BIBLIOGRÁFICA Intolerancia a la Lactosa Lactose Intolerance Dr. Gustavo Adolfo Zúniga* RESUMEN. La intolerancia a la lactosa es un trastorno común en la práctica clínica diaria; su valoración

Más detalles

EL SIGNIFICADO PRACTICO DE LA INTOLERANCIA A LA LACTOSA EN LOS NIÑOS

EL SIGNIFICADO PRACTICO DE LA INTOLERANCIA A LA LACTOSA EN LOS NIÑOS CRONICA 351 * incluso, por lo menos, durante el segundo año de vida, debería hacerse hincapié en la reeducación de los padres y el lactante de modo que adquieran el hábito de evitar comer con exceso. El

Más detalles

Lactomax Super Lactasa de Alto Rendimiento para Leche Con Bajo o Cero Contenido de Lactosa

Lactomax Super Lactasa de Alto Rendimiento para Leche Con Bajo o Cero Contenido de Lactosa Lactomax Super Lactasa de Alto Rendimiento para Leche Con Bajo o Cero Contenido de Lactosa DESCRIPCIÓN Lactomax Super consiste en la enzima lactasa, que se obtiene mediante la fermentación de una cepa

Más detalles

Cómo dar una respuesta nutricional específica a los trastornos gastrointestinales

Cómo dar una respuesta nutricional específica a los trastornos gastrointestinales 16.nutrición Cómo dar una respuesta nutricional específica a los trastornos gastrointestinales Los problemas digestivos pueden tener distinta procedencia y cursar de formas diversas, por lo que es importante

Más detalles

La nutrición en el programa de fitness. Miguel Ángel Buil Bellver

La nutrición en el programa de fitness. Miguel Ángel Buil Bellver La nutrición en el programa de fitness Miguel Ángel Buil Bellver CAPÍTULO II HIDRATOS DE CARBONO CAPIITULO IIII HIIDRATOS DE CARBONO COMPOSICIÓN Y CLASIFICACIÓN Compuestos formados por carbono, hidrógeno

Más detalles

T-4.- DIETA SALUDABLE Y ACTIVIDAD FISICA

T-4.- DIETA SALUDABLE Y ACTIVIDAD FISICA T-4.- DIETA SALUDABLE Y ACTIVIDAD FISICA La actividad física (AF) es importante a largo plazo para regular el peso corporal. Numerosos expertos consideran que incluso más que la dieta. La AF aumenta el

Más detalles

Es una enfermedad que aparece en la infancia y va progresando en la edad adulta si no se diagnostica a tiempo.

Es una enfermedad que aparece en la infancia y va progresando en la edad adulta si no se diagnostica a tiempo. 1 Qué es la intolerancia a la lactosa? La intolerancia a la lactosa consiste en la imposibilidad de digerir la lactosa debido a una deficiencia de la enzima lactasa. Como consecuencia, la mucosa intestinal

Más detalles

Nutrición y dietética. Tema 2. Alimentos funcionales

Nutrición y dietética. Tema 2. Alimentos funcionales Tema 2. : definiciones 3 ª generación de alimentos saludables. 1ª alimentos enriquecidos. 2ª alimentos light. 3ª alimentos funcionales. Alimento que demuestra mejorar una o más funciones beneficiosas en

Más detalles

1 Introducción 1.1 Introducción

1 Introducción 1.1 Introducción 1 Introducción 1.1 Introducción 2 OBJETIVOS NUTRICIONALES EN ATENCIÓN PRIMARIA 2.1 La importancia de la nutrición en atención primaria 2.2 Prevalencia de las enfermedades crónicas en atención primaria

Más detalles

Patologías digestivas y su tratamiento nutricional en el gato

Patologías digestivas y su tratamiento nutricional en el gato 20.nutrición Patologías digestivas y su tratamiento nutricional en el gato Gemma Baciero Comunicación Científica Royal Canin Ibérica, S.A. La nutrición es clave en el tratamiento de las patologías digestivas.

Más detalles

TU COMIDA Escúchala. Aprende a leer las etiquetas de los alimentos

TU COMIDA Escúchala. Aprende a leer las etiquetas de los alimentos EL LABORATORIO PROFECO REPORTA Aprende a leer las etiquetas de los alimentos TU COMIDA Escúchala Llevar una dieta balanceada, con los elementos calóricos y nutricionales adecuados puede ser tan sencillo

Más detalles

Nutrición y Enfermedad Inflamatoria del Intestino

Nutrición y Enfermedad Inflamatoria del Intestino Prof. Sonia I. Serrano Serrano MPH, RD, LND Programa de Internado en Dietética Departamento de Programas Graduados Escuela de Profesiones de la Salud Recinto de Ciencias Médicas Crohn Es una forma de enfermedad

Más detalles

Nutrición y Diabetes Qué hay de nuevo? Información para profesionales

Nutrición y Diabetes Qué hay de nuevo? Información para profesionales Nutrición y Diabetes Qué hay de nuevo? Información para profesionales Qué es la diabetes? La diabetes es un desorden del metabolismo, en el que el páncreas, no produce insulina ó bien, las células no son

Más detalles

RECOMENDACIONES HIGIÉNICO-

RECOMENDACIONES HIGIÉNICO- RECOMENDACIONES HIGIÉNICO- DIETÉTICAS PARA LOS PACIENTES CON ENFERMEDAD DE CROHN Laura Sempere Robles 12 Unidad de Gastroenterología. Hospital General Universitario de Alicante Qué son las medidas higiénico-dietéticas?

Más detalles

Qué son los nutrientes?

Qué son los nutrientes? Qué son los nutrientes? Se llaman nutrientes a aquellas sustancias que se encuentran en los alimentos y que nuestro organismo aprovecha para cubrir sus necesidades vitales. En el proceso de la digestión,

Más detalles

LA ALIMENTACION EN EL FEEDLOT LA PERFORMANCE PRODUCTIVA está determinada por:

LA ALIMENTACION EN EL FEEDLOT LA PERFORMANCE PRODUCTIVA está determinada por: LA ALIMENTACION EN EL FEEDLOT LA PERFORMANCE PRODUCTIVA está determinada por: 1) Ganancia Individual del animal 2) Eficiencia de Conversión del alimento Para 1) = Altos consumos de Energía = Granos. La

Más detalles

Pruebas de aliento basadas en hidrógeno. Germán Campuzano Maya 1

Pruebas de aliento basadas en hidrógeno. Germán Campuzano Maya 1 Tecnología Pruebas de aliento basadas en hidrógeno Germán Campuzano Maya 1 Resumen: las pruebas de aliento proporcionan una valiosa estrategia para evaluar in vivo una amplia variedad de actividades enzimáticas,

Más detalles

Prevenir, mejor que curar. La dieta en la diabetes tipo 2. Factores de riesgo coronario

Prevenir, mejor que curar. La dieta en la diabetes tipo 2. Factores de riesgo coronario Página nº 1 L a dieta constituye uno de los principales retos en el tratamiento de la diabetes por su elevado índice de fracasos relacionados con su complejidad y bajo cumplimiento. Desde el punto de vista

Más detalles

NO DEBE COMER DEMASIADO CALIENTE NI DEMASIADO FRIO

NO DEBE COMER DEMASIADO CALIENTE NI DEMASIADO FRIO CUÁL ES LA DIFERENCIA ENTRE DIETA Y REGIMEN? REGIMEN: MANTENER UNA ALIMENTACIÓN QUE SEA CORRECTA, CON TODAS LAS EXIGENCIAS PARA LA SALUD Y QUE AYUDE AL HOMBRE A CONSERVARSE SANO Y EN PLENITUD DE FUNCIONES.

Más detalles

Un suplemento para cada etapa de la vida.

Un suplemento para cada etapa de la vida. La línea más completa en nutrición. Un suplemento para cada etapa de la vida. CN PLUS y 1000 g SABORES: Vainilla y Sin sabor Suplemento nutricional completo y balanceado utilizado desde niños de 4 años

Más detalles

Unidad 1.- LA DIGESTIÓN

Unidad 1.- LA DIGESTIÓN Unidad 1.- LA DIGESTIÓN LA NUTRICIÓN Las personas necesitamos energía para desarrollar nuestras actividades y materiales de construcción para crecer o reparar nuestro cuerpo. La función de nutrición comprende

Más detalles

Yogurt Maker. Probiotics

Yogurt Maker. Probiotics Yogurt Maker & Probiotics ESSENS Yogurt Maker ESSENS calostro probióticos Costos mínimos, fácil preparación de yogur, fácil mantenimiento del fabricante de yogur. ESSENS Yogurt Maker se caracteriza por

Más detalles

Alérgenos y reacciones alérgicas

Alérgenos y reacciones alérgicas UNIDAD DIDÁCTICA 6 Alérgenos y reacciones alérgicas Se producen reacciones anormales del organismo en aquellas personas sensibles a determinadas sustancias. Según los causantes de la reacción, existen

Más detalles

Aprendamos de CÁNCER DE COLON Y RECTO. N o 19

Aprendamos de CÁNCER DE COLON Y RECTO. N o 19 Aprendamos de N o 19 5ª Edición / Ficha Coleccionable de Clínica Alemana / Abril 2010 CÁNCER DE COLON Y RECTO El cáncer de colon y recto es la tercera causa de muerte en Chile entre los cánceres del aparato

Más detalles

Recomendaciones para pacientes con Enfermedad Inflamatoria Intestinal

Recomendaciones para pacientes con Enfermedad Inflamatoria Intestinal Recomendaciones para pacientes con Enfermedad Inflamatoria Intestinal Información conjunta GETECCU / ACCU nº 11 año 2005 Dieta alta o baja en fibra en la Enfermedad Inflamatoria Intestinal? E. Cabré Gelada

Más detalles

comprensión de las ALERGIAS E INTOLERANCIAS A LOS ALIMENTOS Guía para pacientes de su médico y

comprensión de las ALERGIAS E INTOLERANCIAS A LOS ALIMENTOS Guía para pacientes de su médico y comprensión de las ALERGIAS E INTOLERANCIAS A LOS ALIMENTOS Guía para pacientes de su médico y Conceptos básicos Muchas personas creen tener alergias a alimentos, pero podría tratarse de intolerancia a

Más detalles

Calidad Nutricional del Consumo Infantil

Calidad Nutricional del Consumo Infantil Calidad Nutricional del Consumo Infantil Sergio Britos Nuria Chichizola Programa de Agronegocios y Alimentos (UBA) Facultad de Bromatología, Univ. Nac. E. Ríos (UNER) XV Congreso Latinoamericano y del

Más detalles

Nutrición en la infancia. Mª Teresa Carbajosa Herrero

Nutrición en la infancia. Mª Teresa Carbajosa Herrero Nutrición en la infancia Mª Teresa Carbajosa Herrero Períodos de la alimentación infantil Período de lactancia : 4-6 primeros meses. Alimento exclusivo leche materna o fórmulas inicio. Período transicional:

Más detalles

Información. Nutricional. de Productos Central Lechera Asturiana

Información. Nutricional. de Productos Central Lechera Asturiana Información Nutricional de Productos Central Lechera Asturiana Información Nutricional de Productos Central Lechera Asturiana La Industria alimentaria juega un papel esencial en la elección de alimentos

Más detalles

CAPÍTULO 8. NUTRICIÓN

CAPÍTULO 8. NUTRICIÓN CAPÍTULO 8. NUTRICIÓN Suministro de energía La energía se mide en Mega Julios (MJ) o Mega Calorías (Mcal). En el sistema SI se debe usar el julio aunque las calorías también son comunes. Los siguientes

Más detalles