INTRODUCIÓN. Los datos de la distribución geográfica quedarían distribuidos según el siguiente esquema

Tamaño: px
Comenzar la demostración a partir de la página:

Download "INTRODUCIÓN. Los datos de la distribución geográfica quedarían distribuidos según el siguiente esquema"


1 INTRODUCIÓN Hagamos un repaso de los datos recogidos en la bibliografía. Infección por VHC: Infección crónica por VHC afecta al 3% de la población mundial Incidencia de infección aguda: 1/ habitantes 50-90% Infección aguda asintomática La prevalencia de anticuerpos frente al virus de la hepatitis C (VHC) en España oscila entre el 1,6 y el 2,6% ( y personas infectadas por el VHC) 1. EASL (European Association for the Study of the Liver) Clinical Practical Guidelines: Management of hepatitis C virus infection. J Hepatol. 2011, 55: Hepatitis C en España. Bruguera, Miguel; Forns, Xavier. Med Clin (Barc). 2006; 127: vol.127 núm 03 Los datos de la distribución geográfica quedarían distribuidos según el siguiente esquema Las recomendaciones de las Guías Clínicas para Diagnóstico de hepatitis aguda y crónica por VHC son la realización de Marcadores virológicos para la detección de anticuerpos y Ag del VHC y pruebas de detección de ácidos nucleicos (NAT) 1

2 Realicemos un breve recordatorio del Virus de la Hepatitis C y las recomendaciones de las guías clínicas sobre el diagnóstico de la infección por VHC. Estructura genética del HVC The Journal of Clinical Investigation Volume 119 Number 1 January 2009 Figure 1.The HCV ORF. The approximately 9,600-nt positive-polarity HCV RNA genome encodes a long ORF. The ORF is translated into an approximately 3,010 amino acid polyprotein that is cleaved to 10 mature proteins. The known or predicted functions of the proteins are indicated 2

3 DIAGNÓSTICO VHC PRUEBAS DIAGNÓSTICAS DISPONIBLES Anti VHC Anti VHC: pruebas confirmatorias Anti-VHC: avidez de IgG ARN-VHC HCcAg (Antígeno del core del VHC) Diagnóstico de la Infección por VHC: Las Recomendaciones de las Guías Clínicas Europeas para Diagnóstico de hepatitis aguda y crónica por VHC son la realización de: Marcadores virológicos: Ac VHC (EIA) RNA VHC (PCR real time) *EASL (European Association for the Study of the Liver) Clinical Practical Guidelines: Management of hepatitis C virus infection. J Hepatol. 2011, 55:

4 A continuación recogemos los protocolos de la SEIMC de diagnóstico de infección por VHC. DIAGNÓSTICO VHC AGUDA Procedimientos en Microbiología Clínica 2a. SEROLOGÍA DE LAS HEPATITIS VÍRICAS Anti- VHC ARN VHC o HCcAg Avidez IgG anti-vhc*** Hepatitis aguda por -/+ -/+ ALTA VHC NEGATIVA - + VHC (1) + + BAJA VHC POSITIVA 1 - resultado en la muestra inicial. 4

5 CON ANTI-VHC (+) Procedimientos en Microbiología Clínica 2a. SEROLOGÍA DE LAS HEPATITIS VÍRICAS Confirmación de Anti- VHC ARN VHC o HCcAg INTERPRETACIÓN Positiva o Indeterminada + HEPATITIS C CRÓNICA - - HEPATITIS NANBNC Indeterminada - Seguimiento (1) (1): Si las pruebas de detección de viremia persisten negativas patitis No-A No-B No-C (NANBNC) OBJETIVO 5

6 Las Guías Americanas proponen: Algoritmo diagnóstico de la infección por VHC propuesto por la CDC La confirmación de la infectividad o no del paciente siempre pasa por la realización de técnicas de RNA del VHC En nuestro caso: DIAGNÓSTICO DE HEPATITIS AGUDA VHC Tras la realización de: Anti VHC HCcAg (Antígeno del core del VHC) Anti VHC: pruebas confirmatorias Riba ARN-VHC 6

7 OBJETIVO En el presente estudio nos proponemos como objetivo: Evaluar la determinación del como marcador directo de infección en pacientes con 3 ensayo, que supone alrededor del 20% del total de muestras reactivas analizadas para cribado de AcVHC. La selección del punto de corte del estudio se hizo en base a las recomendaciones de los ensayos de las distintas marcas comerciales. Signal-to-Cut Off Ratios for Commercially Available Assays Screening Test Kit Name Ortho HCV Version 3.0 ELISA Test System Abbott HCV EIA 2.0 VITROS Anti- HCV AxSYM Anti- HCV Manufacturer Ortho Abbott Ortho Abbott Assay Format EIA (Enzyme Immunoassay) EIA (Enzyme Immunoassay) CIA (Chemiluminescennt Immunoassay) MEIA (Microparticle Immunoassay) Signal-to-cut off ratio predictive of a true positive 95% of the time

8 MATERIAL Y METODO Para la realización del estudio se efectuaron las determinaciones antigénicas mediante: ARCHITECT HCV Ag Definición de la técnica: core del VHC -VHC monoclonal para la detección del antígeno ARCHITECT HCV Ag Presenta: Buena correlación con técnicas de amplificación de ácidos nucléicos (r=0,75-0,9) Alta sensibilidad ~ 5000 UI/ml Especificidad cercana al 100% Buena precisión - Reproducibilidad: coeficiente de variación (intra e inter ensayo) entre 3,6 9,5 % Similar comportamiento entre los distintos genotipos Igual detección de seroconversiones que las técnicas de amplificación genómica (detección de replicadores) Resultados paralelos con carga viral en el seguimiento de pacientes bajo tratamiento (limitación con cargas virales menores de 5000 UI/ml) Alta estabilidad del antígeno en muestras expuestas a diferentes temperaturas / Bajo volumen de muestra / rapidez de procesamiento Técnica coste efectiva para el laboratorio Test Otros métodos disponibles para la detección de : (1) Ortho trak-c assay [2, 24, 32, 34,75] (no longer available) (2) Ortho-clínica diagnostics [47, 48,66] (no longer available) (3) ARCHITECT HCV Core Antigen Assay [1] (4) Monolisa HCV Ag/Ab ULTRA (Bio-Rad Laboratories Inc., Hércules, California) [40,50] (5) Murax HCV-Ag/Ab combination assay [53] 8

9 METODOLOGÍA Cuantificación del en 47 muestras de suero, remitidas para cribado de / O 3. Método de ensayo Ag cvhc: inmunoensayo quimioluminiscente en el autoanalizador ARCHITECTi2000 (Abbott Diagnostic). A todas estas muestras se realizo: Prueba de confirmación (BB (Chiron RIBA HCV 3.0 Strip Immunoblot Assay) Carga viral de VHC (COBAS Taqman (Roche Diagnostic). Test : Características: Ag cvhc evaluado para reducir el coste diagnóstico infección en pacientes de riesgo elevado En pacientes Ac VHc positivos junto con el RNA VHC Ag cvhc podría ser una alternativa útil en el seguimiento de pacientes en tratamiento, especialmente los que tras la PCR inicial permanecen con cargas virales >104 IU/ml. En pacientes con viremia inicial baja también puede ser una buena opción para el seguimiento Ag cvhc confirmación diagnóstica de infección por VHC en Inmunodeprimidos: VIH, hemodializados, receptores de trasplante renal, neoplasias Ag cvhc marcador más estable que el RNA VHC Los autores recomiendan la realización de estudios en pacientes susceptibles de trasplantes de órgano sólido 9

10 RESULTADOS 47 / O 3 obtuvieron los siguientes resultados: Resultado del Negativo (<0.04 pg/ml) en 42 Indeterminado (0,06-0,13 pg/ml) en 3 Positivo (>0,13 pg/ml): 2 Resultado del BB: negativo en 21 indeterminado en 23 y positivo en 3 Resultado de la CV VHC < 15 UI/ml en UI/ml en 5 Recuent o AgVH C CV INDETERMINADO VHC Total NEGATIVO CV VHC Total POSITIVO CV VHC Total TABLA DE CONTINGENCIA: CV VHC * BB VHC * AgVHC >15 <15 >15 BB I VHC N P Total Carga viral positiva: Carga viral negativa: CV VHC >15 CV VHC < 15 10

11 DISCUSIÓN Revisamos las recomendaciones de la bibliografía consultada y que a continuación se reseña. M. C. Medici et al. J Clin Microbiol S1 (2011)

12 SM Hosseini-Moghaddam et al. Rev. Med. Virol. 2012; 22:

13 Abbott ARCHITECT HCV Ag (fmol/l) Correlación con Roche Amplicor HCV RNA Monitor y = x r = n = 735 N=735 r: , Roche Amplicor HCV Monitor (KIU/mL) Yokosuka, O., et al. 25 (2005): OBJETIVO Evaluar un inmunoensayo de quimioluminiscencia (CMIA) para la detección de HCVAg aplicable al cribado de urgencia de donantes/receptores de órganos/tejidos, comparándolo con la CV de VHC. Grupo CV VHC Nº casos HCVAg+ (fmol/l) HCVAg- (fmol/l) Nº Rango Nº Rango A >10 4 UI/mL (96%) 13,95 - > * 2,89 B <10 4 UI/mL 31 NEG (Hepatitis C tratada) ND y Anti-VHC <5 (LIA: 5 -, 1 IND, 1 +) 11 (35,5%) 4, ,89 20** 0-2, ,32 *VIH-1 y HTLV-2 positivos (CV 6,25X10E4, genotipo 4c/4d). ** CV: 15 y 7830 UI/mL (media = 1016, ,03). CONCLUSIONES La técnica CMIA tiene buena correlación con PCR. La técnica CMIA por su sensibilidad, especificidad, automatización y rapidez puede ser aplicable al cribado rápido de los pacientes relacionados con los programas de trasplante, simultáneamente al de otros parámetros obligatorios, reduciendo el número de falsos negativos anti-vhc en periodo de ventana. No obstante, debe tenerse en cuenta la existencia de falsos negativos a HCVAg en muestras con CV muy baja. 13

14 En las publicaciones reseñadas anteriormente se recogen las siguientes conclusiones: VENTAJAS Servicio Microbiología. CHGUV 1. La determinación de Ag VHC se podría considerar como un marcador serológico directo, fácil de realizar, de tiempo de respuesta corto y económico, para evaluar la actividad replicativa del VHC. 2. A la vista de los resultados, el Ag VHC permitiría clasificar a los pacientes con niveles de Ac VHC con valores 3 cutoff y Ag VHC negativo como no infectivos. 3. Analizado el alto nivel de correlación entre la carga viral de VHC y Ag VHC se podría proponer el seguimiento de los pacientes. Ag HCV: Puntos fuertes Autoanalizador (Architect ). Totalmente automatizado. Más rápido que la detección de RNA. Menor cantidad de muestra. Mas estable que el RNA. No es sensible a inhibidores Más coste efectivo Aplicable a situaciones de urgencia. 14

15 HCV Ag: Puntos débiles Es menos sensible que la PCR Detección de infecciones crónicas de bajo nivel Determinación de la respuesta terapéutica completa PCR en una técnica bien aceptada Buenas plataformas de realización Ag HCV no está en las guías de VHC Poca difusión entre los clínicos. Revisadas todas estas publicaciones y en base a nuestros resultados realizamos las siguientes propuestas: Propuestas de empleo de Desarrollar un modelo de cálculo de costes para la aplicación de rutina del Ag core VHC Introducción del para determinar el estado de infectividad de los pacientes anti-vhc positivos: una muestra Ag core reactiva evidencia infección activa por VHC Las muestras negativas se puede determinar PCR VHC (límite de detección Ag VHC 5000 copias/ml) Empleo del Ag VHC en el cribado de pacientes: riesgo de infección aguda, inmunodeprimidos 15

16 Utilidad clínica Ag VHC Utilidad clínica del antígeno core del VHC I. Cribado en pacientes de alto riesgo (por ej. Hemodializados) HCV Core Antigen disminuye el periodo ventana Miedouge M. et al J Clin Virol 48 (2010): Utilidad clínica del antígeno core del VHC II. En pacientes seropositivos, diferenciar los replicadores de los que no lo son y para confirmar una infección por VHC activa. Permite diferenciar infección activa de infección pasada Anti-HCV & HCV- RNA / HCV Core Antigen Anti-HCV (+) HCV-RNA (+) or HCV Core Ag (+) Portadores de HCV (Casos con infección persistente) Infección pasada (casos curados) Falsos reactivos Dr. S.Iino, Kiyokawa Hospital, & Dr. H.Yoshizawa, Hiroshima University, Japan Mederacke I. et al. J Clin Virol 46 (2009):

17 Utilidad clínica del antígeno core del VHC III. Confirmación de resultados de anti-vhc Kesli R al. J Clin Microbiol doi.: /jcm (Pub on line Sep 2011) Utilidad clínica del antígeno core del VHC IV. Ayuda en el seguimiento de la terapia para predecir una respuesta temprana al tratamiento y para aumentar el cumplimiento del tratamiento 17

18 CONCLUSIONES 1. La determinación de se podría considerar como un marcador serológico directo, fácil de realizar, de tiempo de respuesta corto y económico, para evaluar la actividad replicativa del VHC. 2. A la vista de los resultados, el permitiría clasificar a los pacientes con niveles de c V con valores 3 cutoff y Ag VHC negativo como no infectivos. 3. Posible Algoritmo Anti VHC Positivo Negativo Ag VHC Ag VHC Positivo Negativo Positivo Negativo Replicador RNA Positivo Negativo Merece la pena? RIBA Replicador En fase de seroconversión Curado Cuántos? No Infectado Seguro? 18



Más detalles

Algoritmos diagnósticos para VIH

Algoritmos diagnósticos para VIH Algoritmos diagnósticos para VIH ALGORITMOS DIAGNÓSTICOS PARA VIH Los avances tecnológicos de los distintos ensayos para el tamizaje y diagnóstico de la infección por VIH, conjuntamente con la necesidad

Más detalles

APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR. Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina

APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR. Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina BiologÍa Molecular: es una disciplina que se enfoca principalmente en el estudio

Más detalles

Virus Hepatitis B. Confirmación HBsAg

Virus Hepatitis B. Confirmación HBsAg Virus Hepatitis B Confirmación HBsAg Dr. Eliecer Villagra Cornejo Sección Virus Hepáticos y Emergentes Subdepartamento Enfermedades Virales Laboratorio Biomédico Nacional de Referencia. Virus Hepatitis

Más detalles

Diagnóstico microbiológico de la infección por HIV

Diagnóstico microbiológico de la infección por HIV Diagnóstico microbiológico de la infección por HIV Juan Carlos Rodríguez Díaz S. Microbiología Hospital General Universitario de Alicante E-mail: http://microbiologí

Más detalles



Más detalles

Como interpretar las pruebas de serología hepatica

Como interpretar las pruebas de serología hepatica Introducción Para descartar en un paciente la presencia de infección viral se deben determinar exclusivamente el antígeno de superficie del virus de la hepatitis B (VHB) (HbsAg) y los anticuerpos frente

Más detalles

NOCIONES DE EPIDEMIOLOGÍA Y DIAGNOSTICO DE HIV. Dra G Carballal Laboratorio de Virología Clínica CEMIC, 2009

NOCIONES DE EPIDEMIOLOGÍA Y DIAGNOSTICO DE HIV. Dra G Carballal Laboratorio de Virología Clínica CEMIC, 2009 NOCIONES DE EPIDEMIOLOGÍA Y DIAGNOSTICO DE HIV Dra G Carballal Laboratorio de Virología Clínica CEMIC, 2009 La Pandemia de SIDA Personas que viven con el HIV/SIDA Total 40 millones Adultos 38 Niños 2 Nuevas

Más detalles

Nuevo algoritmo diagnóstico de la Infección por VIH

Nuevo algoritmo diagnóstico de la Infección por VIH Nuevo algoritmo diagnóstico de la Infección por VIH Dra. Manuelita Zavala Pineda Médico Adscrito Servicio Infectología Hospital General de México Dr. Eduardo Liceaga Marcadores inmunológicos y virológicos

Más detalles



Más detalles

PRUEBA RAPIDA EN EMBARAZADAS (n=62,214 2009-Junio 2010) NO REACTIVO n=218 REACTIVO INDETERMINADO. Tabla 9: Resultados Prueba rápida

PRUEBA RAPIDA EN EMBARAZADAS (n=62,214 2009-Junio 2010) NO REACTIVO n=218 REACTIVO INDETERMINADO. Tabla 9: Resultados Prueba rápida 11-RESULTADOS 11.1-Interpretación y análisis de resultados Un total de de 62,214 mujeres embarazadas se realizaron la prueba rápida de VIH durante años 2009 hasta junio 2010 (Tabla 9). De ellas, 61,808

Más detalles

Bioq. María Elina Acevedo Biología Molecular Fundación Hemocentro Buenos Aires

Bioq. María Elina Acevedo Biología Molecular Fundación Hemocentro Buenos Aires Bioq. María Elina Acevedo Biología Molecular Fundación Hemocentro Buenos Aires OBJETIVO DETECTAR Y DESCARTAR PRECOZMENTE UNIDADES DE SANGRE DE DONANTES CON VIREMIA PARA HIV, HBV Y HCV, CON PRUEBAS SEROLÓGICAS

Más detalles

Pruebas rápidas r. Estrategias preventivas. Propuesta de nuevas estrategias preventivas

Pruebas rápidas r. Estrategias preventivas. Propuesta de nuevas estrategias preventivas XV ENCUENTRO ESTATAL PARA ONG s Madrid, 1-3 de Octubre 2009 Diagnóstico tardío o. Pruebas rápidas r Dra Carmen Rodríguez Centro Sanitario Sandoval Madrid Estrategias preventivas La prevención de nuevas

Más detalles

Algoritmos y actualizaciones en el diagnóstico de las Hepatitis en el Laboratorio. Marta Morito Aguilar. Residente 2º año. Área de laboratorio.

Algoritmos y actualizaciones en el diagnóstico de las Hepatitis en el Laboratorio. Marta Morito Aguilar. Residente 2º año. Área de laboratorio. Algoritmos y actualizaciones en el diagnóstico de las Hepatitis en el Laboratorio Marta Morito Aguilar. Residente 2º año. Área de laboratorio. Introducción. - Es una enfermedad inflamatoria que afecta

Más detalles

PRUEBA DE VIH. Universidad de Panamá USAID Proyecto Capacity Centroamérica

PRUEBA DE VIH. Universidad de Panamá USAID Proyecto Capacity Centroamérica PRUEBA DE VIH Universidad de Panamá USAID Proyecto Capacity Centroamérica Es la prueba de detección que produce los resultados rápidamente, en aproximadamente 20 minutos y utiliza sangre de una vena o

Más detalles

11.2-DISCUSIÓN Prueba rápida

11.2-DISCUSIÓN Prueba rápida 11.2-DISCUSIÓN Prueba rápida Como se observa en la tabla 9 del total de las embarazadas (62,214) a las que se les realizo la prueba rápida un 99.3%(61,808) de ellas dio como resultado no reactivo, tan

Más detalles

Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio

Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio El VIRUS PRUEBAS PRESUNTIVAS ELISA: es la prueba convencional para la detección

Más detalles

Interpretación de resultados

Interpretación de resultados Interpretación de la serología en las hepatitis virales Domingo Sánchez Sendín y Pedro Nogales Aguado Centro de Salud Las Águilas. Área 7. Madrid. España.? Es útil la serología para diagnosticar las hepatitis

Más detalles


5-MARCO DE REFERENCIA 5-MARCO DE REFERENCIA Para hablar de pruebas diagnosticas es necesario el conocimiento de ciertos términos que a continuación se describen. Sensibilidad: Es la probabilidad de obtener una prueba positiva

Más detalles

HEPATITIS C. Dr. Alfredo Martínez CEMIC


Más detalles

Nuevos ensayos moleculares de la tecnología SUMA para el diagnóstico de las hepatitis B y C

Nuevos ensayos moleculares de la tecnología SUMA para el diagnóstico de las hepatitis B y C Nuevos ensayos moleculares de la tecnología SUMA para el diagnóstico de las hepatitis B y C MSc. Anny Armas Cayarga Laboratorio de Biología Molecular Centro de Inmunoensayo Octubre 16, 2015 Qué es el diagnóstico

Más detalles


INFECCIÓN AGUDA POR EL VIH. CASO 632 INFECCIÓN AGUDA POR EL VIH. CASO 632 Mujer de 22 años, española, sin antecedentes clínicos de interés ni alergias conocidas a medicamentos, que acude al Servicio de Urgencias con un cuadro de disuria intensa,

Más detalles



Más detalles

Procedimientos en Microbiología Clínica

Procedimientos en Microbiología Clínica Procedimientos en Microbiología Clínica Recomendaciones de la Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica Editores: Emilia Cercenado y Rafael Cantón Coordinador: Autores: Alberto

Más detalles

Nuevos enfoques diagnósticos de la infección por VIH

Nuevos enfoques diagnósticos de la infección por VIH Nuevos enfoques diagnósticos de la infección por VIH Santiago Estrada M.D Laboratorio Clínico VID Agosto 28 de 2015 Hoja informativa para los pacientes que solicitan una prueba de VIH Recomendaciones para

Más detalles


RESUMEN EJECUTIVO EN ESPAÑOL RESUMEN EJECUTIVO EN ESPAÑOL Guía de Práctica Clínica para la prevención, diagnóstico, evaluación y tratamiento de la Hepatitis C en enfermedad renal crónica Page 1 of 8 GUIA 1: DETECCIÓN Y EVALUACIÓN

Más detalles


DIAGNÓSTICO DE LABORATORIO DE DENGUE EN PANAMÁ DIAGNÓSTICO DE LABORATORIO DE DENGUE EN PANAMÁ TM Brechla Moreno A. Instituto Conmemorativo Gorgas de Estudios de la Salud, Panamá Departamento de Virología y Biotecnología 2013 TÉCNICAS PARA LA DETECCIÓN

Más detalles

TM CLAUDIO MIRANDA Sección SIDA. BQ. EUGENIO RAMIREZ Sección Virus Oncogénicos. TM LILIAN VERA D. Sección Virus Hepáticos y Emergentes

TM CLAUDIO MIRANDA Sección SIDA. BQ. EUGENIO RAMIREZ Sección Virus Oncogénicos. TM LILIAN VERA D. Sección Virus Hepáticos y Emergentes TALLER PARA EL ANALISIS DE RESULTADOS PEEC HBsAg, VHC, Ac- anti VIH y HTLV I/II TM CLAUDIO MIRANDA Sección SIDA BQ. EUGENIO RAMIREZ Sección Virus Oncogénicos TM LILIAN VERA D. Sección Virus Hepáticos y

Más detalles

Prevalencia de hepatitis C por reacción en cadena de polimerasa (PCR) en donantes del banco de sangre

Prevalencia de hepatitis C por reacción en cadena de polimerasa (PCR) en donantes del banco de sangre TRABAJOS ORIGINALES Prevalencia de hepatitis C por reacción en cadena de polimerasa (PCR) en donantes del banco de sangre Prevalence of hepatitis C by RT-PCR in donors of the blood bank Yezid Alfonso Farfán,

Más detalles

Dra. Natàlia Casamitjana


Más detalles

Pruebas serológicas para dengue

Pruebas serológicas para dengue Pruebas serológicas para dengue El 40% de la población mundial corre riesgo de infección por dengue Durante más de 25 años, Focus Diagnostics ha sido un líder en el desarrollo de ensayos inmunológicos

Más detalles

Guía de interpretación y reporte del anticuerpo a hepatitis C

Guía de interpretación y reporte del anticuerpo a hepatitis C ARTÍCULO ESPECIAL Guía de interpretación y reporte del anticuerpo a hepatitis C Ana M. Contreras, 1 Rodolfo J. Ochoa-Jiménez, 2 David Kershenobich, 3 Víctor Granados-García, 4 Carlos J. Conde-González,

Más detalles

Estudio de Costo Efectividad de NAT en México

Estudio de Costo Efectividad de NAT en México Estudio de Costo Efectividad de NAT en México Metodología y Resultados Eleanor Saunders, MSc Consultora Senior en Economía de la Salud TISalud, Mexico Objectivos Presentar la metodología y resultados del

Más detalles

Autores Bioq. María Belén Bouzas Jefa de División Análisis Clínicos. Hospital de Infecciosas Francisco Muñiz.

Autores Bioq. María Belén Bouzas Jefa de División Análisis Clínicos. Hospital de Infecciosas Francisco Muñiz. Autores Bioq. María Belén Bouzas Jefa de División Análisis Clínicos. Hospital de Infecciosas Francisco Muñiz. Bioq. Analia Cudola Jefa de Departamento Laboratorio Central. Ministerio de Salud Pública de

Más detalles

Propuesta de nuevos algoritmos para el diagnóstico de VIH

Propuesta de nuevos algoritmos para el diagnóstico de VIH Propuesta de nuevos algoritmos para el diagnóstico de VIH Propuesta de nuevos algoritmos para el diagnóstico de VIH Autores Bioq. María Belén Bouzas Jefa de División Análisis Clínicos. Hospital de Infecciosas

Más detalles

Herramientas de laboratorio aplicadas al diagnóstico y el monitoreo del tratamiento de la infección por VIH (Virus

Herramientas de laboratorio aplicadas al diagnóstico y el monitoreo del tratamiento de la infección por VIH (Virus Herramientas de laboratorio aplicadas al diagnóstico y el monitoreo del tratamiento de la infección por VIH (Virus Inmunodeficiencia Humana) Fabián Fay CIBIC. Rosario. Argentina Test de laboratorio para

Más detalles


HEPATITIS C, EPIDEMIA SILENTE PILDORAS EPIDEMIOLOGICAS Hepatitis C en el Mundo Se estima una prevalencia de 200 millones de portadores a nivel mundial con una mortalidad anual de 350 mil personas como consecuencia del efecto crónico

Más detalles



Más detalles

infección por el virus.

infección por el virus. Utilización de distintos reactivos y metodologías para el estudio de Anticuerpos anti HTLV- I/II en donantes de sangre José, A. (*); Orofino, M. T. (*); Murlo, P. (**); García, C. (**) (*) Bioquímica.

Más detalles

Manejo de la hepatitis crónica C en Atención Primaria

Manejo de la hepatitis crónica C en Atención Primaria Manejo de la hepatitis crónica C en Atención Primaria Virus C 9 genotipos diferentes 40 subgenotipos 170 millones personas infectadas 800.000 portadores en España Prevalencia hepatitis C crónica: 1,5-2%

Más detalles



Más detalles

Hepatitis aguda C en pacientes VIH. Montserrat Laguno Centeno Hospital Clínico. Barcelona 08/10/2015

Hepatitis aguda C en pacientes VIH. Montserrat Laguno Centeno Hospital Clínico. Barcelona 08/10/2015 Hepatitis aguda C en pacientes VIH Montserrat Laguno Centeno Hospital Clínico. Barcelona 08/10/2015 Situación actual de la Hepatitis Aguda C (HAC) en el paciente VIH Experiencia en HAC en el paciente VIH

Más detalles


Más detalles

Herramientas para el diagnóstico, seguimiento y tratamiento en Hepatitis B. Fabián Fay CIBIC Rosario Argentina

Herramientas para el diagnóstico, seguimiento y tratamiento en Hepatitis B. Fabián Fay CIBIC Rosario Argentina Herramientas para el diagnóstico, seguimiento y tratamiento en Hepatitis B Fabián Fay CIBIC Rosario Argentina HBV - Marcadores Serológicos HBsAg: Antígeno de Superficie Anti-HBc (total):

Más detalles

Diagnóstico del Dengue

Diagnóstico del Dengue Solución Total: Todo lo que usted necesita saber acerca del Diagnóstico del Dengue Prueba Rápida Dengue Duo ( + Ab Combo) Dengue IgG/IgM ELISA Dengue IgM capture ELISA Dengue IgG capture ELISA ELISA 2

Más detalles

Perinatal Transmisión al bebé, durante el embarazo, parto o lactancia.

Perinatal Transmisión al bebé, durante el embarazo, parto o lactancia. Dr. Horacio Salomón Investigador Principal del CONICET Director del INBIRS (Ex-CNRSIDA) UBA-CONICET Contacto sexual Relaciones sexuales sin protección por contacto directo con fluidos corporales como secreciones

Más detalles

Artículo de revisión: hepatitis viral B y su manejo

Artículo de revisión: hepatitis viral B y su manejo Rev. Med. FCM-UCSG, Año 2010, vol.16 Nº4. PáGS. 307-332 ISSN - 1390-0218 Artículo de revisión: hepatitis viral B y su manejo Review article: viral hepatitis B and its handling Jaramillo Tobón Antonio 1

Más detalles



Más detalles

Rol del Laboratorio en el Diagnóstico. CMV en pacientes transplantados. Bioquímica Mariela Merkt

Rol del Laboratorio en el Diagnóstico. CMV en pacientes transplantados. Bioquímica Mariela Merkt Rol del Laboratorio en el Diagnóstico y Prevención n de la Infección n por CMV en pacientes transplantados Bioquímica Mariela Merkt CMV: Características Familia β Herpesviridae DNA doble cadena Virus envuelto

Más detalles

Comparación de dos pruebas automatizadas por quimioluminiscencia para la detección de anticuerpos contra el virus de la hepatitis C

Comparación de dos pruebas automatizadas por quimioluminiscencia para la detección de anticuerpos contra el virus de la hepatitis C doi: 0./S0000040000 ARTÍCULO ORIGINAL ARTIGO ORIGINAL ORIGINAL ARTICLE Comparación de dos pruebas automatizadas por quimioluminiscencia para la detección de anticuerpos contra el virus de la hepatitis

Más detalles

Bioq. María Elina Acevedo Biología Molecular Fundación Hemocentro Buenos Aires Tamizaje de infecciones transmisibles por transfusión en Argentina (Ley 22.990 - Ley Nacional de Sangre ) HVB: Enzimoinmunoensayos

Más detalles


ACTUALIZACIÓN EN DENGUE Y CHIKUNGUNYA ACTUALIZACIÓN EN DENGUE Y CHIKUNGUNYA Diagnóstico de las infecciones por DENV y CHIKV María Gabriela Barbás Bioq. Esp.en Virología Jefa del Servicio Bioquímico Laboratorio Central de la Provincia de Córdoba

Más detalles

Introducción: Pacientes:


Más detalles

8 Congreso Argentino de Salud Integral del Adolescente. Dr. Eduardo Rubinstein. Hospital Francisco J. Muñiz Adolescencia

8 Congreso Argentino de Salud Integral del Adolescente. Dr. Eduardo Rubinstein. Hospital Francisco J. Muñiz Adolescencia 8 Congreso Argentino de Salud Integral del Adolescente Dr. Eduardo Rubinstein Hospital Francisco J. Muñiz Adolescencia VIH EN ADOLESCENTES: QUE HAY DE NUEVO? En diagnóstico de infección por VIH En seguimiento

Más detalles

Diagnóstico Serológico de Sífilis Técnicas treponémicas

Diagnóstico Serológico de Sífilis Técnicas treponémicas Diagnóstico Serológico de Sífilis Técnicas treponémicas T.M. Rodrigo Colina Morales Laboratorio de Infecciones de Transmisión Sexual Sección Bacteriología Mayo 2014 FTA-ABS (Fluorescent Treponemal Antibody

Más detalles



Más detalles



Más detalles

Vigilancia de laboratorio de Hepatitis C. Chile, 2008 2012.

Vigilancia de laboratorio de Hepatitis C. Chile, 2008 2012. 1 Vol. 3, No. 12, Noviembre 213. Vigilancia de laboratorio de Hepatitis C. Chile, 28 212. 1. Antecedentes El virus de la Hepatitis C (VHC) fue identificado y caracterizado en 1989 luego de diversas investigaciones

Más detalles

La estrategia del TEST AND TREAT en la HEPATITIS C: Realidad o ficción?

La estrategia del TEST AND TREAT en la HEPATITIS C: Realidad o ficción? La estrategia del TEST AND TREAT en la HEPATITIS C: Realidad o ficción? Quiénes somos Asociación de Pacientes nacida el año 2000 en la Estación de Sants de Barcelona. Unirse para compartir y aprender pero

Más detalles

Licda. Yarisel Rodríguez Mgtra. Dalis Mojica ICGES/LCRSP


Más detalles


ACADEMIA DE FARMACIA DE CASTILLA Y LEÓN Resumen de la conferencia pronunciada por la Dra. Dª. Cristina Arenas Departamento Médico. Laboratorios Gilead con el título Situación actual del tratamiento farmacológico " Salamanca, 1 de Junio de 2015

Más detalles



Más detalles

Unidad de Enfermedades Infecciosas. Servicio de Medicina Interna. Complejo Hospitalario Universitario de Santiago de Compostela

Unidad de Enfermedades Infecciosas. Servicio de Medicina Interna. Complejo Hospitalario Universitario de Santiago de Compostela PACIENTE CON SINDROME MENINGEO Y EXANTEMA Caso presentado por: E. Losada, A. Antela, A. Prieto. Unidad de Enfermedades Infecciosas. Servicio de Medicina Interna. Complejo Hospitalario Universitario de

Más detalles


PCR EN TIEMPO REAL, UNA HERRAMIENTA EN EL PACIENTE TRASPLANTADO PCR EN TIEMPO REAL, UNA HERRAMIENTA EN EL PACIENTE TRASPLANTADO Dra. Carolina Rodríguez Laboratorio Dr. Stamboulian División Biología Molecular Introducción En la actualidad, el paciente trasplantado,

Más detalles



Más detalles

Universidad de Cantabria. Hepatitis Víricas

Universidad de Cantabria. Hepatitis Víricas Universidad de Cantabria Hepatitis Víricas Guión ETIOLOGÍA: AGENTE CAUSAL Virus ADN bicatenario de la familia de los Hepadnaviridae. Porción central: CORE. Cubierta portadora de la especificidad an?génica:

Más detalles



Más detalles

Cualitativos Caso de Aplicación

Cualitativos Caso de Aplicación Validación n de Métodos M Cualitativos Caso de Aplicación Agenda Introducción Definiciones Clasificación Validación Evaluación de Métodos Cualitativos Caso de Aplicación Conclusiones Introducción La validación

Más detalles


PERFIL DE LOS NUEVOS CABA 2010-2011 PERFIL DE LOS NUEVOS DIAGNÓSTICOS CABA 2010-2011 Distribución de las notificaciones según sexo y estadio clínico al momento del diagnóstico CABA 2010-2011 Estadio % mujeres % hombres SRA 1,9 1,8 Asintomático

Más detalles

Chikungunya en Las Américas:

Chikungunya en Las Américas: Chikungunya en Las Américas: Diagnóstico y vigilancia por laboratorio Jairo A. Méndez-Rico PhD OPS-WDC 0 CHIKV Diagnóstico por laboratorio Introducción Microbial Threats to Health in the United States

Más detalles


PROTOCOLO: ENFERMEDAD DE CHAGAS Y GESTACIÓN 1 PROTOCOLO: ENFERMEDAD DE CHAGAS Y GESTACIÓN Unidad de Infecciones Perinatales, Servicio de Medicina Materno-Fetal. Institut Clínic de Ginecologia, Obstetrícia i Neonatologia, Hospital Clínic de Barcelona

Más detalles

Facultad de Medicina. Departamento de Medicina Interna


Más detalles


Hepatitis HEPATITIS A Hepatitis Es una enfermedad inflamatoria que afecta al hígado. La inflamación, se puede presentar en forma aguda o ser un proceso crónico, dependiendo de la etiología que le dio origen. Sus causas pueden

Más detalles

Investigador principal: Dr. Jordi Casabona Barbarà. Centro: Hospital Universitari Germans Trias i Pujol. Duración: 3 años MEMORIA FINAL. 1.


Más detalles

Problemas en el Diagnostico de la Infección VIH. Diplomado de Atención Integral del VIH-SIDA. 2007

Problemas en el Diagnostico de la Infección VIH. Diplomado de Atención Integral del VIH-SIDA. 2007 Problemas en el Diagnostico de la Infección VIH Diplomado de Atención Integral del VIH-SIDA. 2007 Algunas Generalidades Sub - tipos del VIH y pruebas de laboratorio Analogía del VIH 1 y 2 es de: 40-60%

Más detalles

INTERFERON. Efectos Inmunomoduladores Induce expresión de MHC clase I Activa macrófagos Células asesinas naturales Linfocitos T citotóxicos

INTERFERON. Efectos Inmunomoduladores Induce expresión de MHC clase I Activa macrófagos Células asesinas naturales Linfocitos T citotóxicos INTERFERON Efectos antivirales directos Reclutamiento de células inmunes Efectos Inmunomoduladores Induce expresión de MHC clase I Activa macrófagos Células asesinas naturales Linfocitos T citotóxicos

Más detalles

FORO CLÍNICO Anticuerpo a hepatitis C: verdadero o falso positivo? Nuevas estrategias de diagnóstico Ana María Contreras* * UMAE, Hospital de Especialidades CMNO. Delegación Jalisco del Instituto Mexicano

Más detalles


GUIA DE PRÁCTICA CLINICA HEPATITIS VIRAL C I. CIE 10: B15-B19 GUIA DE PRÁCTICA CLINICA HEPATITIS VIRAL C II. DEFINICIÓN: Es una inflamación del hígado debida a una infección crónica por el virus C. Tras el contacto con el virus, aparece una hepatitis

Más detalles



Más detalles

CONVENIO 036 de 2012

CONVENIO 036 de 2012 CONVENIO 036 de 2012 Guía de Práctica Clínica basada en la evidencia científica para la atención integral del VIH/Sida en niñas y niños. Guía de práctica clínica basada en la evidencia científica para

Más detalles

TOXOPLASMOSIS. Dr. Jaime Altcheh Servicio de Parasitología Hospital de Niños Ricardo Gutiérrez

TOXOPLASMOSIS. Dr. Jaime Altcheh Servicio de Parasitología Hospital de Niños Ricardo Gutiérrez TOXOPLASMOSIS Dr. Jaime Altcheh Servicio de Parasitología Hospital de Niños Ricardo Gutiérrez Epidemiología No tengo la culpa!! Los felinos son huéspedes definitivos (ciclo sexuado y asexuado). Los humanos

Más detalles


PROTOCOLO DE VIGILANCIA DE LA HEPATITIS C PROTOCOLO DE VIGILANCIA DE LA HEPATITIS C DESCRIPCIÓN DE LA ENFERMEDAD Introducción La hepatitis C es una infección viral que puede presentarse como una afección leve, de pocas semanas de duración, o evolucionar

Más detalles

Estrategia utilizada

Estrategia utilizada Estrategia utilizada 1) Extracción HIV RNA V3 7114 7218 2) One Step RT-PCR (x triplicado) 3) 2 nd PCR (A1 A2 A3) A1 A2 A3 4) Secuencuiación A1 A2 A3 TGTACAAGACCCAACAACAATACAAGAAAAAGTATACATGTAGGACG AGGGAGATCAATTTATGCAACAGAAAAAATAATAGGAGATACAAAAC

Más detalles

Hepatitis viral tipo C (HCV) RT-PCR

Hepatitis viral tipo C (HCV) RT-PCR Hepatitis viral tipo C (HCV) RT-PCR Celía, Alejandro Fabián Taborda, Florencia Ines Características Generales del HCV Agente etiológico de las HNANB transmitidas por transfusiones Flia: Flaviviridae Género:

Más detalles

La hepatitis C es prevalente en todo el mundo. Las regiones más afectadas son Asia central y oriental y el norte de África.

La hepatitis C es prevalente en todo el mundo. Las regiones más afectadas son Asia central y oriental y el norte de África. Hepatitis C Nota descriptiva N 164 Abril de 2014 Cifras y datos La hepatitis C es una enfermedad del hígado causada por el virus del mismo nombre; ese virus puede causar una infección, tanto aguda como

Más detalles

CASO CLINICO: ELISA. Inmunología Clínica 2009

CASO CLINICO: ELISA. Inmunología Clínica 2009 CASO CLINICO: ELISA Inmunología Clínica 2009 Qué sabemos sobre la estructura del virus de la Hepatitis B? Acerca de la genotipificación. 7 genotipos, A-G. Su prevalencia difiere geográficamente, con genotipos

Más detalles

Los resultados serológicos. Limitaciones y aplicaciones prácticas para la enfermedad de Gumboro

Los resultados serológicos. Limitaciones y aplicaciones prácticas para la enfermedad de Gumboro PATOLOGÍA LOS RESULTADOS SEROLÓGICOS. LIMITACIONES Y APLICACIONES PRÁCTICAS PARA LA ENFERMEDAD DE GUMBORO Los resultados serológicos. Limitaciones y aplicaciones prácticas para la enfermedad de Gumboro

Más detalles



Más detalles


CARTERA DE SERVICIOS SERVICIO DE INMUNOLOGÍA ( Abril de 2009) CARTERA DE SERVICIOS SERVICIO DE INMUNOLOGÍA ( Abril de 2009) ESTUDIOS INMUNODEFICIENCIAS: I) Consulta Inmunodeficiencias (Responsable Nieves Fernández Arcás) II) Estudio Inmunológico en Pacientes Bronquiectasias

Más detalles

Galván Ramos Marïa Ignacia. Moreno Torres Elisa Maria, Garcia Moreno Olga Lydia


Más detalles

Controles de enfermedades infecciosas para análisis serológicos

Controles de enfermedades infecciosas para análisis serológicos Bio-Rad Laboratories CONTROLES PARA ENFERMEDADES INFECCIOSAS Controles de enfermedades infecciosas para análisis serológicos Guía completa para la supervisión de los análisis de hepatitis, retrovirus,

Más detalles

GUIAS DE ATENCION EN VIH SIDA. Madeleyne Jaramillo Zapata Enfermera, Universidad de Antioquia Mg. En Administración en salud, Universidad CES

GUIAS DE ATENCION EN VIH SIDA. Madeleyne Jaramillo Zapata Enfermera, Universidad de Antioquia Mg. En Administración en salud, Universidad CES GUIAS DE ATENCION EN VIH SIDA Madeleyne Jaramillo Zapata Enfermera, Universidad de Antioquia Mg. En Administración en salud, Universidad CES VIH en cifras En 2011, el Programa de las Naciones Unidas sobre

Más detalles

Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional

Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional BIOQ. LILIANA DI TULLIO BUDASSI FAC. CS.BIOQUÍMICAS Y FARMACÉUTICAS UNIVERSIDAD NACIONAL DE ROSARIO

Más detalles


América Latina OPS0106 PROGRAMA DE EVALUACIÓN EXTERNA DE DESEMPEÑO EN SEROLOGÍA. Coordinación: PROGRAMA DE EVALUACIÓN EXTERNA DE DESEMPEÑO EN SEROLOGÍA América Latina OPS0106 Coordinación: Fundação Pró-Sangue Hemocentro de São Paulo Organización Pan Americana de la Salud International Consortium

Más detalles

A principios de los años ochentas el desarrollo de nuevas tecnologías para la

A principios de los años ochentas el desarrollo de nuevas tecnologías para la Nuevos marcadores para la detección temprana y predicción de sobrevida en blancos terapéuticos. A principios de los años ochentas el desarrollo de nuevas tecnologías para la identificación del ADN del

Más detalles

Hepatitis virales. Juan Carlos Rodríguez Díaz S. Microbiología Hospital General Universitario de Elche

Hepatitis virales. Juan Carlos Rodríguez Díaz S. Microbiología Hospital General Universitario de Elche Hepatitis virales Juan Carlos Rodríguez Díaz S. Microbiología Hospital General Universitario de Elche Hepatitis Características generales Es un proceso asociado a muchas causas, tanto infecciosas como

Más detalles

Vacunación antihepatitis B en el paciente con VIH

Vacunación antihepatitis B en el paciente con VIH José Ángel Rodrigo Pendás Servicio de Medicina Preventiva y Epidemiología Hospital Vall d Hebron 24 de abril de 2008 Contenido Importancia de la vacunación antihepatitis B en personas con VIH Inmunogenicidad

Más detalles



Más detalles

Coinfección VIH / VHC /VHB. Aspectos relevantes de su seguimiento.

Coinfección VIH / VHC /VHB. Aspectos relevantes de su seguimiento. Coinfección VIH / VHC /VHB. Aspectos relevantes de su seguimiento. VIH VHC VHB Porque es importante tener en cuenta la coinfección por VHC y por VHB en el paciente VIH? Importancia epidemiológica 1ª) Alta

Más detalles

Profilaxis de accidentes post exposición a sangre o derivados

Profilaxis de accidentes post exposición a sangre o derivados Universidad de Buenos Aires - Facultad de Odontología - Hospital Odontológico Universitario 2009 Profilaxis de accidentes post exposición a sangre o derivados La actual información está fundamentada en

Más detalles