Urinary Cortisol ELISA

Tamaño: px
Comenzar la demostración a partir de la página:

Download "Urinary Cortisol ELISA"

Transcripción

1 Userś Manual Urinary Cortisol ELISA Enzyme Immunoassay for the quantitative determination of free cortisol in urine HZ

2 Version 8.0 Effective, January 2011 (12/2010) Please use only the valid version of the package insert provided with the kit. Verwenden Sie nur die jeweils gültige, im Testkit enthaltene, Arbeitsanleitung. Si prega di usare la versione valida dell'inserto del pacco a disposizione con il kit. Por favor, se usa solo la version valida de la metodico técnico incluido aqui en el kit. Table of Contents / Inhaltsverzeichnis / Tabella die Contenuti / Tabla de Contenidos 1 INTENDED USE PRINCIPLE REAGENTS, MATERIALS AND INSTRUMENTATION PRECAUTIONS PROCEDURE QUALITY CONTROL LIMITATIONS OF PROCEDURE RESULTS REFERENCE VALUES PERFORMANCE AND CHARACTERISTICS WASTE MANAGEMENT BIBLIOGRAPHY TROUBLESHOOTING DESTINAZIONE D USO PRINCIPIO DEL METODO REATTIVI, MATERIALI E STRUMENTAZIONE PRECAUZIONI PROCEDIMENTO CONTROLLO QUALITA LIMITAZIONI DELLA PROCEDURA RISULTATI VALORI DI RIFERIMENTO PARAMETRI CARATTERISTICI DISPOSIZIONI PER LO SMALTIMENTO BIBLIOGRAFIA SUGGERIMENTI PER LA RISOLUZIONE DEI PROBLEMI USO PREVISTO PRINCIPIO DEL MÉTODO REACTIVOS, MATERIAL E INTRUMENTOS PRECAUCIÓN PROCEDIMIENTO CONTROL DE CALIDAD LIMITACIONES DE USO CURVA ESTÁNDAR - CÁLCULO DE LOS RESULTADOS VALORES DE REFERENCIA CARACTERÍSTICAS DEL ENSAYO GESTIÓN DE LOS RESIDUOS BIBLIOGRAFÍA SYMBOLS USED WITH HÖLZEL ASSAYS Hölzel Diagnostika GmbH, Hansaring 10, Köln, Germany 1

3 1 INTENDED USE Competitive immunoenzymatic colorimetric method for quantitative determination of Free Cortisol concentration in Urine. Urinary Free Cortisol kit is intended for laboratory use only. 1.1 CLINICAL SIGNIFICANCE Cortisol is a steroid hormone released from the adrenal cortex in response to an hormone called ACTH (produced by the pituitary gland), it is involved in the response to stress; it increases blood pressure, blood sugar levels, may cause infertility in women, and suppresses the immune system. Cortisol acts through specific intracellular receptors and has effects in numerous physiologic systems, including immune function, glucose-counter regulation, vascular tone, substrate utilization and bone metabolism. Cortisol is excreted primarily in urine in an unbound (free) form. Cortisol is bound, in plasma, from corticosteroid-binding globulin (CBG, transcotin), with high affinity, and from albumin. Only free cortisol is available to most receptors. These normal endogenous functions are the basis for the physiological consequences of chronic stress - prolonged cortisol secretion causes muscle wastage, hyperglycaemia, and suppresses immune / inflammatory responses. The same consequences arise from long-term use of glucocorticoid drugs. The free cortisol fraction represents the metabolically active cortisol. In normal conditions, less then 1% it comes excrete in urines. In pathological conditions (syndrome of Cushing) the levels of free urinary cortisol are elevate, because the CBG don t bound the plasmatic cortisol in excess and it was remove with urines. During pregnancy or estro-progestogen treatment an increase of plasmatic cortisol caused by an increment of the production of the transport protein, but the levels of free urinary cortisol results normal to indicate a correct surrenic functionality. This test is very useful to estimate the real surrenic function, because is dose the free cortisol, it is the metabolically active form. Moreover the measurement of free urinary cortisol is the better parameter for the diagnosis of the Cushing s syndrome. 2 PRINCIPLE Urinary Cortisol (antigen) in the sample competes with horseradish-peroxidase Cortisol (enzyme-labelledantigen) for binding onto the limited number of anti-cortisol (antibody) sites on the microplates (solid phase). After incubation, the bound/free separation is performed by a simple solid-phase washing. The enzyme substrate (H 2 O 2 ) and the TMB-Sustrate (TMB) are added. After an appropriate time has elapsed for maximum colour development, the enzyme reaction is stopped and the absorbances are determined. Urinary Cortisol concentration in the sample is calculated based on a series of standard. The colour intensity is inversely proportional to the urinary cortisol concentration in the sample. Hölzel Diagnostika GmbH, Hansaring 10, Köln, Germany 2

4 3 REAGENTS, MATERIALS AND INSTRUMENTATION 3.1 Reagents and materials supplied in the kit 1. Cortisol Standards STD0 STD4, 5 vials, 1 ml each 2. Incubation buffer, 1 vial, 100 ml Phosphate buffer 50 mm ph 7.4; BSA 1 g/l 3. Conjugate, 1 vial, 1.0 ml Cortisol-HRP conjugate 4. Coated Microplate, 1 breakable microplate Anti-Cortisol-IgG adsorbed on microplate 5. TMB-substrate, 1 vial, 15 ml H 2 O 2- TMB 0.26 g/l (avoid any skin contact) 6. Stop solution, 1 vial, 15 ml Sulphuric acid 0.15 mol/l (avoid any skin contact) 7. Low Control, 1 vial, 1 ml Ready to use 8. High Control, 1 vial, 1 ml Ready to use 3.2 Reagents necessary not supplied Distilled water 3.3 Auxiliary materials and instrumentation Automatic dispenser Microplates reader (450 nm) Note Store all reagents at 2 C 8 C in the dark. Open the bag of reagent 4 (Coated Microplate) only when it is at room temperature and close immediately after use. Do not remove the adhesive sheet from the unused strips. 4 PRECAUTIONS The reagents contain Proclin 300 as preservative. Avoid the exposure of reagent TMB/H 2 O 2 to directed sunlight, metals or oxidants. Maximum precision is required for reconstitution and dispensation of the reagents. Do not use different lots of reagents. Do not use heavily haemolized samples. This method allows the determination of Cortisol from10 ng/ml to 500 ng/ml. The clinical significance of the Cortisol determination can be invalidated if the patient was treated with corticosteroids or natural or synthetic steroids. Hölzel Diagnostika GmbH, Hansaring 10, Köln, Germany 3

5 5 PROCEDURE 5.1 Preparation of the Standard (S 0, S 1, S 2, S 3, S 4 ) The standards have the following concentration of Cortisol: S 0 S 1 S 2 S 3 S 4 ng/ml Stable when stored at +4 C until the expiration date of the kit; once opened the standards are stable six months at 2 C 8 C. 5.2 Preparation of diluted Conjugate Prepare immediately before use. Add 10 µl Conjugate (reagent 3) to 1.0 ml of Incubation Buffer (reagent 2). Mix gently for at least 10 minutes with a rotating mixer. Stable for 3 hours at room temperature (22 C 28 C). 5.3 Preparation of the Sample The total volume of urine excreted during a 24 hours should be collected and mixed in a single container. Urine samples which are not to be assayed immediately should be stored at 2 C 8 C or at 20 C for periods longer than a week. Dilute the urine sample (1 + 1) with Incubation buffer (e.g. 100 µl µl) 5.4 Procedure As it is necessary to perform the determination in duplicate, prepare two wells for each of the four points of the standard curve (S 0 -S 4 ), one for Blank. Reagent Standards/Controls Samples Blank Standard S 0 -S 4 Controls 10 µl Diluted samples 10 µl Diluted Conjugate 300 µl 300 µl Incubate at 37 C for 1 hour. Remove the contents from each well; wash the wells 2 times with 400 μl of distilled water. TMB substrate 100 µl 100 µl 100 µl Incubate at room temperature (22 C 28 C) for 15 minutes in the dark Stop solution 100 µl 100 µl 100 µl Shake the microplate gently. Read the absorbance (E) at 450 nm against Blank. Hölzel Diagnostika GmbH, Hansaring 10, Köln, Germany 4

6 6 QUALITY CONTROL Each laboratory should assay controls at normal, high and low levels range of Urinary Cortisol for monitoring assay performance. These controls should be treated as unknowns and values determined in every test procedure performed. Quality control charts should be maintained to follow the performance of the supplied reagents. Pertinent statistical methods should be employed to ascertain trends. The individual laboratory should set acceptable assay performance limits. Other parameters that should be monitored include the 80, 50 and 20% intercepts of the standard curve for run-to-run reproducibility. In addition, maximum absorbance should be consistent with past experience. Significant deviation from established performance can indicate unnoticed change in experimental conditions or degradation of kit reagents. Fresh reagents should be used to determine the reason for the variations. 7 LIMITATIONS OF PROCEDURE 7.1 Assay Performance Sample(s), which are contaminated microbiologically, should not be used in the assay. Highly lipemeic or haemolysed specimen(s) should similarly not be used. It is important that the time of reaction in each well is held constant for reproducible results. Pipetting of samples should not extend beyond ten minutes to avoid assay drift. If more than one plate is used, it is recommended to repeat the dose response curve. Addition of the substrate solution initiates a kinetic reaction, which is terminated by the addition of the stop solution. Therefore, the addition of the substrate and the stopping solution should be added in the same sequence to eliminate any time deviation during reaction. Plate readers measure vertically. Do not touch the bottom of the wells. Failure to remove adhering solution adequately in the aspiration or decantation wash step(s) may result in poor replication and spurious results. 7.2 Interpretation If computer controlled data reduction is used to calculate the results of the test, it is imperative that the predicted values for the calibrators fall within 10% of the assigned concentrations. 8 RESULTS 8.1 Mean Absorbance Calculate the mean of the absorbance (Em) for each point of the standard curve and of each sample 8.2 Standard Curve Plot the values of absorbance of the standards against concentration. Draw the best-fit curve through the plotted points (e.g.: Four Parameter Logistic). 8.3 Calculation of Results Interpolate the values of the samples on the standard curve to obtain the corresponding values of the concentrations expressed in ng/ml. To calculate the cortisol concentration in urine, calculate as above and correct for total volume of volume of urine collected in 24 hours: ng/ml x Vol(mL) urine 24 h/ = µg Cortisol/24h 9 REFERENCE VALUES µg/24 hours Hölzel Diagnostika GmbH, Hansaring 10, Köln, Germany 5

7 10 PERFORMANCE AND CHARACTERISTICS 10.1 Precision Intra-Assay Variation Within run variation was determined by replicate measurements (10x) of three different control sera in one assay. The within assay variability is 7% Inter-Assay Variation Between run variation was determined by replicate measurements (10x) of three different control sera in different lots of kit. The between assay variability is 9% Accuracy The recovery of ng/ml of Urinary Cortisol added to a sample gave an average value (±SD) of % ± 4.55% with reference to the original concentrations Sensitivity The lowest detectable concentration of urinary cortisol that can be distinguished from the zero standard is 2.0 ng/ml at the 95 % confidence limit Specificity The cross reaction of the antibody calculated at 50% according to Abraham are shown in the table: Cortisol 100 % Cortisone 10.8 % 11 -deoxycortisol 18.7 % Corticosterone 2.4 % Dexamethasone 0.39 % Progesterone 0.1 % Aldosterone 1 x10-2 % 11 OH Progesterone 1 x10-2 % Cholesterol < 1x10-6 % 10.5 Correlation with RIA The Urinary Cortisol ELISA (HZ-2989) was compared to another commercially available Urinary Cortisol assay. 50 serum samples were analysed according in both test systems. The linear regression curve was calculated: y = 1.10 x 1.56 r 2 = y = Urinary Cortisol ELISA (HZ-2989) x = Cortisol Immunotech RIA 11 WASTE MANAGEMENT Reagents must be disposed off in accordance with local regulations. 12 BIBLIOGRAPHY 1. Foster, L. B. and Dunn, R. T. Clin. Chem. 20/3 365(1974) 2. De Lacerda, et al J. Clin. Endocr. and Metab. 36,227 (1973) 3. Rolleri, E., et al Clin. Chim. Acta (1976) 4. Kobayashi, Y., et al Steroids, 32 no 1(1978) 5. Akarawa, et al Anal. Biochem (1979) Hölzel Diagnostika GmbH, Hansaring 10, Köln, Germany 6

8 13 TROUBLESHOOTING ERRORS / POSSIBLE CAUSES / SUGGESTIONS No colorimetric reaction no conjugate pipetted contamination of conjugates and/or of substrate errors in performing the assay procedure (e.g. accidental pipetting of reagents in a wrong sequence or from the wrong vial, etc.) Too low reaction (too low ODs) incorrect conjugate (e.g. not from original kit) incubation time too short, incubation temperature too low Too high reaction (too high ODs) incorrect conjugate (e.g. not from original kit) incubation time too long, incubation temperature too high water quality for wash buffer insufficient (low grade of deionization) insufficient washing (conjugates not properly removed) Unexplainable outliers contamination of pipettes, tips or containers insufficient washing (conjugates not properly removed) too high within-run CV% reagents and/or strips not pre-warmed to room temperature prior to use plate washer is not washing correctly (suggestion: clean washer head) too high between-run CV % incubation conditions not constant (time, temperature) controls and samples not dispensed at the same time (with the same intervals) (check pipetting order) person-related variation Hölzel Diagnostika GmbH, Hansaring 10, Köln, Germany 7

9 1 DESTINAZIONE D USO Metodo competitivo immunoenzimatico colorimetrico per la determinazione quantitativa della concentrazione del Cortisolo Libero nelle Urine. Il kit Urinary Free Cortisol è destinato al solo uso di laboratorio. 1.1 SIGNIFICATO CLINICO Il cortisolo è un ormone steroideo liberato dalla corteccia surrenale in risposta all ormone ACTH (prodotto dalla ghiandola pituitaria), esso è coinvolto nella risposta allo stress; aumenta la pressione sanguigna, glicemia, può causare la sterilità in donne e sopprime il sistema immunitario. Il cortisolo agisce tramite i recettori intracellulari specifici ed ha effetti in numerosi sistemi fisiologici, compreso il sistema immunitario, la regolazione del glucosio, il tono vascolare, l'utilizzazione del substrato ed il metabolismo osseo. Il cortisolo è escreto soprattutto nelle urine in forma (libera) non legata. Il cortisolo è legato, nel plasma, dalla globulina legante i corticosteroidi (CBG, transcotin), con alta affinità e dall'albumina. Soltanto il cortisolo libero è disponibile ai recettori. Le funzioni endogene normali sono la base per le conseguenze fisiologiche dello stress cronico - la secrezione prolungata del cortisolo causa lo sforzo del muscolo, iperglicemia e sopprime le risposte immuni/infiammatorie. Le stesse conseguenze risultano dall uso prolungato di farmaci a base di glucocorticoidi. Il cortisolo libero rappresenta la frazione di cortisolo metabolicamente attiva. In condizioni normali, meno dell' 1 % viene escreto come tale nelle urine. In condizioni patologiche (sindrome di Cushing) i livelli di cortisolo libero urinario sono molto elevati perché il cortisolo plasmatico in eccesso non si lega alla CBG e viene eliminato con le urine. Durante la gravidanza o il trattamento con estro-progestinici si ha un aumento del cortisolo plasmatico dovuto ad un incremento della sintesi della proteina di trasporto, ma i livelli di cortisolo libero urinario risultano normali, ad indicare una corretta funzionalità surrenica. Tale dosaggio risulta molto utile per valutare la reale funzione surrenica dal momento che viene dosata la quota libera e quindi metabolicamente attiva. Inoltre la valutazione del cortisolo urinario libero è il miglior parametro per la diagnosi della sindrome di Cushing. 2 PRINCIPIO DEL METODO Il Cortisolo Urinario (antigene) presente nel campione, compete con l antigene marcato con perossidasi nei confronti dell anticorpo anti-cortisolo adsorbito su micropiastra (fase solida). La separazione libero-legato si ottiene mediante semplice lavaggio della fase solida. L enzima presente nella frazione legata, reagendo con il Substrato (H 2 O 2 ) ed il TMB-Substrate (TMB), sviluppa una colorazione blu che vira al giallo dopo aggiunta dello Stop solution (H 2 SO 4 ). L intensità del colore sviluppato è proporzionale alla concentrazione di antigene marcato e quindi inversamente proporzionale alla concentrazione del Cortisolo Urinario presente nel campione. Hölzel Diagnostika GmbH, Hansaring 10, Köln, Germany 8

10 3 REATTIVI, MATERIALI E STRUMENTAZIONE 3.1 Reattivi e materiali forniti nel kit 1. Cortisolo Standard STD0 STD4, 5 flaconi, 1 ml ciascuno 2. Incubation Buffer (1 flacone) 100 ml Tampone fosfato 50 mm ph 7,4 - BSA 1 g/l 3. Conjugate, 1 flacone, 1 ml Cortisolo coniugato con Perossidasi 4. Coated Microplate (1 micropiastra breakable) IgG-Anti-Cortisolo adsorbita alla micropiastra 5. TMB-Substrate, 1 flacone, 15 ml H 2 O 2 -TMB (0,26 g/l) (evitare il contatto con la pelle) 6. Stop solution, 1flacone, 15 ml Acido Solforico 0.15 mol/l (evitare il contatto con la pelle) 7. Low Control, 1 flacone, 1 ml) Pronto all uso 8. High Control, 1 flacone, 1 ml) Pronto all uso 3.2 Reattivi necessari non forniti nel kit Acqua distillata. 3.3 Materiale e strumentazione ausiliare Dispensatori automatici. Lettore per micropiastre (450 nm) Note Conservare i reattivi a 2 C 8 C, al riparo dalla luce. Aprire la busta del Reattivo 4 (Coated Microplate) solo dopo averla riportata a temperatura ambiente e chiuderla subito dopo il prelievo delle strip da utilizzare Evitare di staccare la sheet adesiva dalle strip che non vengono utilizzate nella seduta analitica. 4 PRECAUZIONI I reagenti contengono Proclin 300 come conservante. Evitare l esposizione del reattivo TMB/H 2 O 2 alla luce solare diretta, metalli o ossidanti. Osservare la massima precisione nella ricostituzione e nella dispensazione dei reattivi. Non usare reattivi appartenenti a lotti diversi. Non usare campioni altamente emolizzati. Questo metodo consente di determinare concentrazioni di Cortisolo da 10 ng/ml a 500 ng/ml. La somministrazione di steroidi naturali o sintetici può alterare i livelli urinari di Cortisolo. Hölzel Diagnostika GmbH, Hansaring 10, Köln, Germany 9

11 5 PROCEDIMENTO 5.1 Preparazione degli Standard (S 0, S 1, S 2, S 3, S 4 ) Prima dell uso lasciare almeno 5 minuti su agitatore rotante. Gli Standard hanno le seguenti concentrazioni di Cortisolo: S 0 S 1 S 2 S 3 S 4 ng/ml Stabili fino alla scadenza del kit. Una volta aperti sono stabili per 6 mesi a +2 C 8 C 5.2 Preparazione del Coniugato Diluito Preparare immediatamente prima dell uso. Aggiungere 10 µl di Conjugate (reattivo 3) a 1 ml di Incubation buffer (reattivo 2). Mescolare delicatamente lasciando almeno 10 minuti su agitatore rotante. Stabile per 3 ore a temperatura ambiente (22 C 28 C). 5.3 Preparazione del campione Raccogliere le urine delle 24 ore in un unico recipiente. Se il dosaggio non viene effettuato lo stesso giorno del prelievo conservare il campione a + 2 C 8 C. Stabile per una settimana. Per periodi più lunghi conservare a 20 C. Diluire i campioni di urina (1 + 1) con Incubation buffer (es. 100 µl µl) 5.4 Procedimento Poiché è necessario operare in doppio, allestire due pozzetti per ogni punto della curva Standard (S 0 -S 4 ), due per ogni Campione ed una per il Bianco. Reagente Standard/Contolli Campioni Bianco Standard S 0 -S 4 Controlli 10 µl Campioni diluiti 10 µl Coniugato diluito 300 µl 300 µl Incubare 1 h a +37 C. Allontanare la miscela di reazione lavare i pozzetti 2 volte aggiungendo 0,4 ml di acqua distillata TMB substrate 100 µl 100 µl 100 µl Incubare 15 minuti a temperatura ambiente (22 C 28 C), al riparo dalla luce Stop solution 100 µl 100 µl 100 µl Agitare delicatamente la piastra. Leggere l assorbanza (E) a 450 nm azzerando con il Bianco. Hölzel Diagnostika GmbH, Hansaring 10, Köln, Germany 10

12 6 CONTROLLO QUALITA Ogni laboratorio dovrebbe analizzare i campioni nella gamma dei livelli elevati, normali e bassi di Cortisolo urinario per il controllo delle prestazioni dell analisi. Questi campioni dovrebbero essere trattati come ignoti ed i valori determinati in ogni test effettuato. Le tabelle di controllo qualità dovrebbero essere effettuate per seguire le prestazioni dei reagenti forniti. Metodi statistici adeguati dovrebbero essere impiegati per accertare il trend. Il laboratorio dovrebbe fissare i limiti di accettabilità di prestazioni dell analisi. Altri parametri che dovrebbero essere controllati includono le intercette di 80, 50 e 20% della curva standard per valutare la riproducibilità. In più, la capacità di assorbimento massima dovrebbe essere costante con l esperienza precedente. La deviazione significativa dalle prestazioni stabilite può indicare il cambiamento non osservato delle condizioni sperimentali o la degradazione dei reagenti del kit. I questo caso si consiglia di utilizzare reagenti freschi per determinare il motivo delle variazioni. 7 LIMITAZIONI DELLA PROCEDURA 7.1 Prestazioni dell analisi Non usare campioni microbiologicamente contaminati, così come campioni altamente lipemici o emolizzati. E importante che il tempo di reazione di ogni pozzetto sia lo stesso per la riproducibilità dei risultati. Il tempo di dispensazione dei pozzetti non deve essere superiore a 10 minuti. Se si protrae per oltre 10 minuti si raccomanda di seguire l ordine di dispensazione. Se si usa più di una micropiastra, ripetere la curva standard in ogni piastra. L addizione del TMB-substrate da inizio a una reazione cinetica, la quale termina con l aggiunta della stop solution. L addizione del substrato e della stop solution deve avvenire nella stessa sequenza per eliminare differenti tempi di reazione. Le Plate readers misurano le OD verticalmente. Non toccare il fondo dei pozzetti. La non completa aspirazione della soluzione di lavaggio dai pozzetti può dar luogo a cattivi replicati e a falsi risultati. 7.2 Interpretazione dei risultati Se per calcolare i risultati è stato usato il computer, è imperativo che i valori dei calibratori cadano entro il 10 % delle concentrazioni assegnate. 8 RISULTATI 8.1 Estinzione Media Calcolare l estinzione media (Em) di ciascun punto della curva standard (S 0 -S 4 ) e di ogni campione. 8.2 Curva Standard Tracciare il grafico dell assorbanza in funzione delle concentrazioni degli standard (S 0 -S 4 ). (es: Four Parameter Logistic). 8.3 Calcolo dei risultati Interpolare, dal grafico, i valori di assorbanza relativi a ciascun campione e leggerne la corrispondente concentrazione in ng/ml. Per calcolare le concentrazioni nelle urine applicare la seguente formula: ng/ml x Vol(mL) urine 24 h/1.000 = µg Cortisolo/24 h 9 VALORI DI RIFERIMENTO Le concentrazioni urinarie delle 24/h di Cortisolo sono comprese nei seguenti intervalli: µg/24 h Hölzel Diagnostika GmbH, Hansaring 10, Köln, Germany 11

13 10 PARAMETRI CARATTERISTICI 10.1 Precisione Intra-Assay La variabilità all interno dello stesso kit è stata determinata replicando (10x) la misura di tre differenti sieri di controllo. La variabilità intra-assay è 7% Inter-Assay La variabilità tra kit differenti è stata determinata replicando (10x) la misura di tre differenti sieri di controllo con kit appartenenti a lotti diversi. La variabilità inter-assay è 9% 10.2 Accuratezza La prova di recupero condotta su un campione arricchito con ng/ml di Cortisolo, ha dato un valore medio (±SD) di 101,89% ± 4,55% Sensibilità La concentrazione minima di cortisolo urinario misurabile è 2,0 ng/ml con un limite di confidenza del 95% Specificità L anticorpo impiegato presenta le seguenti reazioni crociate, calcolate al 50% secondo Abraham: Cortisolo 100 % Cortisone 10,8 % 11 -deossicortisolo 18,7 % Corticosterone 2,4 % Desametasone 0.39 % Progesterone 0,1 % Aldosterone 1 x10-2 % 11 OH 1 x10-2 % Progesterone Cholesterol < 1 x10-6 % 10.5 Correlazione con il dosaggio RIA Il kit Urinary Cortisol (HZ-2989) è stato comparato con un kit disponibile in commercio. Sono stati testati 50 campioni di siero. La curva di regressione è: y = 1,10 x - 1,56 r 2 = 0,949 y = Urinary Cortisol (HZ-2989) x = Cortisol Immunotech RIA 11 DISPOSIZIONI PER LO SMALTIMENTO I reagenti devono essere smaltiti in accordo con le leggi locali. 12 BIBLIOGRAFIA 1. Foster, L. B. and Dunn, R. T. Clin. Chem. 20/3 365(1974) 2. De Lacerda, et al J. Clin. Endocr. and Metab. 36,227 (1973) 3. Rolleri, E., et al Clin. Chim. Acta (1976) 4. Kobayashi, Y., et al Steroids, 32 no 1(1978) 5. Akarawa, et al Anal. Biochem (1979) Hölzel Diagnostika GmbH, Hansaring 10, Köln, Germany 12

14 13 SUGGERIMENTI PER LA RISOLUZIONE DEI PROBLEMI ERRORE CAUSE POSSIBILI/ SUGGERIMENTI Nessuna reazione colorimetrica del saggio mancata dispensazione del coniugato contaminazione del coniugato e/o del Substrato errori nell esecuzione del saggio (es. Dispensazione accidentale dei reagenti in sequenza errata o provenienti da flaconi sbagliati, etc.) Reazione troppo blanda (OD troppo basse) coniugato non idoneo (es. non proveniente dal kit originale) tempo di incubazione troppo breve, temperatura di incubazione troppa bassa Reazione troppo intensa (OD troppo alte) coniugato non idoneo (es. non proveniente dal kit originale) tempo di incubazione troppo lungo, temperatura di incubazione troppa alta qualità scadente dell acqua usata per la soluzione di lavaggio (basso grado di deionizzazione) lavaggi insufficienti (coniugato non completamente rimosso) Valori inspiegabilmente fuori scala contaminazione di pipette, puntali o contenitori- lavaggi insufficienti (coniugato non completamente rimosso) CV% intrasaggio elevato reagenti e/o strip non portate a temperature ambiente prima dell uso il lavatore per micropiastre non lava correttamente (suggerimento: pulire la testa del lavatore) CV% intersaggio elevato condizioni di incubazione non costanti (tempo o temperatura) controlli e campioni non dispensati allo stesso tempo (con gli stessi intervalli) (controllare la sequenza di dispensazione) variabilità intrinseca degli operatori Hölzel Diagnostika GmbH, Hansaring 10, Köln, Germany 13

15 1 USO PREVISTO Método colorimétrico immunoenzimático competitivo para la determinación cuantitativa de la concentración de Cortisol Libre en la orina. El kit está destinado exclusivamente para uso en laboratorio. 1.1 La Significación Clinica. El cortisol es una hormona esteroide liberada por la corteza suprarrenal en respuesta a la hormona ACTH (producida por la glándula pituitaria), como parte de la respuesta al estrés, aumenta la presión sanguínea, la glucemia, puede causar esterilidad en mujeres, y deprime el sistema inmunitario. El cortisol actúa a través de receptores intracelulares específicos y tiene efecto en varios sistemas fisiológicos, como el sistema inmunitario, la regulación de la glucemia, el tono vascular, la utilización del sustratos y el metabolismo óseo. El cortisol se excreta principalmente en la orina en la forma libre no unida. En el plasma, el cortisol se une con elevada afinidad a la globulina de unión a corticosteroides (CBG, transcotin) y a albúmina. Sólo el cortisol libre puede unirse a sus receptores. Las funciones endógena normales son la base de las consecuencias fisiológicas del estrés crónico - la secreción prolongada de cortisol causa esfuerzo muscular, hiperglucemia y inhibe la respuesta inmune/inflamatoria. Las mismas consecuencias resultan del uso prolongado de fármacos a base de glucocorticoides. El cortisol libre representa la fracción de cortisol metabólicamente activa. En condiciones normales, menos del 1% se excreta como tal en la orina. En condiciones patológicas (síndrome de Cushing) los niveles de cortisol libre urinario son muy elevados porque el cortisol plasmático en exceso no se une a CBG y se elimina por la orina. Durante el embarazo o el tratamiento con estro-progestágenos hay un aumento del cortisol plasmático debido a un incremento en la síntesis de la proteína de transporte, pero los niveles de cortisol libre en orina son normales, indicando una correcta funcionalidad suprarrenal. Este ensayo es muy útil para valorar la función suprarrenal ya que se mide la fracción libre y por tanto metabólicamente activa. Por otra parte, la evaluación de cortisol libre en orina es el mejor parámetro para el diagnóstico de síndrome de Cushing. 2 PRINCIPIO DEL MÉTODO El Cortisol urinario (antígeno) en la muestra compite con el cortisol unido a la peroxidasa de rábano (antígenomarcado con enzima) para la unión al anticuerpo anti-cortisol (anticuerpo) adsorbido en la microplaca (fase sólida). Después de la incubación, la separación entre antígeno unido y libre se realiza por un simple lavado de la fase sólida. El enzima presente en la fracción unida reacciona con el sustrato (H 2 O 2 ) y el sustrato-tmb (TMB), desarrollándose una coloración azul que vira a amarillo después de añadir la solución Stop (H 2 SO 4 ). La intensidad del color es proporcional a la concentración de antígeno marcado y por tanto inversamente proporcional a la concentración del Cortisol urinario en la muestra. Hölzel Diagnostika GmbH, Hansaring 10, Köln, Germany 14

16 3 REACTIVOS, MATERIAL E INTRUMENTOS 3.1 Reactivos y materiales suministrados en el kit 1. Estándares de Cortisol STD0 STD4; 5 x 1 frasco, 1 ml cada uno 2. Tampón de incubación, 1 frasco, 100 ml Tampón fosfato 50 mm ph 7.4; BSA 1 g/l, 3. Conjugado, 1 frasco, 1 ml Cortisol conjugado con peroxidasa 4. Microplaca recubierta, 1 microplaca separable IgG-Anti-Cortisol adsorbida en la microplaca 5. Sustrato TMB, 1 frasco, 15 ml H 2 O 2 -TMB 0.26 g/l (evitar cualquier contacto con la piel) 6. Solución de parada, 1 frasco, 15 ml Ácido Sulfúrico 0.15 mol/l (corrosivo: evitar cualquier contacto con la piel) 7. Control Low, 1 frasco, 1 ml (control bajo), Listo para usar. 8. Control High, 1 frasco, 1 ml (control alto), listo para usar. 3.2 Reactivos necesarios que no se suministran con el kit Agua destilada. 3.3 Materiales e instrumentos auxiliares Dispensador automático. Lector de microplacas (450 nm) Notas Almacenar todos los reactivos entre 2 8 C en oscuridad. Abrir la bolsa de la microplaca sólo cuando se encuentre a temperatura ambiente y cerrar inmediatamente después de sacar las tiras que van a usarse. No eliminar la hoja adhesiva de las tiras que no van a ser utilizadas. 4 PRECAUCIÓN Los reactivos contienen conservantes Proclin 300. Evitar la exposición del reactivo TMB/H 2 O 2 a la luz solar directa, metales u oxidantes. Se requiere una precisión máxima para la reconstitución y dispensación de los reactivos. No usar reactivos partenecientes a lotes diferentes. Evitar muestras hemolisadas. Este método permite la determinación de Cortisol de 10 ng/ml a 500 ng/ml. La administración de esteroides naturales o sintéticos puede alterar los niveles urinarios de cortisol. Hölzel Diagnostika GmbH, Hansaring 10, Köln, Germany 15

17 5 PROCEDIMIENTO 5.1 Preparación d Estándar(S0, S1, S2, S3, S4) Antes de usar mantener en un agitador rotatorio durante al menos 5 minutos. Los estándares tienen las siguientes concentraciones de Cortisol: S 0 S 1 S 2 S 3 S 4 ng/ml Estables hasta la fecha de caducidad del kit. Una vez abiertos son son estables durante seis meses a (2 C 8 C) 5.2 Preparación del conjugado diluito Preparar inmediatamente antes de usar Adicionar 10 µl de conjugado a 1.0 ml de tampón de incubación (dilución ). Mezclar cuidadosamente dejando al menos durante 10 minutos en un agitador rotatorio. Estable durante 3 horas a temperatura ambiente (22 C 28 C). 5.3 Preparación de la muestra Debe recogerse el volumen total de orina excretada durante 24 horas y mezclarse en un único recipiente. Las muestras de orina que no van a ensayarse el mismo dia de la recolección deben almacenarse a 2 C 8 C. Estable durante una semana. Para períodos más largos conservar a -20 C. Diluir las muestras con el tampón de incubación (ej. 100 μl μl). 5.4 Procedimiento Como es necesario realizar la determinación por duplicado, preparar dos pocillos para cada uno de los cinco puntos de la curva estándar (S0-S4), y uno para el blanco. Reactivo Estándar / Controles Muestras Blanco Estándar S 0 -S 4 Controles 10 µl Muestras diluidas 10 µl Conjugado Diluido 300 µl 300 µl Incubar a +37 C durante 1 hora. Desechar la mezcla de reacción; lave los pozos 2 veces con 0,4 ml de agua destilada. Sustrato-TMB 100 µl 100 µl 100 µl Incubar a temperatura ambiente (22 C 28 C) durante 15 minutos, protegido de la luz. Solución de parada 100 µl 100 µl 100 µl Agite con cuicado la microplaca. Leer la absorbancia (E) a 450 nm restando el valor del blanco. Hölzel Diagnostika GmbH, Hansaring 10, Köln, Germany 16

18 6 CONTROL DE CALIDAD Cada laboratorio debe analizar muestras en la gama de niveles elevados, normales y bajos de cortisol en orina para verificar las prestaciones del análisis. Estas muestras deben ser tratadas como desconocidas y sus valores deben ser determinados en cada prueba realizada. Deben realizarse tablas de control de calidad para hacer el seguimiento del rendimiento de los reactivos, utilizándose los métodos estadísticos adecuados para determinar las tendencias. El laboratorio debe determinar los límites aceptables para las prestaciones del análisis. Otros parámetros que deben ser monitoreados incluyen las intersecciones de 80, 50 y 20% de la curva estándar para evaluar la reproducibilidad. Además, la absorción máxima debe ser consistente respecto a las pruebas anteriores. Cualquier desviación significativa de las prestaciones establecidas puede indicar cambios inadvertidos en las condiciones experimentales o la degradación de los reactivos del kit. Deben utilizarse reactivos frescos para determinar la razón de las variaciones. 7 LIMITACIONES DE USO 7.1 Prestaciones del ensayo No deben usarse muestras contaminadas microbiológicamente, ni tampoco muestras altamente lipémicas o hemolisadas. Es importante mantener constante el tiempo de incubación en cada pocillo para obtener resultados reproducibles. El pipeteo de las muestras no debe durar más de diez minutos para evitar la deriva del ensayo. Si se usa más de una placa, se recomienda repetir la curva de calibración. La adición de la solución de sustrato inicia una reacción cinética, la cual se detiene mediante la adición de solución de parada. Por lo tanto, la adición del sustrato y la solución de parada deben realizarse en la misma secuencia para evitar desviaciones temporales durante la reacción. Los lectores de placas miden en vertical. No tocar el fondo de los pocillos. La aspiración incompleta de la solución en los pasos de lavado puede dar lugar a inconsistencia en los replicados y resultados erróneos. 7.2 Interpretación de los resultados Si se usa un ordenador para calcular los resultados, los valores del los calibradores no deben diferir más de un 10% de los valores asignados. 8 CURVA ESTÁNDAR - CÁLCULO DE LOS RESULTADOS 8.1 Absorbancia media Calcular la absorbancia media (E m ) para cada punto de la curva estándar y de cada muestra. 8.2 Curva Estándar Construir una curva estándar mediante la representación de la absorbancia media obtenida para cada estándar frente a su concentración con el valor de absorbancia en el eje vertical (Y) y la concentración en el eje horizontal (X). (Por ejemplo: Cuatro Parámetros Logística). 8.3 Cálculo de los resultados Interpolar los valores de las muestras en la curva estándar para obtener los valores de las concentraciones correspondientes expresadas en ng/ml. Para calcular la concentración de Cortisol en orina, calcular como arriba y corregir para el volumen total de orina recogida en 24 horas: ng/ml x Vol (ml) orina 24 h / = µg Cortisol/ 24 horas 9 VALORES DE REFERENCIA µg/24 horas Hölzel Diagnostika GmbH, Hansaring 10, Köln, Germany 17

19 10 CARACTERÍSTICAS DEL ENSAYO 10.1 Precisión Intra-Ensayo La variabilidad en el mismo kit se determinó por repetición (10x) en la medida de tres sueros de control diferentes. La variabilidad intra-ensayo fue 7% Inter-Assay La variabilidad entre los diferentes kits se determinó por repetición (10x) en la medida de sueros de control con tres diferentes kits de lotes diferentes. La variabilidad inter-ensayo es 9% Exactitud La prueba de recuperación en una muestra enriquecida con a 200 ng/ml Cortisol, dio una media (± DE) de 101,89% ± 4,55% Sensibilidad La concentración mínima de la norma cortisol urinario es de 2,0 ng/ml con un límite de confianza del 95% Especificidad La reacción cruzada de la microplaca recubierta calculada al 50% de acuerdo con Abraham se muestra en la tabla: Cortisol 100 % Cortisona 10,8 % 11 -desoxicortisol 18,7 % Corticosterona 2,4 % Dexametasona 0.39 % Progesterona 0,1 % Aldosterona 1 x10-2 % 11 OH Progesterona 1 x10-2 % Colesterol < 1 x10-6 % 10.5 Correlación con RIA El kit cortisol urinario (HZ-2989) se comparó con un kit comercial. Se probaron 50 muestras de suero. La curva de regresión es: y = 1,10 x - 1,56 r 2 = 0,949 y = Urinary Cortisol (HZ-2989) x = Cortisol Immunotech RIA 11 GESTIÓN DE LOS RESIDUOS Los reactivos han de ser eliminados de acuerdo a las leyes locales. 12 BIBLIOGRAFÍA 1. Foster, L.B. and Dunn, R.T. Clin Chem: 20/3, 365 (1974) 2. De Laceda, L., Kowarski, A., and Migeon, C.J. J. Clin Endocr. and Metab: 36:227 (1973) 3. Rolleri, E., Zannino, M., Orlandini, S., Malvano, R. Clin chim Acta (1976) 4. Kobayashi, Y., et al. Steroids, 32 no. 1 (1978) 5. Arakawa, H., Maeda, M., Tsuji, A. Anal. Biochem (1979) Hölzel Diagnostika GmbH, Hansaring 10, Köln, Germany 18

20 SYMBOLS USED WITH HÖLZEL ASSAYS RUO Symbol English Deutsch Français Español Italiano Consult instructions for use European Conformity Gebrauchsanweisung beachten CE-Konfirmitätskennzeichnung Consulter les instructions d utilisation Conformité aux normes européennes In vitro diagnostic Usage Diagnostic In-vitro-Diagnostikum device in vitro For research use only Nur für Forschungszwecke Seulement dans le cadre de recherches Consulte las instrucciones de uso Consultare le istruzioni per l uso Conformidad europea Conformità europea Para uso Diagnóstico in vitro Sólo para uso en investigación Per uso Diagnostica in vitro Solo a scopo di ricerca Catalogue number Katalog-Nr. Numéro de catalogue Número de catálogo Numero di Catalogo Lot. No. / Batch code Chargen-Nr. Numéro de lot Número de lote Numero di lotto Contains sufficient for <n> tests/ Ausreichend für n Ansätze Contenu suffisant pour n tests Contenido suficiente para <n> ensayos Contenuto sufficiente per n saggi Storage Temperature Lagerungstemperatur Température de conservation Expiration Date Temperatura de conservación Temperatura di conservazione Mindesthaltbarkeitsdatum Date limite d utilisation Fecha de caducidad Data di scadenza Legal Manufacturer Hersteller Fabricant Fabricante Fabbricante Distributed by Distributor Vertreiber Distributeur Distribuidor Distributore Content Content Inhalt Conditionnement Contenido Contenuto Volume/No. Volume / No. Volumen/Anzahl Volume/Quantité Volumen/Número Volume/Quantità Hölzel Diagnostika GmbH, Hansaring 10, Köln, Germany 19

21 Ordering Information Urinary Cortisol ELISA HZ-2989 For orders, please contact : Hölzel Diagnostika Handels GmbH Hansaring 10 D Köln Tel.: Fax: info@hoelzel.de For technical advice, please contact: info@hoelzel.de Hölzel Diagnostika GmbH, Hansaring 10, Köln, Germany 20

b-hcg ELISA DCM014-11 Ed. 11/2013 per analisi di routine Determinazione immunoenzimatica diretta della β-hcg nel siero o plasma umano.

b-hcg ELISA DCM014-11 Ed. 11/2013 per analisi di routine Determinazione immunoenzimatica diretta della β-hcg nel siero o plasma umano. DCM014-11 Ed. 11/2013 b-hcg ELISA per analisi di routine Determinazione immunoenzimatica diretta della β-hcg nel siero o plasma umano. IVD LOT vedere etichetta esterna Σ = 96 test REF DKO014 STINAZIONE

Más detalles

CORTISOL ELISA Determinazione immunoenzimatica diretta del Cortisolo nel siero o plasma umano

CORTISOL ELISA Determinazione immunoenzimatica diretta del Cortisolo nel siero o plasma umano DCM001-9 Ed. 03/2012 CORTISOL ELISA Determinazione immunoenzimatica diretta del Cortisolo nel siero o plasma umano per analisi di routine IVD LOT Vedere etichetta esterna = 96 test REF DKO001 DTINAZIONE

Más detalles

FREE TESTOSTERONE ELISA

FREE TESTOSTERONE ELISA DCM015-14 Ed. 10/2013 EE TTOSTERONE ELISA per analisi di routine Determinazione immunoenzimatica diretta del Testosterone Libero nel siero o plasma umano IVD LOT Vedere etichetta esterna Σ = 96 test REF

Más detalles

ANDROSTENEDIONE ELISA

ANDROSTENEDIONE ELISA DCM008-9 Ed. 03/2012 ANDROSTENEDIONE ELISA per analisi di routine Determinazione immunoenzimatica diretta del 4-Androstenedione nel siero o plasma umano. IVD LOT Vedere etichetta esterna = 96 test REF

Más detalles

DHEA-S SALIVA ELISA. per analisi di routine. DCM024-9 Ed. 08/2013. Determinazione immunoenzimatica diretta del DHEA-S nella saliva.

DHEA-S SALIVA ELISA. per analisi di routine. DCM024-9 Ed. 08/2013. Determinazione immunoenzimatica diretta del DHEA-S nella saliva. DCM024-9 Ed. 08/2013 DHEA-S SALIVA ELISA Determinazione immunoenzimatica diretta del DHEA-S nella saliva. per analisi di routine IVD LOT Vedere etichetta esterna Σ = 96 test REF DKO024 DTINAZIONE D USO

Más detalles

TESTOSTERONE ELISA. per analisi di routine Determinazione immunoenzimatica diretta del Testosterone totale nel siero o plasma umano.

TESTOSTERONE ELISA. per analisi di routine Determinazione immunoenzimatica diretta del Testosterone totale nel siero o plasma umano. DCM002-9 Ed. 03/2012 TTOSTERONE ELISA per analisi di routine Determinazione immunoenzimatica diretta del Testosterone totale nel siero o plasma umano. IVD LOT Vedere etichetta esterna = 96 tests REF DKO002

Más detalles

IgA SALIVA ELISA. DCM078-7 Ed. 03/2012. Determinazione immunoenzimatica diretta della concentrazione di IgA nella saliva.

IgA SALIVA ELISA. DCM078-7 Ed. 03/2012. Determinazione immunoenzimatica diretta della concentrazione di IgA nella saliva. DCM078-7 Ed. 03/2012 IgA SALIVA ELISA per analisi di routine Determinazione immunoenzimatica diretta della concentrazione di IgA nella saliva. IVD LOT Vedere etichetta esterna Σ = 96 test REF DKO078 STINAZIONE

Más detalles

ANDROSTENEDIONE SALIVA ELISA Determinazione immunoenzimatica diretta dell Androstenedione nella saliva.

ANDROSTENEDIONE SALIVA ELISA Determinazione immunoenzimatica diretta dell Androstenedione nella saliva. DCM027-9 Ed. 03/2012 ANDROSTENEDIONE SALIVA ELISA Determinazione immunoenzimatica diretta dell Androstenedione nella saliva. per analisi di routine IVD LOT Vedere etichetta esterna = 96 test REF DKO027

Más detalles

17β ESTRADIOL ELISA Determinazione immunoenzimatica del 17β-Estradiolo nel siero o plasma umano.

17β ESTRADIOL ELISA Determinazione immunoenzimatica del 17β-Estradiolo nel siero o plasma umano. DCM003-10 Ed. 03/2012 17β TRADIOL ELISA Determinazione immunoenzimatica del 17β-Estradiolo nel siero o plasma umano. per analisi di routine LOT IVD IVDI VD DTINAZIONE D USO Metodo competitivo immunoenzimatico

Más detalles

AFP ELISA Determinazione immunoenzimatica diretta dell AFP nel siero o plasma umano

AFP ELISA Determinazione immunoenzimatica diretta dell AFP nel siero o plasma umano DCM012-11 Ed. 03/2012 AFP ELISA Determinazione immunoenzimatica diretta dell AFP nel siero o plasma umano per analisi di routine IVD LOT Vedere etichetta esterna = 96 test REF DKO012 STINAZIONE D USO Metodo

Más detalles

TESTOSTERONE SALIVA ELISA

TESTOSTERONE SALIVA ELISA DCM021-9 Ed. 12/2013 TTOSTERONE SALIVA ELISA Determinazione immunoenzimatica diretta del Testosterone nella saliva. per analisi di routine IVD LOT Vedere etichetta esterna Σ = 96 test REF DKO021 STINAZIONE

Más detalles

URINARY CORTISOL ELISA Determinazione immunoenzimatica del Cortisolo Urinario libero

URINARY CORTISOL ELISA Determinazione immunoenzimatica del Cortisolo Urinario libero DCM018-10 Ed. 03/2013 URINARY CORTISOL ELISA Determinazione immunoenzimatica del Cortisolo Urinario libero per analisi di routine IVD LOT Vedere etichetta esterna Σ = 96 test REF DKO018 DTINAZIONE D USO

Más detalles

Guía de Preparación de Muestras para PLASTICOS para el Software de Formulación de Datacolor

Guía de Preparación de Muestras para PLASTICOS para el Software de Formulación de Datacolor Guía de Preparación de Muestras para PLASTICOS para el Software de Formulación de Datacolor 1. Generalidades 2. Qué se necesita para comenzar? 3. Qué hacer para sistemas opacos y translúcidos? 4. Qué hacer

Más detalles

Enzyme immunoassay for the quantitative determination of Cortisol in human serum or plasma

Enzyme immunoassay for the quantitative determination of Cortisol in human serum or plasma Cortisol Enzyme immunoassay for the quantitative determination of Cortisol in human serum or plasma Inmunoensayo enzimático para la determinación cuantitativa de Cortisol en suero o plasma humano Only

Más detalles

PROGESTERONE SALIVA ELISA Determinazione immunoenzimatica diretta del Progesterone nella saliva.

PROGESTERONE SALIVA ELISA Determinazione immunoenzimatica diretta del Progesterone nella saliva. DCM025-10 Ed. 03/2012 PROGTERONE SALIVA ELISA Determinazione immunoenzimatica diretta del Progesterone nella saliva. per analisi di routine IVD LOT Vedere etichetta esterna = 96 test REF DKO025 DTINAZIONE

Más detalles

25OH Vitamin D. DCM146-2 Ed. 01/2014

25OH Vitamin D. DCM146-2 Ed. 01/2014 DCM146-2 Ed. 01/2014 25OH Vitamin D per analisi di routine Determinazione quantitativa immunoenzimatica della concentrazione di 25OH Vitamin D in siero e plasma umano LOT IVD See external label Σ = 96

Más detalles

Mercodia Ultrasensitive C-peptide ELISA

Mercodia Ultrasensitive C-peptide ELISA Mercodia Ultrasensitive C-peptide ELISA Instrucciones para el uso 10-1141-01 REACTIVOS PARA 96 DETERMINACIONES Para uso diagnóstico in vitro ATENCIÓN! Protocolo de actualización Fabricado por Mercodia

Más detalles

C-PEPTIDE (PÉPTIDO C) Determinación inmunoenzimática directa del nivel de péptido C en suero o plasma humano

C-PEPTIDE (PÉPTIDO C) Determinación inmunoenzimática directa del nivel de péptido C en suero o plasma humano C-PEI (PÉIDO C) Determinación inmunoenzimática directa del nivel de péptido C en suero o plasma humano IVD LOT Ver etiqueta externa Σ = 96 ensayos REF DKO077 USO PREVISTO El kit Péptido C es un método

Más detalles

per analisi di routine Determinazione immunoenzimatica diretta della triiodotironina (T3) nel siero o plasma umano Enz Ag + Ag + Ab cw

per analisi di routine Determinazione immunoenzimatica diretta della triiodotironina (T3) nel siero o plasma umano Enz Ag + Ag + Ab cw DCM044-9 Ed. 03/2012 T3 ELISA per analisi di routine Determinazione immunoenzimatica diretta della triiodotironina (T3) nel siero o plasma umano IVD LOT Vedere etichetta esterna Σ = 96 test REF DKO044

Más detalles

PROTEON TRIGO PROTEON WHEAT

PROTEON TRIGO PROTEON WHEAT Espacio para el men saje. Para causar un mayor impacto, escriba dos o tres frases. PROTEON TRIGO PROTEON WHEAT Título Test Inmunoenzimático para la Detección y Cuantificación de Proteína de Trigo Immunoenzymatic

Más detalles

CIC C1q ELISA. per analisi di routine Determinazione immunoenzimatica diretta del CIC C1q nel siero o plasma umano. DCM016-11 Ed.

CIC C1q ELISA. per analisi di routine Determinazione immunoenzimatica diretta del CIC C1q nel siero o plasma umano. DCM016-11 Ed. DCM016-11 Ed. 03/2012 CIC C1q ELISA per analisi di routine Determinazione immunoenzimatica diretta del CIC C1q nel siero o plasma umano. IVD LOT Vedere etichetta esterna = 96 test REF DKO016 STINAZIONE

Más detalles

TESTOSTERONE ELISA. per analisi di routine Determinazione immunoenzimatica diretta del Testosterone totale nel siero o plasma umano.

TESTOSTERONE ELISA. per analisi di routine Determinazione immunoenzimatica diretta del Testosterone totale nel siero o plasma umano. DCM002-10 Ed. 11/2013 TTOSTERONE ELISA per analisi di routine Determinazione immunoenzimatica diretta del Testosterone totale nel siero o plasma umano. IVD LOT Vedere etichetta esterna Σ = 96 tests REF

Más detalles

UNIVERSIDAD DE GUAYAQUIL FACULTAD DE ODONTOLOGÍA ESCUELA DE POSTGRADO Dr. José Apolo Pineda

UNIVERSIDAD DE GUAYAQUIL FACULTAD DE ODONTOLOGÍA ESCUELA DE POSTGRADO Dr. José Apolo Pineda UNIVERSIDAD DE GUAYAQUIL FACULTAD DE ODONTOLOGÍA ESCUELA DE POSTGRADO Dr. José Apolo Pineda EVALUACIÓN IN VITRO DE LA FILTRACIÓN APICAL EN RAICES DE DIENTES EXTRAIDOS, UTILIZANDO DOS MÉTODOS DE OBTURACION:

Más detalles

ESTRADIOL SALIVA ELISA Determinazione immunoenzimatica diretta dell Estradiolo nella saliva.

ESTRADIOL SALIVA ELISA Determinazione immunoenzimatica diretta dell Estradiolo nella saliva. DCM022-9 Ed. 03/2012 TRADIOL SALIVA ELISA Determinazione immunoenzimatica diretta dell Estradiolo nella saliva. per analisi di routine IVD LOT Vedere etichetta esterna = 96 test REF DKO022 STINAZIONE D

Más detalles

Control de Calidad en la Técnica de ELISA. Lic. Valentina Bastidas D.

Control de Calidad en la Técnica de ELISA. Lic. Valentina Bastidas D. Control de Calidad en la Técnica de ELISA Lic. Valentina Bastidas D. TÉCNICA DE ELISA DEFINICIÓN E L I S A Ensayo Inmunoabsorbente Ligado a Enzimas Enzime-Linked ImmunoSorbent Assay TIPOS DE ELISA: ELISA

Más detalles

Testosterone free ELISA

Testosterone free ELISA Product information Information about other products is available at: www.demeditec.com Userś Manual Testosterone free ELISA Direct immunoenzymatic determination of Free Testosterone in human serum or

Más detalles

INTERCAMBIABILIDAD. Adriana Martínez Martínez DIRECCIÓN EJECUTIVA DE AUTORIZACIÓN DE PRODUCTOS Y ESTABLECIMIENTOS. Dictaminadora Especializada

INTERCAMBIABILIDAD. Adriana Martínez Martínez DIRECCIÓN EJECUTIVA DE AUTORIZACIÓN DE PRODUCTOS Y ESTABLECIMIENTOS. Dictaminadora Especializada INTERCAMBIABILIDAD Adriana Martínez Martínez Dictaminadora Especializada DIRECCIÓN EJECUTIVA DE AUTORIZACIÓN DE PRODUCTOS Y ESTABLECIMIENTOS 1 PRUEBAS DE INTERCAMBIABILIDAD Prueba A. Buenas prácticas de

Más detalles

FUNDAMENTOS DE ANÁLISIS INSTRUMENTAL. 4ª RELACIÓN DE PROBLEMAS.

FUNDAMENTOS DE ANÁLISIS INSTRUMENTAL. 4ª RELACIÓN DE PROBLEMAS. FUNDAMENTOS DE ANÁLISIS INSTRUMENTAL. 4ª RELACIÓN DE PROBLEMAS. 1.- Para determinar el contenido en plomo en una muestra de leche contaminada, se toma 1.0 ml de la leche y se diluye a un volumen final

Más detalles

CARDIOCHEK y CARDIOCHEK P.A

CARDIOCHEK y CARDIOCHEK P.A CARDIOCHEK y CARDIOCHEK P.A NUEVA GENERACIÓN DE ANALIZADORES PORTÁTILES Introducción El Cardiochek y Cardiochek P.A son instrumentos portátiles que proporcionan medidas rápidas y precisas de múltiples

Más detalles

1. Sign in to the website, http://www.asisonline.org / Iniciar sesión en el sitio, http://www.asisonline.org

1. Sign in to the website, http://www.asisonline.org / Iniciar sesión en el sitio, http://www.asisonline.org Steps to Download Standards & Guidelines from the ASIS International Website / Pasos para Descargar los Standards & Guidelines de la Página Web de ASIS International 1. Sign in to the website, http://www.asisonline.org

Más detalles

TaqMan GMO Maize Quantification Kit. Part No: 4481972

TaqMan GMO Maize Quantification Kit. Part No: 4481972 TaqMan GMO Maize Quantification Kit Part No: 4481972 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan

Más detalles

CEA ELISA. per analisi di routine Determinazione quantitativa dell antigene Carcinoembriogenico (CEA) nel siero o plasma umano. DCM051-8 Ed.

CEA ELISA. per analisi di routine Determinazione quantitativa dell antigene Carcinoembriogenico (CEA) nel siero o plasma umano. DCM051-8 Ed. DCM051-8 Ed. 03/2012 CEA ELISA per analisi di routine Determinazione quantitativa dell antigene Carcinoembriogenico (CEA) nel siero o plasma umano IVD LOT Vedi etichetta esterna Σ = 96 test REF DKO051

Más detalles

Registro de Semilla y Material de Plantación

Registro de Semilla y Material de Plantación Registro de Semilla y Material de Plantación Este registro es para documentar la semilla y material de plantación que usa, y su estatus. Mantenga las facturas y otra documentación pertinente con sus registros.

Más detalles

Enzyme immunoassay for the quantitative determination of AFP in human serum or plasma

Enzyme immunoassay for the quantitative determination of AFP in human serum or plasma AFP Enzyme immunoassay for the quantitative determination of AFP in human serum or plasma Inmunoensayo enzimático para la determinación cuantitativa de AFP en suero o plasma humano Only for in-vitro diagnostic

Más detalles

Reutilización de aguas residuales urbanas depuradas

Reutilización de aguas residuales urbanas depuradas Reutilización de aguas residuales urbanas depuradas Grupo TC 10. Centro de Investigaciones de la Energía Solar UNIVERSIDAD DE ALMERÍA Reutilización de aguas residuales urbanas tratadas con fotofenton en

Más detalles

Anti TPO ELISA. per analisi di routine Determinazione quantitativa degli anticorpi contro la tiroperossidasi (TPO) nel siero o plasma umano

Anti TPO ELISA. per analisi di routine Determinazione quantitativa degli anticorpi contro la tiroperossidasi (TPO) nel siero o plasma umano DCM116-5 Ed. 03/2012 Anti TPO ELISA per analisi di routine Determinazione quantitativa degli anticorpi contro la tiroperossidasi (TPO) nel siero o plasma umano IVD LOT Vedere etichetta esterna Σ = 96 test

Más detalles

Curso Comparabilidad de resultados

Curso Comparabilidad de resultados Curso Comparabilidad de resultados Director: Gabriel A. Migliarino. Docente: Evangelina Hernández. Agenda Introducción. n. Protocolos iniciales de comparación de métodos. m * EP9-A2. CLSI. * Comparación

Más detalles

FCC Information : Warning: RF warning statement:

FCC Information : Warning: RF warning statement: FCC Information : This device complies with Part 15 of the FCC Rules. Operation is subject to the following two conditions: (1) This device may not cause harmful interference, and (2) This device must

Más detalles

CA125 ELISA Determinazione immunoenzimatica del CA-125 in siero o plasma umano

CA125 ELISA Determinazione immunoenzimatica del CA-125 in siero o plasma umano DCM054-8 Ed. 03/2012 CA125 ELISA Determinazione immunoenzimatica del CA-125 in siero o plasma umano per analisi di routine IVD LOT DTINAZIONE D USO Il kit Diametra CA-125 è un saggio immunoenziamtico colorimetrico

Más detalles

Héctor Colón, Ph.D. INEN 4530 / CHEM 4850 Universidad Inter Americana de Puerto Rico

Héctor Colón, Ph.D. INEN 4530 / CHEM 4850 Universidad Inter Americana de Puerto Rico Héctor Colón, Ph.D. INEN 4530 / CHEM 4850 Universidad Inter Americana de Puerto Rico Qué es un dispositivo médico? Implantes y equipo usado para obtener un diagnóstico, tratamiento médico, o prevención

Más detalles

17OH PROGESTERONE ELISA

17OH PROGESTERONE ELISA DCM004-8 Ed. 03/2012 17OH PROGTERONE ELISA per analisi di routine Determinazione immunoenzimatica diretta del 17OH Progesterone nel siero o plasma umano. IVD LOT See external label = 96 tests REF DKO004

Más detalles

per analisi di routine Determinazione immunoenzimatica diretta della tiroxina libera (FT4) nel siero o plasma umano Enz Ag + Ag + Ab cw

per analisi di routine Determinazione immunoenzimatica diretta della tiroxina libera (FT4) nel siero o plasma umano Enz Ag + Ag + Ab cw DCM038-10 Ed. 10/2013 FT4 ELISA per analisi di routine Determinazione immunoenzimatica diretta della tiroxina libera (FT4) nel siero o plasma umano IVD LOT Vedere etichetta esterna Σ = 96 test REF DKO038

Más detalles

J. Muestras 2015-871 - 2015-875 Proficiencia para Contaje de Espermatozoides.

J. Muestras 2015-871 - 2015-875 Proficiencia para Contaje de Espermatozoides. 5 de octubre de 2015 Laboratorios Participantes Laboratorios de Salud Pública De Puerto Rico Laboratorios de Salud Pública De Puerto Rico Laboratorios de Salud Pública de P.R. INSTRUCCIONES PARA LA PROFICIENCIA

Más detalles

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

b-hcg ELISA per analisi di routine Determinazione immunoenzimatica diretta della b-hcg nel siero o plasma umano. DCM Ed.

b-hcg ELISA per analisi di routine Determinazione immunoenzimatica diretta della b-hcg nel siero o plasma umano. DCM Ed. DCM014-10 Ed. 03/2012 b-hcg ELISA per analisi di routine Determinazione immunoenzimatica diretta della b-hcg nel siero o plasma umano. IVD LOT vedere etichetta esterna = 96 test REF DKO014 DTINAZIONE D

Más detalles

17OH PROGESTERONE SALIVA ELISA Determinazione immunoenzimatica diretta del 17OH Progesterone nella saliva

17OH PROGESTERONE SALIVA ELISA Determinazione immunoenzimatica diretta del 17OH Progesterone nella saliva DCM023-10 Ed. 03/2012 17OH PROGTERONE SALIVA ELISA Determinazione immunoenzimatica diretta del 17OH Progesterone nella saliva per analisi di routine IVD LOT Vedere etichetta esterna = 96 test REF DKO023

Más detalles

Exactitud y precisión del sistema Accu-Chek Performa. Introducción I. EXACTITUD. Método

Exactitud y precisión del sistema Accu-Chek Performa. Introducción I. EXACTITUD. Método Exactitud y precisión del sistema Accu-Chek Performa Introducción La exactitud del sistema se evaluó según la norma EN ISO 15197:2003 (Sistemas de ensayo para diagnóstico in vitro Requisitos para los sistemas

Más detalles

MANUAL EASYCHAIR. A) Ingresar su nombre de usuario y password, si ya tiene una cuenta registrada Ó

MANUAL EASYCHAIR. A) Ingresar su nombre de usuario y password, si ya tiene una cuenta registrada Ó MANUAL EASYCHAIR La URL para enviar su propuesta a la convocatoria es: https://easychair.org/conferences/?conf=genconciencia2015 Donde aparece la siguiente pantalla: Se encuentran dos opciones: A) Ingresar

Más detalles

Validación de métodos de ensayo

Validación de métodos de ensayo Validación de métodos de ensayo Validación verificación de que los requisitos especificados son adecuados para un uso determinado Ejemplo: Un procedimiento de medición ordinariamente usado para la medición

Más detalles

Volatilidad: Noviembre 2010 Futuros Frijol de Soya

Volatilidad: Noviembre 2010 Futuros Frijol de Soya Observaciones Junio 09, 2010 1. La volatilidad tiene una tendencia a aumentar de Junio a Julio. 2. Este reporte sugiere que se debería considerar la implementación de estrategias largas con opciones en

Más detalles

Control Estadístico de Parámetros de Calidad de la Yerba Mate Elaborada

Control Estadístico de Parámetros de Calidad de la Yerba Mate Elaborada Control Estadístico de Parámetros de Calidad de la Yerba Mate Elaborada WONIATCZUK, Mariela I.; ZIELKE, Liliana E; KOTIK, Adrián y SCHMALKO, Miguel E. Centro de Investigación y Desarrollo Tecnológico (CIDeT)

Más detalles

Validación y verificación de métodos de examen cuantitativos

Validación y verificación de métodos de examen cuantitativos Temas selectos de Calidad en Serología (aplicación en el banco de sangre) Validación y verificación de métodos de examen cuantitativos Ignacio Reyes Ramírez entidad mexicana de acreditación, a.c. Introducción

Más detalles

ELISA PeliClass human IgG subclass kit REF M1551

ELISA PeliClass human IgG subclass kit REF M1551 Sanquin Reagents Plesmanlaan 5 0 CX Amsterdam The Netherlands Phone: +.0.5.599 Fax: +.0.5.570 Email: reagents@sanquin.nl Website: www.sanquinreagents.com M55/ November 007 ELISA PeliClass human IgG subclass

Más detalles

TSH ELISA Determinazione immunoenzimatica del TSH in siero o plasma umano

TSH ELISA Determinazione immunoenzimatica del TSH in siero o plasma umano DCM013-9 Ed. 03/2012 TSH ELISA Determinazione immunoenzimatica del TSH in siero o plasma umano per analisi di routine IVD LOT Vedi etichetta esterna = 96 test REF DKO013 DTINAZIONE D USO Il kit Diametra

Más detalles

NycoCard CRP Single Test

NycoCard CRP Single Test NycoCard CRP Single Test ES DESCRIPCION DEL PRODUCTO Aplicaciones NycoCard CRP Single Test es un test de diagnóstico in vitro para medir de una forma rápida la proteína C reactiva (CRP) en la sangre humana.

Más detalles

1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de Quant- it PicoGreen dsaadnssay Kit (Invitrogen ).

1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de Quant- it PicoGreen dsaadnssay Kit (Invitrogen ). 1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de QuantiT PicoGreen dsaadnssay Kit (Invitrogen ). 2. Finalidad. El presente documento describe el Procedimiento Normalizado de

Más detalles

NTE INEN 344 Primera revisión 2014-XX

NTE INEN 344 Primera revisión 2014-XX Quito Ecuador NORMA TÉCNICA ECUATORIANA NTE INEN 344 Primera revisión 2014-XX BEBIDAS ALCOHÓLICAS DETERMINACIÓN DE FURFURAL DETERMINATION OF ALCOHOLIC BEVERAGES. FURFURAL DESCRIPTORES: Bebidas Alcohólicas,

Más detalles

DETERMINACIÓN DE GLUTEN EN ALIMENTOS PARA CELÍACOS INDICE

DETERMINACIÓN DE GLUTEN EN ALIMENTOS PARA CELÍACOS INDICE DETERMINACIÓN DE GLUTEN EN ALIMENTOS PARA CELÍACOS INDICE 1 Objetivo 2 2 Alcance 2 3 Desarrollo 2 4 Anexo 8 1.0. Objetivo Determinación de gluten en alimentos para celíacos. 2.0. Alcance Este método analítico

Más detalles

per analisi di routine Determinazione quantitativa degli anticorpi IgG contro il dsdna nel siero o plasma umano.

per analisi di routine Determinazione quantitativa degli anticorpi IgG contro il dsdna nel siero o plasma umano. DCM095-5 Ed. 03/2012 Anti dsdna IgG per analisi di routine Determinazione quantitativa degli anticorpi IgG contro il dsdna nel siero o plasma umano. IVD LOT Vedere etichetta esterna Σ = 96 test REF DKO095

Más detalles

a. Viva a más de 3 millas del centro de la ciudad dado que la persona cambiaria a transportación publica.

a. Viva a más de 3 millas del centro de la ciudad dado que la persona cambiaria a transportación publica. 1) Entre 150 personas que fueron encuestadas como parte de un estudio de transporte urbano masivo, algunos vivían a más de 3 millas del centro de la ciudad (A), algunos de ellos van en sus propios carros

Más detalles

TSH ELISA. DCM013-10 Ed. 01/2014. per analisi di routine. Determinazione immunoenzimatica del TSH in siero o plasma umano

TSH ELISA. DCM013-10 Ed. 01/2014. per analisi di routine. Determinazione immunoenzimatica del TSH in siero o plasma umano DCM013-10 Ed. 01/2014 TSH ELISA Determinazione immunoenzimatica del TSH in siero o plasma umano per analisi di routine IVD LOT Vedi etichetta esterna Σ = 96 test REF DKO013 DTINAZIONE D USO Il kit Diametra

Más detalles

Sistemas de impresión y tamaños mínimos Printing Systems and minimum sizes

Sistemas de impresión y tamaños mínimos Printing Systems and minimum sizes Sistemas de impresión y tamaños mínimos Printing Systems and minimum sizes Para la reproducción del Logotipo, deberán seguirse los lineamientos que se presentan a continuación y que servirán como guía

Más detalles

KMR SCA-05 Mounting Instructions Instrucción de Montaje Instruções de Montagem 0899.4897

KMR SCA-05 Mounting Instructions Instrucción de Montaje Instruções de Montagem 0899.4897 0899.4897 KMR SCA-05 Mounting Instructions Instrucción de Montaje Instruções de Montagem 0899.4897 KMR SCA-05 Mounting Instructions Instrucción de Montaje Instruções de Montagem The KMR SCA-05 kit is a

Más detalles

DETERMINACIÓN ESPECTROFOTOMÉTRICA DE KMnO 4, CuSO 4 y K 2 Cr 2 O 7

DETERMINACIÓN ESPECTROFOTOMÉTRICA DE KMnO 4, CuSO 4 y K 2 Cr 2 O 7 DETERMINACIÓN ESPECTROFOTOMÉTRICA DE KMnO 4, CuSO 4 y K 2 Cr 2 O 7 El objetivo de esta investigación es la determinación cuantitativa de la concentración de KMnO 4 en una muestra problema mediante espectroscopía

Más detalles

ICP FOREST / FUTMON 3rd Meeting of the Heads of the Laboratories

ICP FOREST / FUTMON 3rd Meeting of the Heads of the Laboratories mg/l Water Ring Test 2011 Range Na K Mg Ca 0 20 0 10 0 10 0-20 Spain Lab Range 1-20 1-40 1-20 1-40 INIA Lab Only measured ICP Forest samples During more than 15 years Knowledge of the ranges Water samples

Más detalles

CA19-9 ELISA Determinazione immunoenzimatica del CA19-9 in siero o in plasma umano

CA19-9 ELISA Determinazione immunoenzimatica del CA19-9 in siero o in plasma umano DCM056-8 Ed. 03/2012 CA19-9 ELISA Determinazione immunoenzimatica del CA19-9 in siero o in plasma umano per analisi di routine IVD LOT Vedi etichetta esterna Σ = 96 test REF DKO056 STINAZIONE D USO Metodo

Más detalles

2.5 Proceso de formación de los biofilms... 10 2.5.1 Fase de adhesión... 11 2.5.2 Fase de crecimiento... 11 2.5.3 Fase de separación... 12 2.

2.5 Proceso de formación de los biofilms... 10 2.5.1 Fase de adhesión... 11 2.5.2 Fase de crecimiento... 11 2.5.3 Fase de separación... 12 2. ÍNDICE GENERAL Pág. Carátula... i Aprobación por el jurado de tesis... ii Dedicatoria... iii Agradecimiento... iv Índice general... v Índice de cuadros... viii Índice de figuras... ix Índice de anexo...

Más detalles

CORTISOL SALIVA ELISA Determinazione immunoenzimatica diretta del Cortisolo nella saliva

CORTISOL SALIVA ELISA Determinazione immunoenzimatica diretta del Cortisolo nella saliva DCM020-9 Ed. 03/2013 CORTISOL SALIVA ELISA Determinazione immunoenzimatica diretta del Cortisolo nella saliva per analisi di routine IVD LOT Vedere etichetta esterna = 96 test REF DKO020 DTINAZIONE D USO

Más detalles

Save Money 2-up Single Doorhanger Set OH payday advance edition, 4 different doorhangers, Spanish

Save Money 2-up Single Doorhanger Set OH payday advance edition, 4 different doorhangers, Spanish Save Money 2-up Single Doorhanger Set OH payday advance edition, 4 different doorhangers, Spanish PACKAGE CONTENTS How to Customize 4-color doorhanger, Editable PDF (50% OFF first loan) 1-color (black)

Más detalles

Orden de domiciliación o mandato para adeudos directos SEPA. Esquemas Básico y B2B

Orden de domiciliación o mandato para adeudos directos SEPA. Esquemas Básico y B2B Orden de domiciliación o mandato para adeudos directos SEPA. Esquemas Básico y B2B serie normas y procedimientos bancarios Nº 50 Abril 2013 INDICE I. Introducción... 1 II. Orden de domiciliación o mandato

Más detalles

PROGESTERONE ELISA. per analisi di routine Determinazione immunoenzimatica diretta del Progesterone nel siero o plasma umano. DCM006-8 Ed.

PROGESTERONE ELISA. per analisi di routine Determinazione immunoenzimatica diretta del Progesterone nel siero o plasma umano. DCM006-8 Ed. DCM006-8 Ed. 03/2012 PROGTERONE ELISA per analisi di routine Determinazione immunoenzimatica diretta del Progesterone nel siero o plasma umano IVD LOT Vedere etichetta esterna = 96 tests REF DKO006 DTINAZIONE

Más detalles

SHBG. per analisi di routine Determinazione immunoenzimatica diretta della SHBG nel siero o plasma umano. DCM087-3 Ed. 03/2012

SHBG. per analisi di routine Determinazione immunoenzimatica diretta della SHBG nel siero o plasma umano. DCM087-3 Ed. 03/2012 DCM087-3 Ed. 03/2012 SHBG per analisi di routine Determinazione immunoenzimatica diretta della SHBG nel siero o plasma umano. IVD LOT Vedere etichetta esterna Σ = 96 test REF DKO087 STINAZIONE D USO Metodo

Más detalles

per analisi di routine Determinazione immunoenzimatica diretta di triiodotironina libera (FT3) nel siero o plasma umano.

per analisi di routine Determinazione immunoenzimatica diretta di triiodotironina libera (FT3) nel siero o plasma umano. DCM037-9 Ed. 03/2012 FT3 ELISA per analisi di routine Determinazione immunoenzimatica diretta di triiodotironina libera (FT3) nel siero o plasma umano. IVD LOT Vedere etichetta esterna = 96 tes REF DKO037

Más detalles

Certificado de Liberación de Lote de Producto Farmacéutico Fabricado para Exportación

Certificado de Liberación de Lote de Producto Farmacéutico Fabricado para Exportación Certificado de Liberación de Lote de Producto Farmacéutico Fabricado para Exportación Batch Release Certificate of Pharmaceutical Product Manufactured for Export El INSTITUTO NACIONAL DE MEDICAMENTOS,

Más detalles

New! Solvent-free The new MiniSystem is here... New cap design for easier sample collection!! New! New! 1. Ready to Use 2. One Step 3. Disposable 4. Closed Process 5. Save space and reagents 6. Fast Protocol

Más detalles

PCR a tiempo real. Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia

PCR a tiempo real. Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia PCR a tiempo real Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia PCR a tiempo real (PCRrt) Aplicaciones: - Cuantificación de ácidos nucleicos (AQ). - Estudio

Más detalles

Técnicas Avanzadas de Mantenimiento en Vestas. Jornadas Técnicas AEE Madrid, Septiembre 2012

Técnicas Avanzadas de Mantenimiento en Vestas. Jornadas Técnicas AEE Madrid, Septiembre 2012 Técnicas Avanzadas de Mantenimiento en Vestas Jornadas Técnicas AEE Madrid, Septiembre 2012 Estrategias de Mantenimiento Estrategias de Mantenimiento: Planificación y Control Planificación Mantenimiento

Más detalles

SIMILAC ADVANCE Mixing Instructions for Concentrating 20 calorie per ounce formula. To make 22, 24, 27, and 30 kcal/oz. formula

SIMILAC ADVANCE Mixing Instructions for Concentrating 20 calorie per ounce formula. To make 22, 24, 27, and 30 kcal/oz. formula SIMILAC ADVANCE Mixing Instructions for Concentrating 20 calorie per ounce formula To make 22, 24, 27, and 30 kcal/oz. formula Preparing 22 Calorie Per Ounce Formula From Powder (Using Similac Advance

Más detalles

TOUCH MATH. Students will only use Touch Math on math facts that are not memorized.

TOUCH MATH. Students will only use Touch Math on math facts that are not memorized. TOUCH MATH What is it and why is my child learning this? Memorizing math facts is an important skill for students to learn. Some students have difficulty memorizing these facts, even though they are doing

Más detalles

Dispositivos Lab-on-a-chip y ópticos para mediciones distribuidas con aplicaciones en biomedicina.

Dispositivos Lab-on-a-chip y ópticos para mediciones distribuidas con aplicaciones en biomedicina. UNIVERSIDAD NACIONAL DE INGENIERÍA FACULTAD DE CIENCIAS Sección de Posgrado y Segunda Especialización Profesional Dispositivos Lab-on-a-chip y ópticos para mediciones distribuidas con aplicaciones en biomedicina.

Más detalles

Creating your Single Sign-On Account for the PowerSchool Parent Portal

Creating your Single Sign-On Account for the PowerSchool Parent Portal Creating your Single Sign-On Account for the PowerSchool Parent Portal Welcome to the Parent Single Sign-On. What does that mean? Parent Single Sign-On offers a number of benefits, including access to

Más detalles

Pruebas serológicas para dengue

Pruebas serológicas para dengue Pruebas serológicas para dengue El 40% de la población mundial corre riesgo de infección por dengue Durante más de 25 años, Focus Diagnostics ha sido un líder en el desarrollo de ensayos inmunológicos

Más detalles

II. ANÁLISIS DE SISTEMAS DE MEDICIÓN

II. ANÁLISIS DE SISTEMAS DE MEDICIÓN II. ANÁLISIS DE SISTEMAS DE MEDICIÓN INTRODUCCIÓN Siempre que registramos o medimos los resultados de un proceso nos encontramos con cierta variación en los datos obtenidos. Esta variación puede provenir

Más detalles

Las pesas se utilizan para realizar pesajes con balanzas mecánicas y más frecuentemente para el ajuste y la comprobación de balanzas electrónicas. La Organización Internacional de Metrología Legal (OIML)

Más detalles

Calibración y control de calidad de instrumentos de análisis

Calibración y control de calidad de instrumentos de análisis Calibración y control de calidad de instrumentos de análisis cĺınico. María Cecilia San Román Rincón Monografía vinculada a la conferencia del Dr. Horacio Venturino sobre Instrumental para laboratorio

Más detalles

turbidez en los medios de cultivo. La duración de la prueba de esterilidad es de 14 días. Las pruebas de toxicidad (específica y general), llamadas

turbidez en los medios de cultivo. La duración de la prueba de esterilidad es de 14 días. Las pruebas de toxicidad (específica y general), llamadas Para que una prueba se considere validada deberá cumplir los requisitos siguientes: Precisión: es la variación de los resultados de acuerdo a la desviación estándar o al coeficiente de variación. Exactitud:

Más detalles

Enzyme immunoassay for the quantitative determination of Progesterone in human saliva

Enzyme immunoassay for the quantitative determination of Progesterone in human saliva Progesterone Saliva Enzyme immunoassay for the quantitative determination of Progesterone in human saliva Inmunoensayo enzimático para la determinación cuantitativa de Progesterona en saliva humana Only

Más detalles

SEPARACIÓN DE ALUMINIO A PARTIR DE MATERIAL DE DESECHO

SEPARACIÓN DE ALUMINIO A PARTIR DE MATERIAL DE DESECHO Actividad Experimental SEPARACIÓN DE ALUMINIO A PARTIR DE MATERIAL DE DESECHO Investigación previa 1.- Investigar las medidas de seguridad que hay que mantener al manipular KOH y H SO, incluyendo que acciones

Más detalles

Los ensayos que se van a desarrollar son los siguientes:

Los ensayos que se van a desarrollar son los siguientes: I Resumen El objetivo principal del proyecto es desarrollar un software que permita analizar unos datos correspondientes a una serie de ensayos militares. Con este objetivo en mente, se ha decidido desarrollar

Más detalles

ID. Number: 40-01 Su Seguridad y Salud al Soldar o Cortar / Your Safety and Health When Welding or Cutting

ID. Number: 40-01 Su Seguridad y Salud al Soldar o Cortar / Your Safety and Health When Welding or Cutting CATEGORIA 40 SOLDADURA/WELDING ID. Number: 40-01 Su Seguridad y Salud al Soldar o Cortar / Your Safety and Health When Welding or Cutting Produced: Publication date: Literacy level: Appropriate for: OHSP

Más detalles

CA 15-3 ELISA Determinazione immunoenzimatica del CA 15-3 nel siero o plasma umano

CA 15-3 ELISA Determinazione immunoenzimatica del CA 15-3 nel siero o plasma umano DCM055-9 Ed. 03/2012 CA 15-3 ELISA Determinazione immunoenzimatica del CA 15-3 nel siero o plasma umano per analisi di routine IVD LOT Vedi etichetta esterna Σ = 96 test REF DKO055 DTINAZIONE D USO Metodo

Más detalles

Integrantes: Andrés Felipe Cárdenas Álvarez 2101302 Diana Katherine Carreño Moyano 2100993 Lorena Duarte Peña 2100968. Grupo: 4

Integrantes: Andrés Felipe Cárdenas Álvarez 2101302 Diana Katherine Carreño Moyano 2100993 Lorena Duarte Peña 2100968. Grupo: 4 PRÁCTICA 8. DETERMINACIÓN DE CALCIO Y MAGNESIO EN UN LÁCTEO, LECHE ENTERA PARMALAT Integrantes: Andrés Felipe Cárdenas Álvarez 2101302 Diana Katherine Carreño Moyano 2100993 Lorena Duarte Peña 2100968

Más detalles

PROCEDIMIENTO DE CONTROL DE DOPING: ORINA

PROCEDIMIENTO DE CONTROL DE DOPING: ORINA PROCEDIMIENTO DE CONTROL DE DOPING: ORINA INTERNATIONAL RUGBY BOARD PROCEDIMIENTO DE CONTROL DE DOPING: ORINA El Control de Doping juega un papel esencial en la promoción y protección del Rugby libre de

Más detalles

Sistemas de información de laboratorio

Sistemas de información de laboratorio Sistemas de información de laboratorio Version 3.0, April 2009 2008 Pharmaceutical Product Development, Inc. Todos los derechos reservados. Sistemas de información de laboratorio También llamados SIL En

Más detalles

SEPARACIÓN DE PROTEÍNAS POR CROMATOGRAFÍA DE EXCLUSIÓN MOLECULAR

SEPARACIÓN DE PROTEÍNAS POR CROMATOGRAFÍA DE EXCLUSIÓN MOLECULAR SEPARACIÓN DE PROTEÍNAS POR CROMATOGRAFÍA DE EXCLUSIÓN MOLECULAR INTRODUCCION La cromatografía es una técnica que permite la separación de moléculas diferentes presentes en una misma muestra. El método

Más detalles

Sierra Security System

Sierra Security System Using Your SpreadNet Accessories With Your Sierra Security System Uso de Sus Accesorios SpreadNet Con Su Sistema de Seguridad Sierra SN990-KEYPAD SN961-KEYFOB SN991-REMOTE 1 SN990-KEYPAD The SN990-KEYPAD

Más detalles

CRITERIOS ESPECÍFICOS PARA EVALUAR LA INCERTIDUMBRE EN PROCESOS DE MEDICIÓN EN LABORATORIOS QUIMICOS

CRITERIOS ESPECÍFICOS PARA EVALUAR LA INCERTIDUMBRE EN PROCESOS DE MEDICIÓN EN LABORATORIOS QUIMICOS Página 1 de 6 TITULO: CRITERIOS ESPECIFICOS PARA EVALUAR LA INCERTIDUMBRE DE UN PROCESO DE MEDICIÓN EN LABORATORIOS QUÍMICOS Resumen: El presente documento contiene los criterios en lo referente a la evaluación

Más detalles

Quantikine IVD ELISA. Inmunoensayo Epo Humano Manual de Instrucciones suplementario. Referencia DEP00

Quantikine IVD ELISA. Inmunoensayo Epo Humano Manual de Instrucciones suplementario. Referencia DEP00 Quantikine IVD ELISA Inmunoensayo Epo Humano Manual de Instrucciones suplementario Referencia DEP00 Este manual de instrucciones incluye el protocolo del ensayo y debe leerse en su totalidad antes de comenzar

Más detalles

Cortisol Urinario Inmunoensayo enzimático para la determinación cuantitativa de Cortisol en Orina humano Para uso In Vitro únicamente

Cortisol Urinario Inmunoensayo enzimático para la determinación cuantitativa de Cortisol en Orina humano Para uso In Vitro únicamente 1 Cortisol Urinario Inmunoensayo enzimático para la determinación cuantitativa de Cortisol en Orina humano Para uso In Vitro únicamente Número del Producto: DNOV010 (96 Determinaciones) 2 CONTENIDO 1.

Más detalles

HERRAMIENTAS ESTADÍSTICAS PARA. Luis Valenzuela Tecnologo Medico, Magister ISO15189, UNAB, Chile Product Manager Sistemas de gestion de la calidad

HERRAMIENTAS ESTADÍSTICAS PARA. Luis Valenzuela Tecnologo Medico, Magister ISO15189, UNAB, Chile Product Manager Sistemas de gestion de la calidad HERRAMIENTAS ESTADÍSTICAS PARA CONTROL DE CALIDAD Luis Valenzuela Tecnologo Medico, Magister ISO15189, UNAB, Chile Product Manager Sistemas de gestion de la calidad QUE CALCULAMOS? Son necesarios algunos

Más detalles