Save this PDF as:

Tamaño: px
Comenzar la demostración a partir de la página:



1 EXPRESION DEL GEN CYP1A1 HEPATICO DE TILAPIA COMO BIOINDICADOR DE CONTAMINACION ACUATICA EN 2 LAGUNAS COSTERAS NORVERACRUZANAS Pablo SAN MARTIN 1,2, Luisa C. R. HERNANDEZ 3, Humberto GARZA 4, Graciela GARCIA 1*, Omar ZAPATA 5 y Arturo ORTEGA 3. 1 Facultad de Ciencias Biológicas, Universidad Autónoma de Nuevo León, San Nicolás de los Garza, Nuevo León. 2 Facultad de Ciencias Biológicas y Agropecuarias, Universidad Veracruzana-Tuxpan, carretera Tuxpan-Tampico, Km. 7.5, Tuxpan, Veracruz, 3 Depto. de Genética y Biología Molecular, Cinvestav- Zacatenco, Apdo. postal México, D.F., 4 ALS-Indequim, Monterrey, Nuevo León, 5 Depto. de Recursos del Mar, Cinvestav-Mérida, Km 6 Antigua Carretera a Progreso, Cordemex, 97310, Mérida, Yucatán. *Av. Pedro de Alba s/n, Facultad de Ciencias Biológicas/UANL (Jefatura de Alimentos), San Nicolás de los Garza, Nuevo León; Tel: 01 (81) , Palabras clave: PAH; HTP; mrna; sedimentos, Oreochromis niloticus RESUMEN Se determinó la concentración de Hidrocarburos Aromáticos Policíclicos (HAP) e Hidrocarburos Totales del Petróleo (HTP) en sedimentos, agua y organismos de dos lagunas costeras veracruzanas y evaluó la capacidad de los extractos de sedimentos para inducir la expresión del CYP1A1 en la tilapia (Oreochromis niloticus), como bioindicador de contaminación. El área de estudio incluyó las lagunas costeras de Tamiahua y Tampamachoco en el norte del estado de Veracruz, para cada laguna se establecieron 6 estaciones, se realizaron muestreos preliminares y definitivos de: sedimento, agua y organismos bajo la metodología propuesta por la EPA 823B95001, Se optimizó la extracción, concentración y purificación de HAP y HTP, para los análisis se utilizaron los métodos EPA y EPA 8270 respectivamente y para organismos el método EPA En ambas lagunas y en todas las muestras los HAP se situaron por debajo del límite de detección, mientras que los HTP fueron registrados en los sedimentos de la estación 4 y 5 con y mg/kg de HTP en Tamiahua y para Tampamachoco en la estación 5 y 6 con 97 y 204 mg/kg de HTP. Por ello se elaboraron extractos de sedimentos de las estaciones 4, 5 y 2 de la laguna de Tamiahua con contaminación alta, moderada y baja respectivamente; los mismos se inyectaron intraperitonealmente a tilapias, al término de 24 h, los organismos fueron sacrificados y disectados para obtener los hígados y fueron analizados por RT-PCR para determinar los niveles del mrna CYP1A1, se encontró que los peces tratados con extractos de sedimentos de la estación 4 presentaron un incremento significativo en más de 16 veces respecto al control (aceite de maíz), mientras que los peces de las estaciones 2 y 5 presentaron un incremento de 5 veces. El incremento significativo del mrna hepático en tilapias expuestas a 1

2 extractos de sedimentos sugiere que la inducción del CYP1A1 puede ser utilizada como herramienta para el monitoreo de HTP en ecosistemas acuáticos. INTRODUCCIÓN Entre los ecosistemas costeros del país sobresalen por diversas causas, las lagunas costeras, las cuales están catalogadas como los ecosistemas que poseen las más elevadas tasas de productividad conocidas, tanto primaria como secundaria, además son áreas utilizadas comúnmente para la protección, alimentación y reproducción de muchos organismos marinos, por lo que gran número de pesquerías litorales, como la mayoría de las especies de camarón, dependen de la conservación de estos ecosistemas; por pequeñas que sean, mantienen una vida particular en su interior y generalmente son sitios donde la biodiversidad asociada es un atributo muy importante (Contreras y Castañeda, 2004). El petróleo es un insumo estratégico para la economía mundial, pues es la principal fuente de energía en el mundo. Por su importancia en la economía, el petróleo es un producto codiciado y se invierten grandes cantidades de recursos en su búsqueda, extracción y refinación (Gold, 2000). Por otra parte, las mayores pesquerías del mundo se concentran en áreas con una alta productividad biológica, como son las zonas costeras. En algunas partes del mundo, éstas comparten su alta productividad con las actividades de la industria petrolera, tal es el caso de México, donde la producción del petróleo en la plataforma continental alcanza volúmenes considerables. Por ello, las pesquerías del área estarán sujetas a una contaminación crónica y a derrames de petróleo intermitentes por muchos años (Vázquez y Páez, 1987). La contaminación de suelos y aguas con compuestos derivados de la actividad petrolera, se ha convertido en un problema en gran número de sitios de explotación, refinación y almacenamiento de hidrocarburos. Se estima que 1.6 millones de barriles ( l) se derraman anualmente en el mar, que representa aproximadamente el 0.1 % del consumo mundial por año (Internacional Oil Spill Statistic, 1999; OECD, 1991, en Fernández 2003). Volke y Velasco 2002 mencionan que en México dentro de los compuestos peligrosos más comúnmente involucrados en emergencias ambientales entre 1997 y 1999 se encuentran el petróleo y sus derivados (gasolina, combustóleo, diesel), agroquímicos, gas LP y natural, y que dentro de los contaminantes considerados prioritarios debido a su alta toxicidad y a su persistencia en el ambiente se incluyen entre otros a los hidrocarburos poliaromáticos (HAP), los cuales se encuentran como componentes de los hidrocarburos totales del petróleo (HTP). Los organismos marinos pueden ser utilizados como bioindicadores e integradores de la calidad de agua en los ecosistemas marinos, debido a que proveen de información útil acerca del potencial de biomagnificación en la cadena alimenticia (Peña et al.1996), además se sabe que HAP, bifenilos policlorados (PCBs), dioxinas, etc. estimulan la expresión de varios miembros de la superfamilia de genes del citocromo P450, particularmente de la familia CYP1A (Rees et al. 2003). Actualmente, la inducción del CYP1A en peces es analizada de manera rutinaria 2

3 en diferentes laboratorios alrededor del mundo y ha sido incorporada a varios programas de vigilancia internacionales como NOAA (Nacional Oceanic and Atmospheric Administration). Por otra parte, una combinación de las mediciones de la inducción del CYP1A junto con otros bioindicadores, pueden dar una señal de alerta temprana sobre los efectos que puedan causar los contaminantes en los organismos expuestos y en los ecosistemas. MATERIALES Y METODOS El área de estudio (figura 1) incluye las lagunas costeras de Tampamachoco y Tamiahua en el norte del Estado de Veracruz, ubicadas en la porción occidental de las costas del Golfo de México entre las coordenadas 20º 18 y 21º 02 latitud norte, 97º 19 y 97º 22 longitud este con un área aproximada de 1,500 Hectáreas para Tampamachoco; 21º 06 y 21º 20 latitud norte, 97º 23 y 97º 46 longitud este con un área de 88,000 Hectáreas para Tamiahua (Contreras y Castañeda, 1995) Se prospectó el área de estudio, se elaboró el plan y se realizaron los muestreos con la metodología propuesta por EPA 823B95001, Para cada laguna se establecieron 6 estaciones, el punto exacto de la estación fue registrado con un sistema de posicionamiento global (GPS). Los sedimentos y organismos fueron colectados durante los meses de enero y marzo del 2002 en Tampamachoco y en marzo y octubre del 2003 en Tamiahua. De cada estación, sedimentos superficiales a una profundidad de 0-5 cm fueron colectados con una draga de acero inoxidable y colocados en frascos de vidrio de boca ancha, las muestras fueron colocadas in situ en hielo y posteriormente transferidas en almacenamiento a -20ºC hasta el análisis. 10 gr de sedimento fueron sometidos a extracción con soxhlet durante 16 hrs con hexano grado analítico, los extractos fueron concentrados a 2 ml utilizando un aparato Kuderna-Danish (K-D) siguiendo el método EPA 3540C. La cuantificación del PAH en las muestras fue realizada con un cromatógrafo de gases (GC) Hewlett Packard HP-5890 series II, con interfaz a un detector selectivo de masas (MS) HP 5971 y una columna capilar HP-5 MS, 30 m X 0.25 mm i.d. (0.25 μm film). Las temperaturas programadas fueron 30ºC 290ºC (a una tasa de 7ºC/min), la temperatura fue de 250ºC para el inyector y 280ºC para el detector. Se utilizó Helio como gas acarreador (flujo 1 ml/min). El MS fue operado en modo scanning de 35 a 550 uma. 2 μl de muestra fueron inyectados y el análisis se realizó de acuerdo al método EPA 8270 C. Peces, camarones, ostras y jaibas fueron colectadas frescas con la ayuda de pescadores de la región. Después de la colecta, las muestras fueron colocadas en bolsas de papel aluminio protegidas adentro de un frasco de vidrio y congeladas a -70ºC hasta el análisis. Únicamente músculo de cada especie fue analizado individualmente. Las muestras fueron homogeneizadas utilizando diclorometano (100 ml) y sometidas a extracción en soxhlet por 24 hr. Los extractos de cada especie fueron purificados utilizando columnas de vidrio para remover los lípidos co-extraídos. La cuantificación de los PAH se utilizando un equipo HPLC siguiendo el método EPA

4 La extracción de HTP se realizó utilizando el método EPA modificado, el solvente fue vertido a la muestra y se agitó vigorosamente por 2 minutos para realizar la extracción. Se dejó reposar para permitir la separación de las capas, la del solvente se filtró a un matraz volumétrico de 100 ml con un embudo y papel filtro. Los lavados se repitieron 2 ó más veces con otros 30 ml de solvente fresco y recuperando todo en el matraz, finalmente se aforó a 100 ml y la muestra fue leída en un espectrofotómetro de infrarrojo a una longitud de onda de 2950 cm -1. La cuantificación de los HTP se realizó con la ecuación de una curva de calibración de absorbancia contra concentración en mg/l de una mezcla de hexadecano, isooctano, clorobenceno y aceite de referencia. Figura 1. Mapa del área de estudio mostrando la localización de las estaciones de muestreo en las lagunas de Tamiahua y Tampamachoco, Veracruz. Para determinar el efecto de HAP y HTP sobre la expresión del CYP1A como bioindicador de contaminación se seleccionaron 3 estaciones de muestreo solamente de la laguna de Tamiahua, correspondientes a San Jerónimo, Boca de Tancochín y Salto el Tigre previamente caracterizadas por presentar alta, moderada y baja contaminación por HAP y HTP respectivamente. Para ello 10 g de sedimento (n=6) de las estaciones de fueron sometidos a extracción por 4

5 Soxhlet durante 16 h y los extractos fueron concentrados por K-D a 5 ml, el resto del solvente fue evaporado completamente bajo atmósfera de nitrógeno. La mezcla de residuos orgánicos resultante fue reconstituida con 1 ml de aceite de maíz en un sonicador Branson (modelo 2510) por 2 h a 60ºC. 12 peces (4 por tratamiento) fueron inyectados intraperitonealmente (IP) con los extractos de sedimentos a una dosis de 100 μl del extracto por cada 100 g de peso del pez y 4 peces fueron inyectados solamente con aceite de maíz, los cuales fueron utilizados como control. Los peces tratados con extracto de sedimentos y con aceite de maíz, fueron sacrificados 24 h después de la inyección. Cada pez fue disectado para extraerle el hígado, el cual fue inmediatamente colocado en nitrógeno líquido y posteriormente almacenado en ultracongelación a 70 ºC para su posterior análisis. El método utilizado para la extracción de RNA total es el descrito por Chomczynski y Sacchi (1987), los hígados de tilapia (Oreochromis niloticus) fueron homogeneizados en mortero y nitrógeno líquido en presencia del isotiocianato de guanidina, una solución 4 M de β-mercaptoetanol, sarcosil al 0.6%, citrato de sodio al 0.5% (solución D, ph 7). Para la cuantificación del RNA extraído, 1 μl de RNA total fue diluido en 499 μl de agua estéril libre de RNAasas, la cuantificación del RNA total se realizó en un espectrofotómetro Beckman DU 640 UV/VIS (260, 280, 260/280 y 280/260 nm). La tasa resultante entre la absorción de 260/280 fluctuó entre 1.75 a 2.0. Adicionalmente la integridad del RNA se verificó electroforéticamente, para ello se colocaron aproximadamente 1-3 μl de RNA total por carril en un gel de agarosa al 1.5%, previamente teñido con bromuro de etidio para observar las bandas de RNA con un transiluminador Biometra TI 3. A partir del RNA total, el mrna presente en cada muestra fue convertido a cdna en una reacción de volumen final de 20 μl, que contenía 0.5 μg de Oligo (dt), RNA muestra (2 μg) y como componentes adicionales 5X first strand buffer, cloruro de magnesio (MgCl 2 ) 50 mm, 0.1 M DTT y la enzima M-MLVRT Moloney Murine Leukemia Virus Reverse Transcriptase (200 u, Gibco BRL), la reacción fue incubada a 37 ºC durante 1 hora. El cdna elaborado previamente (2 μl) se utilizó en conjunto con los oligonucleótidos para realizar las reacciones de PCR, además de 100 mm dntps (incluyendo los 4 desoxinucleótidos), 10 pmol de cada oligonucleótido y 0.05 u/μl de Taq DNA polimerasa (Thermus aquaticus, Gibco BRL-Life Technologies, Rockville MD) y como componentes adicionales: Buffer 10X PCR y MgCl 2 50 mm. Las amplificaciones del mrna CYP1A fueron llevadas a cabo en un termociclador PTC-100 MJ Research, bajo las siguientes condiciones: desnaturalización (1 min a 95 ºC), alineamiento (1 min a 58 ºC) y elongación (1 min a 72 ºC), durante 36 ciclos, además de una incubación final a 72 ºC por 7 min. Los productos de PCR fueron resueltos junto con un marcador de peso molecular de 100 pares de bases (pb) por electroforesis en geles de agarosa al 1.5% y teñidos en bromuro de etidio. Las imágenes fotográficas fueron obtenidas del gel con luz ultravioleta (UV), colocando el gel en un transiluminador Biometra TI 3. El volumen total de las bandas (densidad óptica OD x mm) de los productos amplificados fueron 5

6 calculados mediante el software Kodak Digital Science EDAS 120 System Densitometer (Eastman Kodak, CO, Rochester, N.Y.). RESULTADOS Y DISCUSION En el presente trabajo se encontró que las concentraciones individuales de los HAP en muestras de sedimentos de la laguna de Tamiahua estuvieron situadas por debajo del límite de detección de 1 mg/kg; lo que contrasta con los valores observados por Botello y Calva (1998), en un trabajo realizado en la misma laguna en el año de En dicho trabajo se reporta que para la estación 4 (Cabo Rojo) se encontraron valores de 1.01, 1.95 y 4.08 para fluoreno, pireno y benzo(a) antraceno respectivamente. En el presente estudio, la estación correspondiente es la estación 3, del mismo nombre, donde los valores fueron inferiores a aquellos para los mismos HAP. Otras estaciones con presencia de HAP reportadas por los mismos autores son la estación 2 y 6 donde se encontró para la primera estación 1.40 y 1.02 μg/g para pireno y benzo(a)antraceno respectivamente; mientras que para la última 1.02 y 1.63 μg/g para pireno e indeno; sin embargo en esta última (Estero Cucharas) fue la única estación donde se detectó benzo(a)pireno con un valor de 0.46 μg/g. Del presente estudio, las estaciones más próximas a las anteriormente mencionadas corresponden a las estaciones 1 (Punta Arenas) y 2 (Salto El Tigre) en las cuales no se detectaron valores superiores de 1 mg/kg para cada HAP individual. Al igual que para Tamiahua, en la laguna de Tampamachoco, las concentraciones de HAP individuales en las muestras de sedimentos estuvieron situadas por debajo del límite de detección de 1 mg/kg, dichos valores son inferiores a los que reporta Botello y Calva (1998) para la misma laguna, por ejemplo, los autores mencionan que en la estación 3 (Frente a la Termoeléctrica) encontraron valores de 1.62, 4.81 y 1.13 μg/g para pireno, benzo(a)antraceno y benzo(k)fluoranteno respectivamente, y es la única estación en esta laguna en donde se encontró un valor de 0.42 μg/g para Benzo(a)pireno. En el presente estudio las estaciones más próximas a la anterior son estación 2 (Banda Mar Norte) y estación 4 (Banda Mar Sur), en las cuales no se detectó valores superiores al límite de detección. Bajo este esquema, las concentraciones de HAP individuales en muestras de agua de las estaciones de muestreo, analizadas en ambas lagunas también se situaron por debajo del límite de detección de mg/l, dichos valores guardan concordancia a los valores encontrados en las muestras de sedimentos, que también fueron bajos. Una de las principales causas a las que se puede atribuir los bajos valores de HAP en el presente estudio es a que en el mes de octubre del año de 1999, en el área de estudio se produjo la peor inundación ocurrida en los últimos 50 años, donde grandes masas de agua y sedimentos fueron aportadas a las lagunas de Tamiahua y Tampamachoco, Veracruz y que las muestras al ser de sedimentos recientes y superficiales, las mismas estarían presumiblemente no contaminadas, que fue lo que se presentó este estudio. 6

7 Respecto a los HTP en las muestras de sedimentos de la laguna de Tamiahua, la mayoría de las estaciones mostraron concentraciones inferiores al límite de detección de 50 mg/kg (tabla I), excepto la estación 4 (San Jerónimo) y estación 5 (Boca Tancochín), donde se encontraron 2, y mg/kg de HTP. Los valores de HTP registrados en el presente estudio están principalmente relacionados de manera directa e indirectamente con actividades de la industria petrolera, ya que cercana a la estación 4 se encuentra un área de 20 Hectáreas denominado pozo Dos Bocas, el cual fue explotado a principios de 1900 y que actualmente se encuentra abandonado, sin embargo, en el mismo hay emanaciones naturales que hoy en día es incosteable explotar y que por tal razón principalmente en época de lluvias al incrementarse el nivel de crudo desborda, vertiendo y aportando hidrocarburos a la laguna en este sitio. En Boca Tancochín, los aportes de HTP, puede ser atribuida a la existencia de líneas de conducción (ductos) que transportan crudo de mar a tierra y que al sufrir ruptura vierten crudo al sistema lagunar en este sitio. Tabla I. Concentración de HTP (mg/kg) determinado en sedimentos de las lagunas de Tamiahua y Tampamachoco, Veracruz. LAGUNA DE TAMPAMACHOCO LAGUNA DE TAMIAHUA E S T A C I O N E S E S T A C I O N E S 1 *2 3 *4 * <50 <50 < <50 <50 < <50 En Tampamachoco, sólo las estaciones 5 (Torres) y 6 (Tubito) presentaron valores de 97 y 204 mg/kg de HTP (tabla I). Éstos valores pueden explicarse por la cercanía (aproximadamente 1 km) con el muelle de PEMEX, donde atracan barcos los cuales muy posiblemente transportan crudo y que además por las actividades de limpieza vierten el agua de lastre a este lugar, por lo que sin duda este sitio puede ser un lugar de carga o descarga y por ende de introducción de petróleo, que al ubicarse frente a la boca de la laguna y por la acción de las corrientes, los hidrocarburos son transportados hacia el interior. Considerando que no existe para estos contaminantes, límites máximos permisibles en sedimentos (marinos, de ríos, lagos, lagunas costeras) afectados por hidrocarburos, se tomó como referencia la normatividad establecida para suelos, Norma Oficial Mexicana (NOM) de Emergencia NOM-EM-138-ECOL-2002 (uso: agrícola, forestal, recreativo y de conservación residencial y comercial; en ppm) que establece un máximo de 200 a 1,000 mg/kg (ppm). Para el caso de la laguna de Tamiahua, sólo la estación 4 (San Jerónimo) fue la que sobrepasó en más del doble el límite máximo permisible con un valor de 2, mg/kg de HTP (tabla 21); mientras que para Tampamachoco, fue la estación 6 (tubito), la que presentó un valor de 200 mg/kg de HTP (tabla I), todas las demás estaciones en ambas lagunas presentaron valores situados por debajo del límite máximo 7

8 permisible establecido en la NOM. Las concentraciones de HTP en las muestras de agua, presentaron valores inferiores al límite de detección de 5 mg/l. En el presente estudio se analizaron especies de importancia económica de peces, crustáceos y moluscos, mismas que constituyen un alimento importante para las comunidades locales y que además son comercializadas en los principales mercados de la región e incluso de la ciudad de México. El hecho que ninguna de las especies analizadas de ambas lagunas presentaran valores superiores al límite de detección de mg/kg, guarda lógica, toda vez que valores no detectables de HAP se presentaron en las muestras de sedimentos y muestras de agua. Aunque el ostión americano es una especie abundante en ambas lagunas y la misma es utilizada como indicador biológico debido a su capacidad de bioacumular una gran variedad de contaminantes del agua y de los sedimentos, en el presente trabajo concentraciones indetectables de HAP fueron encontradas en estos organismos en ambas lagunas. Por su parte Krahn et al., (1984) reportó que en análisis de rutina de HAP (pares) en peces capturados en áreas contaminadas, frecuentemente muestren sólo trazas de HAP, aún cuando los sedimentos contengan altas concentraciones de estos compuestos; lo anterior descrito apoyaría a los resultados encontrados en el presente trabajo, ya que al encontrar bajos valores de HAP en sedimentos, se esperaría por ende bajos o nulos valores de los mismos en las especies bajo el análisis. En el presente estudio el análisis de HAP se realizó sólo en tejido del muscular y para peces es necesario considerar diferentes órganos y tejidos ya que Al Hassan et al., (2003) no detectó ningún HAP individual tal como el benzo(a)pireno entre músculo, branquia e hígado en peces comestibles provenientes de áreas contaminadas del Mar de Arabia. Aunque son relativamente pocos los trabajos realizados utilizando al mrna CYP1A1 como bioindicador de contaminación, en ellos se ha observado un incremento en los niveles de expresión del gen. Similares resultados fueron encontrados en el presente estudio, donde una fuerte inducción del CYP1A1 causó un incrementó significativo (p< 0.01) de más de 17 veces respecto al control en los niveles de mrna CYP1A1 hepático, 24 h después de que los peces fueron inyectados intraperitonealmente (IP) con extractos de sedimentos de la estación 4 (San Jerónimo) de la laguna de Tamiahua, una expresión moderada de 5 veces más se observó para los peces inyectados con extractos de la estación 5 (Boca Tancochín) y estación 2 (Salto El Tigre), mientras que una débil expresión se observó en los peces control (figura 2). Un patrón similar fue observado por Wong et al., 2001, quienes observaron que la más alta expresión del mrna del CYP1A1 hepático y del intestino en peces tratados con extractos de los sedimentos costeros de las estaciones más contaminadas por HAP y PCBs del área de Hong Kong y mencionan que en estudios ecotoxicológicos es esencial el uso de métodos químicos y biológicos. 8

9 Figura 2. Gráfico de columnas que muestra la cuantificación de la expresión del gen CYP1A1 mrna (n=4). Las columnas con un mismo número de asteriscos no son significativamente diferentes (p< 0.05) comparadas con el control, de acuerdo a los resultados del ANOVA (one way) seguida de una comparación múltiple de medias con rangos de Dunnet. CONCLUSIONES Los resultados de este estudio muestran que no existe contaminación evidente por Hidrocarburos Aromáticos Policíclicos en los sedimentos, muestras de agua y en tejido de algunas especies explotadas y de interés comercial en las lagunas costeras de Tamiahua y Tampamachoco, Veracruz; durante el período en el que se desarrolló el presente trabajo. En este trabajo se detectaron Hidrocarburos Totales del Petróleo en los siguientes sitios: 2,637 mg/kg de HTP en la estación 4 (San Jerónimo) y mg/kg de HTP en la estación 5 (Boca Tancochín) en la laguna de Tamiahua y 204 mg/kg de HTP en la estación 6 (Tubito) en la laguna de Tampamachoco. 9

10 Los extractos de sedimentos de San Jerónimo, Boca Tancochín y Salto El Tigre, tuvieron la capacidad de inducir la expresión del mrna del CYP1A1 en la tilapia (Orechromis niloticus). La más elevada expresión del mrna del CYP1A1 correspondió a San Jerónimo, que también fue la estación con la concentración más alta de HTP. El incremento significativo del mrna del CYP1A1 hepático en tilapias expuestas a extractos de sedimentos, sugieren que la inducción del CYP1A1 puede ser una herramienta para el monitoreo de HTP en ecosistemas acuáticos. REFERENCIAS Al-Hassan JM, Afzal M, Rao CVN, Fayad S (2003). Polycyclic aromatic hydrocarbons (PAHs) and aliphatic hydrocarbons (AHs) in edible fish from the Arabian Gulf. Bull. Environ. Contam. Toxicol. 70: Botello AV y Calva BL (1998). Polycyclic aromatic hydrocarbons in sediments from Pueblo Viejo, Tamiahua and Tampamachoco lagoons in the southern Gulf of Mexico. Bull. Environ. Contam. Toxicol. 60: Contreras EF y Castañeda LO (1995). Los ecosistemas costeros del Estado de Veracruz. Gobierno del Estado de Veracruz y Secretaria de Desarrollo Agropecuario, Forestal y Pesquero, 144 p. Contreras EF y Castañeda LO (2004). La biodiversidad de las lagunas costeras. Ciencias 76: EPA, 823B95001 (1995) QA/QC guidance for sampling and analysis of sediments water and tissue for dredged material evaluations - chemical evaluations. Available from: URL: Fernández LL. (2003). Biorremediación y atenuación natural de sitios contaminados con hidrocarburos. p En: Galan W. L., Elías S. M., Tamez G. P., Quintero R. R. y Quintero Z. I. (eds). Procesos Biotecnológicos. Universidad Autónoma de Nuevo León. Gold BG. (2000). El petróleo: características e impacto ambiental. En: Petróleo, medio ambiente y sociedad, Ramírez CA, Gold BG, Florencia GJ, Durán GR, Trejo TJ, Olmsted I, Juun-Qui VM, Morales AL (eds). Senado de la República, 107 p. Krahn MM, Myers MS, Burrows DG, Malin DC (1984). Determination of metabolites of xenobiotics in the bile of fish from polluted waterways. Xenobiotic 14: Rees CB, McCormick SD, Vanden-Heuvel JP, Li W (2003) Quantitative PCR analysis of CYPIA induction in Atlantic salmon (Salmo salar). Aquat Toxicol 62:67-78 Vázquez BA y Páez F El problema crucial: la contaminación. Ecodesarrollo, 180 p Volke ST, Velasco TJ (2002) Tecnología de remediación para suelos contaminados. INE-SEMARNAT, 64 p Wong CKC, Yeung HY, Woo PS, Wong MH (2001) Specific expression of cytochrome P4501A1 gene in gill, intestine and liver of tilapia exposed to coastal sediments. Aquat Toxicol 54:


ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles

Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala

Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala IICA/Red SICTA-CIAT INFORME DE AVANCE Gerardo Gallego - Harold

Más detalles


CROMATOGRAFÍA DE GASES ACOPLADO A UN DETECTOR DE MASAS GC/MS CROMATOGRAFÍA DE GASES ACOPLADO A UN DETECTOR DE MASAS GC/MS La cromatografía es una técnica para separar las sustancias químicas que se basa en las diferencias en conductas partitivas de una fase móvil

Más detalles

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN.

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. PROGRAMA CONTROL DE CALIDAD DE MUESTRAS El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. El programa completo de control de calidad de muestras de ADN y ARN engloba diferentes

Más detalles

FLS -SUV LiDAR para embarcaciones

FLS -SUV LiDAR para embarcaciones FLS -SUV LiDAR para embarcaciones Objetivos QUIÉNES SOMOS? VIXIA SYSTEM es una empresa destinada a desarrollar actividades en torno a sistemas de visualización y evaluación de variables ambientales, sistemas

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

3. Principios de medición de la calidad del aire

3. Principios de medición de la calidad del aire 3. Principios de medición de la calidad del aire 3.1. Medición. Medir es contar, comparar una unidad con otra, dar una valoración numérica, asignar un valor, asignar números a los objetos. Todo lo que

Más detalles

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR Módulo 1 Amplificación de un fragmento de ADN genómico por PCR En este primer módulo se amplificará por PCR, mediante el uso de oligonucleótidos específicos, un fragmento de ADN genómico de Aspergillus

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. info@atgen.com.uy www.atgen.com.uy

Más detalles

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles

Se trabajó con jugo de zanahorias obtenidas de tres fuentes diferentes elegidas al azar

Se trabajó con jugo de zanahorias obtenidas de tres fuentes diferentes elegidas al azar 5. METODOLOGIA Se trabajó con jugo de zanahorias obtenidas de tres fuentes diferentes elegidas al azar (supermercado, mercado de San Pedro Cholula y tienda de verduras). Revisando la bibliografía se encontraron

Más detalles

Gestión medioambiental integral de antigua planta de desgasificación y limpieza de buques

Gestión medioambiental integral de antigua planta de desgasificación y limpieza de buques COMUNICACIÓN TÉCNICA Gestión medioambiental integral de antigua planta de desgasificación y limpieza de buques Autor: Juan Pérez García de Prado Institución: Desotermia e-mail: jperez@emgrisa.es Otros

Más detalles


5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN 5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN Materiales - Eppendorf de 1,5 ml estériles - Eppendorf de pared fina para PCR - Puntas de pipeta estériles desechables - Guantes

Más detalles



Más detalles

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico.

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. AQUAGESTION ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. Noviembre 2011 ACTUALIDAD Este año Sernapesca confirma

Más detalles


5. MATERIALES Y MÉTODOS 5. MATERIALES Y MÉTODOS 5.1 Equipos Los siguientes termocicladores se emplearon para la amplificación por PCR: - Perkin Elmer, GeneAmp PCR System 2400. - Perkin Elmer, GeneAmp PCR System 9600. - Applied

Más detalles

Laboratorio de Métodos Instrumentales I. Práctica No. 1 Determinación de fósforo en bebidas de cola por Espectrofotometría UV- Vis.

Laboratorio de Métodos Instrumentales I. Práctica No. 1 Determinación de fósforo en bebidas de cola por Espectrofotometría UV- Vis. Laboratorio de Métodos Instrumentales I Práctica No. 1 Determinación de fósforo en bebidas de cola por Espectrofotometría UV- Vis Equipo 1 Candy Lara Rentería Jessica Torres Gámez Salón 1 Mérida, Yucatán

Más detalles

GPA2286: Análisis extendido para Gas Natural y Mezclas Gaseosas similares por Cromatografía de Gases de Temperatura programada

GPA2286: Análisis extendido para Gas Natural y Mezclas Gaseosas similares por Cromatografía de Gases de Temperatura programada GPA2286: Análisis extendido para Gas Natural y Mezclas Gaseosas similares por Cromatografía de Gases de Temperatura programada Tiempo de análisis inferior a 30 minutos Alta sensibilidad, linealidad, exactitud

Más detalles

Cuantificación de Clorofila a

Cuantificación de Clorofila a Cuantificación de Clorofila a Clorofilas Las clorofilas son una familia de pigmentos de color verde que se encuentran en las cianobacterias y en todos aquellos organismos que contienen cloroplastos en

Más detalles

Fuente: Capacidad instalada de proceso. Estadísticas mensuales básicas de diciembre 2009 y Subdirección de Producción.

Fuente: Capacidad instalada de proceso. Estadísticas mensuales básicas de diciembre 2009 y Subdirección de Producción. Complejos procesadores de gas Pemex Gas cuenta con diez complejos procesadores de gas. De ellos, ocho están ubicados en la región sur-sureste del país (Chiapas, Tabasco y Veracruz) y dos en la región noreste

Más detalles

11.1- Descripción breve de los laboratorios especializados del Posgrado en Ciencias (Ciencias Biológicas).

11.1- Descripción breve de los laboratorios especializados del Posgrado en Ciencias (Ciencias Biológicas). 11.1- Descripción breve de los laboratorios especializados del Posgrado en Ciencias (Ciencias Biológicas). UNIDAD DE BIOQUÍMICA Y BIOLOGÍA MOLECULAR DE PLANTAS ESPACIOS Y EQUIPOS COMUNES La Unidad de Bioquímica

Más detalles

TaqMan GMO Maize Quantification Kit. Part No: 4481972

TaqMan GMO Maize Quantification Kit. Part No: 4481972 TaqMan GMO Maize Quantification Kit Part No: 4481972 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan

Más detalles

2. Redes de Medición de la Calidad del Aire

2. Redes de Medición de la Calidad del Aire 2. Redes de Medición de la Calidad del Aire Una red de medición de la calidad del aire es parte de un Sistema de Medición de Calidad del aire, SMCA. Es importante mencionar que un SMCA puede incluir una

Más detalles



Más detalles

Materiales para la secuenciación de ADN

Materiales para la secuenciación de ADN Introduccion La Secuenciación Sanger es un método de secuenciación de ADN en el que el ADN diana se desnaturaliza y se hibrida con un cebador de oligonucleótidos, que se extiende entonces gracias a la

Más detalles


DANAGENE RNA PURIFICATION KIT DANAGENE RNA PURIFICATION KIT REF.0801.1 100 EXTRACCIONES REF.0801.2 500 EXTRACCIONES 1.INTRODUCCION Este kit permite la permite la obtención de ARN total a partir de cultivos celulares, tejidos animales,

Más detalles

Hidrosfera. 1) En las aguas epicontinentales se incluyen el mar Caspio, el Aral y el mar Muerto, además de lagos, ríos, etc.

Hidrosfera. 1) En las aguas epicontinentales se incluyen el mar Caspio, el Aral y el mar Muerto, además de lagos, ríos, etc. Hidrosfera Formación Cuando la Tierra se fue formando, hace unos 4600 millones de años, las altas temperaturas hacían que toda el agua estuviera en forma de vapor. Al enfriarse por debajo del punto de

Más detalles



Más detalles



Más detalles


FUNDAMENTOS DE ANÁLISIS INSTRUMENTAL. 4ª RELACIÓN DE PROBLEMAS. FUNDAMENTOS DE ANÁLISIS INSTRUMENTAL. 4ª RELACIÓN DE PROBLEMAS. 1.- Para determinar el contenido en plomo en una muestra de leche contaminada, se toma 1.0 ml de la leche y se diluye a un volumen final

Más detalles



Más detalles

Determinación de sorbato potásico y benzoato sódico en alimentos por HPLC

Determinación de sorbato potásico y benzoato sódico en alimentos por HPLC Determinación de sorbato potásico y benzoato sódico en alimentos por HPLC Apellidos, nombre Fuentes López, Ana (anfuelo@upv.es) García Martínez, Eva (evgarmar@tal.upv.es) Fernández Segovia, Isabel (isferse1@tal.upv.es

Más detalles

Técnicas de Biología Molecular

Técnicas de Biología Molecular Técnicas de Biología Molecular DNA I. Enzimas de restricción Análisis Las enzimas de restricción fueron aisladas de bacterias; su función natural es proteger contra DNA extraño II. Separación electroforética

Más detalles


III. METODOLOGÍA EXPERIMENTAL III. METODOLOGÍA EXPERIMENTAL 3.1 Análisis Previos Se utilizaron los filtros con muestra de partículas suspendidas en el aire PM 10 que el Instituto Municipal de Ecología (IME) proporcionó para llevar

Más detalles

Muestreo 1, 1A 15, 15 A. Emisiones Atmosféricas

Muestreo 1, 1A 15, 15 A. Emisiones Atmosféricas Muestreo Emisiones Atmosféricas AAIR Environmental posee un laboratorio de fuentes fijas acreditado ante la SEREMI de Salud, y además, posee convenios por análisis con laboratorios locales que se encuentran

Más detalles

CAPÍTULO VI. Expresión de genes relacionados con apoptosis

CAPÍTULO VI. Expresión de genes relacionados con apoptosis CAPÍTULO VI Expresión de genes relacionados con apoptosis 1.- Introducción 2.- Protocolos para análisis genéticos 3.- Resultados en MCF-7 4.- Discusión 1.- Introducción Como se ha descrito anteriormente,

Más detalles

Control de balanza analítica. Medida de masa

Control de balanza analítica. Medida de masa Control de balanza analítica Medida de masa Objetivo Identificar aspectos críticos y fundamentales en uso adecuado de las balanzas analíticas. Establecer una metodología practica para desarrollar un cronograma

Más detalles

Sacha 94. Texaco taponó el pozo junto con su trabajo de remediación

Sacha 94. Texaco taponó el pozo junto con su trabajo de remediación Sacha 94 Pag 7 foja 46293. 2do párrafo. ( ). La perforación del pozo SA-94 se completó en mayo de 1981. Antes del proyecto de remediación por Texpet, el sitio denominado SA-94 consistía de un cabezal del

Más detalles


CALCULO DE CONCENTRACIONES DE AGENTES QUÍMICOS 1 CALCULO DE CONCENTRACIONES DE AGENTES QUÍMICOS El objetivo prioritario y fundamental de la Higiene Industrial es la prevención de las enfermedades profesionales originadas por los agentes contaminantes

Más detalles

Especialmente recomendado para: El regadío y los Embalses de los Campos de


Más detalles

4027 Síntesis de 11-cloroundec-1-eno a partir de 10-undecen-1- ol

4027 Síntesis de 11-cloroundec-1-eno a partir de 10-undecen-1- ol 4027 Síntesis de 11-cloroundec-1-eno a partir de 10-undecen-1- ol OH SOCl 2 Cl + HCl + SO 2 C 11 H 22 O C 11 H 21 Cl (170.3) (119.0) (188.7) (36.5) (64.1) Clasificación Tipos de reacción y clases de productos

Más detalles



Más detalles

GAS NATURAL. 1 Qué es? 2 Cómo se formó?

GAS NATURAL. 1 Qué es? 2 Cómo se formó? GAS NATURAL Educadores Contenidos 1. Qué es?........................................ 1 2. Cómo se formó?................................... 1 3. Cómo se extrae?................................... 1 4.

Más detalles

CROMATOGRAFÍA DE GASES APLICADA A ANÁLISIS DE GRASAS. Mª Luisa Fernández de Córdova Universidad de Jaén

CROMATOGRAFÍA DE GASES APLICADA A ANÁLISIS DE GRASAS. Mª Luisa Fernández de Córdova Universidad de Jaén CROMATOGRAFÍA DE GASES APLICADA A ANÁLISIS DE GRASAS CROMATOGRAFÍA DE GASES 1. Técnicas analíticas de separación: Cromatografía 2. Cromatografia de Gases: Fundamento, parámetros, instrumento 3. Columnas

Más detalles

UNIDAD 4. Reparto entre dos disolventes. Separaciones por Extracción

UNIDAD 4. Reparto entre dos disolventes. Separaciones por Extracción UNIDAD 4 Reparto entre dos disolventes. Separaciones por Extracción Introducción En los análisis químicos es necesario, después de la toma de muestra y su disolución en el disolvente adecuado, aislar el

Más detalles

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml)

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml) PCR SIMULADA Ref.PCR Simulada (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles


DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082 Página 1 de 5 1. OBJETIVO Detectar la presencia de Campylobacter jejuni en hamburguesa de pollo mediante técnica de PCR. 2. CAMPO DE APLICACIÓN Y ALCANCE Aplicar este procedimiento a muestras de hamburguesa

Más detalles

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa?

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa? 2º BIOQUÍMICA CUESTIONES 1. Por qué la PCR convencional no es cuantitativa? En la PCR convencional, la cuantificación del ADN de la muestra es complicada debido a que la eficacia de amplificación va disminuyendo

Más detalles

III. Materiales y métodología. III-1. Materiales

III. Materiales y métodología. III-1. Materiales III. Materiales y métodología III-1. Materiales III-1.1 Agua El agua utilizada para la preparación de las soluciones fue agua purificada (Millipore) con una resistividad de 18.3MΩcm -1 y cuya conductividad

Más detalles



Más detalles

Hidrógeno, una solución más segura para el laboratorio. tell me more

Hidrógeno, una solución más segura para el laboratorio. tell me more Hidrógeno, una solución más segura para el laboratorio tell me more Generadores o botellas de H 2? Gráfico 4: Diseño del purificador y de la válvula BIP Los generadores de hidrógeno pueden ser una opción

Más detalles


FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

Bioquímica III- 2009

Bioquímica III- 2009 Facultad de Ciencias Exactas, Universidad Nacional de La Plata Bioquímica III- 2009 Trabajo Práctico Nro 4 Extracción de RNA y DNA bacteriano INTRODUCCIÓN El RNA es el ácido nucleico más abundante en la

Más detalles


DETERMINACIÓN DEL FACTOR Rh por PCR Ref.PCRRh DETERMINACIÓN DEL FACTOR Rh por PCR 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles


MEDICIÓN Y ANÁLISIS DE CONTAMINANTES DEL AIRE CAPÍTULO 8 MEDICIÓN Y ANÁLISIS DE CONTAMINANTES DEL AIRE Fuente: National Geographic - Noviembre 2000 INTRODUCCIÓN La medición de los contaminantes sirve para varias funciones tales como: Provee un criterio

Más detalles



Más detalles


ELECTROFORESIS AVANZADA Ref.ELECAVANZADA (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO ELECTROFORESIS AVANZADA El objetivo de este experimento es introducir a los alumnos en el conocimiento de la teoría electroforética y familiarizarse

Más detalles


DETERMINACIÓN DE PATULINA EN JUGOS DE MANZANA Extracción líquido-líquido Página 1 de 9 1. OBJETIVO Detectar y cuantificar la presencia de la micotoxina patulina en jugos de manzana. 2. CAMPO DE APLICACIÓN Y ALCANCE El método es aplicable a los jugos y concentrados de manzana.

Más detalles


BENTLEY BactoCount IBC BENTLEY BactoCount IBC Características del equipo El BactoCount IBC es un equipo automático para contar rápido e individualmente las bacterias de la leche cruda. Capacidad: de 50 hasta 150 muestras / hora.

Más detalles

Nitrógeno. El Nitrógeno, Útil en Todas las Operaciones Petroleras. tecnología

Nitrógeno. El Nitrógeno, Útil en Todas las Operaciones Petroleras. tecnología Por: Ing. Leopoldo López Marín, Director Servicios Especializados de Nitrógeno, Cryoinfra. Nitrógeno El Nitrógeno, Útil en Todas las Operaciones Petroleras Actualmente el nitrógeno es empleado en perforación,

Más detalles



Más detalles

Directrices Técnicas

Directrices Técnicas Determinación del Contenido del Alcaloide de Cocaína en Hoja de Coca Determinación de la pureza de la cocaína en productos intermedio y final Análisis cualitativo de la hoja de coca y productos de cocaína

Más detalles


CAPÍTULO 4 DESARROLLO EXPERIMENTAL CAÍTUL 4 DEALL EXEIMETAL 4.1 Generalidades Los reactivos utilizados en las reacciones fueron de marca Aldrich. El desarrollo de las reacciones y los productos de reacción se siguió por medio de cromatografía

Más detalles

5 Materiales y Métodos

5 Materiales y Métodos 5 Materiales y Métodos Los tejidos de Cenchurs ciliaris utilizados en esta investigación fueron obtenidos por pretratamiento con H 2 SO 4 al 0.15 M, a 135ºC, para eliminar la hemicelulosa. Con los tejidos

Más detalles


www.autoexactomexico.com Análisis de los gases de escape de los motores de combustión interna El presente artículo explica los fundamentos básicos del análisis de gases de escape de un motor de combustión interna. Del resultado

Más detalles

El ININ desarrolla la Sonda Monitor de Contaminantes Atmosféricos (SOMCAT)

El ININ desarrolla la Sonda Monitor de Contaminantes Atmosféricos (SOMCAT) El ININ hoy El ININ desarrolla la Sonda Monitor de Contaminantes Atmosféricos (SOMCAT) Por A. Vilchis Pineda (aevp@nuclear.inin.mx ), B. Hernández Méndez (bhm@nuclear.inin.mx), N. Cruz Ortiz (nestor@nuclear.inin.mx),

Más detalles

Las cubetas para espectrofotometría Zuzi son instrumentos de gran precisión con una relación calidad/precio inmejorable. Pueden ser empleadas con gran variedad de espectrofotómetros y colorímetros, atendiendo

Más detalles



Más detalles

PCR. Técnica inventada por Kary Mullis :1987. Premio Nobel 1993. Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN

PCR. Técnica inventada por Kary Mullis :1987. Premio Nobel 1993. Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN PCR PCR Técnica inventada por Kary Mullis :1987 Premio Nobel 1993 Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN Aprovecha los requerimientos de la replicación Templete ADN Nucleótidos

Más detalles

INTRODUCCIÓN A LA METODOLOGÍA MOLECULAR. 2002 `Derechos Reservados Pontificia Universidad Javeriana Instituto de Genética Humana Bogotá COLOMBIA

INTRODUCCIÓN A LA METODOLOGÍA MOLECULAR. 2002 `Derechos Reservados Pontificia Universidad Javeriana Instituto de Genética Humana Bogotá COLOMBIA INTRODUCCIÓN A LA METODOLOGÍA MOLECULAR 2002 `Derechos Reservados Pontificia Universidad Javeriana Instituto de Genética Humana Bogotá COLOMBIA Equipos de Laboratorio Un equipo de laboratorio es un conjunto

Más detalles



Más detalles

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a Introducción Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a los investigadores verificar la expresión de una proteína, determinar la cantidad relativa

Más detalles

METODOLOGIA. A. Colección de muestras de agua:

METODOLOGIA. A. Colección de muestras de agua: CUARTA PARTE BIOMASA FOTOTROFOS: CLOROFILAS LA BIOMASA DE FITOPLANCTON puede ser estimada determinando la concentración de pigmentos fotosintéticos en una muestra de agua. Midiendo la concentración de

Más detalles



Más detalles



Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles



Más detalles

CEM: Digestión y extracción por microondas Mars 6 y Discover SP-D. Dpto. de laboratorio. VERTEX Technics 93 223 33 33 www.vertex.

CEM: Digestión y extracción por microondas Mars 6 y Discover SP-D. Dpto. de laboratorio. VERTEX Technics 93 223 33 33 www.vertex. VERTEX Technics 93 223 33 33 www.vertex.es CEM: Digestión y extracción por microondas Mars 6 y Discover SP-D Dpto. de laboratorio Mars 6: Digestión de 40 muestras en paralelo. Discover SP-D: Digestión

Más detalles

PROCEDIMIENTO PARA DETERMINACIÓN DE SODIO, POTASIO y CALCIO EN ALIMENTOS. Método Espectrofotometría de Absorción Atómica de llama. Método AOAC 985.

PROCEDIMIENTO PARA DETERMINACIÓN DE SODIO, POTASIO y CALCIO EN ALIMENTOS. Método Espectrofotometría de Absorción Atómica de llama. Método AOAC 985. Página 1 de 8 1. OBJETIVO Determinar la concentración de sodio, potasio y calcio en muestras de alimentos con bajo contenido de grasa. 2. CAMPO DE APLICACIÓN Y ALCANCE El método es aplicable a alimentos

Más detalles

Normalización de soluciones de NaOH 0,1N y HCl 0,1N.

Normalización de soluciones de NaOH 0,1N y HCl 0,1N. Laboratorio N 1: Normalización de soluciones de NaOH 0,1N y HCl 0,1N. Objetivos: - Determinar la normalidad exacta de una solución de hidróxido de sodio aproximadamente 0,1 N, utilizando biftalato de potasio

Más detalles


APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS Prácticas docentes en la COD: 10-71 APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS FUNDAMENTO TEÓRICO La PCR es una técnica que permite llevar a cabo la síntesis in vitro de fragmentos de ADN. Está basada

Más detalles

RESULTADOS Y DISCUSIÓN. Estimación de la Concentración Proteica del Filtrado de Cultivo de Mycobacterium tuberculosis H37Rv

RESULTADOS Y DISCUSIÓN. Estimación de la Concentración Proteica del Filtrado de Cultivo de Mycobacterium tuberculosis H37Rv RESULTADOS Y DISCUSIÓN Estimación de la Concentración Proteica del Filtrado de Cultivo de Mycobacterium tuberculosis H37Rv La curva estándar con la que se estimó la concentración proteica del filtrado

Más detalles

Práctico: Genética bacteriana 2007.

Práctico: Genética bacteriana 2007. Práctico: Genética bacteriana 2007. Actividad integrada Departamento de Genética Departamento de Bacteriología y Virología. OBJETIVOS Objetivos generales El estudiante al terminar la actividad práctica

Más detalles



Más detalles

Romero-Hernández, Carlos; Martínez-Gallegos, Sonia; García-Rosales, Genoveva

Romero-Hernández, Carlos; Martínez-Gallegos, Sonia; García-Rosales, Genoveva Uso de carbón activado reciclado en barreras permeables para disminuir la materia orgánica en los lixiviados del vertedero del municipio de Mexicaltzingo Romero-Hernández, Carlos; Martínez-Gallegos, Sonia;

Más detalles

SAFEYE XENON 700. Detección de hidrocarburos y etileno. Ópticas térmicas. Garantía de 10 años para la lámpara destellante de xenón

SAFEYE XENON 700. Detección de hidrocarburos y etileno. Ópticas térmicas. Garantía de 10 años para la lámpara destellante de xenón SAFEYE XENON 700 Detección de hidrocarburos y etileno Ópticas térmicas Garantía de 10 años para la lámpara destellante de xenón SIL 2 conforme a IEC 61508 SISTEMA DE DETECCIÓN DE GAS DE CAMINO ABIERTO

Más detalles

Reacción en cadena de la polimerasa (PCR)

Reacción en cadena de la polimerasa (PCR) Dr. Alejandro Leal Reacción en cadena de la polimerasa (PCR) La reacción en cadena de la polimerasa (PCR, por sus siglas en inglés de "polymerase chain reaction") es un método de amplificación in vitro

Más detalles

Caracterización de la composición acídica del aceite de híbridos tradicionales de girasol

Caracterización de la composición acídica del aceite de híbridos tradicionales de girasol 2012- Año de homenaje al Dr. D. Manuel Belgrano" Instituto Nacional de Tecnología Agropecuaria Ministerio de Agricultura, Ganadería y Pesca INFORME PRELIMINAR Caracterización de la composición acídica

Más detalles



Más detalles

Debe garantizarse y prevenirse de la imposibilidad de llegar a disponer en el interior del garaje de una atmósfera potencialmente explosiva.

Debe garantizarse y prevenirse de la imposibilidad de llegar a disponer en el interior del garaje de una atmósfera potencialmente explosiva. DOSSIER VENTILACION Ante los diferentes criterios suscitados, previos a la aplicación que el vigente Reglamento Electrotécnico de Baja Tensión, Decreto 842/2002 de 2 de agosto, en concreto a la Instrucción

Más detalles

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri OBJETIVO Desarrollar un banco de datos a partir de plantas de origen indudable y del uso

Más detalles



Más detalles

CICLO 2 : Fraccionamiento subcelular

CICLO 2 : Fraccionamiento subcelular Curso de Fisicoquímica Biológica 2006 Licenciatura de Bioquímica. Facultad de Ciencias. CICLO 2 : Fraccionamiento subcelular OBJETIVOS GENERALES: 1) Obtención de preparados enriquecidos en fracciones subcelulares

Más detalles

Clonación molecular. Clonar significa hacer copias idénticas

Clonación molecular. Clonar significa hacer copias idénticas INGENIERÍA GENÉTICA Clonación molecular Clonar significa hacer copias idénticas Este término originalmente fue aplicado al procedimiento de aislar una célula y permitirle reproducirse creando una población

Más detalles

Rosamil Rey, Ph.D. CHEM 4160

Rosamil Rey, Ph.D. CHEM 4160 Rosamil Rey, Ph.D. CHEM 4160 Los métodos analíticos se pueden clasificar en: Métodos Clásicos Métodos Instrumentales Métodos Clásicos Precipitación Extracción Destilación Medidas gravimétricas Medidas

Más detalles

Practica la genética Ficha didáctica del profesorado Bachillerato

Practica la genética Ficha didáctica del profesorado Bachillerato Ficha didáctica del profesorado Bachillerato www.eurekamuseoa.es Extracción de ADN Cuál es la función de cada uno de los ingredientes utilizados para realizar la disolución tampón para la visualización

Más detalles

Radiación solar en ambientes acuáticos

Radiación solar en ambientes acuáticos Radiación solar en ambientes acuáticos Fuente energía (PP) Calentamiento superficies Influencia fuerte en procesos biológicos y ecológicos Superficie UV Violeta Azul Verde Amarillo Naranja Rojo IR 5 m

Más detalles

UOP 603-13: Análisis de Trazas de CO y CO2 en H2 e Hidrocarburos Gaseosos Ligeros por GC

UOP 603-13: Análisis de Trazas de CO y CO2 en H2 e Hidrocarburos Gaseosos Ligeros por GC UOP 603-13: Análisis de Trazas de CO y CO2 en H2 e Hidrocarburos Gaseosos Ligeros por GC Análisis Rápido en

Más detalles



Más detalles