11 Número de publicación: Int. Cl. 7 : A61K 45/ Agente: Curell Suñol, Marcelino

Tamaño: px
Comenzar la demostración a partir de la página:

Download "11 Número de publicación: 2 229 792. 51 Int. Cl. 7 : A61K 45/06. 74 Agente: Curell Suñol, Marcelino"

Transcripción

1 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: Int. Cl. 7 : A61K 4/06 A61P 31/00 12 TRADUCCIÓN DE PATENTE EUROPEA T3 86 Número de solicitud europea: Fecha de presentación: Número de publicación de la solicitud: Fecha de publicación de la solicitud: Título: Composición y método de quimioterapia. Prioridad: US 1119 P US 1273 P 73 Titular/es: Bioniche Life Sciences Inc. 383 Sovereign Road London, Ontario N6M 1A3, CA 4 Fecha de publicación de la mención BOPI: Inventor/es: Phillips, Nigel, C. y Filion, Mario, C. 4 Fecha de la publicación del folleto de la patente: Agente: Curell Suñol, Marcelino ES T3 Aviso: En el plazo de nueve meses a contar desde la fecha de publicación en el Boletín europeo de patentes, de la mención de concesión de la patente europea, cualquier persona podrá oponerse ante la Oficina Europea de Patentes a la patente concedida. La oposición deberá formularse por escrito y estar motivada; sólo se considerará como formulada una vez que se haya realizado el pago de la tasa de oposición (art del Convenio sobre concesión de Patentes Europeas). Venta de fascículos: Oficina Española de Patentes y Marcas. C/Panamá, Madrid

2 Composición y método de quimioterapia. DESCRIPCIÓN 1 Referencia cruzada a aplicaciones relacionadas La presente aplicación reivindica prioridad a la solicitud de patente provisional US nº de serie / presentada el 4 de diciembre de 1998 y a la solicitud de patente provisional US nº de serie /127.3 presentada el 1 de abril de Campo de la invención La presente invención se refiere a una composición que comprende ADN de Mycobacterium phlei (M. phlei) (M- ADN), M-ADN conservado y complejado sobre pared celular de M. phlei (MCC) así como a un agente quimioterapéutico, en la que el M-ADN y MCC resultan eficaces para el tratamiento de cáncer y para potenciar el efecto antineoplásico del agente quimioterapéutico sobre el cáncer. Antecedentes de la invención El cáncer es una acumulación neta aberrante de células atípicas que resulta de un exceso de proliferación, una muerte celular insuficiente, o una combinación de las dos. La proliferación es la culminación de una progresión celular a través del ciclo celular y se caracteriza por la replicación del ADN celular total y la división de una célula en dos células. Para la división celular, las células de mamíferos pasan por una serie organizada de eventos controlados, denominados ciclo celular. El comienzo de un evento durante la progresión del ciclo celular depende de la finalización con éxito de un evento anterior. El ciclo celular se puede dividir en fases principales. Éstas son las fases Go, G 1, S, G 2 y M. Durante la fase Go, las células son quiascentes. La mayoría de células del cuerpo, en cualquier momento, se encuentran en este estadio. Durante la fase G 1, las células, respondiendo a señales para dividirse, producen el ARN y las proteínas necesarias para la síntesis de ADN. Durante la fase S (SE, fase S temprana; SM, fase S media; y SL, fase S tardía) las células replican su ADN. Al final de la fase S, cada célula contiene el doble de su contenido en ADN original pero aún se encuentra unida por una membrana celular externa. Durante la fase G 2, se elaboran proteínas en preparación para la división celular. Durante la fase mitótica (M), la célula se divide en dos células hijas. En todos los cánceres se producen alteraciones en la progresión del ciclo celular y pueden ser el resultado de una sobreexpresión de genes, la mutación de genes reguladores o la abrogación de los puntos de control del daño del ADN, y pueden modular la respuesta celular al tratamiento con agentes quimioterapéuticos (Hochhauser D. Anti- Cancer Chemotherapeutic Agents, 1997). La muerte celular es llevada a cabo por mediadores inmunes que inician procesos citolíticos y promueven la apoptosis, y a partir de inductores de apoptosis que inician directamente rutas que conducen a la muerte celular. La apoptosis es un proceso activo de muerte celular caracterizado por cambios morfológicos distintivos que incluyen la condensación de la cromatina, retracción celular, desintegración nuclear, formación de ampollas en la membrana plasmática, y la formación de cuerpos apoptóticos unidos a la membrana (Wyllie et al. Int. Rev. Cytol. 68:21, 1980). Un indicador molecular de la apoptosis es la degradación del ADN nuclear de la célula en fragmentos de longitud oligonuclosomal como resultado de la activación de endonucleasas endógenas (Wyllie A. Nature 284-, 1981). Las caspasas se han implicado como enzimas clave en la etapa de ejecución de la apoptosis. La familia de las caspasas consiste en por lo menos catorce cisteína aspartato proteasas relacionadas. Todas las caspasas presentan un motivo pentapéptido conservado QACXG (donde X es R, Q ó G) (SEC ID nº 1) en el centro activo (Cohen G. Biochim Biophys. Acta 1366:139, 1997). Varias caspasas se sintetizan como proenzimas inactivos, que se activan tras el corte en sitios de corte específicos de aspartato (Cohen G. Biochim Biophys. Acta 1366:139, 1997) o como enzimas inactivos que requieren de la asociación con moléculas reguladoras para su activación (Stennicke et al. J. Biol. Chem. 274:839, 1999). La activación del iniciador de procaspasa activa caspasas efectoras situadas corriente abajo iniciando la cascada de muerte celular (Pan et al., J. Biol. Chem. 273:841, 1998; Earnshaw W. Nature 397:387, 1999). Los agentes quimioterapéuticos utilizados más corrientemente presentan una citotoxicidad no específica. Muchos de estos agentes quimioterapéuticos presentan efectos secundarios tóxicos, resultan debilitantes y frecuentemente comprometen la calidad de vida del paciente. Además, las alteraciones en el transporte y metabolismo de los agentes quimioterapéuticos en las células cancerígenas resultan en el desarrollo de resistencia de las células cancerígenas a los agentes quimioterapéuticos. Por lo tanto, existe una necesidad de nuevas composiciones y procedimientos que induzcan la detención del ciclo celular en células cancerígenas, que inhiban la proliferación de células cancerígenas, que induzcan la apoptosis en células cancerígenas y que potencien el efecto antineoplásico de los agentes quimioterapéuticos sobre células cancerígenas. Además, tales composiciones han de poder ser preparadas de forma fácil y relativamente económica, su actividad debe permanecer terapéuticamente estable a lo largo del tiempo y deben ser eficaces a regímenes de dosis que estén asociados con una toxicidad mínima incluso tras varias administraciones. 2

3 Sumario de la invención 1 2 La presente invención satisface las necesidades anteriores proporcionando una composición que comprende ADN de Mycobacterium phlei (M. phlei) (M-ADN), M-ADN conservado y complejado sobre pared celular de M. phlei (MCC), un agente quimioterapéutico y un vehículo farmacéuticamente aceptable, en la que el M-ADN y el MCC inducen la detención del ciclo celular en células cancerígenas, inhiben la proliferación de células cancerígenas, inducen la apoptosis en células cancerígenas y potencian el efecto antineoplásico del agente quimioterapéutico sobre células cancerígenas. Además, el M-ADN y el MCC se preparan de forma fácil y relativamente económica, su actividad es reproducible entre preparaciones, permanece terapéuticamente estable a lo largo del tiempo y resulta eficaz a regímenes de dosis que están asociados con una toxicidad mínima incluso tras varias administraciones. Para preparar MCC, se cultiva M. phlei en medio líquido y se recoge. Se realiza la disrupción de los M. phlei, y se recogen los componentes sólidos de M. phlei mediante sedimentación por centrifugación. Los componentes sólidos se desproteinizan, se deslipidizan y se lavan. Todos los reactivos se seleccionan para favorecer la conservación del ADN durante la preparación del MCC. El M-ADN se prepara a partir del MCC o directamente a partir de M. phlei. De nuevo, todos los reactivos se seleccionan para favorecer la conservación del ADN durante la preparación del M-ADN. Una composición que comprende M-ADN, MCC, M-ADN + agente quimioterapéutico o MCC + agente quimioterapéutico se administra a un animal que sufre un cáncer, incluyendo un humano, en una cantidad eficaz para tratar el cáncer en el animal. La capacidad inesperada y sorprendente del M-ADN y del MCC para inducir la detención del ciclo celular en células cancerígenas, para inhibir la proliferación de células cancerígenas, para inducir la apoptosis en células cancerígenas y para potenciar el efecto antineoplásico de los agentes quimioterapéuticos sobre células cancerígenas da respuesta a una necesidad largamente considerada e insatisfecha en el arte médico y proporciona un beneficio importante para los animales, incluyendo humanos. Otro objetivo de la presente invención consiste en proporcionar una composición que induzca la detención del ciclo celular en células cancerígenas. Otro objetivo de la presente invención consiste en proporcionar una composición que inhiba la proliferación de células cancerígenas. Otro objetivo de la presente invención consiste en proporcionar una composición que potencie el efecto antineoplásico de un agente quimioterapéutico sobre células cancerígenas. 3 Otro objetivo de la presente invención consiste en proporcionar una composición que potencie el efecto de un agente quimioterapéutico sobre células cancerígenas mediante la sincronización del ciclo celular de las células cancerígenas. Otro objetivo de la presente invención consiste en proporcionar una composición que potencie el efecto de un agente quimioterapéutico sobre la proliferación de células cancerígenas. Otro objetivo de la presente invención consiste en proporcionar una composición que resulte eficaz para tratar el cáncer en un animal, incluyendo un humano. 4 0 Otro objetivo de la presente invención consiste en proporcionar una composición que potencie el efecto antineoplásico de un agente quimioterapéutico en el tratamiento del cáncer en un animal, incluyendo un humano. Otro objetivo de la presente invención consiste en proporcionar una composición que resulte eficaz para eliminar el cáncer en un animal, incluyendo un humano. Otro objetivo de la presente invención consiste en proporcionar una composición que potencie el efecto antineoplásico de un agente quimioterapéutico en la eliminación del cáncer en un animal, incluyendo un humano. Otro objetivo de la presente invención consiste en proporcionar una composición que induzca la detención del ciclo celular en las células de un melanoma maligno. Otro objetivo de la presente invención consiste en proporcionar una composición que inhiba la proliferación de las células de un melanoma maligno. 6 Otro objetivo de la presente invención consiste en proporcionar una composición que potencie el efecto antineoplásico de un agente quimioterapéutico sobre las células de un melanoma maligno. Otro objetivo de la presente invención consiste en proporcionar una composición que potencie el efecto antineoplásico de un agente quimioterapéutico sobre la detención del ciclo celular en las células de un melanoma maligno. Otro objetivo de la presente invención consiste en proporcionar una composición que potencie el efecto antineoplásico de un agente quimioterapéutico sobre la proliferación de las células de un melanoma maligno. 3

4 Otro objetivo de la presente invención consiste en proporcionar una composición que induzca la apoptosis en las células de un melanoma maligno. Otro objetivo de la presente invención consiste en proporcionar una composición que active las caspasas en las células de un melanoma maligno. Otro objetivo de la presente invención consiste en proporcionar una composición que resulte eficaz para tratar un melanoma maligno en un animal, incluyendo un humano. 1 Otro objetivo de la presente invención consiste en proporcionar una composición que potencie el efecto antineoplásico de un agente quimioterapéutico en el tratamiento de un melanoma maligno en un animal, incluyendo un humano. Otro objetivo de la presente invención consiste en proporcionar una composición que resulte eficaz para eliminar el melanoma maligno en un animal, incluyendo un humano. Otro objetivo de la presente invención consiste en proporcionar una composición que potencie el efecto antineoplásico de un agente quimioterapéutico en la eliminación de un melanoma maligno en un animal, incluyendo un humano. Otro objetivo de la presente invención consiste en proporcionar una composición que potencie el efecto de la radiación en el tratamiento del cáncer en un animal, incluyendo un humano. Otro objetivo de la presente invención consiste en proporcionar una composición que potencie el efecto de la radiación en la eliminación del cáncer en un animal, incluyendo un humano. 2 3 Otro objetivo de la presente invención consiste en proporcionar una composición que potencie el efecto de la radioterapia sobre células cancerígenas mediante la sincronización del ciclo celular de las células cancerígenas. Otro objetivo de la presente invención consiste en proporcionar una composición que pueda ser preparada en grandes cantidades. Otro objetivo de la presente invención consiste en proporcionar una composición que resulte relativamente económica de preparar. Otro objetivo de la presente invención consiste en proporcionar una composición que presente una actividad reproducible entre preparaciones. Otro objetivo de la presente invención consiste en proporcionar una composición que permanezca estable a lo largo del tiempo. Estos y otros objetivos, características y ventajas de la presente invención resultarán evidentes tras una revisión de la siguiente descripción detallada de la forma de realización dada a conocer y las reivindicaciones adjuntas. Breve descripción de las figuras 4 Fig. 1. Inhibición de la división de células de melanoma B-16 por MCC, M-ADN, M-ADN sonicado y ADN de esperma de arenque. Fig. 2. Inhibición de la división de células del melanoma B-16 por mitomicina-c, MCC y mitomicina-c + MCC. 0 Fig. 3. Inhibición de la división de células de melanoma B-16 por -fluorouracilo, MCC y -fluorouracilo + MCC. Fig. 4. Inhibición de la división de células de melanoma B-16 por cisplatino, MCC y cisplatino+ MCC. Fig.. Evaluación de la fase S de células de melanoma B-16 (A) y evaluación de la fase S de células de melanoma B-16 después del tratamiento con MCC (B). Fig. 6. Inducción de la apoptosis en células de melanoma B-16 por MCC y M-ADN. Fig. 7. Inducción de la actividad de la caspasa-1 en células de melanoma B-16 por MCC. Fig.8. Citotoxicidad de MCC. Descripción detallada de la invención 6 La presente invención es una composición que comprende ADN de Mycobacterium phlei (M. phlei) (M-ADN), M-ADN conservado y complejado sobre pared celular de M. phlei (MCC), un agente quimioterapéutico y un vehículo farmacéuticamente aceptable, en la que el M-ADN y el MCC inducen la detención del ciclo celular en células cancerígenas, inhiben la proliferación de células cancerígenas, inducen la apoptosis en células cancerígenas y potencian 4

5 1 el efecto antineoplásico del agente quimioterapéutico sobre células cancerígenas. El M-ADN y MCC se preparan de forma fácil y relativamente económica, su actividad es reproducible entre preparaciones, permanece terapéuticamente estable a lo largo del tiempo y resulta eficaz a regímenes de dosis que están asociados con una toxicidad mínima incluso tras varias administraciones. Tal como se utiliza en la presente memoria, M-ADN incluye ADN aislado directamente a partir de M. phlei y ADN aislado a partir de MCC preparado a partir de M. phlei. Tal como se utiliza en la presente memoria, MCC es M-ADN conservado y complejado sobre pared celular de M. phlei desproteinizada y deslipidizada. Tal como se utiliza en la presente memoria, agente quimioterapéutico es cualquier agente aprobado por una agencia reguladora del gobierno de un país o estado o inscrito en la Pharmacopoeia de US u otra pharmacopoeia reconocida generalmente para la utilización en el tratamiento de cáncer en un animal, incluyendo un humano. Tal como se utiliza en la presente memoria, antineoplásico se refiere a la prevención del desarrollo, maduración, proliferación y propagación de células cancerígenas. Tal como se utiliza en la presente memoria, que potencia se refiere a un grado de sinergismo que es mayor que aditivo. Tal como se utiliza en la presente memoria, sinergismo se refiere a la acción coordinada de dos o más agentes quimioterapéuticos Tal como se utiliza en la presente memoria, que intensifica se refiere a la acción aditiva de dos o más agentes quimioterapéuticos. Los procedimientos para incrementar la eficacia terapéutica del M-ADN y MCC incluyen, pero no se limitan a, aportar químicamente o amplificar biotecnológicamente secuencias estimuladoras o confirmaciones de M-ADN y complejar el M-ADN, MCC, M-ADN + agente quimioterapéutico y MCC + agente quimioterapéutico a vehículos naturales o sintéticos. Opcionalmente, en el M-ADN y el MCC se pueden incluir agentes que incluyen, pero no se limitan a, agentes inmunológicos y agentes de unión a un receptor. El M-ADN, MCC, M-ADN + agente quimioterapéutico y MCC + agente quimioterapéutico se administran en un vehículo farmacéuticamente aceptable, incluyendo, pero sin limitarse a, un vehículo líquido y un vehículo sólido. Los vehículos líquidos son vehículos acuosos, vehículos no-acuosos o ambos, e incluyen, pero no se limitan a, suspensiones acuosas, emulsiones de aceite, emulsiones de agua en aceite, emulsiones de agua-en-aceite-en-agua, emulsiones específicas de lugar, emulsiones de larga residencia, emulsiones adherentes, microemulsiones, nanoemulsiones y liposomas. Los vehículos sólidos son vehículos biológicos, vehículos químicos o ambos e incluyen, pero no se limitan a, micropartículas, nanopartículas, microesferas, nanoesferas, minibombas, extractos de pared celular bacteriana y polímeros naturales o sintéticos biodegradables o no biodegradables que permiten una liberación prolongada del M- ADN, MCC, M-ADN + agente quimioterapéutico o MCC + agente quimioterapéutico. Tales polímeros pueden ser implantados en la proximidad de la zona donde se requiere la liberación. Los polímeros y su utilización se describen en, por ejemplo, Brem et al., J. Neurosurg. 74: (1991). Entre los vehículos acuosos preferidos se incluyen, pero no se limitan a, agua exenta de DNasa, solución salina exenta de DNasa y tampones fisiológicamente aceptables exentos de DNasa. Entre los vehículos no acuosos preferidos se incluyen, pero no se limitan a, aceite mineral o aceite neutro incluyendo, pero sin limitarse a, un diglicérido, un triglicérido, un fosfolípido, un lípido, un aceite y mezclas de los mismos, en los que el aceite contiene una mezcla apropiada de ácidos grasos poliinsaturados y saturados. Entre los ejemplos se incluyen, pero no se limitan a, aceite de soja, aceite de canola, aceite de palma, aceite de oliva y migliol, en los que el número de carbonos de los ácidos grasos se encuentra comprendido entre 12 y 22 y en los que los ácidos grasos pueden ser saturados o insaturados. Opcionalmente, el lípido o fosfolípido cargado se puede suspender en el aceite neutro. En un ejemplo, el M-ADN se suspende en agua estéril exenta de DNasa y se sonica a un rendimiento del % durante minutos (Sonicador Modelo W-38, Heat Systems-Ultrasonics Inc). Opcionalmente, el M-ADN sonicado se homogeniza por microfluidización a psi a través de un flujo (Modelo M-1Y; Microfluidics, Newton, MA) y se transfiriere a una recipiente con tapa autoclavado para guardarlo a 4ºC. En un ejemplo, se añade fosfatidilcolina exenta de DNasa al triglicérido de aceite de soja exento de DNasa en una proporción de 1 gramo de fosfolípido por ml de triglicérido y se disuelve mediante calentamiento suave a 0-ºC. Se añaden varios gramos de MCC a un recipiente autoclavado seco y se añade la solución de fosfolípido-triglicérido a una concentración de ml por gramo de MCC. La suspensión se incuba a ºC durante min y seguidamente se mezcla con PBS exento de DNasa en una proporción de ml de la suspensión de MCC por litro de PBS exento de DNasa. La mezcla se sonica a un rendimiento del % durante minutos (Sonicador Modelo W-38, Heat Systems- Ultrasonics Inc). Opcionalmente, la mezcla sonicada de MCC se homogeniza por microfluidización a psi a través de un flujo (Modelo M-1Y; Microfluidics) y se transfiriere a un recipiente con tapa autoclavado para guardarla a 4ºC.

6 Se puede añadir un agente quimioterapéutico al M-ADN o al MCC antes, durante o después de la sonicación o microfluidización o antes o después de guardarlo. Adicionalmente, se pueden utilizar otros procedimientos conocidos por los expertos en la técnica para preparar ácidos desoxirribonucleicos, extractos de pared celular bacteriana y agentes quimioterapéuticos para la administración a un animal, incluyendo un humano. Además, el M-ADN, MCC, M-ADN + agente quimioterapéutico y MCC + agente quimioterapéutico pueden ser utilizados con cualquiera, todos o cualquier combinación de excipientes independientemente del vehículo utilizado para presentar la composición a las células de respuesta. Entre estos excipientes se incluyen, pero no se limitan a, antioxidantes, tampones y bacteriostáticos, y pueden incluir agentes de suspensión, agentes espesantes y agentes estabilizantes. Entre los agentes estabilizantes se incluyen, pero no se limitan a, polímeros no-iónicos e iónicos tales como, por ejemplo, monooleato polioxietilenosorbitán (Tween) o ácido hialurónico. El M-ADN, MCC, M-ADN + agente quimioterapéutico y MCC + agente quimioterapéutico se administran a un animal con cáncer en una cantidad eficaz para inducir la detención del ciclo celular, inhibir la proliferación de las células cancerígenas, inducir la apoptosis en las células cancerígenas y potenciar el efecto antineoplásico del agente quimioterapéutico sobre células cancerígenas. El agente quimioterapéutico se puede administrar antes, al mismo tiempo, o después de la administración del M-ADN o del MCC. El agente quimioterapéutico utilizado, así como la cantidad de M-ADN, MCC y agente quimioterapéutico administrada por dosis, el número de dosis y la programación de dosis, dependerán del tipo de cáncer, la severidad del cáncer, la localización del cáncer y otros factores clínicos tales como el tamaño, peso y condición física del receptor y de la vía de administración y pueden ser determinados por el médico practicante utilizando técnicas clínicas estándar y sin experimentación indebida. Adicionalmente, se pueden utilizar opcionalmente ensayos in vitro para ayudar a identificar rangos óptimos para la administración de M-ADN, MCC M-ADN + agente quimioterapéutico y MCC + agente quimioterapéutico. Preferentemente, la cantidad de M-ADN administrada se encuentra entre aproximadamente 0,00001 y 00 mg/kg por dosis, más preferentemente entre aproximadamente 0,0001 y 0 mg/kg por dosis, y aún más preferentemente entre aproximadamente 0,001 y mg/kg por dosis. Preferentemente, la cantidad de MCC administrada se encuentra entre aproximadamente 0,00001 y 00 mg/kg por dosis, más preferentemente entre aproximadamente 0,0001 y 0 mg/kg por dosis, y aún más preferentemente entre aproximadamente 0,001 y mg/kg por dosis. Preferentemente, el contenido en M-ADN del MCC se encuentra entre aproximadamente 0,001 y 90 mg/0 mg de MCC seco, más preferentemente entre aproximadamente 0,01 y mg/0 mg de MCC seco, y aún más preferentemente entre aproximadamente 0,1 y mg/0 mg de MCC seco. El contenido en proteína del MCC debe ser inferior a aproximadamente mg/0 mg de MCC seco y el M-ADN extraíble debe ser inferior a aproximadamente el 4,% del peso seco de MCC. Los agentes quimioterapéuticos incluyen, pero no se limitan a, agentes alquilantes de ADN, agentes antibioticos y antimetabólicos antitumorales. Entre los agentes alquilantes de ADN se incluyen, pero no se limitan a, nitrosureas, agentes de metales pesados y agentes de entrecruzamiento; entre los agentes antibióticos antitumorales se incluyen, pero no se limitan a, mitomicina- C; entre los agentes antimetabólicos se incluyen, pero no se limitan a, -fluorouracilo y metotrexato; entre los agentes inhibidores de topoisomerasa se incluyen, pero no se limitan a, CPT-11; entre los agentes estabilizantes de tubulina se incluyen, pero no se limitan a, taxol; entre los agentes desestabilizantes de tubulina se incluyen, pero no se limitan a, vincristina y vinblastina; y, entre los agentes antagonistas de hormonas se incluyen, pero no se limitan a, tamoxifeno. Preferentemente, la cantidad de agente quimioterapéutico administrada por dosis se encuentra entre aproximadamente 0,0001 y 00 mg/m 2 o entre aproximadamente 0,0001 y 00 mg/kg, más preferentemente entre aproximadamente 0, y 70 mg/m 2 o entre aproximadamente 0, y 70 mg/kg y aún más preferentemente entre aproximadamente 1 y 0 mg/m 2 o entre aproximadamente 1 y 0 mg/kg. Entre las vías de administración de la composición de la presente invención se incluyen, pero no se limitan a, oral, tópica, subcutánea, transdérmica, subdérmica, intra-muscular, intraperitoneal, intraarticular, intravesical, intraarterial, intravenosa, intradérmica, intracraneal, intralesional, intratumoral, intraocular, intrapulmonar, intraespinal, disposición en cavidades del cuerpo, inhalación nasal, inhalación pulmonar, impresión en la piel y electrocorporación. Dependiendo de la vía de administración, el volumen por dosis se encuentra preferentemente entre aproximadamente 0,001 y 00 ml por dosis, más preferentemente entre aproximadamente 0,01 y 0 ml por dosis y aún más preferentemente entre aproximadamente 0,1 y 0 ml por dosis. Los ejemplos siguientes servirán para ilustrar la presente invención, sin, al mismo tiempo, no obstante, constituir una limitación de la misma. Por el contrario, se entenderá claramente que se puede recurrir a otras formas de realización, modificaciones y equivalentes de la misma que, tras leer esta descripción, pueden sugerir los expertos en la técnica sin salir del espíritu de la presente invención y/o el alcance de las reivindicaciones adjuntas. Ejemplo 1 Preparación de M-ADN y MCC a partir de M. phlei Se preparó M-ADN y MCC a partir de M. phlei (cepa 1) tal como se describe en la solicitud de patente in- 6

7 1 ternacional nº PCT/CA98/00744, la cual se incluye en la presente memoria como referencia. Todos los reactivos se seleccionaron para favorecer la conservación del ADN. A menos que se indique lo contrario, el M-ADN y MCC se resuspendieron en agua exenta de DNasa o en un tampón exento de DNasa farmacéuticamente aceptable y se sonicaron a un rendimiento del % durante minutos (Sonicador Modelo W-38, Heat Systems-Ultrasonics, Inc). El M-ADN y MCC no contenían endotoxinas tal como se determinó utilizando un kit de lisado de amebócitos de Limulus QCL- 00 (BioWhittaker, Walkersville, MD). Para el tratamiento con DNasa, el M-ADN y MCC se digirieron con 1 unidad internacional de DNasa I exenta de RNasa (Life Technologies) durante 1 hora a 2ºC en Tris HCl mm, ph 8,4, MgCl 2 2 mm y KCl 0 mm. La DNasa I se activó mediante la adición de EDTA hasta una concentración final de 2, mm y calentando durante minutos a 6ºC. La DNasa I digiere tanto el ADN de doble cadena como el de cadena simple y proporciona una degradación casi total del ADN. Ejemplo 2 Preparación de ADN micobacteriano (B-ADN) y de ADN micobacteriano conservado y complejado sobre pared celular micobacteriana (BCC) a partir de especies distintas a M. phlei Se preparó BCC y B-ADN a partir de especies micobacterianas incluyendo, pero sin limitarse a, M. vaccae, M. chelonei, M. smegmatis, M. terrae, M. duvalii, M. tuberculosis, M. bovis BCG, M. avium, M. Szulgai, M. scrofulaceum, M. xenopi, M. kansaii, M. gastr, M. fortuitous y M.asiaticum tal como en el Ejemplo 1. Ejemplo Células y reactivos Células de leucemia celular humana Jurkat T (Jurkat), células de leucemia promielocítica humana HL (HL-), células de leucemia promielocítica humana resistentes a mitoxantrona HL-MX1 (HL-MX1), células de linfoma murino EL-4 (EL-4), y células de melanoma murino B-16 se obtuvieron a partir del American Type Tissue Culture Collection (ATCC Rockville, MD, USA) y se cultivaron en el medio recomendado por el ATCC a menos que se indique lo contrario, las células se sembraron en placas de cultivo de tejidos de 6 pocillos de fondo plano a concentraciones comprendidas entre x 3 y 1 x 6 células/ml y se mantuvieron a 37ºC durante entre 24 y 72 horas. La mitomicina-c, -fluorouracilo, cisplatino, metotrexato y el ADN de esperma de arenque se obtuvieron a partir de Sigma Aldrich Canada (Oakville, Ontario, Canadá). Ejemplo Análisis del ciclo celular El estadio del ciclo celular se determinó utilizando un kit comercial CYCLETEST TM PLUS DNA (Becton Dickinson, San José, CA, USA). Brevemente, se obtuvieron núcleos de células tratadas disolviendo la membrana plasmática con un detergente no iónico, eliminando el citoesqueleto celular y las proteínas nucleares con tripsina, digiriendo el ARN celular con RNasa y estabilizando la cromatina nuclear con espermina. Se añadió ioduro de propidio a los núcleos celulares y se analizó su fluorescencia en un citómetro de flujo equipado con capacidad de discriminación electrónica de dobletes (FACSCalibur, Becton Dickinson). La acumulación de células en las fases GO/G 1, S (SE, SM, SL) o G 2 /M del ciclo celular se analizó utilizando un software MODFIT LT (Verity Software House Inc., Topsham, MA, USA). Los resultados se expresan como el porcentaje de células en cada fase del ciclo celular. Ejemplo Sincronización de las poblaciones celulares con metotrexato 6 Para sincronizar las poblaciones celulares, las células en crecimiento exponencial se incubaron en un medio de cultivo de tejidos que contenía entre 0,04 y 0,16 µm de metotrexato (MTX) durante horas. Se eliminó el medio MTX, las células se lavaron extensamente con tampón fosfato salino (PBS), se añadió medio nuevo, se continuó la incubación durante 8 horas y se realizó el análisis del ciclo celular tal como en el Ejemplo 4. Ejemplo 6 Inducción de la detención del ciclo celular por MCC en células cancerígenas en división sincrónica Células en crecimiento exponencial de tipo Jurkat, HL-, HL-MX1 y EL-4, a 1 x 6 células/ml, y células B- 16, a 3 x células/ml, se prepararon para el análisis como en el Ejemplo con 0, y 0 µg/ml de MCC en el medio MTX. La tabla 1 muestra que el MCC, tanto a como a 0 µg/ml induce la detención en la fase SL + G 2 M del ciclo celular en células cancerígenas Jurkat, HL-, HL-MX1, EL-4 y B-16 en división sincrónica. La acumulación de 7

8 células en la fase SL+G 2 M iba acompañada de una reducción de células en la fase GO/G 1 +SE o en las fases GO/G 1 +SE y SM del ciclo celular. TABLA 1 Inducción de la detención del ciclo celular por MCC en células cancerígenas en división sincrónica 1 2 a 0,08 µm, b 0,16 µm ó c 0,04 µm Estos datos demuestran que el MCC induce la detención del ciclo celular en células cancerígenas en división sincrónica, incluyendo células cancerígenas HL- MX1, que presentan una resistencia atípica a agentes quimioterapéuticos, alteración de la actividad catalítica de la topoisomerasa II y niveles reducidos de las proteínas topoisimerasa II alfa y beta (Harker et al., Cancer Res. 49: , 1989). Ejemplo 7 Inducción de la detención del ciclo celular por MCC y MCC tratado con DNasa I en células leucémicas Jurkat en división sincrónica Células leucémicas Jurkat en crecimiento exponencial, a 1 x 6 células/ml, se prepararon para el análisis como en el Ejemplo con 0 y µg/ml de MCC y µg/ml de MCC tratado con DNasa I en el medio MTX. 3 La tabla 2 muestra que el MCC inducía la detención en la fase SL+G 2 M del ciclo celular en células Jurkat sincronizadas. La acumulación de células en la fase SL+G 2 M iba acompañada de una reducción de células en la fase GO/G 1 +SE o en las fases GO/G 1 +SE y SM del ciclo celular. La tabla 2 también muestra que el MCC tratado con DNasa I no inducía la detención del ciclo celular en células Jurkat en división sincrónica. TABLA 2 Inducción de la detención del ciclo celular por MCC y por MCC tratado con DNasa I en células Jurkat en división sincrónica 4 0 El MCC es M-ADN conservado y complejado sobre pared celular de M. phlei y la DNasa I digiere el M-ADN del MCC. Por lo tanto, el hecho que el MCC tratado con DNasa I no induzca la detención en células leucémicas Jurkat en división sincrónica demuestra la importancia del M-ADN para la inducción por MCC de la detención del ciclo celular en células cancerígenas en división. Ejemplo 8 6 Inducción de la detención del ciclo celular en células cancerígenas por MCC Células en crecimiento exponencial de tipo Jurkat, HL-, HL-MX1 y EL-4, a 1 x 6 células/ml, y células B- 16, a 3 x células/ml, se prepararon para el análisis como en el Ejemplo en ausencia de MTX y en presencia de 0, y 0 µg/ml de MCC. La tabla 3 muestra que el MCC, tanto a como a 0 µg/ml inducía la detención en la fase SL+G 2 M del ciclo celular en células Jurkat, HL-, HL-MX1, EL-4 y B-16 en división asincrónica. La acumulación de células en la 8

9 fase SL+G 2 M iba acompañada de una reducción de células en la fase GO/G 1 +SE o en las fases GO/G 1 +SE y SM del ciclo celular. TABLA 3 Inducción de la detención del ciclo celular por MCC en células cancerígenas en división asincrónica 1 2 El MCC inducía la detención del ciclo celular en células cancerígenas en división asincrónica, incluso en células cancerígenas HL-MX1, que presentan una multiresistencia atípica a agentes quimioterapéuticos, alteración de la actividad catalítica de la topoisomerasa II y niveles reducidos de las proteínas topoisomerasa II alfa y beta (Harker et al., Cancer Res. 49: , 1989). Ejemplo 9 Inducción de la detención del ciclo celular en células leucémicas Jurkat por M-ADN, MCC y MCC tratado con DNasa I 3 Células leucémicas Jurkat en crecimiento exponencial, a 1 x 6 células/ml, se prepararon para el análisis como en el Ejemplo en ausencia de MTX y en presencia de 0 µg/ml de M-ADN, µg/ml de MCC y µg/ml de MCC tratado con DNasa I. La tabla 4 muestra que tanto el M-ADN como el MCC inducían la detención en la fase SL+G 2 M del ciclo celular en células Jurkat en división asincrónica. La acumulación de células en la fase SL+G 2 M iba acompañada de una reducción de células en las fases GO/G 1 +SE y SM del ciclo celular. La tabla 3 también muestra que, después del tratamiento con DNasa I, el MCC inducía menos detención del ciclo celular en células Jurkat en división asincrónica. TABLA 4 Inducción de la detención del ciclo celular por M-ADN, MCC y MCC tratado con DNasa I en células leucémicas Jurkat en división asincrónica 4 0 El M7,3-ADN y el MCC inducían la detención del ciclo celular en células Jurkat en división asincrónica. El MCC es M-ADN conservado y complejado sobre pared celular de M. phlei y la DNasa I digiere el M-ADN del MCC. Por lo tanto, el hecho que el MCC tratado con DNasa I induzca una detención menor en células leucémicas Jurkat en división asincrónica demuestra de nuevo la importancia del M-ADN para la inducción por MCC de la detención del ciclo celular en células cancerígenas en división. Ejemplo 6 Inhibición de la proliferación de células de melanoma B-16 por MCC, M-ADN, M-ADN sonicado y ADN de esperma de arenque Células de melanoma B-16 en crecimiento exponencial, a 3 x células/ml, se prepararon para el análisis como 9

10 en el Ejemplo en ausencia de MTX y en presencia de entre 1 y 0 µg/ml de MCC, M-ADN o M-ADN sonicado durante minutos en hielo en un procesador de ultrasonidos Modelo W-38 (HeatSystems-Ultrasonics, Inc.) para reducir la longitud de oligonucleótidos, y DNA de esperma de arenque. 1 Tal como se muestra en la figura 6, a 1 µg/ml, el MCC inhibía la proliferación aproximadamente un 2%, el M- ADN aproximadamente un %, el M-ADN sonicado aproximadamente un % y el DNA de esperma de arenque un 0%. A µg/ml, el MCC inhibía la proliferación aproximadamente un 0%, el M-ADN aproximadamente un %, el M-ADN sonicado aproximadamente un 2% y el DNA de esperma de arenque un 0%. A 0 µg/ml, el MCC inhibía la proliferación aproximadamente un 80%,el M-ADN y el M-ADN sonicado aproximadamente un 0% y el DNA de esperma de arenque aproximadamente un %. Cada uno de MCC, M-ADN y M-ADN sonicado inhibían la proliferación de células de melanoma B-16 en división asincrónica, mientras que el DNA de esperma de arenque no inhibía la proliferación de células de melanoma B-16 en división asincrónica. Ejemplo 11 Inhibición de la proliferación de células de melanoma B-16 por agentes quimioterapéuticos + MCC El melanoma maligno se encuentra entre los cánceres más refractarios a la quimioterapia y muchos agentes quimioterapéuticos no parecen modificar el pronóstico de esta enfermedad. Las líneas celulares derivadas de melanoma también demuestran una resistencia significativa a la mayoría de agentes quimioterapéuticos, sugiriendo la presencia de resistencia celular intrínseca. Esta resistencia puede estar mediada por mecanismos incluyendo, pero sin limitarse a, P-glicoproteína, proteína del sistema glutationa/glutationa S-transferasa asociada a la multiresistencia a agentes terapéuticos, N-Ras mutada, oncogenes Bcl-2 y p3 y enzima topoisomerasa II (Serrone et al., Melanoma Res. 9:1, 1999). Células de melanoma B-16, a 3 x células/ml, se incubaron durante 72 h con los agentes quimioterapéuticos mitomicina-c, -fluorouracilo y cisplatino en ausencia y en presencia de MCC. La proliferación celular se determinó utilizando la reducción de bromuro de dimetiltiazol-difeniltretazolio (MTT) (Mosman et al. Journal of Immunological Methods 6:-63, 1983). Después de 72 h, a cada pocillo se le añadieron µl de MTT en medio de cultivo y se incubó durante 3 h. Seguidamente se aspiró el medio de cada pocillo, se añadieron 0 µl de alcohol isopropílico acidificado a cada muestra y el MTT reducido se solubilizó mezclando. La absorbancia del producto de reacción se determinó utilizando un lector de microplacas ELISA a una longitud de onda de 70 nm. Las células de melanoma B-16 se incubaron con entre 0,01 y 0 µg/ml de mitomicina-c, con entre 1 y 0 µg de MCC y con entre 0,01 y µg/ml de mitomicina-c + 1 µg/ml de MCC. La mitomicina-c es un antibiótico antitumoral sintetizado por Streptomyces caespitosus, el cual entrecruza el ADN, despolimeriza el ADN y forma radicales libres. La figura 2 muestra que con células B-16, 0,1 µg/ml de mitomicina-c inhibían la proliferación aproximadamente un %, 1 µg/ml aproximadamente un %, y y 0 µg/ml un 0%, mientras que 1 µg/ml de MCC inhibía la proliferación aproximadamente un 2%, µg/ml aproximadamente un 0%, y 0 µg/ml aproximadamente un 80%. La figura 2 también muestra que, en presencia de 1 µg/ml de MCC, 0,1 µg/ml de mitomicina-c inhibían la proliferación aproximadamente un %, 1 µg/ml aproximadamente un 6% y 0 µg/ml un 0%. Estos datos muestran que el MCC potencia el efecto antineoplásico de la mitomicina-c sobre células cancerígenas en proliferación. Células de melanoma B-16 se incubaron con entre 0,01 y 0 µg/ml de -fluorouracilo, con entre 1 y 0 µg de MCC y con entre 0,01 y µg/ml de -fluorouracilo + 1 µg/ml de MCC. El -fluorouracilo es un antimetabólico que interfiere con la síntesis de ADN y ARN. La figura 3 muestra que con células B-16, 0,01 µg/ml de -fluorouracilo inhibían la proliferación aproximadamente un 8%, 0,1 µg/ml aproximadamente un 0%, 1 µg/ml aproximadamente un 90% y y 0 µg/ml un 0%, mientras que 1 µg/ml de MCC inhibía la proliferación aproximadamente un 2%, µg/ml aproximadamente un 0%, y 0 µg/ml aproximadamente un 80%. La figura 3 también muestra que, en presencia de 1 µg/ml de MCC, 0,01 µg/ml de -fluorouracilo inhibían la proliferación aproximadamente un 7%, 0,1 µg/ml aproximadamente un 8%, 1 µg/ml aproximadamente un 90% y µg/ml un 0%. Estos datos muestran que el MCC potencia el efecto antineoplásico del -fluorouracilo sobre células cancerígenas en proliferación. Células de melanoma B-16 se incubaron con entre 0,01 y 0 µg/ml de cisplatino, con entre 1 y 0 µg de MCC y con entre 0,01 y µg/ml de cisplatino + 1 µg/ml de MCC. El cisplatino es una gente alquilante que entrecruza el ADN e inhibe los precursores de ADN. La figura 4 muestra que, con células B-16, 0,01 µg/ml de cisplatino inhibían la proliferación un 0%, 0,1 µg/ml aproximadamente un 8%, 1 µg/ml aproximadamente un 62%, µg/ml aproximadamente un 90% y 0 µg/ml un 0%, mientras que 1 µg/ml de MCC inhibía la proliferación aproximadamente un 2%, µg/ml aproximadamente un 0% y 0 µg/ml aproximadamente un 80%. La figura 4 también muestra que, en presencia de 1 µg/ml de MCC,

11 0,01 µg/ml de cisplatino inhibían la proliferación aproximadamente un %, 0,1 µg/ml aproximadamente un 0%, 1 µg/ml aproximadamente un 70% y µg/ml aproximadamente un 90%. Estos datos muestran que el MCC intensifica el efecto antineoplásico del cisplatino sobre células cancerígenas en proliferación. La tabla muestra las concentraciones de la mitomicina-c, -fluorouracilo y cisplatino necesarias para una inhibición del 0% de la división de células de melanoma B-16 en ausencia y presencia de 1 µg/ml de MCC. TABLA Concentración de mitomicina-c, -fluorouracilo y cisplatino necesaria para una inhibición del 0% de la proliferación de células de melanoma B-16 en ausencia y presencia de 1 µg/ml de MCC 1 * concentración para una inhibición del 0% 2 3 La tabla muestra la inhibición dependiente de dosis de la proliferación de células de melanoma B-16 por el MCC a entre y 0 µg/ml (IC 0 = µg/ml) y por mitomicina-c, -fluorouracilo y cisplatino a entre 0,1 y µg/ml (IC 0 = 2,2, 0,12 y 0,6 µg/ml respectivamente). La tabla también muestra que 1 µg/ml de MCC potenciaba la inhibición de la proliferación de células de melanoma B-16 por mitomicina-c (IC 0 = 0,12 µg/ml) y -fluorouracilo (IC 0 = 0,00 µg/ml) y que 1 µg/ml de MCC intensificaba la inhibición de la proliferación de células de melanoma B-16 por cisplatino (IC 0 = 0,16 µg/ml). Estos datos muestran que el MCC no solo inhibe la proliferación de células cancerígenas, sino que también potencia los efectos antineoplásicos de la mitomicina-c y -fluorouracilo sobre la proliferación de células cancerígenas e intensifica el efecto antineoplásico del cisplatino sobre la proliferación de células cancerígenas. Ejemplo 12 Inducción de la apoptosis en células de melanoma B-16 por MCC y M-ADN 4 0 La fragmentación del ADN celular en fragmentos de tamaño de nucleosoma es característica de las células bajo apoptosis (Newell et al. Nature 37: , 1990). Para evaluar la fragmentación del ADN, las células B-16 se lisaron con 0, ml de tampón de lisis hipotónico (tampón Tris mm, EDTA 1 mm, 0,2% de octilfenoxipolietoxietanol (Triton X-0), ph 7,). Los lisados se centrifugaron a g durante min y los sobrenadantes, que contenían el ADN fragmentado, se precipitaron durante una noche a -ºC en 0% de isopropanol y NaCl 0, M. Los precipitados se recogieron por centrifugación y se analizaron por electroforesis en geles de agarosa al 0,7% durante 3 h a 0 V. Células de melanoma B-16, a x células/ml, se incubaron durante 72 h con 1 µg/ml de M-ADN (figura 6, carril 1) y con 0 (carril 2), (carril 3) y 1 µg/ml de MCC (carril 4). Las células de melanoma B-16 tratadas con M-ADN y MCC mostraron una fragmentación significativa del ADN, mientras que las células de melanoma B-16 sin tratar (figura 6, carril ) no mostraban fragmentación del ADN. Se utilizó un marcador de ADN de 123 pb (Gibco Life Science) para determinar el peso molecular de los fragmentos de ADN de tamaño de nucleosoma (figura 6, carril L). Estos datos demuestran que el M-ADN y MCC inducen la apoptosis en células de melanoma B-16. Ejemplo 13 Activación de la caspasa-1 en células de melanoma B-16 por MCC 6 El enzima de conversión de la interleucina-1 (ICE/caspasa 1) es una cisteína proteasa implicada en la activación secuencial de la cascada de caspasas necesaria para la apoptosis. La ICE/caspasa-1 resulta rápidamente y transitoriamente activada por varios estímulos pro-apoptóticos. Para determinar si el MCC puede activar directamente la ICE/caspasa-1, se ensayó el efecto del MCC sobre la actividad ICE/caspasa-1 en células de melanoma B-16. Se plaquearon células de melanoma B-16, a 3 x células/ml, en placas de cultivo de tejidos de 6 pocillos utilizando un volumen de 1 ml y se incubaron durante 3 h con entre 1 y 0 µg/ml de MCC. Las células se lavaron, se lisaron en HEPES 0 mm, ph 7,4, NaCl 0 mm, 0,1% de 3-[3-colamidopropil)dimetilamonio]-1-propano-sulfonato (CHAPS), DTT mm, EDTA 1 mm y % de glicerol y se centrifugaron a g durante minutos. La actividad ICE/caspasa-1 en el sobrenadante se determinó utilizando el estrato sintético fluorogénico Z-tyr-val-ala-asp[OMe]-7-11

12 amino-4-metilcumarina [Calbiochem # ]. La fluorescencia se determinó a una longitud de onda de excitación de 0 nm y una longitud de onda de emisión de 0 nm. Tal como se muestra en la figura 7, la incubación de células de melanoma B-16 con MCC resultó en un incremento significativo dependiente de dosis de la actividad ICE/caspasa-1, mientras que la incubación de células de melanoma B-16 sin MCC no resultó en un cambio de la actividad ICE/caspasa-1. Ejemplo 14 Efectos citotóxicos del MCC sobre células de melanoma maligno La citotoxicidad celular se caracteriza por la pérdida de la integridad de la membrana plasmática y la liberación de enzimas citoplasmáticos tales como, por sin limitarse a, LDH (Phillips et al., Vaccine 14: ) Para evaluar la citotoxicidad del MCC, las células de melanoma B-16 se incubaron durante 48 h con 0 µg/ml de MCC o con tampón de lisis (Tris mm, EDTA 1 mm, 0,2% de Triton X-0, ph 7,) como control para la liberación total de LDH (Filion et al. Biochim Biophys Acta 1329:34-36, 1997). El LDH se determinó mediante un ensayo comercial (Sigma-Aldrich). Tal como se muestra en la Figura 8, el MCC no resultó citotóxico para las células de melanoma B-16. Estos datos demuestran que el MCC no actúa rompiendo la membrana de las células, sino que el MCC actúa directamente sobre las células de melanoma B-16 para inducir la apoptosis. Ejemplo 1 Efectos del M-ADN, MCC y MCC tratado con DNasa I sobre tumores de melanoma B-16 en ratones Células de melanoma B-16 se implantan subcutáneamente en ratones macho nude BALB/c y se dejan crecer durante días. Los ratones se dividen en 4 grupos y se mide la masa tumoral en cada ratón. En el día 0, los ratones del Grupo 1 reciben solución salina, los ratones del Grupo 2 reciben MCC, los ratones del Grupo 3 reciben M-ADN y los ratones del Grupo 4 reciben MCC tratado con DNasa I. Tras 4 semanas de tratamiento, se sacrifican los ratones y se mide la masa tumoral. Los ratones del Grupo 2 y Grupo 3 presentan una masa tumoral menor que los ratones del Grupo 1 y el Grupo 4. Ejemplo 16 Efectos del M-ADN y MCC en combinación con mitomicina-c sobre tumores de melanoma B-16 en ratones 4 Células de melanoma B-16 se implantan subcutáneamente en ratones macho nude BALB/c y se dejan crecer durante días. Los ratones se dividen en 6 grupos y se mide la masa tumoral en cada ratón. En el día 0, los ratones del Grupo 1 reciben solución salina, los ratones del Grupo 2 reciben M-ADN, los ratones del Grupo 3 reciben MCC, los ratones del Grupo 4 reciben mitomicina-c, los ratones del Grupo reciben M-ADN y mitomicina-c y los ratones del Grupo 6 reciben MCC y mitomicina-c. Tras 4 semanas de tratamiento, se sacrifican los ratones y se determina la masa tumoral y el número de metástasis. Los ratones del Grupo 1 presentan la mayor masa tumoral. Los ratones del Grupo 4 presentan una masa tumoral menor que los ratones del Grupo 1. Los ratones del Grupo 2 y el Grupo 3 presentan una masa tumoral menor que los ratones del Grupo 4. Los ratones del Grupo y el Grupo 6 presentan la masa tumoral menor

13 REIVINDICACIONES Uso de ADN de Mycobacterium phlei (M-ADN) y un agente quimioterapéutico (M-ADN + agente quimioterapéutico) para la preparación de un medicamento destinado al tratamiento de un cáncer en un animal, en el que el agente quimioterapéutico se selecciona de entre el grupo que comprende agentes alquilantes de ADN, agentes antibióticos antitumorales y agentes antimetabólicos. 2. Uso según la reivindicación 1, en el que el M-ADN se conserva y compleja sobre la pared celular de Mycobacterium phlei (MCC). 3. Uso según la reivindicación 1 ó 2, en el que el agente alquilante de ADN es cisplatino. 4. Uso según la reivindicación 1 ó 2, en el que el agente antibiótico antitumoral es mitomicina-c.. Uso según la reivindicación 1 ó 2, en el que el agente antimetabólico es -fluoruracilo. 6. Uso según cualquiera de las reivindicaciones 1 a, en el que M-ADN + agente quimioterapéutico y MCC + agente quimioterapéutico induce la detención del ciclo celular en las células del cáncer. 7. Uso según cualquiera de las reivindicaciones 1 a, en el que M-ADN + agente quimioterapéutico y MCC + agente quimioterapéutico inhibe la proliferación de las células del cáncer. 8. Uso según cualquiera de las reivindicaciones 1 a, en el que M-ADN + agente quimioterapéutico y MCC + agente quimioterapéutico induce la apoptosis en las células del cáncer. 9. Uso según cualquiera de las reivindicaciones anteriores, en el que el cáncer es leucemia, linfoma o melanoma.. Uso según la reivindicación 9, en el que el cáncer es melanoma. 11. Uso de M-ADN para la preparación de un medicamento destinado a inducir la detención del ciclo celular en células cancerígenas en un animal, activar la actividad caspasa en células de melanoma maligno, o inhibir la actividad neoplásica en células cancerígenas en un animal. 12. Uso según la reivindicación 11, en el que el M-ADN se conserva y compleja sobre pared celular de Mycobacterium phlei (MCC). 13. Uso según la reivindicación 11 ó 12, en el que la detención del ciclo celular en células cancerígenas se induce en la fase SL + GM2 del ciclo celular. 14. Uso según la reivindicación 11, 12 ó 13, en el que las células cancerígenas son células de melanoma. 1. Composición que comprende M-ADN y un agente quimioterapéutico, en la que el M-ADN potencia la actividad anticancerígena del agente quimioterapéutico en el tratamiento del cáncer en un animal que sufre un cáncer, y en la que el agente quimioterapéutico se selecciona de entre el grupo que comprende agentes alquilantes de ADN, agentes antibióticos antitumorales y agentes antimetabólicos. 16. Composición según la reivindicación 1, en la que el M-ADN se conserva y compleja sobre pared celular de Mycobacterium phlei (MCC) y en la que el MCC potencia la actividad anticancerígena del agente quimioterapéutico en el tratamiento del cáncer en un animal que sufre un cáncer. 6 13

14 14

15 1

16 16

17 17

18 18

19 19

20

Int. Cl.: 72 Inventor/es: Miller, Richard, A. 74 Agente: Carpintero López, Mario

Int. Cl.: 72 Inventor/es: Miller, Richard, A. 74 Agente: Carpintero López, Mario 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 31 429 1 Int. Cl.: A61K 31/33 (06.01) A61P 2/00 (06.01) 12 TRADUCCIÓN DE PATENTE EUROPEA T3 96 Número de solicitud europea: 027992.3

Más detalles

11 Número de publicación: 2 208 435. 51 Int. Cl. 7 : A61K 31/255. 72 Inventor/es: Baumgart, Joachim. 74 Agente: Curell Suñol, Marcelino

11 Número de publicación: 2 208 435. 51 Int. Cl. 7 : A61K 31/255. 72 Inventor/es: Baumgart, Joachim. 74 Agente: Curell Suñol, Marcelino 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 8 43 1 Int. Cl. 7 : A61K 31/2 A61P 37/06 12 TRADUCCIÓN DE PATENTE EUROPEA T3 86 Número de solicitud europea: 009799.2 86 Fecha

Más detalles

11 Número de publicación: 2 251 987. 51 Int. Cl. 7 : A61K 31/4188. 72 Inventor/es: Ragab, Mohamed, H. 74 Agente: Tavira Montes-Jovellar, Antonio

11 Número de publicación: 2 251 987. 51 Int. Cl. 7 : A61K 31/4188. 72 Inventor/es: Ragab, Mohamed, H. 74 Agente: Tavira Montes-Jovellar, Antonio 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 21 987 1 Int. Cl. 7 : A61K 31/4188 A61P 3/00 12 TRADUCCIÓN DE PATENTE EUROPEA T3 86 Número de solicitud europea: 0091843.9 86

Más detalles

11 Número de publicación: 2 239 799. 51 Int. Cl. 7 : A61K 38/00. 72 Inventor/es: Hauptman, Jonathan, Brian. 74 Agente: Isern Jara, Jorge

11 Número de publicación: 2 239 799. 51 Int. Cl. 7 : A61K 38/00. 72 Inventor/es: Hauptman, Jonathan, Brian. 74 Agente: Isern Jara, Jorge 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 239 799 1 Int. Cl. 7 : A61K 38/00 A61K 31/36 A61P 3/ 12 TRADUCCIÓN DE PATENTE EUROPEA T3 86 Número de solicitud europea: 98908008.0

Más detalles

DANAGENE RNA PURIFICATION KIT

DANAGENE RNA PURIFICATION KIT DANAGENE RNA PURIFICATION KIT REF.0801.1 100 EXTRACCIONES REF.0801.2 500 EXTRACCIONES 1.INTRODUCCION Este kit permite la permite la obtención de ARN total a partir de cultivos celulares, tejidos animales,

Más detalles

11 knúmero de publicación: 2 170 589. 51 kint. Cl. 7 : A61K 31/165

11 knúmero de publicación: 2 170 589. 51 kint. Cl. 7 : A61K 31/165 k 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 knúmero de publicación: 2 170 89 1 kint. Cl. 7 : A61K 31/16 A61K 9/08 A61K 47/ A61P 29/00 12 k TRADUCCION DE PATENTE EUROPEA T3 86 k Número de solicitud

Más detalles

Int. Cl. 7 : C08B 37/10

Int. Cl. 7 : C08B 37/10 k 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 k Número de publicación: 2 161 61 21 k Número de solicitud: 009901671 1 k Int. Cl. 7 : C08B 37/ A61K 31/727 A61P 7/02 k 12 SOLICITUD DE PATENTE A1 22

Más detalles

Int. Cl. 7 : C12N 9/02. 72 Inventor/es: Kajiyama, Naoki. 74 Agente: Carvajal y Urquijo, Isabel

Int. Cl. 7 : C12N 9/02. 72 Inventor/es: Kajiyama, Naoki. 74 Agente: Carvajal y Urquijo, Isabel 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 249 794 1 Int. Cl. 7 : C12N 9/02 12 TRADUCCIÓN DE PATENTE EUROPEA T3 86 Número de solicitud europea: 9766.6 86 Fecha de presentación

Más detalles

Int. Cl. 7 : A61K 31/365. 72 Inventor/es: Pisano, C. y Riccioni, T. 74 Agente: Carpintero López, Francisco

Int. Cl. 7 : A61K 31/365. 72 Inventor/es: Pisano, C. y Riccioni, T. 74 Agente: Carpintero López, Francisco 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 249 68 1 Int. Cl. 7 : A61K 31/36 A61P 3/02 A61P /0 A61K 31/3 A61P 43/00 A61P 3/ 12 TRADUCCIÓN DE PATENTE EUROPEA T3 86 Número

Más detalles

La Regulación del Ciclo Celular, la Apoptosis y el Cáncer

La Regulación del Ciclo Celular, la Apoptosis y el Cáncer La Regulación del Ciclo Celular, la Apoptosis y el Cáncer Bio 112 La proliferación celular tiene lugar de un modo controlado de acuerdo a las necesidades generales del organismo. Las células de algunos

Más detalles

11 kn. de publicación: ES 2 073 416. 51 kint. Cl. 6 : A61K 31/74

11 kn. de publicación: ES 2 073 416. 51 kint. Cl. 6 : A61K 31/74 k 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 kn. de publicación: ES 2 073 416 1 kint. Cl. 6 : A61K 31/74 C08L 9/00 A61K 31/80 12 k TRADUCCION DE PATENTE EUROPEA T3 86 knúmero de solicitud europea:

Más detalles

Utilización de modelos celulares in vitro para la optimización de sistema de liberación controlada de antitumorales

Utilización de modelos celulares in vitro para la optimización de sistema de liberación controlada de antitumorales Utilización de modelos celulares in vitro para la optimización de sistema de liberación controlada de antitumorales María Jesús Garrido Dpto. Farmacia y Tecnología Farmacéutica Universidad de Navarra Por

Más detalles

Int. Cl.: 74 Agente: Carpintero López, Mario

Int. Cl.: 74 Agente: Carpintero López, Mario 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 8 038 1 Int. Cl.: CL 1/02 (06.01) CL 1/18 (06.01) 12 TRADUCCIÓN DE PATENTE EUROPEA T3 96 Número de solicitud europea: 038944.3

Más detalles

11 knúmero de publicación: 2 148 828. 51 kint. Cl. 7 : A61K 31/445. k 72 Inventor/es: Pein, Eckhart; k 74 Agente: Ungría López, Javier

11 knúmero de publicación: 2 148 828. 51 kint. Cl. 7 : A61K 31/445. k 72 Inventor/es: Pein, Eckhart; k 74 Agente: Ungría López, Javier 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 148 828 1 Int. Cl. 7 : A61K 31/44 12 TRADUCCION DE PATENTE EUROPEA T3 86 Número de solicitud europea: 9694312.3 86 Fecha de presentación

Más detalles

11 knúmero de publicación: 2 124 477. 51 kint. Cl. 6 : A61K 31/665

11 knúmero de publicación: 2 124 477. 51 kint. Cl. 6 : A61K 31/665 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 124 477 1 Int. Cl. 6 : A61K 31/66 12 TRADUCCION DE PATENTE EUROPEA T3 86 Número de solicitud europea: 91124. 86 Fecha de presentación

Más detalles

11 knúmero de publicación: 2 103 799. 51 kint. Cl. 6 : A61K 31/72

11 knúmero de publicación: 2 103 799. 51 kint. Cl. 6 : A61K 31/72 k 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 knúmero de publicación: 2 103 799 51 kint. Cl. 6 : A61K 31/72 A61K 31/735 12 k TRADUCCION DE PATENTE EUROPEA T3 86 knúmero de solicitud europea: 91904092.3

Más detalles

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles

CAPÍTULO VI. Expresión de genes relacionados con apoptosis

CAPÍTULO VI. Expresión de genes relacionados con apoptosis CAPÍTULO VI Expresión de genes relacionados con apoptosis 1.- Introducción 2.- Protocolos para análisis genéticos 3.- Resultados en MCF-7 4.- Discusión 1.- Introducción Como se ha descrito anteriormente,

Más detalles

11 Número de publicación: 2 239 848. 51 Int. Cl. 7 : A61K 35/76. 74 Agente: Arias Sanz, Juan

11 Número de publicación: 2 239 848. 51 Int. Cl. 7 : A61K 35/76. 74 Agente: Arias Sanz, Juan 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 239 848 1 Int. Cl. 7 : A61K 3/76 A61P 3/00 12 TRADUCCIÓN DE PATENTE EUROPEA T3 86 Número de solicitud europea: 99938172.6 86

Más detalles

11 Número de publicación: 2 302 602. 21 Número de solicitud: 200600632. 51 Int. Cl.: 72 Inventor/es: Comenge Sánchez Real, Alberto

11 Número de publicación: 2 302 602. 21 Número de solicitud: 200600632. 51 Int. Cl.: 72 Inventor/es: Comenge Sánchez Real, Alberto 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 2 2 21 Número de solicitud: 00632 1 Int. Cl.: C12G 3/00 (06.01) A23C 23/00 (06.01) 12 PATENTE DE INVENCIÓN B1 22 Fecha de presentación:

Más detalles

11 knúmero de publicación: 2 122 570. 51 kint. Cl. 6 : A61K 7/06. k 72 Inventor/es: Shander, Douglas y

11 knúmero de publicación: 2 122 570. 51 kint. Cl. 6 : A61K 7/06. k 72 Inventor/es: Shander, Douglas y 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 122 70 1 Int. Cl. 6 : A61K 7/06 12 TRADUCCION DE PATENTE EUROPEA T3 86 Número de solicitud europea: 9913991.6 86 Fecha de presentación

Más detalles

AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO

AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO E l estudio del genoma de los seres vivos a sido uno d los principales objetivos de la Biología. Desde los trabajos de Mendel (1866),

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

Apoptosis en Otorrinolaringología

Apoptosis en Otorrinolaringología Apoptosis en Otorrinolaringología Teolinda Morales y Myrian Adriana Pérez García Definición La apoptosis es un proceso biológico que existe en todas las células de nuestro organismo, conocida desde 1950

Más detalles

38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa

38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa 38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa José Luis Caballero Repullo, Enriqueta Moyano, Juan Muñoz Blanco Departamento de Bioquímica y Biología Molecular, Campus

Más detalles

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a Introducción Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a los investigadores verificar la expresión de una proteína, determinar la cantidad relativa

Más detalles

11 kn. de publicación: ES 2 061 718. 51 kint. Cl. 5 : A61K 31/575

11 kn. de publicación: ES 2 061 718. 51 kint. Cl. 5 : A61K 31/575 k 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 kn. de publicación: ES 2 061 718 1 kint. Cl. : A61K 31/7 A61K 31/6 12 k TRADUCCION DE PATENTE EUROPEA T3 86 knúmero de solicitud europea: 887281.8 86

Más detalles

11 knúmero de publicación: 2 184 678. 51 kint. Cl. 7 : C07D 233/94

11 knúmero de publicación: 2 184 678. 51 kint. Cl. 7 : C07D 233/94 k 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 knúmero de publicación: 2 184 678 1 kint. Cl. 7 : C07D 233/94 A61K 31/4168 A61P 43/00 12 k TRADUCCION DE PATENTE EUROPEA T3 86 knúmero de solicitud

Más detalles

11 Número de publicación: 2 232 634. 51 Int. Cl. 7 : A61K 31/122. 74 Agente: Durán Benejam, Maria del Carmen

11 Número de publicación: 2 232 634. 51 Int. Cl. 7 : A61K 31/122. 74 Agente: Durán Benejam, Maria del Carmen 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 232 634 51 Int. Cl. 7 : A61K 31/122 A61P 35/00 12 TRADUCCIÓN DE PATENTE EUROPEA T3 86 Número de solicitud europea: 01945212.7

Más detalles

Proceso de Evaluación biológica Ensayos de Biocompatibilidad Dra. Mónica Cameo Directora Biología Aplicada Ciudad Autónoma de Buenos Aires

Proceso de Evaluación biológica Ensayos de Biocompatibilidad Dra. Mónica Cameo Directora Biología Aplicada Ciudad Autónoma de Buenos Aires Proceso de Evaluación biológica Ensayos de Biocompatibilidad Dra. Mónica Cameo Directora Biología Aplicada Ciudad Autónoma de Buenos Aires PROCESO DE EVALUACIÓN BIOLÓGICA SEGÚN ISO 10993 1.Caracterización

Más detalles

11 knúmero de publicación: 2 138 197. 51 kint. Cl. 6 : A61K 7/06. k 72 Inventor/es: Navarro, Roger y. k 74 Agente: Curell Suñol, Marcelino

11 knúmero de publicación: 2 138 197. 51 kint. Cl. 6 : A61K 7/06. k 72 Inventor/es: Navarro, Roger y. k 74 Agente: Curell Suñol, Marcelino 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 138 197 1 Int. Cl. 6 : A61K 7/06 12 TRADUCCION DE PATENTE EUROPEA T3 86 Número de solicitud europea: 9914382.7 86 Fecha de presentación

Más detalles

Análisis de la Proliferación y Apoptosis. Lic. En Bioquímica Carolina Leimgruber

Análisis de la Proliferación y Apoptosis. Lic. En Bioquímica Carolina Leimgruber Análisis de la Proliferación y Apoptosis Lic. En Bioquímica Carolina Leimgruber El funcionamiento adecuado de cualquier organismo depende de su capacidad para producir nuevas células y de eliminar aquellas

Más detalles

Radiación y Cáncer. Karel van Wely 23-10 - 2012. -) El cáncer, consecuencia de un problema biológico

Radiación y Cáncer. Karel van Wely 23-10 - 2012. -) El cáncer, consecuencia de un problema biológico Radiación y Cáncer Karel van Wely 23-10 - 2012 -) Una definición del cáncer -) El cáncer, consecuencia de un problema biológico -) el ambiente, donde aparece el cáncer? -) estadios diferentes de la carcinogénesis

Más detalles

Comisión Nacional del Mercado de Valores Att. Director del Área de Mercados C/ Edison nº4 28006 Madrid. Madrid, a 20 de Noviembre de 2014

Comisión Nacional del Mercado de Valores Att. Director del Área de Mercados C/ Edison nº4 28006 Madrid. Madrid, a 20 de Noviembre de 2014 Comisión Nacional del Mercado de Valores Att. Director del Área de Mercados C/ Edison nº4 28006 Madrid Madrid, a 20 de Noviembre de 2014 De conformidad con lo previsto en el artículo 82 de la Ley del Mercado

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

FISIOLOGÍA GENERAL Jesús Merino Pérez y María José Noriega Borge

FISIOLOGÍA GENERAL Jesús Merino Pérez y María José Noriega Borge CRECIMIENTO Y DIFERENCIACIÓN CELULAR CICLO CELULAR El ciclo celular se describe como la secuencia general de acontecimientos que se producen durante la vida de una célula eucariota y se divide en cuatro

Más detalles

11 Número de publicación: 2 257 319. 51 Int. Cl.: 72 Inventor/es: Butler, Terri y St. Cyr, John. 74 Agente: Zuazo Araluze, Alexander

11 Número de publicación: 2 257 319. 51 Int. Cl.: 72 Inventor/es: Butler, Terri y St. Cyr, John. 74 Agente: Zuazo Araluze, Alexander 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 27 319 1 Int. Cl.: A61K 31/704 (06.01) A61P 21/00 (06.01) 12 TRADUCCIÓN DE PATENTE EUROPEA T3 86 Número de solicitud europea:

Más detalles

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN 5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN Materiales - Eppendorf de 1,5 ml estériles - Eppendorf de pared fina para PCR - Puntas de pipeta estériles desechables - Guantes

Más detalles

Identificación y caracterización de células madres cancerígenas (CMCs) en Sarcoma de Ewing

Identificación y caracterización de células madres cancerígenas (CMCs) en Sarcoma de Ewing Identificación y caracterización de células madres cancerígenas (CMCs) en Sarcoma de Ewing Introducción Una célula madre o célula troncal es una célula que tiene capacidad de autorrenovarse mediante divisiones

Más detalles

Bioquímica III- 2009

Bioquímica III- 2009 Facultad de Ciencias Exactas, Universidad Nacional de La Plata Bioquímica III- 2009 Trabajo Práctico Nro 4 Extracción de RNA y DNA bacteriano INTRODUCCIÓN El RNA es el ácido nucleico más abundante en la

Más detalles

Aplicación de los microarrays de DNA al estudio de la resistencia a isoniazida en Mycobacterium tuberculosis

Aplicación de los microarrays de DNA al estudio de la resistencia a isoniazida en Mycobacterium tuberculosis Aplicación de los microarrays de DNA al estudio de la resistencia a isoniazida en Mycobacterium tuberculosis PNAS, 22: 12833-12838 (1999) Tuberculosis La tuberculosis es una enfermedad crónica infecciosa

Más detalles

11 Número de publicación: 2 214 126. 21 Número de solicitud: 200300131. 51 Int. Cl. 7 : A61K 31/167. 72 Inventor/es: Torne Cabanes, Montserrat

11 Número de publicación: 2 214 126. 21 Número de solicitud: 200300131. 51 Int. Cl. 7 : A61K 31/167. 72 Inventor/es: Torne Cabanes, Montserrat 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 214 126 21 Número de solicitud: 00131 1 Int. Cl. 7 : A61K 31/167 A61K 31/137 A61K 38/47 12 SOLICITUD DE PATENTE A1 22 Fecha de

Más detalles

11 knúmero de publicación: 2 176 397. 51 kint. Cl. 7 : A61K 38/48. k 72 Inventor/es: Lebovitz, Shamir. k 74 Agente: Durán Moya, Carlos

11 knúmero de publicación: 2 176 397. 51 kint. Cl. 7 : A61K 38/48. k 72 Inventor/es: Lebovitz, Shamir. k 74 Agente: Durán Moya, Carlos 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 176 397 1 Int. Cl. 7 : A61K 38/48 12 TRADUCCION DE PATENTE EUROPEA T3 86 Número de solicitud europea: 962193.7 86 Fecha de presentación:

Más detalles

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR Módulo 1 Amplificación de un fragmento de ADN genómico por PCR En este primer módulo se amplificará por PCR, mediante el uso de oligonucleótidos específicos, un fragmento de ADN genómico de Aspergillus

Más detalles

MUERTE CELULAR PROGRAMADA

MUERTE CELULAR PROGRAMADA MUERTE CELULAR PROGRAMADA Dulce María Delgadillo Dulce María Delgadillo (ciudad de México, 1965) es licenciada en biología por la UNAM, maestra en ciencias del Centro de Investigación y de Estudios Avanzados

Más detalles

DIAGNÓSTICO GENÉTICO DE LA HIPERCOLESTEROLEMIA FAMILIAR POR RFLP Ref.PCRCOLEST(4 prácticas)

DIAGNÓSTICO GENÉTICO DE LA HIPERCOLESTEROLEMIA FAMILIAR POR RFLP Ref.PCRCOLEST(4 prácticas) DIAGNÓSTICO GENÉTICO DE LA HIPERCOLESTEROLEMIA FAMILIAR POR RFLP Ref.PCRCOLEST(4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios

Más detalles

11 Número de publicación: 2 195 764. 21 Número de solicitud: 200200188. 51 Int. Cl. 7 : A61K 35/80. 72 Inventor/es: Gasso Casademunt, Francisco

11 Número de publicación: 2 195 764. 21 Número de solicitud: 200200188. 51 Int. Cl. 7 : A61K 35/80. 72 Inventor/es: Gasso Casademunt, Francisco 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 19 764 21 Número de solicitud: 00188 1 Int. Cl. 7 : A61K 3/80 A61K 31/1 A61K 31/2 12 PATENTE DE INVENCIÓN B1 22 Fecha de presentación:

Más detalles

Materiales y Métodos RESULTADOS

Materiales y Métodos RESULTADOS Materiales y Métodos RESULTADOS Materiales y Métodos 131 4. RESULTADOS RI. ANÁLISIS DE LA ACTIVIDAD CITOTÓXICA DE LA WP631 EN LAS LÍNEAS CELULARES JURKAT T, MCF-7/VP Y MDA-MB-231 4.1. DETERMINACIÓN DE

Más detalles

TRABAJO PRÁCTICO Nº 5: ÁCIDOS NUCLEICOS DESCRIPCIÓN DE LOS MÉTODOS A UTILIZAR

TRABAJO PRÁCTICO Nº 5: ÁCIDOS NUCLEICOS DESCRIPCIÓN DE LOS MÉTODOS A UTILIZAR TRABAJO PRÁCTICO Nº 5: ÁCIDOS NUCLEICOS DOCENTES: Andrés Ciocchini, Gabriela Niemirowicz. DESCRIPCIÓN DE LOS MÉTODOS A UTILIZAR Purificación de ácido desoxiribonucleico (ADN) por partición diferencial

Más detalles

11 knúmero de publicación: 2 170 760. 51 kint. Cl. 7 : A61K 31/711

11 knúmero de publicación: 2 170 760. 51 kint. Cl. 7 : A61K 31/711 k 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 knúmero de publicación: 2 170 7 1 kint. Cl. 7 : A61K 31/711 A61K 48/00 A61K 38/18 12 k TRADUCCION DE PATENTE EUROPEA T3 86 knúmero de solicitud europea:

Más detalles

Int. Cl.: 72 Inventor/es: Saviola, Gianantonio. 74 Agente: Álvarez López, Fernando

Int. Cl.: 72 Inventor/es: Saviola, Gianantonio. 74 Agente: Álvarez López, Fernando 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 288 898 1 Int. Cl.: A61K 31/7048 (06.01) A61P 19/02 (06.01) 12 TRADUCCIÓN DE PATENTE EUROPEA T3 86 Número de solicitud europea:

Más detalles

11 Número de publicación: 2 281 508. 51 Int. Cl.: 74 Agente: Curell Suñol, Marcelino

11 Número de publicación: 2 281 508. 51 Int. Cl.: 74 Agente: Curell Suñol, Marcelino 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 281 08 1 Int. Cl.: B01J 2/ (06.01) A23P 1/06 (06.01) 12 TRADUCCIÓN DE PATENTE EUROPEA T3 86 Número de solicitud europea: 02712667.1

Más detalles

11 knúmero de publicación: 2 194 983. 51 kint. Cl. 7 : A61K 38/40

11 knúmero de publicación: 2 194 983. 51 kint. Cl. 7 : A61K 38/40 k 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 knúmero de publicación: 2 194 983 1 kint. Cl. 7 : A61K 38/ //C07K 14/79, A61P 41/00 12 k TRADUCCION DE PATENTE EUROPEA T3 86 knúmero de solicitud europea:

Más detalles

11 Número de publicación: 2 221 928. 51 Int. Cl. 7 : A61P 17/00. 74 Agente: Díez de Rivera y Elzaburu, Ignacio

11 Número de publicación: 2 221 928. 51 Int. Cl. 7 : A61P 17/00. 74 Agente: Díez de Rivera y Elzaburu, Ignacio 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 221 928 1 Int. Cl. 7 : A61P 17/00 12 TRADUCCIÓN DE PATENTE EUROPEA T3 86 Número de solicitud europea: 990880.1 86 Fecha de presentación:

Más detalles

39. Aislamiento y purificación del DNA de un plásmido recombinante

39. Aislamiento y purificación del DNA de un plásmido recombinante 39. Aislamiento y purificación del DNA de un plásmido recombinante Aurora Galván Cejudo, Manuel Tejada, Antonio Camargo, José Javier Higuera, Vicente Mariscal, Emilio Fernández Reyes Departamento de Bioquímica

Más detalles

5. MATERIALES Y MÉTODOS

5. MATERIALES Y MÉTODOS 5. MATERIALES Y MÉTODOS 5.1 Equipos Los siguientes termocicladores se emplearon para la amplificación por PCR: - Perkin Elmer, GeneAmp PCR System 2400. - Perkin Elmer, GeneAmp PCR System 9600. - Applied

Más detalles

51 Int. CI.: A61M 1/02 (2006.01) TRADUCCIÓN DE PATENTE EUROPEA. Título: Dispositivo de extracción de sangre de la placenta y del cordón umbilical

51 Int. CI.: A61M 1/02 (2006.01) TRADUCCIÓN DE PATENTE EUROPEA. Título: Dispositivo de extracción de sangre de la placenta y del cordón umbilical 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 432 672 1 Int. CI.: A61M 1/02 (06.01) 12 TRADUCCIÓN DE PATENTE EUROPEA T3 96 Fecha de presentación y número de la solicitud europea:

Más detalles

11 knúmero de publicación: 2 188 513. 51 kint. Cl. 7 : A61K 31/519

11 knúmero de publicación: 2 188 513. 51 kint. Cl. 7 : A61K 31/519 k 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 knúmero de publicación: 2 188 13 1 kint. Cl. 7 : A61K 31/19 A61P 2/ 12 k TRADUCCION DE PATENTE EUROPEA T3 86 knúmero de solicitud europea: 009649.3

Más detalles

11 knúmero de publicación: 2 134 021. 51 kint. Cl. 6 : A61M 5/32. k 73 Titular/es: NOVO NORDISK A/S. k 72 Inventor/es: Smedegaard, Jorgen K.

11 knúmero de publicación: 2 134 021. 51 kint. Cl. 6 : A61M 5/32. k 73 Titular/es: NOVO NORDISK A/S. k 72 Inventor/es: Smedegaard, Jorgen K. 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 134 021 1 Int. Cl. 6 : A61M /32 12 TRADUCCION DE PATENTE EUROPEA T3 86 Número de solicitud europea: 9694196.7 86 Fecha de presentación

Más detalles

k 11 N. de publicación: ES 2 051 708 k 51 Int. Cl. 5 : A61K 31/715 k 72 Inventor/es: Ochi, Takahiro k 74 Agente: Ungría Goiburu, Bernardo

k 11 N. de publicación: ES 2 051 708 k 51 Int. Cl. 5 : A61K 31/715 k 72 Inventor/es: Ochi, Takahiro k 74 Agente: Ungría Goiburu, Bernardo k 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA k 11 N. de publicación: ES 2 01 708 k 1 Int. Cl. : A61K 31/71 k 12 TRADUCCION DE PATENTE EUROPEA T3 k k k k 86 Número de solicitud europea: 87732.4 86

Más detalles

11 Número de publicación: 2 267 932. 51 Int. Cl.: 74 Agente: Carpintero López, Francisco

11 Número de publicación: 2 267 932. 51 Int. Cl.: 74 Agente: Carpintero López, Francisco 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 267 932 1 Int. Cl.: A61Q 19/00 (06.01) A61K 8/44 (06.01) 12 TRADUCCIÓN DE PATENTE EUROPEA T3 86 Número de solicitud europea:

Más detalles

CICLO 2 : Fraccionamiento subcelular

CICLO 2 : Fraccionamiento subcelular Curso de Fisicoquímica Biológica 2006 Licenciatura de Bioquímica. Facultad de Ciencias. CICLO 2 : Fraccionamiento subcelular OBJETIVOS GENERALES: 1) Obtención de preparados enriquecidos en fracciones subcelulares

Más detalles

k 11 N. de publicación: ES 2 054 077 k 51 Int. Cl. 5 : A61K 31/195 k 72 Inventor/es: Cehovic, Georges y k 74 Agente: Curell Suñol, Marcelino

k 11 N. de publicación: ES 2 054 077 k 51 Int. Cl. 5 : A61K 31/195 k 72 Inventor/es: Cehovic, Georges y k 74 Agente: Curell Suñol, Marcelino 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 N. de publicación: ES 2 04 077 1 Int. Cl. : A61K 31/19 12 TRADUCCION DE PATENTE EUROPEA T3 86 Número de solicitud europea: 89007.3 86 Fecha de presentación

Más detalles

Int. Cl. 7 : A61K 38/46

Int. Cl. 7 : A61K 38/46 k 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 k Número de publicación: 2 181 92 21 k Número de solicitud: 01383 1 k Int. Cl. 7 : A61K 38/46 A61P 17/12 k 12 SOLICITUD DE PATENTE A1 22 kfecha de presentación:

Más detalles

MECANISMO DE EVASIÓN DE LA RESPUESTA INMUNE POR CÉLULAS DE CÁNCER CERVICAL: APOPTOSIS INDUCIDA SOBRE CÉLULAS LINFOIDES.

MECANISMO DE EVASIÓN DE LA RESPUESTA INMUNE POR CÉLULAS DE CÁNCER CERVICAL: APOPTOSIS INDUCIDA SOBRE CÉLULAS LINFOIDES. MECANISMO DE EVASIÓN DE LA RESPUESTA INMUNE POR CÉLULAS DE CÁNCER CERVICAL: APOPTOSIS INDUCIDA SOBRE CÉLULAS LINFOIDES. Laura Padierna Mota 1,2, Paula Figueroa-Arredondo 1, Fernando Enríquez-Rincón 2.

Más detalles

CAPÍTULO IV. Proliferación en 3T3 y MCF-7

CAPÍTULO IV. Proliferación en 3T3 y MCF-7 CAPÍTULO IV Proliferación en 3T3 y MCF-7 1.- Introducción 2.- Irradiación y cultivo de 3T3 y MCF-7 3.- Resultados en 3T3 4.- Resultados en MCF-7 5.- Discusión 1.- Introducción La metodología general de

Más detalles

11 knúmero de publicación: 2 193 698. 51 kint. Cl. 7 : A01N 65/00. k 72 Inventor/es: Subba Rao, Pillarisetti Venkata;

11 knúmero de publicación: 2 193 698. 51 kint. Cl. 7 : A01N 65/00. k 72 Inventor/es: Subba Rao, Pillarisetti Venkata; 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 193 698 1 Int. Cl. 7 : A01N 6/00 12 TRADUCCION DE PATENTE EUROPEA T3 86 Número de solicitud europea: 9991828.7 86 Fecha de presentación:

Más detalles

TEMA 33 Envejecimiento y muerte celular

TEMA 33 Envejecimiento y muerte celular TEMA 33 Envejecimiento y muerte celular 33.1.- Introducción. Un hecho evidente es que la duración de la vida es limitada. A lo largo de la vida encontramos una serie de etapas, marcadas en un principio

Más detalles

11 knúmero de publicación: 2 192 217. 51 kint. Cl. 7 : A61K 31/135. k 72 Inventor/es: Johnson, Brian F. k 74 Agente: Carpintero López, Francisco

11 knúmero de publicación: 2 192 217. 51 kint. Cl. 7 : A61K 31/135. k 72 Inventor/es: Johnson, Brian F. k 74 Agente: Carpintero López, Francisco 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 192 217 1 Int. Cl. 7 : A61K 31/13 12 TRADUCCION DE PATENTE EUROPEA T3 86 Número de solicitud europea: 964906.9 86 Fecha de presentación:

Más detalles

11 knúmero de publicación: 2 150 566. 51 kint. Cl. 7 : A61K 38/26. k 72 Inventor/es: Dupre, John. k 74 Agente: Manresa Val, Manuel

11 knúmero de publicación: 2 150 566. 51 kint. Cl. 7 : A61K 38/26. k 72 Inventor/es: Dupre, John. k 74 Agente: Manresa Val, Manuel k 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 knúmero de publicación: 2 150 566 51 kint. Cl. 7 : A61K 38/26 k 12 TRADUCCION DE PATENTE EUROPEA T3 k k k k 86 Número de solicitud europea: 95917874.0

Más detalles

(Estudios in vivo y estudios in vitro)

(Estudios in vivo y estudios in vitro) (Estudios in vivo y estudios in vitro) IN VIVO: es la experimentación con un todo, que viven organismos en comparación. Ensayos con animales y ensayos clínicos son dos formas de investigación in vivo.

Más detalles

Prevención secundaria de recurrencias de cáncer de hígado asociado a hepatitis B con nuevas drogas quimioterapéuticas

Prevención secundaria de recurrencias de cáncer de hígado asociado a hepatitis B con nuevas drogas quimioterapéuticas Prevención secundaria de recurrencias de cáncer de hígado asociado a hepatitis B con nuevas drogas quimioterapéuticas Frederick Arce Maestría en Ciencias Biomédicas Mención en Fisiología Celular Universidad

Más detalles

11 Número de publicación: 2 221 030. 51 Int. Cl. 7 : A61K 31/23. 74 Agente: Suárez Díaz, Jesús

11 Número de publicación: 2 221 030. 51 Int. Cl. 7 : A61K 31/23. 74 Agente: Suárez Díaz, Jesús 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 221 0 1 Int. Cl. 7 : A61K 31/23 A61K 9/08 A61K 31/232 A61P 27/02 12 TRADUCCIÓN DE PATENTE EUROPEA T3 86 Número de solicitud europea:

Más detalles

Costa Rica: Grupo Bioquímica (Coordinadora: Dra. Cecilia Díaz) Natalia Ortiz Chaves

Costa Rica: Grupo Bioquímica (Coordinadora: Dra. Cecilia Díaz) Natalia Ortiz Chaves Costa Rica: Grupo Bioquímica (Coordinadora: Dra. Cecilia Díaz) Natalia Ortiz Chaves Noviembre-2012 Grupo de trabajo 1. Cecilia Díaz Oreiro (coordinadora) 2. Natalia Ortiz Chaves 3. Ernesto Vargas Méndez

Más detalles

Fármacos antitumorales e Inmunosupresores. Prof. Emilio Puche Cañas

Fármacos antitumorales e Inmunosupresores. Prof. Emilio Puche Cañas Fármacos antitumorales e Inmunosupresores Prof. Emilio Puche Cañas características del cáncer aumento proliferación celular (tumor) pérdida señales reguladoras crecimiento celular inestabilidad genómica

Más detalles

11 Número de publicación: 2 208 222. 51 Int. Cl. 7 : B21J 15/04. 74 Agente: Isern Jara, Jorge

11 Número de publicación: 2 208 222. 51 Int. Cl. 7 : B21J 15/04. 74 Agente: Isern Jara, Jorge 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 208 222 51 Int. Cl. 7 : B21J 15/04 B21J 15/06 12 TRADUCCIÓN DE PATENTE EUROPEA T3 86 Número de solicitud europea: 00301734.0

Más detalles

11 kn. de publicación: ES 2 083 160. 51 kint. Cl. 6 : A23D 7/00. k 72 Inventor/es: Byrne, Charles Michael; k 74 Agente: Curell Suñol, Marcelino

11 kn. de publicación: ES 2 083 160. 51 kint. Cl. 6 : A23D 7/00. k 72 Inventor/es: Byrne, Charles Michael; k 74 Agente: Curell Suñol, Marcelino 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 N. de publicación: ES 2 083 1 1 Int. Cl. 6 : A23D 7/00 12 TRADUCCION DE PATENTE EUROPEA T3 86 Número de solicitud europea: 929062.0 86 Fecha de presentación

Más detalles

y desinfección. Medios de cultivo. Objetivos Métodos de esterilización Definiciones Calor seco Calor seco MECÁNICOS FISICOS: QUIMICOS

y desinfección. Medios de cultivo. Objetivos Métodos de esterilización Definiciones Calor seco Calor seco MECÁNICOS FISICOS: QUIMICOS Métodos de esterilización y desinfección. n. Medios de cultivo. Curso: Diagnósticos en Fitopatología 17 de setiembre de 2015 Ing. Agr. MSc. Vivienne Gepp Objetivos Familiarizarse con los procesos de desinfección

Más detalles

11 Número de publicación: 2 239 769. 51 Int. Cl. 7 : A61K 31/05. 72 Inventor/es: Oxford, John, Sidney. 74 Agente: Lehmann Novo, María Isabel

11 Número de publicación: 2 239 769. 51 Int. Cl. 7 : A61K 31/05. 72 Inventor/es: Oxford, John, Sidney. 74 Agente: Lehmann Novo, María Isabel 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 239 769 1 Int. Cl. 7 : A61K 31/0 A61K 31/4 // (A61K 31/0 A61K 31:04) 12 TRADUCCIÓN DE PATENTE EUROPEA T3 86 Número de solicitud

Más detalles

11 Número de publicación: 2 215 268. 51 Int. Cl. 7 : A61K 38/29. 74 Agente: Carpintero López, Francisco

11 Número de publicación: 2 215 268. 51 Int. Cl. 7 : A61K 38/29. 74 Agente: Carpintero López, Francisco 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 21 268 1 Int. Cl. 7 : A61K 38/29 A61K 9/08 A61K 47/ A61K 47/26 A61P 19/ 12 TRADUCCIÓN DE PATENTE EUROPEA T3 86 Número de solicitud

Más detalles

11 knúmero de publicación: 2 175 989. 51 kint. Cl. 7 : C07J 1/00

11 knúmero de publicación: 2 175 989. 51 kint. Cl. 7 : C07J 1/00 k 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 knúmero de publicación: 2 17 989 1 kint. Cl. 7 : C07J 1/00 A61K 31/6 12 k TRADUCCION DE PATENTE EUROPEA T3 86 knúmero de solicitud europea: 999298.9

Más detalles

EVALUACIÓN DE CASIOPEÍNAS EN GLIOBLASTOMA U-373 EMPLEANDO EL MODELO DE XENOTRANSPLANTACIÓN EN RATÓN DESNUDO

EVALUACIÓN DE CASIOPEÍNAS EN GLIOBLASTOMA U-373 EMPLEANDO EL MODELO DE XENOTRANSPLANTACIÓN EN RATÓN DESNUDO EVALUACIÓN DE CASIOPEÍNAS EN GLIOBLASTOMA U-373 EMPLEANDO EL MODELO DE XENOTRANSPLANTACIÓN EN RATÓN DESNUDO Rico Morales H. A. 1, Macías Rosales L. 1, Rivera Huerta M. 1, Tinoco Méndez M. 1, Gracia Mora

Más detalles

Parámetros bioquímicos enzimáticos (ALT, AST, ALP, γ-gt, LDH) en niños con leucemia linfoblástica aguda antes del tratamiento antineoplásico

Parámetros bioquímicos enzimáticos (ALT, AST, ALP, γ-gt, LDH) en niños con leucemia linfoblástica aguda antes del tratamiento antineoplásico Parámetros bioquímicos enzimáticos (ALT, AST, ALP, γ-gt, LDH) en niños con leucemia linfoblástica aguda antes del tratamiento antineoplásico 1 2 RESUMEN Objetivo: Material y Métodos: datos. valores normales,

Más detalles

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN.

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. PROGRAMA CONTROL DE CALIDAD DE MUESTRAS El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. El programa completo de control de calidad de muestras de ADN y ARN engloba diferentes

Más detalles

11 Número de publicación: 2 274 567. 51 Int. Cl.: 74 Agente: Ungría López, Javier

11 Número de publicación: 2 274 567. 51 Int. Cl.: 74 Agente: Ungría López, Javier 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 274 67 1 Int. Cl.: A61K 38/18 (06.01) A61P 7/06 (06.01) A61P 3/02 (06.01) 12 TRADUCCIÓN DE PATENTE EUROPEA T3 86 Número de solicitud

Más detalles

En los años cincuenta esta técnica entró en una fase de expansión, al dejar de cultivar tejidos resecados para cultivar células dispersas.

En los años cincuenta esta técnica entró en una fase de expansión, al dejar de cultivar tejidos resecados para cultivar células dispersas. El cultivo celular inició su desarrollo a principios del siglo XX (Harrison, 1907; Carrel, 1912) como un método para el estudio del comportamiento de las células animales, libre de las influencias sistémicas

Más detalles

La Regulación del Ciclo Celular, la Apoptosis y el Cáncer

La Regulación del Ciclo Celular, la Apoptosis y el Cáncer La Regulación del Ciclo Celular, la Apoptosis y el Cáncer Compilado por Prof. F. Arturo Russell Las células proliferan aumentando su contenido de moléculas y organelos (crecimiento en masa o tamaño) y

Más detalles

ACTIVIDAD PRACTICA No. 8 BIOLOGIA CELULAR EXTRACCIÓN DE ADN

ACTIVIDAD PRACTICA No. 8 BIOLOGIA CELULAR EXTRACCIÓN DE ADN Universidad Centroccidental Lisandro Alvarado Decanato de Ciencias de la Salud ACTIVIDAD PRACTICA No. 8 BIOLOGIA CELULAR EXTRACCIÓN DE ADN Octubre 2009 INTRODUCCION La molécula de ADN (que es la que se

Más detalles

Nutrición y salud en grupos específicos de población (adultos de edad avanzada). Interacción entre I+D y Cadena Alimentaria.

Nutrición y salud en grupos específicos de población (adultos de edad avanzada). Interacción entre I+D y Cadena Alimentaria. XV F XV Foro de Colaboración Público Privada d C l b ió Públi P i d Nutrición y salud en grupos específicos de población y g p p f p (adultos de edad avanzada). Interacción entre I+D y Cadena Alimentaria.

Más detalles

Cultura Cientí fica 1 Bachillerato

Cultura Cientí fica 1 Bachillerato Cultura Cientí fica 1 Bachillerato 3. La revolución genética: biotecnología Actividades de consolidación 1. Cualquier molécula de ADN formada por la unión de segmentos de ADN de origen diferente es: a)

Más detalles

11 knúmero de publicación: 2 192 608. 51 kint. Cl. 7 : A61K 31/135

11 knúmero de publicación: 2 192 608. 51 kint. Cl. 7 : A61K 31/135 k 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 knúmero de publicación: 2 192 8 1 kint. Cl. 7 : A61K 31/13 A61P 1/04 A61P 31/ A61P 3/00 12 k TRADUCCION DE PATENTE EUROPEA T3 86 k Número de solicitud

Más detalles

Capítulo 7.3. Resumen para no expertos

Capítulo 7.3. Resumen para no expertos Resumen para no expertos Comunicación bacteriana y síntesis de antibióticos La comunicación es un factor esencial para todos los seres vivos. Las bacterias, en concreto, se comunican utilizando pequeños

Más detalles

11 knúmero de publicación: 2 177 666. 51 kint. Cl. 7 : A61K 31/70

11 knúmero de publicación: 2 177 666. 51 kint. Cl. 7 : A61K 31/70 k 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 knúmero de publicación: 2 177 666 1 kint. Cl. 7 : A61K 31/70 C07H 7/027 A61K 31/71 A61P 43/00 12 k TRADUCCION DE PATENTE EUROPEA T3 86 k Número de solicitud

Más detalles

INTRODUCCIÓN AL CULTIVO CELULAR

INTRODUCCIÓN AL CULTIVO CELULAR INTRODUCCIÓN AL CULTIVO CELULAR Cultivo celular: Es un modelo de estudio in vitro constituido por células que pueden crecer y mantenerse en suspensión o en monocapa por más de 24 horas en condiciones controladas.

Más detalles

11 Número de publicación: 2 284 498. 51 Int. Cl.: 72 Inventor/es: West, Michael, Robert. 74 Agente: Elzaburu Márquez, Alberto

11 Número de publicación: 2 284 498. 51 Int. Cl.: 72 Inventor/es: West, Michael, Robert. 74 Agente: Elzaburu Márquez, Alberto 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 284 498 51 Int. Cl.: G01N 33/68 (2006.01) 12 TRADUCCIÓN DE PATENTE EUROPEA T3 86 Número de solicitud europea: 00931424.6 86 Fecha

Más detalles

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

11 knúmero de publicación: 2 138 812. 51 kint. Cl. 6 : B65D 75/58

11 knúmero de publicación: 2 138 812. 51 kint. Cl. 6 : B65D 75/58 k 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 knúmero de publicación: 2 138 812 1 kint. Cl. 6 : B6D 7/8 A61F 6/00 12 k TRADUCCION DE PATENTE EUROPEA T3 86 knúmero de solicitud europea: 969922.2

Más detalles

k 11 N. de publicación: ES 2 038 643 k 51 Int. Cl. 5 : A61K 31/58

k 11 N. de publicación: ES 2 038 643 k 51 Int. Cl. 5 : A61K 31/58 k 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA k 11 N. de publicación: ES 2 038 643 k 1 Int. Cl. : A61K 31/8 A61K 47/00 12 k TRADUCCION DE PATENTE EUROPEA T3 86 knúmero de solicitud europea: 87114368.1

Más detalles

NEUROPROTECCIÓN EN ESCLEROSIS MÚLTIPLE: UNA ESTRATEGIA A FUTURO?

NEUROPROTECCIÓN EN ESCLEROSIS MÚLTIPLE: UNA ESTRATEGIA A FUTURO? NEUROPROTECCIÓN EN ESCLEROSIS MÚLTIPLE: UNA ESTRATEGIA A FUTURO? Por Vladimiro Sinay Encargado del Área de Enfermedades Desmielinizantes. Instituto de Neurociencias de Fundación Favaloro. Durante años

Más detalles

OBTENCIÓN DE MUTANTES

OBTENCIÓN DE MUTANTES OBTENCIÓN DE MUTANTES parp::hyg DE Fusarium oxysporum f. sp. lycopersici MEDIANTE LA TÉCNICA PCR DE DOBLE FUSIÓN. Gallegos Almanza I. A. (1) ; Martínez Cadena M. G. (2) ; Ferrel Cano L. E. (2). (1) Facultad

Más detalles