Save this PDF as:

Tamaño: px
Comenzar la demostración a partir de la página:




2 Índice Identificación y cuantificación de cianobacterias potencialmente tóxicas Taxonomía de cianobacterias Métodos de detección y cuantificación de cianotoxinas Métodos cromatográficos Otros métodos: ELISA, PP1 Resumen

3 METODOLOGÍAS Recepción de las muestras Identificación taxonómica Preparación Determinación Tox. disolución Determinación Tox. particulada Fluorómetro, Microscopio Filtración, extracción, concentración ELISA, LC/MS ELISA, PP, LC-MS, HPLC


5 TAXONOMÍA DE CIANOBACTERIAS Criterios tradicionalmente morfológicos (aspecto), actualmente además genéticos y fisiológicos. Órdenes familias (subfamilias) géneros especies (variedades). Más de 2000 especies. Constantes variaciones por revisión de expertos.

6 CIANOBACTERIAS POTENCIALMENTE TÓXICAS Alguna de sus cepas a nivel mundial ha sido tóxica. Potencial siempre tóxico Unos 20 géneros tóxicos descritos. Aprox. 25 especies potencialmente tóxicas en España. Los más importantes en España: Microcystis (Microcistinas), Aphanizomenon (Cilindrospermopsina), Anabaena (anatoxina-a) Cylindrospermopsis, Planktothrix, Woronichinia,etc

7 COLONIALES (Orden Chroococcales) Microcystis aeruginosa 50 µm

8 FILAMENTOSAS SIN HETEROCISTOS (Orden Oscillatoriales) Planktothrix agardhii 10 µm

9 FILAMENTOSAS CON HETEROCISTOS (Orden Nostocales) ACINETO HETEROCISTO ACINETO HETEROCISTO Aphanizomenon flos-aquae Anabaena crassa Aphanizomenon ovalisporum

10 FLOTACIÓN vs UTERMÖHL FLOTACIÓN UTERMÖHL Tipo de muestra Viva Fijada (lugol) Microscopio Óptico Óptico invertido Cuantificación Abundancia relativa (%) Concentración de Células Biovolumen Ventajas Inconvenientes Aplicación recomendada Rápido Evita otras algas subestima taxones no formadores de blooms Cuantificación poco precisa Gestión: detección rápida de especies más abundantes formadoras de acumulados Cuantificación precisa Método estandarizado (norma UNE-EN 15204:2007) Tedioso Lugol altera aspecto real Demasiadas especies Posible subestimación de formadoras de scums?? Investigación y/o gestión a medio plazo: seguimientos temporales precisos Experto Recomendable Imprescindible

11 CLAVE DE IDENTIFICACIÓN (MUY) SIMPLIFICADA Unicelular, colonial, filamentosa? Unicelular Colonial Filamentosa Microcystis? Woronichinia? NO Heterocistos? SÍ OSCILATORIALES NOSTOCALES Planktothrix? NO Anabaena? Cylindrospermopsis? Apuntamiento? Aphanizomenon? SÍ

12 Métodos de detección y cuantificación de cianotoxinas Métodos cromatográficos de detección Técnicas para la separación de compuestos en una mezcla que permita una detección individualizada de uno o varios analitos Constan de: 1.Separación cromatográfica 2.Detección Empleados en muy diversos campos

13 Separación cromatográfica 1.Compuestos añadidos conjuntamente a una fase móvil 2.Compuestos atraviesan fase estacionaria 3.Los compuestos son retenidos o eluidos según sus características químicas o físico químicas 4.Los compuestos abandonan la fase estacionaria ordenados inversamente a su grado de retención


15 RT: 0,56-77, , ,73 NL: 6,81E8 TIC MS , , , , , , , , ,61 9, , , , , , , , , , , , , , , , ,63 77, Time (min)


17 RT: 5,11-23, Time (min) , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , ,04 NL: 6,81E8 TIC MS NL: 2,28E7 m/z= 994,50-995,50 MS NL: 2,08E8 m/z= 519,50-520,50 MS NL: 1,48E7 m/z= 1044, ,50 MS RR -LR -YR

18 Otros métodos de análisis de Microcistinas -Test de Inhibición de Protein-fosfatasa (PPI) - Ensayo de inmunodetección (ELISA)

19 PPI-test (Inhibición enzimática de la protein fosfatasa) Kit comercial (ZEU- Inmunotec) Microcistinas Inhibición de enzimas proteinfosfatasas (tipos 1 y 2A) Principio: Reducción de la defosforilación como medida indirecta de su concentración. Extracto Pfasa + Sustrato (pnitrofenolfosfato) Defosforilación (cambio de color) Cuantificación por absorbancia 405nm Microcistinas

20 ELISA Enzyme-linked inmunosorbent assay Kits comerciales (Envirogard, ) Basado en la interacción entre anticuerpos y toxina. Mecanismo: 1. Placa multipocillo con anticuerpos 2. Adición de muestra [MC desconocida] 3. Adición de conjugado MC-enzima Unión competitiva a sitios de unión 4. Adición de sustrato (genera color en presencia del conjugado) 5. Medición de la absorbancia a 450nm

21 Selectividad RMN MALDI-TOF LC/MS Bioensayo HPLC ELISA PP µg ng pg fg Sensibilidad

22 Gracias!!

Cuantificación de Clorofila a

Cuantificación de Clorofila a Cuantificación de Clorofila a Clorofilas Las clorofilas son una familia de pigmentos de color verde que se encuentran en las cianobacterias y en todos aquellos organismos que contienen cloroplastos en

Más detalles



Más detalles



Más detalles



Más detalles


CROMATOGRAFÍA DE GASES ACOPLADO A UN DETECTOR DE MASAS GC/MS CROMATOGRAFÍA DE GASES ACOPLADO A UN DETECTOR DE MASAS GC/MS La cromatografía es una técnica para separar las sustancias químicas que se basa en las diferencias en conductas partitivas de una fase móvil

Más detalles

METODOLOGIA. A. Colección de muestras de agua:

METODOLOGIA. A. Colección de muestras de agua: CUARTA PARTE BIOMASA FOTOTROFOS: CLOROFILAS LA BIOMASA DE FITOPLANCTON puede ser estimada determinando la concentración de pigmentos fotosintéticos en una muestra de agua. Midiendo la concentración de

Más detalles

ELISA. Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes

ELISA. Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes ELISA Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes ELISA Enzyme Linked Immuno Sorbent Assay Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes

Más detalles


CENTRO NACIONAL DE ALIMENTACIÓN CENTRO NACIONAL DE ALIMENTACIÓN DETECCIÓN DE ALÉRGENOS EN ALIMENTOS Mª Isabel Prieto Santos Servicio de Biotecnología Jornada: Reglamento sobre Información Alimentaria al Consumidor: Compartir experiencias

Más detalles

ELISA. Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes

ELISA. Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes ELISA Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes ELISA Enzyme Linked Immuno Sorbent Assay Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes

Más detalles

El tipo de alteración observada también proporciona gran información:

El tipo de alteración observada también proporciona gran información: TEMA 5: ENZIMOLOGÍA CLÍNICA 1. Valor diagnóstico de las enzimas en el plasma. 2. Principios del análisis de enzimas 3. Análisis de isoenzimas. 4. Determinación enzimática de sustratos. 1. Valor diagnóstico

Más detalles

Monitoreo biológico para la detección temprana de enfermedades ocupacionales. Dr. Ángel L. Rodríguez P.

Monitoreo biológico para la detección temprana de enfermedades ocupacionales. Dr. Ángel L. Rodríguez P. Prevención de enfermedades ocupacionales Control ambiental Control biológico Vigilancia de la salud AMBIENTE DE TRABAJO Concentración Absorción Tiempo de exposición Control ambiental Dosis interna FACTORES

Más detalles


USO PRACTICO E INTERPRETACIÓN DE LA SEROLOGÍA EN CAMPO. Joaquín Girón, MSD AH USO PRACTICO E INTERPRETACIÓN DE LA SEROLOGÍA EN CAMPO. Joaquín Girón, MSD AH El objetivo final de las empresas es tener lotes con muy buenas producciones y económicamente rentables, lógicamente un lote

Más detalles

Control de Calidad en la Técnica de ELISA. Lic. Valentina Bastidas D.

Control de Calidad en la Técnica de ELISA. Lic. Valentina Bastidas D. Control de Calidad en la Técnica de ELISA Lic. Valentina Bastidas D. TÉCNICA DE ELISA DEFINICIÓN E L I S A Ensayo Inmunoabsorbente Ligado a Enzimas Enzime-Linked ImmunoSorbent Assay TIPOS DE ELISA: ELISA

Más detalles

Contenido de este informe

Contenido de este informe A: José Gallero, Oscar Bertoletti DE: Eleonora Scoseria TEMA: Conceptos de antidoping equino para divulgación FECHA: 22/12/2008 Contenido de este informe 1. Conceptos básicos sobre antidoping equino...

Más detalles


APLICAÇÃO DAS TÉCNICAS MOLECULARES NA MONITORIZAÇÃO DE CULTIVOS DE MICROALGAS. Patrícia Alexandra Clemente Janeiro de Assunção APLICAÇÃO DAS TÉCNICAS MOLECULARES NA MONITORIZAÇÃO DE CULTIVOS DE MICROALGAS. Patrícia Alexandra Clemente Janeiro de Assunção Protocolo Básico Identificación (BM) Extracción de ADN Polymerase Chain Reaction

Más detalles


EMBARAZO Y NEONATOLOGÍA EMBARAZO Y NEONATOLOGÍA 1. Introducción 2. Diagnóstico del embarazo 3. Parámetros bioquímicos alterados durante el embarazo 4. Estudio del líquido amniótico para la detección y prevención de alteraciones

Más detalles

La selectividad en análisis químico

La selectividad en análisis químico La selectividad en análisis químico Ricard Boqué Grupo de Quimiometría y Cualimetría Universidad Rovira i Virgili (Tarragona) El concepto de selectividad en análisis químico ha sido objeto de una redefinición

Más detalles

Detección de microorganismos patógenos en los alimentos. Prof. Dr. Luis M. Medina

Detección de microorganismos patógenos en los alimentos. Prof. Dr. Luis M. Medina Detección de microorganismos patógenos en los alimentos Prof. Dr. Luis M. Medina ANÁLISIS MICROBIOLÓGICOS EN ALIMENTOS Indicadores recuento total (BAM ) enterobacteriáceas totales coliformes totales E.

Más detalles


DEFINICIÓN Y CARACTERÍSTICAS DE LA TÉCNICA: EQUIPO AUTOMÁTICO PARA LA DETECCIÓN DE PATÓGENOS minividas-vidas DEFINICIÓN Y CARACTERÍSTICAS DE LA TÉCNICA: Sistema automático de inmunodetección rápida de patógenos basado en la técnica ELFA (Enzyme

Más detalles

Ministerio del Ambiente 1

Ministerio del Ambiente 1 Módulo Didáctico: Recursos Genéticos y Bioseguridad BASES TÉCNICAS PARA LA SEGURIDAD DE BIOTECOLOGÍA Cajamarca, 19 21 junio de 2012 Blgo. David Castro Garro Especialista en Biotecnología Ministerio del

Más detalles


ALERGENOS-DETERMINACIÓN DE LISOZIMA ALERGENOS-DETERMINACIÓN DE LISOZIMA Disertante: Brom. Carolina Chiconofri Departamento de Normas Analíticas Especiales Sub. De Investigación para la Fiscalización Instituto Nacional de Vitivinicultura

Más detalles



Más detalles


ACTIVIDAD PERMANENTE DE MONITOREO DEL EMBALSE SAN ROQUE Y SU CUENCA Informe periódico Nº 2 Desde el año 1998 INA-CIRSA monitorea la calidad de aguas del Embalse San Roque, y de sus ríos tributarios. Principal fuente de abastecimiento para la Ciudad de Córdoba - con una

Más detalles

Detección n de Alérgenos en Alimentos. Actuaciones del Centro Nacional de Alimentación

Detección n de Alérgenos en Alimentos. Actuaciones del Centro Nacional de Alimentación Centro Nacional de Alimentación Detección n de Alérgenos en Alimentos. Actuaciones del Centro Nacional de Alimentación Mª Isabel Prieto Santos Servicio de Biotecnología ALÉRGENOS ALIMENTARIOS Los alérgenos

Más detalles



Más detalles


SEPARACIONES POR CROMATOGRAFÍA SEPARACIONES POR CROMATOGRAFÍA Conceptos generales. Clasificación de los métodos cromatográficos. Separación cromatográfica Esquema básico de un cromatógrafo Cromatografía líquida de alta resolución. HPLC.

Más detalles



Más detalles


LABORATORIO ORGÁNICO LABORATORIO ORGÁNICO LABORATORIO ORGÁNICO Actualmente es uno de los centros más avanzados de Latinoamérica en el control de la seguridad alimentaria. El Laboratorio de Orgánico está compuesto por una serie

Más detalles

Departamento de Bioquímica y Biología Molecular,

Departamento de Bioquímica y Biología Molecular, 18. Inmunoanálisis Aurora Galván Cejudo 1, Isaac Túnez Fiñana 2 Departamento de Bioquímica y Biología Molecular, 1 Campus Universitario de Rabanales, Edificio Severo Ochoa, 14071-Córdoba, 2 Facultad de

Más detalles


INTRODUCCIÓN N A LA HPLC FUNDAMENTOS DEL ANALISIS CROMATOGRAFICO. Cromatografía Líquida de Alta Resolución Dr. JOSÉ ANTONIO FERNÁNDEZ LÓPEZ Depto. Ingeniería Química Grupo de Investigación QUIMYTEC UPCT Cromatografía = escribir

Más detalles


CAPÍTULO 7 ALGAS Y CIANOBACTERIAS EN AGUAS DULCES CAPÍTULO 7 ALGAS Y CIANOBACTERIAS EN AGUAS DULCES En aguas dulces, el término alga se refiere a organismos microscópicos, en principio unicelulares, algunos de los cuales forman colonias y alcanzan dimensiones

Más detalles



Más detalles


TRABAJO PRACTICO Nº 3 ENZIMOINMUNOANALISIS ELISA TRABAJO PRACTICO Nº 3 ENZIMOINMUNOANALISIS ELISA Docentes encargados: Bioq. Natalia Guiñazú Bioq. Maria Sol Renna Biol. Virginia Andreani Bioq. Mauricio Figueredo Bioq. Vanina Garrido Bioq. Laura Dulgerian

Más detalles

Universidad de Belgrano

Universidad de Belgrano Universidad de Belgrano Las tesinas de Belgrano Facultad de Ciencias Exactas y Naturales Carrera de Licenciatura en Ciencias Quimicas Determinación de microcistinas en aguas de captación y tratadas N 446

Más detalles

SEGURIDAD ALIMENTARIA: DETECCIÓN DE ALÉRGENOS Metodologías para la detección de alérgenos

SEGURIDAD ALIMENTARIA: DETECCIÓN DE ALÉRGENOS Metodologías para la detección de alérgenos SEGURIDAD ALIMENTARIA: DETECCIÓN DE ALÉRGENOS Metodologías para la detección de alérgenos Sra. Juliana Roca. Responsable departamento técnico, Bioser, S. A. DERIO, martes 16 de Junio de 2015 1 Alérgenos

Más detalles

Introducción a los Inmunoensayos. GDS_0418723_McClelland_v4 1

Introducción a los Inmunoensayos. GDS_0418723_McClelland_v4 1 Introducción a los Inmunoensayos GDS_0418723_McClelland_v4 1 Introducción a los Inmunoensayos Objetivos del Entrenamiento Una vez finalizado este capítulo, usted podrá: Definir inmunoensayo Describir la

Más detalles

MÉTODOS CROMATOGRÁFICOS: 1. Exclusión molecular 2. Intercambio iónico 3. Afinidad SSN

MÉTODOS CROMATOGRÁFICOS: 1. Exclusión molecular 2. Intercambio iónico 3. Afinidad SSN MÉTODOS CROMATOGRÁFICOS: 1. Exclusión molecular 2. Intercambio iónico 3. Afinidad SSN Propiedades de una proteína que son útiles para su purificación por cromatografía Peso molecular Carga iónica Hidrofobicidad

Más detalles

Universidad de Costa Rica Facultad de Microbiología (Trabajo de graduación para optar por el grado de Licenciatura en Microbiología y Química Clínica)

Universidad de Costa Rica Facultad de Microbiología (Trabajo de graduación para optar por el grado de Licenciatura en Microbiología y Química Clínica) Universidad de Costa Rica Facultad de Microbiología (Trabajo de graduación para optar por el grado de Licenciatura en Microbiología y Química Clínica) IMPACTO DE LAS CIANOTOXINAS EN LA ECOLOGÍA ACUÁTICA

Más detalles

CURSO de ANÁLISIS INSTRUMENTAL I. Catedrática: Dra. Silvia Echeverría, Ph.D., Escuela de Química, Facultad Ciencias Químicas y Farmacia, USAC

CURSO de ANÁLISIS INSTRUMENTAL I. Catedrática: Dra. Silvia Echeverría, Ph.D., Escuela de Química, Facultad Ciencias Químicas y Farmacia, USAC CURSO de ANÁLISIS INSTRUMENTAL I Catedrática: Dra. Silvia Echeverría, Ph.D., Escuela de Química, Facultad Ciencias Químicas y Farmacia, USAC QUÍMICA ANALÍTICA Comprende la metodología para determinar la

Más detalles



Más detalles

Duración del proyecto: 3,5 años.

Duración del proyecto: 3,5 años. Comparación de metodologías para la determinación de toxinas paralizantes en bivalvos relacionadas con el Paralytic Shellfish Poisoning (PSP). Aplicación a la acuicultura en España Duración del proyecto:

Más detalles

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles

Cómo funciona la prueba de ELISA SYSTEMS de residuos de alergenos alimentarios:

Cómo funciona la prueba de ELISA SYSTEMS de residuos de alergenos alimentarios: En muchos países, entre ellos Australia, Canadá, la Unión Europea, Corea, Japón, Nueva Zelanda, EEUU, existen leyes y sistemas de control para regular el etiquetado relativo a alergenos alimentarios. Las

Más detalles

Elisabet Cañete Ortiz. Aquesta tesi doctoral està subjecta a la llicència Reconeixement- CompartirIgual 3.0. Espanya de Creative Commons.

Elisabet Cañete Ortiz. Aquesta tesi doctoral està subjecta a la llicència Reconeixement- CompartirIgual 3.0. Espanya de Creative Commons. Optimización de ensayos celulares para la detección de toxinas marinas responsables de intoxicaciones alimentarias. Aplicación en extractos lipofílicos de muestras naturales de Mytilus galloprovincialis

Más detalles


PROCEDIMIENTO PARA APLICACIÓN DE LAS PRUEBAS 1 de 9 TABLA DE CONTENIDO 1. Objetivo. 2. Alcance. 3. Referencias. 4. Definiciones. 5. Responsabilidades. 6. Descripción 7. Registros 8. Anexos 9. Control de Cambios. 2 de 9 1. OBJETIVO Establecer el procedimiento

Más detalles



Más detalles

Guías Didácticas para el desarrollo de experimentos

Guías Didácticas para el desarrollo de experimentos Guías Didácticas para el desarrollo de experimentos 1) Obtención y cuantificación de tu propio ADN El ácido desoxirribonucleico, abreviado como ADN, es un tipo de ácido nucleico, una molécula que forma

Más detalles

3. Principios de medición de la calidad del aire

3. Principios de medición de la calidad del aire 3. Principios de medición de la calidad del aire 3.1. Medición. Medir es contar, comparar una unidad con otra, dar una valoración numérica, asignar un valor, asignar números a los objetos. Todo lo que

Más detalles


PET-RPLA KIT para DETECCIÓN de TOXINAS. Código: TD0930 PET-RPLA KIT para DETECCIÓN de TOXINAS Código: TD0930 Kit para detección de enterotoxina tipo A de Clostridium perfringens en muestras fecales o en filtrados de cultivos por aglutinación pasiva de látex

Más detalles


TOXINAS EMERGENTES EN EL MAR ARGENTINO TOXINAS EMERGENTES EN EL MAR ARGENTINO Nora Montoya, Mario Carignan y Hugo Benavides Proyecto Marea Roja INIDEP-Argentina Detección de Ficotoxinas: Dificultades Matrices biológicas complejas Toxinas estructuralmente

Más detalles

Práctica No 1. Separación de Cationes por Cromatografía de Papel

Práctica No 1. Separación de Cationes por Cromatografía de Papel Práctica No 1 Separación de Cationes por Cromatografía de Papel La cromatografía es un técnica de separación basada en el principio de retención selectiva, que permite separar los distintos componentes

Más detalles


Lección 16. INTRODUCCIÓN AL ANÁLISIS CUANTITATIVO. Lección 16. INTRODUCCIÓN AL ANÁLISIS CUANTITATIVO. Análisis cuantitativo: Conceptos básicos. Propiedades analíticas de interés. Trazabilidad. Materiales de referencia. Calibración instrumental y metodológica.

Más detalles



Más detalles

Capítulo 7.3. Resumen para no expertos

Capítulo 7.3. Resumen para no expertos Resumen para no expertos Comunicación bacteriana y síntesis de antibióticos La comunicación es un factor esencial para todos los seres vivos. Las bacterias, en concreto, se comunican utilizando pequeños

Más detalles

11.2-DISCUSIÓN Prueba rápida

11.2-DISCUSIÓN Prueba rápida 11.2-DISCUSIÓN Prueba rápida Como se observa en la tabla 9 del total de las embarazadas (62,214) a las que se les realizo la prueba rápida un 99.3%(61,808) de ellas dio como resultado no reactivo, tan

Más detalles


INTERFERÓN BETA-1A BIOFARMACO, SOLUCIÓN CONCENTRADA MONOGRAFÍA NUEVA Con fundamento en el numeral 4.11.1 de la Norma Oficial Mexicana NOM-001-SSA1-2010, se publica el presente proyecto a efecto de que los interesados, a partir del 1º de agosto y hasta el

Más detalles

TaqMan GMO Maize Quantification Kit. Part No: 4481972

TaqMan GMO Maize Quantification Kit. Part No: 4481972 TaqMan GMO Maize Quantification Kit Part No: 4481972 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan

Más detalles

Monitoreo y sistema de vigilancia de cianotoxinas en Uruguay

Monitoreo y sistema de vigilancia de cianotoxinas en Uruguay FLORACIONES DE ALGAS NOCIVAS (FAN) EN SISTEMAS ACUATICOS CONTINENTALES Monitoreo y sistema de vigilancia de cianotoxinas en Uruguay Mag. Lizet De León - MVOTMA Dirección Nacional de Medio Ambiente Dpto.

Más detalles

Los resultados serológicos. Limitaciones y aplicaciones prácticas para la enfermedad de Gumboro

Los resultados serológicos. Limitaciones y aplicaciones prácticas para la enfermedad de Gumboro PATOLOGÍA LOS RESULTADOS SEROLÓGICOS. LIMITACIONES Y APLICACIONES PRÁCTICAS PARA LA ENFERMEDAD DE GUMBORO Los resultados serológicos. Limitaciones y aplicaciones prácticas para la enfermedad de Gumboro

Más detalles

Laboratorio de Métodos Instrumentales I. Práctica No. 1 Determinación de fósforo en bebidas de cola por Espectrofotometría UV- Vis.

Laboratorio de Métodos Instrumentales I. Práctica No. 1 Determinación de fósforo en bebidas de cola por Espectrofotometría UV- Vis. Laboratorio de Métodos Instrumentales I Práctica No. 1 Determinación de fósforo en bebidas de cola por Espectrofotometría UV- Vis Equipo 1 Candy Lara Rentería Jessica Torres Gámez Salón 1 Mérida, Yucatán

Más detalles

Roque. Participantes: Ruiz, M., Rodríguez, M.I., Ruibal, A. L., Gonzalez, I., Alasia, V., Pellicioni, P; Biagi, M. & Lerda, D.

Roque. Participantes: Ruiz, M., Rodríguez, M.I., Ruibal, A. L., Gonzalez, I., Alasia, V., Pellicioni, P; Biagi, M. & Lerda, D. Panel: Caso Comuna San Roque Participantes: Ruiz, M., Rodríguez, M.I., Ruibal, A. L., Gonzalez, I., Alasia, V., Pellicioni, P; Biagi, M. & Lerda, D. Córdoba, 28 y 29 de Julio 2011. AREA

Más detalles



Más detalles



Más detalles


ALERGIAS E INTOLERANCIAS ALIMENTARIAS ALERGIAS E INTOLERANCIAS ALIMENTARIAS Aquello que para algunos es un alimento, puede resultar un veneno para otros. ( quod aliis cibus est aliis fuat acre venenum Libro IV, linea 637) Titus Lucretius Carus

Más detalles



Más detalles

Proceso de Evaluación biológica Ensayos de Biocompatibilidad Dra. Mónica Cameo Directora Biología Aplicada Ciudad Autónoma de Buenos Aires

Proceso de Evaluación biológica Ensayos de Biocompatibilidad Dra. Mónica Cameo Directora Biología Aplicada Ciudad Autónoma de Buenos Aires Proceso de Evaluación biológica Ensayos de Biocompatibilidad Dra. Mónica Cameo Directora Biología Aplicada Ciudad Autónoma de Buenos Aires PROCESO DE EVALUACIÓN BIOLÓGICA SEGÚN ISO 10993 1.Caracterización

Más detalles


FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

CARTERA DE SERVICIOS. (1) El alcance de acreditación puede ser consultado en la página de ENAC ( CENTRO NACIONAL DE SANIDAD AMBIENTAL

CARTERA DE SERVICIOS. (1) El alcance de acreditación puede ser consultado en la página de ENAC ( CENTRO NACIONAL DE SANIDAD AMBIENTAL Pelo humano Mercurio total Espectrofotometría de absorción atómica con analizador directo de mercurio Metilmercurio Ensayo acreditado (1) Extracción + Pirólisisamalgamaciónespectrofotometría de absorción

Más detalles

Detección de IgE específica.

Detección de IgE específica. Detección de IgE específica. Una forma de identificar los alérgenos responsables de los síntomas alérgicos es la detección de anticuerpos IgE específicos frente a dichos alérgenos. Estos anticuerpos están

Más detalles

Pruebas rápidas r. Estrategias preventivas. Propuesta de nuevas estrategias preventivas

Pruebas rápidas r. Estrategias preventivas. Propuesta de nuevas estrategias preventivas XV ENCUENTRO ESTATAL PARA ONG s Madrid, 1-3 de Octubre 2009 Diagnóstico tardío o. Pruebas rápidas r Dra Carmen Rodríguez Centro Sanitario Sandoval Madrid Estrategias preventivas La prevención de nuevas

Más detalles


24ª REUNIÓN DEL GRUPO DE TRABAJO SOBRE ANÁLISIS Y TOXICIDAD DE LAS PROLAMINAS Ancona (Italia), 30 Septiembre - 2 Octubre 2010 24ª REUNIÓN DEL GRUPO DE TRABAJO SOBRE ANÁLISIS Y TOXICIDAD DE LAS PROLAMINAS Ancona (Italia), 30 Septiembre - 2 Octubre 2010 El Grupo de Trabajo sobre Análisis de Prolaminas y Toxicidad fue creado con

Más detalles



Más detalles

Detección problemas relacionados uso de drogas. Dr. Pedro Marina Psicología Médica 2003-2004 Seminario

Detección problemas relacionados uso de drogas. Dr. Pedro Marina Psicología Médica 2003-2004 Seminario Detección problemas relacionados uso de drogas Dr. Pedro Marina Psicología Médica 2003-2004 Seminario Drogas y sociedad El uso de alcohol y drogas es una práctica habitual. Las consecuencias de su uso

Más detalles

PRUEBA RAPIDA EN EMBARAZADAS (n=62,214 2009-Junio 2010) NO REACTIVO n=218 REACTIVO INDETERMINADO. Tabla 9: Resultados Prueba rápida

PRUEBA RAPIDA EN EMBARAZADAS (n=62,214 2009-Junio 2010) NO REACTIVO n=218 REACTIVO INDETERMINADO. Tabla 9: Resultados Prueba rápida 11-RESULTADOS 11.1-Interpretación y análisis de resultados Un total de de 62,214 mujeres embarazadas se realizaron la prueba rápida de VIH durante años 2009 hasta junio 2010 (Tabla 9). De ellas, 61,808

Más detalles


BIBLIOGRAFÍA COMENTADA BIBLIOGRAFÍA COMENTADA Liver Transplantation Noninvasive diagnosis of acute cellular rejection in liver transplant recipients: a proteomic signature validated by enzyme-linked immunosorbent assay Diagnóstico

Más detalles



Más detalles

Columnas para oligonucleótidos Agilent AdvanceBio y patrones de oligonucleótidos MEJORE LA FIABILIDAD. REDUZCA COSTES. AUMENTE LA FLEXIBILIDAD.

Columnas para oligonucleótidos Agilent AdvanceBio y patrones de oligonucleótidos MEJORE LA FIABILIDAD. REDUZCA COSTES. AUMENTE LA FLEXIBILIDAD. Columnas para oligonucleótidos Agilent AdvanceBio y patrones de oligonucleótidos MEJORE LA FIABILIDAD. REDUZCA COSTES. AUMENTE LA FLEXIBILIDAD. COLUMNAS PARA OLIGONUCLEÓTIDOS AGILENT ADVANCEBIO Y PATRONES

Más detalles


ELECTROFORESIS WESTERN BLOT ELISA ELECTROFORESIS WESTERN BLOT ELISA INTEGRANTES: Arguelles, Rocío Assandri, Matías Almirón, Marianela Buonanduci, Facundo Gómez, Alan Miller, Florencia López, Rocío Vidal, Sol Sillingardi, Leonardo Soria,

Más detalles



Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60.

Más detalles

UNIDAD 4. Reparto entre dos disolventes. Separaciones por Extracción

UNIDAD 4. Reparto entre dos disolventes. Separaciones por Extracción UNIDAD 4 Reparto entre dos disolventes. Separaciones por Extracción Introducción En los análisis químicos es necesario, después de la toma de muestra y su disolución en el disolvente adecuado, aislar el

Más detalles


FUNDAMENTOS DE ANÁLISIS INSTRUMENTAL. 4ª RELACIÓN DE PROBLEMAS. FUNDAMENTOS DE ANÁLISIS INSTRUMENTAL. 4ª RELACIÓN DE PROBLEMAS. 1.- Para determinar el contenido en plomo en una muestra de leche contaminada, se toma 1.0 ml de la leche y se diluye a un volumen final

Más detalles

Factores involucrados en la expansión de la cianobacteria Cylindrospermopsis raciborskii en el continente americano

Factores involucrados en la expansión de la cianobacteria Cylindrospermopsis raciborskii en el continente americano FACULTAD DE CIENCIAS UNIVERSIDAD DE LA REPÚBLICA MONTEVIDEO, URUGUAY 2014 Factores involucrados en la expansión de la cianobacteria Cylindrospermopsis raciborskii en el continente americano Tesina para

Más detalles


MÉTODO DE DETERMINACIÓN GRAVIMÉTRICA DE LA FRACCIÓN RESPIRABLE EN AIRE MÉTODO DE DETERMINACIÓN GRAVIMÉTRICA DE LA FRACCIÓN RESPIRABLE EN AIRE 11 IT0 1 de 8 1 OBJETO Y ALCANCE El objeto del presente método es describir el equipo y el procedimiento necesarios para la determinación

Más detalles

5. BIOLOGÍA. BACHILLERATO (LOGSE) Prueba de acceso a la Universidad. Ejercicio de BIOLOGIA. Segunda parte de la prueba

5. BIOLOGÍA. BACHILLERATO (LOGSE) Prueba de acceso a la Universidad. Ejercicio de BIOLOGIA. Segunda parte de la prueba 84 5. BIOLOGÍA BACHILLERATO (LOGSE) Prueba de acceso a la Universidad Ejercicio de BIOLOGIA Segunda parte de la prueba Modalidad de Ciencias de la Naturaleza y de la Salud Materia obligatoria en la via

Más detalles

CIANOBACTERIAS. Estructura celular. Ecología. Clasificación. Desarrollo de florecimientos (blooms) CIANOTOXINAS. Cianobacterias toxigénicas

CIANOBACTERIAS. Estructura celular. Ecología. Clasificación. Desarrollo de florecimientos (blooms) CIANOTOXINAS. Cianobacterias toxigénicas CIANOBACTERIAS Estructura celular (Makino & Tsuzaki, 1971; Stainer & Cohen-Bazire,, 1977; Edge et al., 1997; Adams, 2000; Várkonyi et al., 2002 ) Ecología Clasificación Desarrollo de florecimientos (blooms)

Más detalles

Cuantificación de compuestos por cromatografía: Método del Patrón Externo

Cuantificación de compuestos por cromatografía: Método del Patrón Externo Cuantificación de compuestos por cromatografía: Método del Patrón Externo Apellidos, nombre Departamento Centro Fernández Segovia, Isabel ( García Martínez, Eva (

Más detalles

En el APOENZIMA se distinguen tres tipos de aminoácidos:

En el APOENZIMA se distinguen tres tipos de aminoácidos: 1. Concepto de biocatalizador. Son sustancias que consiguen que las reacciones se realicen a gran velocidad a bajas temperaturas, ya que disminuyen la energía de activación de los reactivos. Pueden ser:

Más detalles


SERVICIOS LABORATORIO HISTOCOMPATIBILIDAD SERVICIOS LABORATORIO HISTOCOMPATIBILIDAD El laboratorio de histocompatibilidad está capacitado para desarrollar los estudios necesarios para trasplantes de órganos de acuerdo a los requerimientos internacionalmente

Más detalles

1. Diseño, elaboración de manuales y desarrollo de prácticas de las asignaturas del primer año de la titulación.

1. Diseño, elaboración de manuales y desarrollo de prácticas de las asignaturas del primer año de la titulación. Anexo I. 1. Diseño, elaboración de manuales y desarrollo de prácticas de las asignaturas del primer año de la titulación. a) Asignatura BIOQUÍMICA Esta asignatura es la primera en la que el alumno entra

Más detalles

Araclon Biotech. Pionera en investigación y desarrollo de terapias y métodos de diagnóstico para la enfermedad de Alzheimer MAR SERRANO

Araclon Biotech. Pionera en investigación y desarrollo de terapias y métodos de diagnóstico para la enfermedad de Alzheimer MAR SERRANO Araclon Biotech Pionera en investigación y desarrollo de terapias y métodos de diagnóstico para la enfermedad de Alzheimer MAR SERRANO Fundada en 2004, la compañía biotecnológica Araclon Biotech surge

Más detalles

GPA2286: Análisis extendido para Gas Natural y Mezclas Gaseosas similares por Cromatografía de Gases de Temperatura programada

GPA2286: Análisis extendido para Gas Natural y Mezclas Gaseosas similares por Cromatografía de Gases de Temperatura programada GPA2286: Análisis extendido para Gas Natural y Mezclas Gaseosas similares por Cromatografía de Gases de Temperatura programada Tiempo de análisis inferior a 30 minutos Alta sensibilidad, linealidad, exactitud

Más detalles

Oferta tecnológica: Procedimiento novedoso para fabricar sensores altamente selectivos de sustancias de interés bioquímico, alimentario y ambiental

Oferta tecnológica: Procedimiento novedoso para fabricar sensores altamente selectivos de sustancias de interés bioquímico, alimentario y ambiental Oferta tecnológica: Procedimiento novedoso para fabricar sensores altamente selectivos de sustancias de interés bioquímico, alimentario y ambiental Oferta tecnológica: Procedimiento novedoso para fabricar

Más detalles

ELISA. Enzyme-Linked. Immuno Sorbent Assay

ELISA. Enzyme-Linked. Immuno Sorbent Assay ELISA Enzyme-Linked Immuno Sorbent Assay Recordemos Cuando un Ag y un Ac interaccionan in vitro PRIMERA ETAPA SEGUNDA ETAPA INTERACCIÓN 1ª INTERACCIÓN 2ª No visualizable Fenómeno visible Precipitación

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental.

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Gemma Saucedo. Laboratorio Aguas de Barcelona 22-23 de noviembre de 2006 Introducción PCR: Polymerase Chain Reaction

Más detalles


TEMA 5. ERP ENTERPRISE RESOURCE PLANNING PLANIFICACIÓN DE RECURSOS EMPRESARIALES TEMA 5. ERP ENTERPRISE RESOURCE PLANNING PLANIFICACIÓN DE RECURSOS EMPRESARIALES solución ERP aplicación integrada de gestión, modular, y que cubre las necesidades de las distintas áreas de una empresa

Más detalles


PELIGROS EMERGENTES: MICOTOXINAS EN ALIMENTO PARA PECES PELIGROS EMERGENTES: MICOTOXINAS EN ALIMENTO PARA PECES Douglas Zaviezo Ph. D. Citrexchile FEEDNEWS 2011 29 Noviembre 2011 Puerto Varas - Chile Industria Acuícola En el último tiempo la tendencia nutricional

Más detalles

FeLV Ag / FIV Ab Test Kit

FeLV Ag / FIV Ab Test Kit SensPERT FeLV Ag / FIV Ab Test Kit CONCEPTO SENSPERT La línea de diagnóstico SensPERT de Rapid Test proporciona una solución rápida, específica y fiable para los médicos veterinarios en su práctica clínica

Más detalles