METODOLOGÍA DE DETECCIÓN Y CUANTIFICACIÓN DE CIANOBACTERIAS Y CIANOTOXINAS. Antonio Quesada Universidad Autónoma de Madrid

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamaño: px
Comenzar la demostración a partir de la página:

Download "METODOLOGÍA DE DETECCIÓN Y CUANTIFICACIÓN DE CIANOBACTERIAS Y CIANOTOXINAS. Antonio Quesada Universidad Autónoma de Madrid"

Transcripción

1 METODOLOGÍA DE DETECCIÓN Y CUANTIFICACIÓN DE CIANOBACTERIAS Y CIANOTOXINAS Antonio Quesada Universidad Autónoma de Madrid

2 Índice Identificación y cuantificación de cianobacterias potencialmente tóxicas Taxonomía de cianobacterias Métodos de detección y cuantificación de cianotoxinas Métodos cromatográficos Otros métodos: ELISA, PP1 Resumen

3 METODOLOGÍAS Recepción de las muestras Identificación taxonómica Preparación Determinación Tox. disolución Determinación Tox. particulada Fluorómetro, Microscopio Filtración, extracción, concentración ELISA, LC/MS ELISA, PP, LC-MS, HPLC

4 IDENTIFICACIÓN Y CUANTIFICACIÓN DE CIANOBACTERIAS POTENCIALMENTE TÓXICAS MUESTRA DE AGUA VIVA UTERMÖHL FLUOROMETRÍA FLOTACIÓN IDENTIFICACIÓN (lista de géneros o especies) CUANTIFICACIÓN DISTRIBUCIÓN DE GRUPOS ALGALES (%) BIOMASA DE CIANOBACTERIAS (CLOROFILA a) ABUNDANCIA RELATIVA (% Y/O CLASES ) CONCENTRACIÓN DE CÉLULAS, BIOVOLUMEN

5 TAXONOMÍA DE CIANOBACTERIAS Criterios tradicionalmente morfológicos (aspecto), actualmente además genéticos y fisiológicos. Órdenes familias (subfamilias) géneros especies (variedades). Más de 2000 especies. Constantes variaciones por revisión de expertos.

6 CIANOBACTERIAS POTENCIALMENTE TÓXICAS Alguna de sus cepas a nivel mundial ha sido tóxica. Potencial siempre tóxico Unos 20 géneros tóxicos descritos. Aprox. 25 especies potencialmente tóxicas en España. Los más importantes en España: Microcystis (Microcistinas), Aphanizomenon (Cilindrospermopsina), Anabaena (anatoxina-a) Cylindrospermopsis, Planktothrix, Woronichinia,etc

7 COLONIALES (Orden Chroococcales) Microcystis aeruginosa 50 µm

8 FILAMENTOSAS SIN HETEROCISTOS (Orden Oscillatoriales) Planktothrix agardhii 10 µm

9 FILAMENTOSAS CON HETEROCISTOS (Orden Nostocales) ACINETO HETEROCISTO ACINETO HETEROCISTO Aphanizomenon flos-aquae Anabaena crassa Aphanizomenon ovalisporum

10 FLOTACIÓN vs UTERMÖHL FLOTACIÓN UTERMÖHL Tipo de muestra Viva Fijada (lugol) Microscopio Óptico Óptico invertido Cuantificación Abundancia relativa (%) Concentración de Células Biovolumen Ventajas Inconvenientes Aplicación recomendada Rápido Evita otras algas subestima taxones no formadores de blooms Cuantificación poco precisa Gestión: detección rápida de especies más abundantes formadoras de acumulados Cuantificación precisa Método estandarizado (norma UNE-EN 15204:2007) Tedioso Lugol altera aspecto real Demasiadas especies Posible subestimación de formadoras de scums?? Investigación y/o gestión a medio plazo: seguimientos temporales precisos Experto Recomendable Imprescindible

11 CLAVE DE IDENTIFICACIÓN (MUY) SIMPLIFICADA Unicelular, colonial, filamentosa? Unicelular Colonial Filamentosa Microcystis? Woronichinia? NO Heterocistos? SÍ OSCILATORIALES NOSTOCALES Planktothrix? NO Anabaena? Cylindrospermopsis? Apuntamiento? Aphanizomenon? SÍ

12 Métodos de detección y cuantificación de cianotoxinas Métodos cromatográficos de detección Técnicas para la separación de compuestos en una mezcla que permita una detección individualizada de uno o varios analitos Constan de: 1.Separación cromatográfica 2.Detección Empleados en muy diversos campos

13 Separación cromatográfica 1.Compuestos añadidos conjuntamente a una fase móvil 2.Compuestos atraviesan fase estacionaria 3.Los compuestos son retenidos o eluidos según sus características químicas o físico químicas 4.Los compuestos abandonan la fase estacionaria ordenados inversamente a su grado de retención

14

15 RT: 0,56-77, , ,73 NL: 6,81E8 TIC MS , , , , , , , , ,61 9, , , , , , , , , , , , , , , , ,63 77, Time (min)

16

17 RT: 5,11-23, Time (min) , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , ,04 NL: 6,81E8 TIC MS NL: 2,28E7 m/z= 994,50-995,50 MS NL: 2,08E8 m/z= 519,50-520,50 MS NL: 1,48E7 m/z= 1044, ,50 MS RR -LR -YR

18 Otros métodos de análisis de Microcistinas -Test de Inhibición de Protein-fosfatasa (PPI) - Ensayo de inmunodetección (ELISA)

19 PPI-test (Inhibición enzimática de la protein fosfatasa) Kit comercial (ZEU- Inmunotec) Microcistinas Inhibición de enzimas proteinfosfatasas (tipos 1 y 2A) Principio: Reducción de la defosforilación como medida indirecta de su concentración. Extracto Pfasa + Sustrato (pnitrofenolfosfato) Defosforilación (cambio de color) Cuantificación por absorbancia 405nm Microcistinas

20 ELISA Enzyme-linked inmunosorbent assay Kits comerciales (Envirogard, ) Basado en la interacción entre anticuerpos y toxina. Mecanismo: 1. Placa multipocillo con anticuerpos 2. Adición de muestra [MC desconocida] 3. Adición de conjugado MC-enzima Unión competitiva a sitios de unión 4. Adición de sustrato (genera color en presencia del conjugado) 5. Medición de la absorbancia a 450nm

21 Selectividad RMN MALDI-TOF LC/MS Bioensayo HPLC ELISA PP µg ng pg fg Sensibilidad

22 Gracias!!

Cuantificación de Clorofila a

Cuantificación de Clorofila a Cuantificación de Clorofila a Clorofilas Las clorofilas son una familia de pigmentos de color verde que se encuentran en las cianobacterias y en todos aquellos organismos que contienen cloroplastos en

Más detalles

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR)

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) Centro de de Microscopía Electrónica Facultad de de Ciencias Médicas Universidad Nacional de de Córdoba

Más detalles

CIANOBACTERIAS PLANCTÓNICAS Y CIANOTOXINAS EN EMBALSES ESPAÑOLES

CIANOBACTERIAS PLANCTÓNICAS Y CIANOTOXINAS EN EMBALSES ESPAÑOLES UNIVERSIDAD AUTÓNOMA DE MADRID FACULTAD DE CIENCIAS DEPARTAMENTO DE BIOLOGÍA CIANOBACTERIAS PLANCTÓNICAS Y CIANOTOXINAS EN EMBALSES ESPAÑOLES DAVID CARRASCO GATA Madrid, 27 Memoria presentada para optar

Más detalles

CROMATOGRAFÍA DE GASES ACOPLADO A UN DETECTOR DE MASAS GC/MS

CROMATOGRAFÍA DE GASES ACOPLADO A UN DETECTOR DE MASAS GC/MS CROMATOGRAFÍA DE GASES ACOPLADO A UN DETECTOR DE MASAS GC/MS La cromatografía es una técnica para separar las sustancias químicas que se basa en las diferencias en conductas partitivas de una fase móvil

Más detalles

CENTRO NACIONAL DE ALIMENTACIÓN

CENTRO NACIONAL DE ALIMENTACIÓN CENTRO NACIONAL DE ALIMENTACIÓN DETECCIÓN DE ALÉRGENOS EN ALIMENTOS Mª Isabel Prieto Santos Servicio de Biotecnología Jornada: Reglamento sobre Información Alimentaria al Consumidor: Compartir experiencias

Más detalles

ELISA. Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes

ELISA. Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes ELISA Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes ELISA Enzyme Linked Immuno Sorbent Assay Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes

Más detalles

El tipo de alteración observada también proporciona gran información:

El tipo de alteración observada también proporciona gran información: TEMA 5: ENZIMOLOGÍA CLÍNICA 1. Valor diagnóstico de las enzimas en el plasma. 2. Principios del análisis de enzimas 3. Análisis de isoenzimas. 4. Determinación enzimática de sustratos. 1. Valor diagnóstico

Más detalles

CIANOBACTERIAS EN AGUAS DULCES: IDENTIFICACIÓN, CUANTIFICACIÓN Y TOXICIDAD

CIANOBACTERIAS EN AGUAS DULCES: IDENTIFICACIÓN, CUANTIFICACIÓN Y TOXICIDAD , DE MEDIO MEDIO RURAL Y MARINO CIANOBACTERIAS EN AGUAS DULCES: IDENTIFICACIÓN, CUANTIFICACIÓN Y TOXICIDAD Caridad de Hoyos Centro de Estudios Hidrográficos del CEDEX 1 Cianobacterias en embalses. Visión

Más detalles

ELISA. Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes

ELISA. Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes ELISA Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes ELISA Enzyme Linked Immuno Sorbent Assay Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes

Más detalles

EMBARAZO Y NEONATOLOGÍA

EMBARAZO Y NEONATOLOGÍA EMBARAZO Y NEONATOLOGÍA 1. Introducción 2. Diagnóstico del embarazo 3. Parámetros bioquímicos alterados durante el embarazo 4. Estudio del líquido amniótico para la detección y prevención de alteraciones

Más detalles

TEMARIO DE PROFESORES DE ENSEÑANZA SECUNDARIA PROCESOS EN LA INDUSTRIA ALIMENTARIA

TEMARIO DE PROFESORES DE ENSEÑANZA SECUNDARIA PROCESOS EN LA INDUSTRIA ALIMENTARIA HOJA INFORMATIVA A.5.2.17 TEMARIO DE PROFESORES DE ENSEÑANZA SECUNDARIA PROCESOS EN LA INDUSTRIA ALIMENTARIA "Publicado en el B.O.E. de 13 de Febrero de 1.996" OCTUBRE 1997 PROCESOS EN LA INDUSTRIA ALIMENTARIA

Más detalles

Monitoreo biológico para la detección temprana de enfermedades ocupacionales. Dr. Ángel L. Rodríguez P.

Monitoreo biológico para la detección temprana de enfermedades ocupacionales. Dr. Ángel L. Rodríguez P. Prevención de enfermedades ocupacionales Control ambiental Control biológico Vigilancia de la salud AMBIENTE DE TRABAJO Concentración Absorción Tiempo de exposición Control ambiental Dosis interna FACTORES

Más detalles

Control de Calidad en la Técnica de ELISA. Lic. Valentina Bastidas D.

Control de Calidad en la Técnica de ELISA. Lic. Valentina Bastidas D. Control de Calidad en la Técnica de ELISA Lic. Valentina Bastidas D. TÉCNICA DE ELISA DEFINICIÓN E L I S A Ensayo Inmunoabsorbente Ligado a Enzimas Enzime-Linked ImmunoSorbent Assay TIPOS DE ELISA: ELISA

Más detalles

METODOLOGIA. A. Colección de muestras de agua:

METODOLOGIA. A. Colección de muestras de agua: CUARTA PARTE BIOMASA FOTOTROFOS: CLOROFILAS LA BIOMASA DE FITOPLANCTON puede ser estimada determinando la concentración de pigmentos fotosintéticos en una muestra de agua. Midiendo la concentración de

Más detalles

Catálogo de cianobacterias planctónicas potencialmente tóxicas de las aguas continentales españolas

Catálogo de cianobacterias planctónicas potencialmente tóxicas de las aguas continentales españolas Catálogo de cianobacterias planctónicas potencialmente tóxicas de las aguas continentales españolas GOBIERNO DE ESPAÑA MINISTERIO DE MEDIO AMBIENTE Y MEDIO RURAL Y MARINO 2011 Catálogo de cianobacterias

Más detalles

Contenido de este informe

Contenido de este informe A: José Gallero, Oscar Bertoletti DE: Eleonora Scoseria TEMA: Conceptos de antidoping equino para divulgación FECHA: 22/12/2008 Contenido de este informe 1. Conceptos básicos sobre antidoping equino...

Más detalles

La selectividad en análisis químico

La selectividad en análisis químico La selectividad en análisis químico Ricard Boqué Grupo de Quimiometría y Cualimetría Universidad Rovira i Virgili (Tarragona) El concepto de selectividad en análisis químico ha sido objeto de una redefinición

Más detalles

Práctica No 1. Separación de Cationes por Cromatografía de Papel

Práctica No 1. Separación de Cationes por Cromatografía de Papel Práctica No 1 Separación de Cationes por Cromatografía de Papel La cromatografía es un técnica de separación basada en el principio de retención selectiva, que permite separar los distintos componentes

Más detalles

APLICAÇÃO DAS TÉCNICAS MOLECULARES NA MONITORIZAÇÃO DE CULTIVOS DE MICROALGAS. Patrícia Alexandra Clemente Janeiro de Assunção

APLICAÇÃO DAS TÉCNICAS MOLECULARES NA MONITORIZAÇÃO DE CULTIVOS DE MICROALGAS. Patrícia Alexandra Clemente Janeiro de Assunção APLICAÇÃO DAS TÉCNICAS MOLECULARES NA MONITORIZAÇÃO DE CULTIVOS DE MICROALGAS. Patrícia Alexandra Clemente Janeiro de Assunção Protocolo Básico Identificación (BM) Extracción de ADN Polymerase Chain Reaction

Más detalles

UNIVERSIDAD DE OVIEDO

UNIVERSIDAD DE OVIEDO UNIVERSIDAD DE OVIEDO MASTER UNIVERSITARIO EN BIOTECNOLOGÍA ALIMENTARIA MÉTODOS DE DISRUPCIÓN CELULAR PARA MICROALGAS TRABAJO FIN DE MASTER POR LAURA LLORENS ESCOBAR JULIO, 2015 ÍNDICE RESUMEN ABSTRACT

Más detalles

LABORATORIO ORGÁNICO

LABORATORIO ORGÁNICO LABORATORIO ORGÁNICO LABORATORIO ORGÁNICO Actualmente es uno de los centros más avanzados de Latinoamérica en el control de la seguridad alimentaria. El Laboratorio de Orgánico está compuesto por una serie

Más detalles

TOXINAS EMERGENTES EN EL MAR ARGENTINO

TOXINAS EMERGENTES EN EL MAR ARGENTINO TOXINAS EMERGENTES EN EL MAR ARGENTINO Nora Montoya, Mario Carignan y Hugo Benavides Proyecto Marea Roja INIDEP-Argentina Detección de Ficotoxinas: Dificultades Matrices biológicas complejas Toxinas estructuralmente

Más detalles

Detección de microorganismos patógenos en los alimentos. Prof. Dr. Luis M. Medina

Detección de microorganismos patógenos en los alimentos. Prof. Dr. Luis M. Medina Detección de microorganismos patógenos en los alimentos Prof. Dr. Luis M. Medina ANÁLISIS MICROBIOLÓGICOS EN ALIMENTOS Indicadores recuento total (BAM ) enterobacteriáceas totales coliformes totales E.

Más detalles

Ministerio del Ambiente 1

Ministerio del Ambiente 1 Módulo Didáctico: Recursos Genéticos y Bioseguridad BASES TÉCNICAS PARA LA SEGURIDAD DE BIOTECOLOGÍA Cajamarca, 19 21 junio de 2012 Blgo. David Castro Garro Especialista en Biotecnología Ministerio del

Más detalles

USO PRACTICO E INTERPRETACIÓN DE LA SEROLOGÍA EN CAMPO. Joaquín Girón, MSD AH

USO PRACTICO E INTERPRETACIÓN DE LA SEROLOGÍA EN CAMPO. Joaquín Girón, MSD AH USO PRACTICO E INTERPRETACIÓN DE LA SEROLOGÍA EN CAMPO. Joaquín Girón, MSD AH El objetivo final de las empresas es tener lotes con muy buenas producciones y económicamente rentables, lógicamente un lote

Más detalles

SEPARACIONES POR CROMATOGRAFÍA

SEPARACIONES POR CROMATOGRAFÍA SEPARACIONES POR CROMATOGRAFÍA Conceptos generales. Clasificación de los métodos cromatográficos. Separación cromatográfica Esquema básico de un cromatógrafo Cromatografía líquida de alta resolución. HPLC.

Más detalles

VI JORNADA DE FORMACIÓN INTERHOSPITALARIA DEL LABORATORIO CLÍNICO

VI JORNADA DE FORMACIÓN INTERHOSPITALARIA DEL LABORATORIO CLÍNICO VI JORNADA DE FORMACIÓN INTERHOSPITALARIA DEL LABORATORIO CLÍNICO 3. TÉCNICAS EN EL LABORATORIO DE AUTOINMUNIDAD PATRICIA MORAIS FERREIRA RI. BIOQUÍMICA CLÍNICA PRINCIPALES TÉCNICAS DE INMUNOANÁLISIS Aglutinación

Más detalles

FUNDAMENTOS DE ANÁLISIS INSTRUMENTAL. 4ª RELACIÓN DE PROBLEMAS.

FUNDAMENTOS DE ANÁLISIS INSTRUMENTAL. 4ª RELACIÓN DE PROBLEMAS. FUNDAMENTOS DE ANÁLISIS INSTRUMENTAL. 4ª RELACIÓN DE PROBLEMAS. 1.- Para determinar el contenido en plomo en una muestra de leche contaminada, se toma 1.0 ml de la leche y se diluye a un volumen final

Más detalles

ENFERMEDADES PARASITARIAS TRANSMITIDOS POR ALIMENTOS: (CISTICERCOSIS, HIDATIDOSIS Y FASCIOLOSIS)

ENFERMEDADES PARASITARIAS TRANSMITIDOS POR ALIMENTOS: (CISTICERCOSIS, HIDATIDOSIS Y FASCIOLOSIS) ENFERMEDADES PARASITARIAS TRANSMITIDOS POR ALIMENTOS: (CISTICERCOSIS, HIDATIDOSIS Y FASCIOLOSIS) Dr. Hermes Escalante Añorga Profesor Principal de la Universidad Nacional de Trujillo Laboratorio Clínico

Más detalles

CURSO de ANÁLISIS INSTRUMENTAL I. Catedrática: Dra. Silvia Echeverría, Ph.D., Escuela de Química, Facultad Ciencias Químicas y Farmacia, USAC

CURSO de ANÁLISIS INSTRUMENTAL I. Catedrática: Dra. Silvia Echeverría, Ph.D., Escuela de Química, Facultad Ciencias Químicas y Farmacia, USAC CURSO de ANÁLISIS INSTRUMENTAL I Catedrática: Dra. Silvia Echeverría, Ph.D., Escuela de Química, Facultad Ciencias Químicas y Farmacia, USAC QUÍMICA ANALÍTICA Comprende la metodología para determinar la

Más detalles

INTRODUCCIÓN N A LA HPLC

INTRODUCCIÓN N A LA HPLC FUNDAMENTOS DEL ANALISIS CROMATOGRAFICO. Cromatografía Líquida de Alta Resolución Dr. JOSÉ ANTONIO FERNÁNDEZ LÓPEZ Depto. Ingeniería Química Grupo de Investigación QUIMYTEC UPCT Cromatografía = escribir

Más detalles

TEMA 6 INTRODUCCIÓN A LA ESPECTROMETRÍA DE MASAS Y SUS APLICACIONES EN ANÁLISIS AMBIENTAL

TEMA 6 INTRODUCCIÓN A LA ESPECTROMETRÍA DE MASAS Y SUS APLICACIONES EN ANÁLISIS AMBIENTAL TEMA 6 INTRODUCCIÓN A LA ESPECTROMETRÍA DE MASAS Y SUS APLICACIONES EN ANÁLISIS AMBIENTAL 1. INTRODUCCIÓN: ESPECTROS DE MASAS. Los espectros de masas se obtienen convirtiendo los componentes de una muestra

Más detalles

Detección n de Alérgenos en Alimentos. Actuaciones del Centro Nacional de Alimentación

Detección n de Alérgenos en Alimentos. Actuaciones del Centro Nacional de Alimentación Centro Nacional de Alimentación Detección n de Alérgenos en Alimentos. Actuaciones del Centro Nacional de Alimentación Mª Isabel Prieto Santos Servicio de Biotecnología ALÉRGENOS ALIMENTARIOS Los alérgenos

Más detalles

ACTIVIDAD PERMANENTE DE MONITOREO DEL EMBALSE SAN ROQUE Y SU CUENCA

ACTIVIDAD PERMANENTE DE MONITOREO DEL EMBALSE SAN ROQUE Y SU CUENCA Informe periódico Nº 2 Desde el año 1998 INA-CIRSA monitorea la calidad de aguas del Embalse San Roque, y de sus ríos tributarios. Principal fuente de abastecimiento para la Ciudad de Córdoba - con una

Más detalles

Departamento de Bioquímica y Biología Molecular,

Departamento de Bioquímica y Biología Molecular, 18. Inmunoanálisis Aurora Galván Cejudo 1, Isaac Túnez Fiñana 2 Departamento de Bioquímica y Biología Molecular, 1 Campus Universitario de Rabanales, Edificio Severo Ochoa, 14071-Córdoba, 2 Facultad de

Más detalles

Lección 16. INTRODUCCIÓN AL ANÁLISIS CUANTITATIVO.

Lección 16. INTRODUCCIÓN AL ANÁLISIS CUANTITATIVO. Lección 16. INTRODUCCIÓN AL ANÁLISIS CUANTITATIVO. Análisis cuantitativo: Conceptos básicos. Propiedades analíticas de interés. Trazabilidad. Materiales de referencia. Calibración instrumental y metodológica.

Más detalles

CAPÍTULO 7 ALGAS Y CIANOBACTERIAS EN AGUAS DULCES

CAPÍTULO 7 ALGAS Y CIANOBACTERIAS EN AGUAS DULCES CAPÍTULO 7 ALGAS Y CIANOBACTERIAS EN AGUAS DULCES En aguas dulces, el término alga se refiere a organismos microscópicos, en principio unicelulares, algunos de los cuales forman colonias y alcanzan dimensiones

Más detalles

ALERGENOS-DETERMINACIÓN DE LISOZIMA

ALERGENOS-DETERMINACIÓN DE LISOZIMA ALERGENOS-DETERMINACIÓN DE LISOZIMA Disertante: Brom. Carolina Chiconofri Departamento de Normas Analíticas Especiales Sub. De Investigación para la Fiscalización Instituto Nacional de Vitivinicultura

Más detalles

DEFINICIÓN Y CARACTERÍSTICAS DE LA TÉCNICA:

DEFINICIÓN Y CARACTERÍSTICAS DE LA TÉCNICA: EQUIPO AUTOMÁTICO PARA LA DETECCIÓN DE PATÓGENOS minividas-vidas DEFINICIÓN Y CARACTERÍSTICAS DE LA TÉCNICA: Sistema automático de inmunodetección rápida de patógenos basado en la técnica ELFA (Enzyme

Más detalles

TRABAJO PRACTICO Nº 3 ENZIMOINMUNOANALISIS ELISA

TRABAJO PRACTICO Nº 3 ENZIMOINMUNOANALISIS ELISA TRABAJO PRACTICO Nº 3 ENZIMOINMUNOANALISIS ELISA Docentes encargados: Bioq. Natalia Guiñazú Bioq. Maria Sol Renna Biol. Virginia Andreani Bioq. Mauricio Figueredo Bioq. Vanina Garrido Bioq. Laura Dulgerian

Más detalles

Laboratorio de Métodos Instrumentales I. Práctica No. 1 Determinación de fósforo en bebidas de cola por Espectrofotometría UV- Vis.

Laboratorio de Métodos Instrumentales I. Práctica No. 1 Determinación de fósforo en bebidas de cola por Espectrofotometría UV- Vis. Laboratorio de Métodos Instrumentales I Práctica No. 1 Determinación de fósforo en bebidas de cola por Espectrofotometría UV- Vis Equipo 1 Candy Lara Rentería Jessica Torres Gámez Salón 1 Mérida, Yucatán

Más detalles

UNIVERSIDAD DE LOS ANDES FACULTAD DE MEDICINA INSTITUTO DE INMUNOLOGIA CLINICA HERRAMIENTAS MODERNAS PARA EL DIAGNÓSTICO

UNIVERSIDAD DE LOS ANDES FACULTAD DE MEDICINA INSTITUTO DE INMUNOLOGIA CLINICA HERRAMIENTAS MODERNAS PARA EL DIAGNÓSTICO UNIVERSIDAD DE LOS ANDES FACULTAD DE MEDICINA INSTITUTO DE INMUNOLOGIA CLINICA HERRAMIENTAS MODERNAS PARA EL DIAGNÓSTICO Dra. Haydeé Urdaneta Romero. Junio 2007 ABORDAJES DIAGNÓSTICOS IDENTIFICACIÓN MORFOLÓGICA

Más detalles

DIRECTRICES PARA EL USO DE LA ESPECTROMETRÍA DE MASAS (EM) EN LA IDENTIFICACIÓN, CONFIRMACIÓN Y DETERMINACIÓN CUANTITATIVA DE RESIDUOS CAC/GL 56-2005

DIRECTRICES PARA EL USO DE LA ESPECTROMETRÍA DE MASAS (EM) EN LA IDENTIFICACIÓN, CONFIRMACIÓN Y DETERMINACIÓN CUANTITATIVA DE RESIDUOS CAC/GL 56-2005 CAC/GL 56-2005 Página 1 de 6 DIRECTRICES PARA EL USO DE LA ESPECTROMETRÍA DE MASAS (EM) EN LA IDENTIFICACIÓN, CONFIRMACIÓN Y DETERMINACIÓN CUANTITATIVA DE RESIDUOS ENSAYOS DE CONFIRMACIÓN CAC/GL 56-2005

Más detalles

Pruebas rápidas r. Estrategias preventivas. Propuesta de nuevas estrategias preventivas

Pruebas rápidas r. Estrategias preventivas. Propuesta de nuevas estrategias preventivas XV ENCUENTRO ESTATAL PARA ONG s Madrid, 1-3 de Octubre 2009 Diagnóstico tardío o. Pruebas rápidas r Dra Carmen Rodríguez Centro Sanitario Sandoval Madrid Estrategias preventivas La prevención de nuevas

Más detalles

MÉTODOS CROMATOGRÁFICOS: 1. Exclusión molecular 2. Intercambio iónico 3. Afinidad SSN

MÉTODOS CROMATOGRÁFICOS: 1. Exclusión molecular 2. Intercambio iónico 3. Afinidad SSN MÉTODOS CROMATOGRÁFICOS: 1. Exclusión molecular 2. Intercambio iónico 3. Afinidad SSN Propiedades de una proteína que son útiles para su purificación por cromatografía Peso molecular Carga iónica Hidrofobicidad

Más detalles

PROCEDIMIENTO PARA APLICACIÓN DE LAS PRUEBAS

PROCEDIMIENTO PARA APLICACIÓN DE LAS PRUEBAS 1 de 9 TABLA DE CONTENIDO 1. Objetivo. 2. Alcance. 3. Referencias. 4. Definiciones. 5. Responsabilidades. 6. Descripción 7. Registros 8. Anexos 9. Control de Cambios. 2 de 9 1. OBJETIVO Establecer el procedimiento

Más detalles

SEGURIDAD ALIMENTARIA: DETECCIÓN DE ALÉRGENOS Metodologías para la detección de alérgenos

SEGURIDAD ALIMENTARIA: DETECCIÓN DE ALÉRGENOS Metodologías para la detección de alérgenos SEGURIDAD ALIMENTARIA: DETECCIÓN DE ALÉRGENOS Metodologías para la detección de alérgenos Sra. Juliana Roca. Responsable departamento técnico, Bioser, S. A. DERIO, martes 16 de Junio de 2015 1 Alérgenos

Más detalles

3. Principios de medición de la calidad del aire

3. Principios de medición de la calidad del aire 3. Principios de medición de la calidad del aire 3.1. Medición. Medir es contar, comparar una unidad con otra, dar una valoración numérica, asignar un valor, asignar números a los objetos. Todo lo que

Más detalles

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles

CUERPO SUPERIOR FACULTATIVO OPCIÓN: QUÍMICA. I. TEORIA BASICA SOBRE ANALISIS QUiMICOS INORGANICOS

CUERPO SUPERIOR FACULTATIVO OPCIÓN: QUÍMICA. I. TEORIA BASICA SOBRE ANALISIS QUiMICOS INORGANICOS CUERPO SUPERIOR FACULTATIVO OPCIÓN: QUÍMICA I. TEORIA BASICA SOBRE ANALISIS QUiMICOS INORGANICOS TEMA 1. Volumetrías de neutralización. Aplicaciones. TEMA 2. Volumetrías de oxidación-reducción. Aplicaciones.

Más detalles

BENTLEY BactoCount IBC

BENTLEY BactoCount IBC BENTLEY BactoCount IBC Características del equipo El BactoCount IBC es un equipo automático para contar rápido e individualmente las bacterias de la leche cruda. Capacidad: de 50 hasta 150 muestras / hora.

Más detalles

Elisabet Cañete Ortiz. Aquesta tesi doctoral està subjecta a la llicència Reconeixement- CompartirIgual 3.0. Espanya de Creative Commons.

Elisabet Cañete Ortiz. Aquesta tesi doctoral està subjecta a la llicència Reconeixement- CompartirIgual 3.0. Espanya de Creative Commons. Optimización de ensayos celulares para la detección de toxinas marinas responsables de intoxicaciones alimentarias. Aplicación en extractos lipofílicos de muestras naturales de Mytilus galloprovincialis

Más detalles

ALERGIAS E INTOLERANCIAS ALIMENTARIAS

ALERGIAS E INTOLERANCIAS ALIMENTARIAS ALERGIAS E INTOLERANCIAS ALIMENTARIAS Aquello que para algunos es un alimento, puede resultar un veneno para otros. ( quod aliis cibus est aliis fuat acre venenum Libro IV, linea 637) Titus Lucretius Carus

Más detalles

TaqMan GMO Maize Quantification Kit. Part No: 4481972

TaqMan GMO Maize Quantification Kit. Part No: 4481972 TaqMan GMO Maize Quantification Kit Part No: 4481972 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan

Más detalles

GPA2286: Análisis extendido para Gas Natural y Mezclas Gaseosas similares por Cromatografía de Gases de Temperatura programada

GPA2286: Análisis extendido para Gas Natural y Mezclas Gaseosas similares por Cromatografía de Gases de Temperatura programada GPA2286: Análisis extendido para Gas Natural y Mezclas Gaseosas similares por Cromatografía de Gases de Temperatura programada Tiempo de análisis inferior a 30 minutos Alta sensibilidad, linealidad, exactitud

Más detalles

UNIVERSIDAD DE ANTIOQUIA FACULTAD DE QUÍMICA FARMACÉUTICA PROGRAMA DE ASIGNATURA PROGRAMA QUÍMICA FARMACÉUTICA

UNIVERSIDAD DE ANTIOQUIA FACULTAD DE QUÍMICA FARMACÉUTICA PROGRAMA DE ASIGNATURA PROGRAMA QUÍMICA FARMACÉUTICA UNIVERSIDAD DE ANTIOQUIA FACULTAD DE QUÍMICA FARMACÉUTICA PROGRAMA DE ASIGNATURA PROGRAMA QUÍMICA FARMACÉUTICA 200/ 2 / ASIGNATURA ANÁLISIS INSTRUMENTAL ÁREA O NÚCLEO TEMÁTICO BASICA CÓDIGO QSQ-387 SEMESTRE

Más detalles

UNIDAD 4. Reparto entre dos disolventes. Separaciones por Extracción

UNIDAD 4. Reparto entre dos disolventes. Separaciones por Extracción UNIDAD 4 Reparto entre dos disolventes. Separaciones por Extracción Introducción En los análisis químicos es necesario, después de la toma de muestra y su disolución en el disolvente adecuado, aislar el

Más detalles

Cómo funciona la prueba de ELISA SYSTEMS de residuos de alergenos alimentarios:

Cómo funciona la prueba de ELISA SYSTEMS de residuos de alergenos alimentarios: En muchos países, entre ellos Australia, Canadá, la Unión Europea, Corea, Japón, Nueva Zelanda, EEUU, existen leyes y sistemas de control para regular el etiquetado relativo a alergenos alimentarios. Las

Más detalles

EULA: guías muestreo y análisis de suelos 25/09/13

EULA: guías muestreo y análisis de suelos 25/09/13 GUÍAS METODOLÓGICAS ESTANDARIZADAS DE MUESTREO Y DE ANÁLISIS QUÍMICOS DE SUELOS PARA ÁREAS BACKGROUND Y PARA LA INVESTIGACIÓN CONFIRMATORIA Y EVALUACIÓN DE RIESGO EN SUELOS/SITIOS CON PRESENCIA DE CONTAMINANTES

Más detalles

Universidad de Belgrano

Universidad de Belgrano Universidad de Belgrano Las tesinas de Belgrano Facultad de Ciencias Exactas y Naturales Carrera de Licenciatura en Ciencias Quimicas Determinación de microcistinas en aguas de captación y tratadas N 446

Más detalles

ORGANISMO DE EVALUACIÓN Y FISCALIZACIÓN AMBIENTAL DIRECCIÓN DE EVALUACIÓN EQUIPOS DE MEDICION DE LA CALIDAD DEL AIRE

ORGANISMO DE EVALUACIÓN Y FISCALIZACIÓN AMBIENTAL DIRECCIÓN DE EVALUACIÓN EQUIPOS DE MEDICION DE LA CALIDAD DEL AIRE OEFA ORGANISMO DE EVALUACIÓN Y FISCALIZACIÓN AMBIENTAL DIRECCIÓN DE EVALUACIÓN EQUIPOS DE MEDICION DE LA CALIDAD DEL AIRE MONITOREO DE LA CALIDAD DEL AIRE Métodos Pasivos Métodos Activos Métodos Automáticos

Más detalles

Introducción a los Inmunoensayos. GDS_0418723_McClelland_v4 1

Introducción a los Inmunoensayos. GDS_0418723_McClelland_v4 1 Introducción a los Inmunoensayos GDS_0418723_McClelland_v4 1 Introducción a los Inmunoensayos Objetivos del Entrenamiento Una vez finalizado este capítulo, usted podrá: Definir inmunoensayo Describir la

Más detalles

MÉTODO DE ENSAYO PARA MEDICIÓN DE LA CAPACIDAD DE RETENCIÓN DE PARTÍCULAS DE LOS TEJIDOS.

MÉTODO DE ENSAYO PARA MEDICIÓN DE LA CAPACIDAD DE RETENCIÓN DE PARTÍCULAS DE LOS TEJIDOS. MÉTODO DE ENSAYO PARA MEDICIÓN DE LA CAPACIDAD DE RETENCIÓN DE PARTÍCULAS DE LOS TEJIDOS. Fig. Núm. 1 Método 1. Objeto Esta norma tiene por objeto indicar los métodos a seguir para determinar la capacidad

Más detalles

Cuantificación de compuestos por cromatografía: Método del Patrón Externo

Cuantificación de compuestos por cromatografía: Método del Patrón Externo Cuantificación de compuestos por cromatografía: Método del Patrón Externo Apellidos, nombre Departamento Centro Fernández Segovia, Isabel (isferse1@tal.upv.es) García Martínez, Eva (evgarmar@tal.upv.es)

Más detalles

Roque. Participantes: Ruiz, M., Rodríguez, M.I., Ruibal, A. L., Gonzalez, I., Alasia, V., Pellicioni, P; Biagi, M. & Lerda, D.

Roque. Participantes: Ruiz, M., Rodríguez, M.I., Ruibal, A. L., Gonzalez, I., Alasia, V., Pellicioni, P; Biagi, M. & Lerda, D. Panel: Caso Comuna San Roque Participantes: Ruiz, M., Rodríguez, M.I., Ruibal, A. L., Gonzalez, I., Alasia, V., Pellicioni, P; Biagi, M. & Lerda, D. mruiz@ina.gov.ar Córdoba, 28 y 29 de Julio 2011. AREA

Más detalles

GALLIVAC SE. Vacuna doblemente atenuada Salmonella enteritidis mutante en liofilizado para suspensión oral

GALLIVAC SE. Vacuna doblemente atenuada Salmonella enteritidis mutante en liofilizado para suspensión oral GALLIVAC SE Vacuna doblemente atenuada Salmonella enteritidis mutante en liofilizado para suspensión oral Laboratorio MERIAL LABORATORIOS, S.A. Forma farmacéutica Liofilizado para suspensión oral (Liof.susp.o.)

Más detalles

Mecanismos Generales de Acción de los Fármacos. Farmacodinamia. Dr. Pedro Guerra López

Mecanismos Generales de Acción de los Fármacos. Farmacodinamia. Dr. Pedro Guerra López Mecanismos Generales de Acción de los Fármacos. Farmacodinamia. Dr. Pedro Guerra López EFECTO DE UN FÁRMACO FARMACO Modificación Bióquímica Modulación sistemas biológicos SIT. PATOLOGICAS SIT. FISIOLOGICAS

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

Universidad de Costa Rica Facultad de Microbiología (Trabajo de graduación para optar por el grado de Licenciatura en Microbiología y Química Clínica)

Universidad de Costa Rica Facultad de Microbiología (Trabajo de graduación para optar por el grado de Licenciatura en Microbiología y Química Clínica) Universidad de Costa Rica Facultad de Microbiología (Trabajo de graduación para optar por el grado de Licenciatura en Microbiología y Química Clínica) IMPACTO DE LAS CIANOTOXINAS EN LA ECOLOGÍA ACUÁTICA

Más detalles

Capítulo 7.3. Resumen para no expertos

Capítulo 7.3. Resumen para no expertos Resumen para no expertos Comunicación bacteriana y síntesis de antibióticos La comunicación es un factor esencial para todos los seres vivos. Las bacterias, en concreto, se comunican utilizando pequeños

Más detalles

PELIGROS EMERGENTES: MICOTOXINAS EN ALIMENTO PARA PECES

PELIGROS EMERGENTES: MICOTOXINAS EN ALIMENTO PARA PECES PELIGROS EMERGENTES: MICOTOXINAS EN ALIMENTO PARA PECES Douglas Zaviezo Ph. D. Citrexchile FEEDNEWS 2011 29 Noviembre 2011 Puerto Varas - Chile Industria Acuícola En el último tiempo la tendencia nutricional

Más detalles

Duración del proyecto: 3,5 años.

Duración del proyecto: 3,5 años. Comparación de metodologías para la determinación de toxinas paralizantes en bivalvos relacionadas con el Paralytic Shellfish Poisoning (PSP). Aplicación a la acuicultura en España Duración del proyecto:

Más detalles

CURSO: Segumdo DICTADO : (ANUAL/1er.SEM 2do. SEM) CÁTEDRA: Enología II (dos) CARRERA: Tecnicatura Superior en Enología

CURSO: Segumdo DICTADO : (ANUAL/1er.SEM 2do. SEM) CÁTEDRA: Enología II (dos) CARRERA: Tecnicatura Superior en Enología Página 1 de 10 Objetivos de la asignatura: Relacionar e integrar los conocimientos del área, incorporando situaciones reales que lleven al alumno a un franco contacto con la industria regional. Aprender

Más detalles

ELECTROFORESIS WESTERN BLOT ELISA

ELECTROFORESIS WESTERN BLOT ELISA ELECTROFORESIS WESTERN BLOT ELISA INTEGRANTES: Arguelles, Rocío Assandri, Matías Almirón, Marianela Buonanduci, Facundo Gómez, Alan Miller, Florencia López, Rocío Vidal, Sol Sillingardi, Leonardo Soria,

Más detalles

FUNDAMENTOS DE ANÁLISIS INSTRUMENTAL. 1ª RELACIÓN DE PROBLEMAS.

FUNDAMENTOS DE ANÁLISIS INSTRUMENTAL. 1ª RELACIÓN DE PROBLEMAS. FUNDAMENTOS DE ANÁLISIS INSTRUMENTAL. ª RELACIÓN DE PROBLEMAS. PROBLEMAS BÁSICOS DE DISOLUCIONES.- Una disolución de ácido sulfúrico tiene una densidad de.8 g ml - y contiene 37.0 % en peso de H SO 4.

Más detalles

PROGRAMACIÓN DIDÁCTICA E-LERNING 2015-2016 OPERACIONES BÁSICAS DE LABORATORIO

PROGRAMACIÓN DIDÁCTICA E-LERNING 2015-2016 OPERACIONES BÁSICAS DE LABORATORIO INRODUCCIÓN: El Módulo Profesional denominado OPERACIONES BASICAS DE LABORATORIA, impartido en el primer curso del ciclo formativo de grado medio, persigue que los alumnos adquieran los conocimientos,

Más detalles

CROMATOGRAFÍA DE FILTRACIÓN EN GEL

CROMATOGRAFÍA DE FILTRACIÓN EN GEL 1.- FUNDAMENTO TEÓRICO CROMATOGRAFÍA DE FILTRACIÓN EN GEL Filtración en gel - 1 (Farmacia) La cromatografía de exclusión o filtración en gel es una clase de cromatografía sólido-líquido que permite la

Más detalles

Mediante HPLC podemos analizar un rango más amplio de compuestos en comparación con GC.

Mediante HPLC podemos analizar un rango más amplio de compuestos en comparación con GC. CURSO TEÓRICO-PRÁCTICO DE ESPECTROMETRÍA DE MASAS Dra. Pilar Blasco Dr. Pablo Candela CURSO FORMACIÓN ESPECÍFICA PAS - 2012 HPLC/MS Por qué acoplar un HPLC y un MS? Mediante HPLC podemos analizar un rango

Más detalles

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

CARTERA DE SERVICIOS. (1) El alcance de acreditación puede ser consultado en la página de ENAC (www.enac.es) CENTRO NACIONAL DE SANIDAD AMBIENTAL

CARTERA DE SERVICIOS. (1) El alcance de acreditación puede ser consultado en la página de ENAC (www.enac.es) CENTRO NACIONAL DE SANIDAD AMBIENTAL Pelo humano Mercurio total Espectrofotometría de absorción atómica con analizador directo de mercurio Metilmercurio Ensayo acreditado (1) Extracción + Pirólisisamalgamaciónespectrofotometría de absorción

Más detalles

NOMBRE DE LA ASIGNATURA: TECNOLOGIA FARMACEUTICA II

NOMBRE DE LA ASIGNATURA: TECNOLOGIA FARMACEUTICA II FACULTAD: CIENCIAS DE LA SALUD CARRERA PROFESIONAL: FARMACIA Y BIOQUIMICA CENTRO ULADECH CATÓLICA: TRUJILLO NOMBRE DE LA ASIGNATURA: TECNOLOGIA FARMACEUTICA II CICLO ACADÉMICO: IX DOCENTE: Q.F. GOMEZ VEJARANO

Más detalles

Monitoreo y sistema de vigilancia de cianotoxinas en Uruguay

Monitoreo y sistema de vigilancia de cianotoxinas en Uruguay FLORACIONES DE ALGAS NOCIVAS (FAN) EN SISTEMAS ACUATICOS CONTINENTALES Monitoreo y sistema de vigilancia de cianotoxinas en Uruguay Mag. Lizet De León - MVOTMA Dirección Nacional de Medio Ambiente Dpto.

Más detalles

Radiación solar en ambientes acuáticos

Radiación solar en ambientes acuáticos Radiación solar en ambientes acuáticos Fuente energía (PP) Calentamiento superficies Influencia fuerte en procesos biológicos y ecológicos Superficie UV Violeta Azul Verde Amarillo Naranja Rojo IR 5 m

Más detalles

Tema 4 Aseguramiento de la calidad, los procesos y su mejora

Tema 4 Aseguramiento de la calidad, los procesos y su mejora Tema 4 Aseguramiento de la calidad, los procesos y su mejora 4.1.- Surgimiento y consolidación del aseguramiento de la calidad 4.2.- Características básicas y definición del aseguramiento de la calidad

Más detalles

En el APOENZIMA se distinguen tres tipos de aminoácidos:

En el APOENZIMA se distinguen tres tipos de aminoácidos: 1. Concepto de biocatalizador. Son sustancias que consiguen que las reacciones se realicen a gran velocidad a bajas temperaturas, ya que disminuyen la energía de activación de los reactivos. Pueden ser:

Más detalles

Validación de Métodos

Validación de Métodos Validación de Métodos Francisco Rojo Callejas Validación de Métodos Definiciones Parámetros básicos Requisitos Validación de Métodos El proceso de definir las condiciones analíticas y confirmar que el

Más detalles

Guías Didácticas para el desarrollo de experimentos

Guías Didácticas para el desarrollo de experimentos Guías Didácticas para el desarrollo de experimentos 1) Obtención y cuantificación de tu propio ADN El ácido desoxirribonucleico, abreviado como ADN, es un tipo de ácido nucleico, una molécula que forma

Más detalles

TEMA 5. ERP ENTERPRISE RESOURCE PLANNING PLANIFICACIÓN DE RECURSOS EMPRESARIALES

TEMA 5. ERP ENTERPRISE RESOURCE PLANNING PLANIFICACIÓN DE RECURSOS EMPRESARIALES TEMA 5. ERP ENTERPRISE RESOURCE PLANNING PLANIFICACIÓN DE RECURSOS EMPRESARIALES solución ERP aplicación integrada de gestión, modular, y que cubre las necesidades de las distintas áreas de una empresa

Más detalles

PROTOCOLO DE ANÁLISIS Y CÁLCULO DE MÉTRICAS DE FITOPLANCTON EN LAGOS Y EMBALSES CÓDIGO: MFIT- 2013

PROTOCOLO DE ANÁLISIS Y CÁLCULO DE MÉTRICAS DE FITOPLANCTON EN LAGOS Y EMBALSES CÓDIGO: MFIT- 2013 PROTOCOLO DE ANÁLISIS Y CÁLCULO DE MÉTRICAS DE FITOPLANCTON EN LAGOS Y EMBALSES CÓDIGO: MFIT- 2013 Aprobado por instrucción del Secretario de Estado de Medio Ambiente de fecha 22 de noviembre de 2013 Este

Más detalles

Los resultados serológicos. Limitaciones y aplicaciones prácticas para la enfermedad de Gumboro

Los resultados serológicos. Limitaciones y aplicaciones prácticas para la enfermedad de Gumboro PATOLOGÍA LOS RESULTADOS SEROLÓGICOS. LIMITACIONES Y APLICACIONES PRÁCTICAS PARA LA ENFERMEDAD DE GUMBORO Los resultados serológicos. Limitaciones y aplicaciones prácticas para la enfermedad de Gumboro

Más detalles

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri OBJETIVO Desarrollar un banco de datos a partir de plantas de origen indudable y del uso

Más detalles

Capacidades y criterios de evaluación:

Capacidades y criterios de evaluación: DATOS IDENTIFICATIVOS DE LA UNIDAD FORMATIVA UNIDAD FORMATIVA ELABORACIÓN DE INVENTARIOS DE FOCOS DURACIÓN 90 CONTAMINANTES Específica Código UF1941 Familia profesional SEGURIDAD Y MEDIOAMBIENTE Área Profesional

Más detalles

Diseño cubierta y maquetación: J.J.Gràfics - c/ Espígol, 14-08328 Alella (Barcelona)

Diseño cubierta y maquetación: J.J.Gràfics - c/ Espígol, 14-08328 Alella (Barcelona) 2 - Evaluación de los métodos analíticos actuales para alérgenos del látex de esta edición: Asociación Española de Alérgicos al Látex Dirección y coordinación Asociación Española de Alérgicos al Látex

Más detalles

INDICE GENERAL 1. DIABETES: ASPECTOS GENERALES... 1

INDICE GENERAL 1. DIABETES: ASPECTOS GENERALES... 1 INDICE GENERAL Página INTRODUCCION GENERAL... 1 1. DIABETES: ASPECTOS GENERALES... 1 1.1 Definición... 1 1.2 Tipos de diabetes... 1 1.2.1 Diabetes insulinodependiente o tipo 1... 1 1.2.2 Diabetes no insulinodependiente

Más detalles

PET-RPLA KIT para DETECCIÓN de TOXINAS. Código: TD0930

PET-RPLA KIT para DETECCIÓN de TOXINAS. Código: TD0930 PET-RPLA KIT para DETECCIÓN de TOXINAS Código: TD0930 Kit para detección de enterotoxina tipo A de Clostridium perfringens en muestras fecales o en filtrados de cultivos por aglutinación pasiva de látex

Más detalles

CERTIFICACIÓN INTERNACIONAL EN SEGURIDAD ALIMENTARIA. SISTEMA APPCC Y MANIPULACIÓN EN LA ALIMENTACIÓN

CERTIFICACIÓN INTERNACIONAL EN SEGURIDAD ALIMENTARIA. SISTEMA APPCC Y MANIPULACIÓN EN LA ALIMENTACIÓN Modalidad: Distancia CERTIFICACIÓN INTERNACIONAL EN Duración: 100 Horas Objetivos: A través de esta formación el/la alumno/a conocerá en profundidad todos aquellos aspectos relacionados con la seguridad

Más detalles

PRÁCTICA 7 INSTRUMENTACIÓN BÁSICA EN QUÍMICA

PRÁCTICA 7 INSTRUMENTACIÓN BÁSICA EN QUÍMICA PRÁCTICA 7 INSTRUMENTACIÓN BÁSICA EN QUÍMICA OBJETIVOS En esta práctica se tratarán aspectos de interés relacionados con la instrumentación básica utilizada en química, haciendo especial hincapié en la

Más detalles

CURSO POST-CONGRESO LAPRW2015 MAYO CONGRESO LATINOAMERICANO DE RESIDUOS DE PLAGUICIDAS

CURSO POST-CONGRESO LAPRW2015 MAYO CONGRESO LATINOAMERICANO DE RESIDUOS DE PLAGUICIDAS CONGRESO LATINOAMERICANO DE RESIDUOS DE PLAGUICIDAS 5 O Alimentos y Medio Ambiente VALIDACIÓN DE MÉTODOS - CONTROL DE CALIDAD INTERNA - INCERTIDUMBRE - MÉTODOS DE EXTRACCIÓN CURSO POST-CONGRESO : Taller:

Más detalles

TEMA 14. Métodos inmunológicos para la identificación microbiana

TEMA 14. Métodos inmunológicos para la identificación microbiana TEMA 14 Métodos inmunológicos para la identificación microbiana Tema 14. Métodos inmunológicos para la identificación microbiana 1. Introducción 2. Detección de antígenos 2.1. Obtención de anticuerpos

Más detalles