1. Cuáles son las diferencias en los componentes químicos del ADN y ARN?

Save this PDF as:

Tamaño: px
Comenzar la demostración a partir de la página:

Download "1. Cuáles son las diferencias en los componentes químicos del ADN y ARN?"


1 ACTIVIDADES TEMA 4 - BIOTECNOLOGÍA 1. Cuáles son las diferencias en los componentes químicos del ADN y ARN? Las cadenas de ADN están formadas por fosfato y desoxirribosa y la del ARN por fosfato y ribosa. Las bases nitrogenadas del ADN son Adenina, Guanina, Citosina y timina. Las del ARN son las mismas salvo que cambia el uracilo por la timina. El ADN tiene estructura de doble hélice y el ARN es monocatenario. 2. Cuáles son las bases púricas y las pirimidínicas en el ADN? Las bases púricas son la adenina y la guanina. Las pirimidínicas son la citosina y timina. 3. Cuántos ciclos tienen las bases púricas y pirimidínicas? Las púricas dos ciclos, uno hexagonal y otro pentagonal y las pirimidínicas uno hexagonal. 4. Describe las características químicas y estructurales del ADN Está formada por fosfato y desoxirribosa en las dos hebras o cadenas exteriores enrolladas en doble hélice. Ambas cadenas están conectadas por las bases púricas (Adenina y Guanina) que se enganchan con las bases pirimidínicas (Citosinas y Timina). La adenina se une con la Timina por un doble puente de hidrógeno. La guanina con la citosina por un triple enlace por puente de hidrógeno. Se dice que las dos hebras o cadenas enrolladas en hélice son complementarias.

2 5. En una molécula de ADN, la guanina constituye el 18% del total de bases nitrogenadas. Qué proporción habrá de cada una de las otras bases nitrogenadas A,C,T? Su complementaria, la citosina tendrá el mismo porcentaje, y el 64 % restante será para el par AT, a partes iguales. C 18%; A 32%; T 32%. 6. Qué diferencias existen entre los procesos de replicación, transcripción y traducción? Replicación: El ADN puede hacer copia exacta de si mismo, justo antes de la división celular. Por lo tanto la dotación genética de las células hijas es igual al de la célula madre. Transcripción: Síntesis de un ARNm en el núcleo, que saldrá a través de los poros de la membrana nuclear al citoplasma para ser traducido a proteínas por los ribosomas. Este acontecimiento sólo ocurre cuando la célula está en interfase y el ADN está abierto en forma de cromatina. Traducción: El ARNm sale del núcleo llevando el mensaje genético, la información, hasta los ribosomas, estos leen y traducen el mensaje del ARNm, para sintetizar las proteínas. El código genético asigna las equivalencias entre el lenguaje del ARNm (secuencia de bases) y el lenguaje de las proteínas (secuencia de aminoácidos). 7. Cuáles son las técnicas empleadas en biotecnología? Tecnología del ADN recombinante: permite aislar una región de ADN, crear muchas copias y saber su secuencia de nucleótidos. Este ADN recombinante puede ser introducido en un vector (un virus, por ejemplo) para crear un organismo transgénico con nuevas capacidades, por ejemplo una bacteria capaz de sintetizar una hormona humana.

3 Tecnología de ingeniería genética: permite transferir genes de unos organismos a otros consiguiendo organismos genéticamente modificados. Requiere enzimas de restricción, para cortar, enzimas ligasas, para unir extremos, un organismo receptor para introducir ese ADN recombinante y un medio adecuado de crecimiento para replicarlo. Tecnología de clonación celular: es la obtención de células exactamente iguales para reparar tejidos y órganos. Tecnología de cultivo de células y tejidos: permite mantener y crecer in vitro células y tejidos. Estos cultivos son la base de la experimentación en microbiología, y sirven también para procedimientos terapéuticos. 8. Qué es la huella genética? Mediante qué técnica se puede obtener? Es la huella digital del ADN de un individuo y sirve para averiguar su identidad. Se puede analizar el ADN mediante electroforesis, separando y estudiando fragmentos de ADN que, colocados en una lámina conectada con electrodos, se dirigen hacia el polo + a diferente velocidad en función de la masa y la carga del fragmento. 9. Qué es un chip de ADN? Para qué se usa esta tecnología? Son microscópicas celdillas de vidrio en donde se fijan pequeños fragmentos de ADN. Se utilizan para analizar miles de genes. 10. Qué es un organismo transgénico? Cuál es su utilidad? Son los que tienen algún gen procedente de otro organismo (transgen). Sus aplicaciones: aumentar la resistencia a enfermedades, diseñar organismos para experimentar con ellos, crear granjas farmacéuticas para obtener fármacos, obtener frutos que tarden en madurar y con mayor valor nutritivo. 11. Objetivo de la terapia génica y la clonación reproductiva?

4 Tratar, curar y prevenir enfermedades producidas por un gen defectuoso, introduciendo en el paciente un gen terapéutico. La clonación reproductiva pretende crear organismos exactamente iguales al original. 12. Qué son las células madre? Son células que pueden dividirse indefinidamente produciendo nuevas células madre o diferenciarse en diferentes tipos de células. 13. Qué tipo de células madre existen y cuáles son sus aplicaciones? Embrionarias: son pluripotentes, por sí solas no pueden originar cualquier célula, pero sí con la ayuda de la placenta. Adultas: son multipotentes, originan muchos tipos de células pero no todas. Fetales: procedentes del feto no nacido. Del cordón umbilical después del nacimiento: son equivalentes a los embrionarios. 14. Qué es el genoma humano? Conjunto de todos los genes de nuestra especie distribuidos entre los 23 pares de cromosomas que tienen nuestras células. 15. Qué significa que las dos cadenas del ADN son complementarias químicamente? Que las bases nitrogenadas de cada cadena están unidas de una forma determinada, la adenina con la timina, mediante dos enlaces por puentes de hidrógeno, y la citosina con la guanina, mediante tres enlaces por puentes de hidrógeno. 16. Qué son las mutaciones y cuales son sus consecuencias? Errores durante la replicación del ADN, que provocan enfermedades. En algunas ocasiones producen ventajas que, con el tiempo, se irán haciendo más abundantes en una población concreta. 17. Qué es la biotecnología? En qué campos tiene aplicaciones útiles? Es la manipulación del material genético para desarrollar nuevas plantas, mejores cultivos, desarrollar organismos para luchar contra las plagas, mejorar determinados tratamientos contra enfermedades, nuevas vacunas y fármacos, cuidado del medioambiente, etc. 18. La secuencia de bases que se indica a continuación corresponde a un fragmento de una de las cadenas de un gen que tiene la información para la síntesis de una proteína. ATGCCGTCGCAAACGTTGCACGTCAAATGG

5 a) Construye la secuencia de bases de su cadena complementaria. TACGGCAGCGTTTGCAACGTGCAGTTTACC b) A partir de la secuencia del apartado a, elabora la secuencia correspondiente al ARNm. AUGCCGUCGCAAACGUUGCACGUCAAAUGG c) Cómo se llama el proceso de síntesis del ARN y donde se produce? Trascripción y se realiza en el núcleo. d) Cuántos codones tiene dicho ARNm? 10 codones (cada triplete de bases es un codón). e) Cuántos aminoácidos tendrá la proteína sintetizada por traducción de este ARNm? 10 aminoácidos



TEMA 4 CMC BIOTECNOLOGÍA Conceptos Tema 4 TEMA 4 CMC BIOTECNOLOGÍA Células eucariotas: Células con núcleo. Núcleo: Un compartimento en el interior de la célula que alberga el material genético. Citoplasma: En una célula eucariota,

Más detalles


CÓDIGO GENÉTICO Y SÍNTESIS DE PROTEÍNAS CÓDIGO GENÉTICO Y SÍNTESIS DE PROTEÍNAS Sumario Mitosis y meiosis Código genético y síntesis de proteínas: 1. Concepto de gen 2. Estructura del ADN 3. La replicación del ADN 4. La transcripción 5. La traducción

Más detalles

ÁCIDOS NUCLEICOS. Por: Wilfredo Santiago

ÁCIDOS NUCLEICOS. Por: Wilfredo Santiago ÁCIDOS NUCLEICOS Por: Wilfredo Santiago Ácidos Nucleicos Formados por subunidades llamadas nucleótidos; pueden ser un solo nucleótido o una cadena larga de nucleótidos. Ácidos Nucleicos Nucleótidos individuales:

Más detalles


GENES Y MANIPULACIÓN GENÉTICA GENES Y MANIPULACIÓN GENÉTICA El ADN, material de los genes La información que controla la aparición de los caracteres hereditarios se localiza en el interior del núcleo celular y se transmite de célula

Más detalles

Cultura Cientí fica 1 Bachillerato

Cultura Cientí fica 1 Bachillerato Cultura Cientí fica 1 Bachillerato 3. La revolución genética: biotecnología Actividades de consolidación 1. Cualquier molécula de ADN formada por la unión de segmentos de ADN de origen diferente es: a)

Más detalles

Preguntas de selectividad en Andalucía. Ácidos nucleicos. Análisis e interpretación de imágenes, esquemas, figuras...

Preguntas de selectividad en Andalucía. Ácidos nucleicos. Análisis e interpretación de imágenes, esquemas, figuras... Año 2001 Describa las funciones más relevantes de los nucleótidos. Cite un ejemplo de nucleótido que participe en cada una de ellas [1,5]. Explique las funciones de los distintos tipos de RNA que participan

Más detalles

Biología Profundización

Biología Profundización UNIDAD 1: GENÉTICA SUB-UNIDAD 2: TRANSCRIPCIÓN Y TRADUCCIÓN Biología Profundización En esta sesión tú podrás: - Conocer el proceso transcripcional y post-transcripcional. - Reconocer los sucesivos procesos

Más detalles


QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA. Julio A. Carrasco Vallejo Julio 2014 QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA Julio A. Carrasco Vallejo Julio 2014 Definiciones Biología Molecular: Estudio de los flujos de información genética en una célula Biotecnología: Uso de sistemas

Más detalles


REVOLUCIÓN GENÉTICA Y BIOTECNOLOGÍA Tema 4 REVOLUCIÓN GENÉTICA Y BIOTECNOLOGÍA 1. ADN y ARN pág 92-93 -Composición química y conceptos: ADN, ARN, nucleótidos, bases nitrogenadas, ácido fosfórico. -Estructura: doble hélice, cadenas complementarias.

Más detalles

Los elementos químicos más abundantes en los seres vivos son: Agua y proteínas. Carbono, oxígeno, hidrógeno, nitrógeno, fósforo y azufre.

Los elementos químicos más abundantes en los seres vivos son: Agua y proteínas. Carbono, oxígeno, hidrógeno, nitrógeno, fósforo y azufre. Los elementos químicos más abundantes en los seres vivos son: Agua y proteínas. Carbono, oxígeno, hidrógeno, nitrógeno, fósforo y azufre. Glúcidos, lípidos, proteínas, ácidos nucleicos. Oxígeno, calcio,

Más detalles



Más detalles

ADN ARN Proteínas. La información genética es portada por el ADN y se hereda con él.

ADN ARN Proteínas. La información genética es portada por el ADN y se hereda con él. Todos los organismos contienen información que les permite coordinar sus procesos. Esta información, a fin de poder ser transferida a la descendencia, esta asentada en una molécula capaz de replicarse,

Más detalles

GLOSARIO. Ácido Desoxirribonucleico (ADN).- Molécula almacenadora de información hereditaria

GLOSARIO. Ácido Desoxirribonucleico (ADN).- Molécula almacenadora de información hereditaria GLOSARIO Ácido Desoxirribonucleico (ADN).- Molécula almacenadora de información hereditaria que se encuentra en el núcleo de la célula. Las bases del ADN son 4: Adenina, Timina, Citosina y Guanina representadas

Más detalles



Más detalles

J. L. Sánchez Guillén. IES Pando - Oviedo Departamento de Biología y Geología 1

J. L. Sánchez Guillén. IES Pando - Oviedo Departamento de Biología y Geología 1 J. L. Sánchez Guillén IES Pando - Oviedo Departamento de Biología y Geología 1 LOS ÁCIDOS NUCLEICOS CONCEPTO: Químicamente, los ácidos nucleicos son polímeros constituidos por la unión mediante enlaces

Más detalles

Ácidos nucleicos: ADN y ARN

Ácidos nucleicos: ADN y ARN Unidad I Genética Ácidos nucleicos: ADN y ARN Definición Los ácidos nucleicos son compuestos orgánicos constituidos por unidades llamadas nucleótidos. Su función principal es transmitir las características

Más detalles

III. Material genético. b. Composición y estructura del RNA.

III. Material genético. b. Composición y estructura del RNA. III. Material genético b. Composición y estructura del RNA. RNA (ácido ribonucléico) Polímero de nucleótidos La pentosa de los nucleótidos es la Ribosa: en la posición 2' del anillo del azúcar hay un grupo

Más detalles


EL ADN y la INGENIERÍA GENÉTICA IES LAS VIÑAS MANILVA. MÁLAGA. CMC. Susana Serradilla EL ADN y la INGENIERÍA GENÉTICA EL GENOMA HUMANO GENOMA: Conjunto de genes de un ser vivo. GENOMA HUMANO: Conjunto de genes de la especie humana PROYECTO

Más detalles

EL A.D.N. Existen 2 tipos de Acidos Nucleicos : ADN (Acido Desoxirribonucleico) y ARN (Acido Ribonucleico) Diferencias entre ADN y ARN

EL A.D.N. Existen 2 tipos de Acidos Nucleicos : ADN (Acido Desoxirribonucleico) y ARN (Acido Ribonucleico) Diferencias entre ADN y ARN EL A.D.N Existen 2 tipos de Acidos Nucleicos : ADN (Acido Desoxirribonucleico) y ARN (Acido Ribonucleico) Diferencias entre ADN y ARN Hay tres tipos netamente diferenciados de ARN, tanto en su estructura

Más detalles

CUESTIONES TEMA 4: La revolución genética y la biotecnología.

CUESTIONES TEMA 4: La revolución genética y la biotecnología. CUESTIONES TEMA 4: La revolución genética y la biotecnología. 1. El ADN no puede salir del núcleo: Cómo logra llevar a los ribosomas que están en el citoplasma la información que porta? 2. El individuo

Más detalles


TEMA 4: LA REVOLUCIÓN GENÉTICA TEMA 4: LA REVOLUCIÓN GENÉTICA 1. Introducción Los seres vivos son capaces de hacer copias de sí mismos, de tal modo que los hijos heredan los caracteres de sus padres. Para lograrlo a) Deben almacenar

Más detalles

cromátidas centrómero cromosoma

cromátidas centrómero cromosoma núcleo en interfase fibra de cromatina cromátidas centrómero cromosoma 2n = 46 cromátidas cromosomas homólogos Los genes están formados por genes alelos segmentos de ADN y se encuentran situados en los

Más detalles

Revolución genética (tema 4) Raquel Pascual, Paula Pardo y Jaime Parras

Revolución genética (tema 4) Raquel Pascual, Paula Pardo y Jaime Parras Revolución genética (tema 4) Raquel Pascual, Paula Pardo y Jaime Parras Diferencia entre los seres vivos 1. Pedruscos y bichos, Qué los diferencia? Dos tipos de objeto seres vivos (pueden hacer copias

Más detalles



Más detalles



Más detalles

Genoma bacteriano. Cromosoma circular 1 ó 2 moléculas/bacteria

Genoma bacteriano. Cromosoma circular 1 ó 2 moléculas/bacteria ADN Dogma BC Genoma bacteriano Cromosoma circular 1 ó 2 moléculas/bacteria Plásmidos: Ciculares ó Lineales 1 a 600 moléculas por bacteria Cromosoma lineal 1 ó 2 moléculas/bacteria Es haploide (n). Formado

Más detalles

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante BIOTECNOLOGÍA 1.- Ingeniería Genética, ADN recombinante Técnica del ADN recombinante: es la más usada en ingeniería genética, esta basada en el uso de las enzimas de restricción o endonucleasas de restricción

Más detalles

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri OBJETIVO Desarrollar un banco de datos a partir de plantas de origen indudable y del uso

Más detalles

Jesús G.C. Colegio Claret Segovia

Jesús G.C. Colegio Claret Segovia 1 UNIDAD 8 Documento elaborado por del de LA R E VO LU CI Ó N G EN É TI CA 1.- El ADN La célula es la unidad morfológica, funcional y genética de todos los seres vivos Todos los seres vivos están formados

Más detalles

Módulo III (Optativo) Ampliación de Biología-Geología Bloque 2. Unidad 6. Genes y manipulación genética.

Módulo III (Optativo) Ampliación de Biología-Geología Bloque 2. Unidad 6. Genes y manipulación genética. Módulo III (Optativo) Ampliación de Biología-Geología Bloque 2. Unidad 6. Genes y manipulación genética. En Unidades anteriores has estudiado que las características de un ser vivo se deben a sus genes

Más detalles

1) a) En la figura señale, englobando con un trazo continuo, lo siguiente:

1) a) En la figura señale, englobando con un trazo continuo, lo siguiente: CÁTEDRA: BIOQUÍMICA Carreras: Farmacia Profesorado en Química Licenciatura en Química Licenciatura en Alimentos ÁCIDOS NUCLEICOS 1) a) En la figura señale, englobando con un trazo continuo, lo siguiente:

Más detalles


NIVELES DE ORGANIZACIÓN DEL ADN. TEMA 4. Modos de información genética. Acidos nucleicos: ADN y ARN. Estructura polarizada del ADN. Cromatina, cromosomas, gen, cistrón, genotipo y fenotipo. Duplicación semiconservativa de la información

Más detalles

1. Motivación. 2. Introducción. Universidad Técnica Federico Santa María Departamento de Informática Campus Santiago

1. Motivación. 2. Introducción. Universidad Técnica Federico Santa María Departamento de Informática Campus Santiago Universidad Técnica Federico Santa María Departamento de Informática Campus Santiago Classification of Normal and Tumor Colon Tissues Using Linear Classifiers and Microarray Data Análisis Inteligente de

Más detalles

Textos de refuerzo. 2. Formación de ADN y ARN. 1. Principios de bioquímica. Proteínas. 1 Unidad 3

Textos de refuerzo. 2. Formación de ADN y ARN. 1. Principios de bioquímica. Proteínas. 1 Unidad 3 1. Principios de bioquímica 2. Formación de ADN y ARN 1. Principios de bioquímica La bioquímica estudia los componentes químicos de los seres vivos: proteínas, carbohidratos, lípidos y ácidos nucleicos.

Más detalles



Más detalles


REPARACIÓN DE LESIONES EN EL MATERIAL GENÉTICO El ININ hoy REPARACIÓN DE LESIONES EN EL MATERIAL GENÉTICO Por Jorge Serment Guerrero, Departamento de Biología (josg@nuclear.inin.mx) Como sabemos, los seres vivos tienen la capacidad de transmitir sus

Más detalles


TEMA 6. ÁCIDOS NUCLEICOS TEMA 6. ÁCIDOS NUCLEICOS 1. Definición. 2. Composición química de los ácidos nucleicos. Nucleotidos Nucleósido 3. Nucleótidos no nucleicos Adenosín trifosfato (ATP) Adenosín monofosfato cíclico (AMP-c)

Más detalles



Más detalles

IES Pando Departamento de Biología y Geología 1

IES Pando Departamento de Biología y Geología 1 IES Pando Departamento de Biología y Geología 1 2 Células en diversos estadios del ciclo celular en la raíz de ajo. 3 Diversos aspectos del núcleo durante el ciclo celular Ciclo celular 4 Repartición del

Más detalles


FLUJO DE LA INFORMACIÓN GENÉTICA REPRODUCCIÓN CELULAR Biología General FLUJO DE LA INFORMACIÓN GENÉTICA REPRODUCCIÓN CELULAR Biología General 1- Diga si son falsas o verdaderas las siguientes afirmaciones con respecto al núcleo celular: I. La envoltura nuclear presenta dos

Más detalles

el ARN heterogéneo nuclear que cumple diferentes funciones en el núcleo de las células.

el ARN heterogéneo nuclear que cumple diferentes funciones en el núcleo de las células. Tema 4.- Genética microbiana. Elementos genéticos bacterianos. Transferencia horizontal de material genético en microorganismos: transformación, conjugación y transducción. Elementos genéticos de los virus.

Más detalles


PREGUNTAS TEST CORRESPONDIENTES A LOS TEMAS 1 AL 5 PREGUNTAS TEST CORRESPONDIENTES A LOS TEMAS 1 AL 5 Las preguntas de test que le adjuntamos corresponden a exámenes de las últimas convocatorias. Una vez que finalicen el estudio de los cinco primeros capítulos,

Más detalles


LA BIOTECNOLOGÍA HACE TU VIDA MEJOR Y MÁS FÁCIL LA BIOTECNOLOGÍA HACE TU VIDA MEJOR Y MÁS FÁCIL BIOTECNOLOGÍA APLICADA A LA SALUD La Biotecnología está presente en la Medicina y en la Salud animal, ya que participa en el diagnóstico y en el tratamiento

Más detalles

La ingeniería genética

La ingeniería genética Objetivos Antes de empezar En esta quincena aprenderás a: Biotecnología moderna. tradicional Ingeniería genética y manipulación del genoma. Alimentos transgénicos. La clonación. El genoma humano Problemas

Más detalles

Genética molecular. 1. Qué son los genes? 2. En qué consiste. 3. Pueden los genes CUESTIONES. Dónde se encuentran?

Genética molecular. 1. Qué son los genes? 2. En qué consiste. 3. Pueden los genes CUESTIONES. Dónde se encuentran? 0S4BL_12_07 25/1/12 16:46 Página 150 ESIONES enética molecular 1. Qué son los genes? Dónde se encuentran? 2. En qué consiste la realización del mensaje genético? 3. Pueden los genes cambiarse o eliminarse,

Más detalles

Técnicas de Biología Molecular

Técnicas de Biología Molecular Técnicas de Biología Molecular DNA I. Enzimas de restricción Análisis Las enzimas de restricción fueron aisladas de bacterias; su función natural es proteger contra DNA extraño II. Separación electroforética

Más detalles

Microbiología General 2006-2007. Tema 5: Transmisión de la información genética

Microbiología General 2006-2007. Tema 5: Transmisión de la información genética Microbiología General 2006-2007 Tema 5: Transmisión de la información genética Transmisión de la información genética Reparto del material genético en procariontes y eucariontes. Transferencia horizontal

Más detalles


ADN, ARN E INFORMACIÓN ADN, ARN E INFORMACIÓN LOS ÁCIDOS NUCLEICOS Los ácidos nucleicos fueron descubiertos en 1869 por Miescher, en el pus de los vendajes de heridas, pero su papel en la herencia y control de la actividad celular

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles


ARAGÓN (ZARAGOZA) / JUNIO 02. LOGSE / BIOLOGÍA / EXAMEN COMPLETO TIEMPO DISPONIBLE: 1 H. 30 M. Se valorará el uso de vocabulario y la notación científica. Los errores ortográficos, el desorden, la falta de limpieza en la presentación y la mala redacción, podrán suponer

Más detalles

Medicina y Biología Molecular y Celular

Medicina y Biología Molecular y Celular Medicina y Biología Molecular y Celular Molecular Cell Biology is at the center of Modern Medicine Diseases such as cancer, heart disease, diabetes and arthritis all involve molecules and/or cells that

Más detalles

Veamos rápidamente el ciclo celular

Veamos rápidamente el ciclo celular Replicación del adn Veamos rápidamente el ciclo celular Fase G1: Fase de crecimiento celular. Fase G2: la célula ya duplicó su material genético, y se prepara para la mitosis. Fase M: fase de división

Más detalles

- Polímeros por crecimiento en cadena, se obtienen por adición de monómeros. Los monómeros suelen ser alquénicos.

- Polímeros por crecimiento en cadena, se obtienen por adición de monómeros. Los monómeros suelen ser alquénicos. Tema 10 Se llaman macromoléculas a los productos orgánicos de elevada masa molecular. Polímeros son macromoléculas cuya masa molecular puede alcanzar millones de umas. Son compuestos muy simples químicamente,

Más detalles

Capítulo 7.3. Resumen para no expertos

Capítulo 7.3. Resumen para no expertos Resumen para no expertos Comunicación bacteriana y síntesis de antibióticos La comunicación es un factor esencial para todos los seres vivos. Las bacterias, en concreto, se comunican utilizando pequeños

Más detalles

Qué sabemos de la naturaleza física del gen?

Qué sabemos de la naturaleza física del gen? LAS BASES MOLECULARES DE LA HERENCIA - Genes como entidades abstractas - Se duplican y pasan a la generación siguiente - De algún modo controlan los caracteres hereditarios HERENCIA DE LOS GENES ANÁLISIS

Más detalles

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas ELEMENTOS BÁSICOS DE LA INVESTIGACIÓN EN GENES Análisis

Más detalles


Capítulo 5: BIOMOLÉCULAS Capítulo 5: BIOMOLÉCULAS De qué están hechas las células? Al analizar los átomos y moléculas presentes en las células, se observa que todas ellas se asemejan: una gran proporción es agua; el resto es un

Más detalles


LA REVOLUCIÓN GENÉTICA: DESVELANDO LOS SECRETOS DE LA VIDA LA REVOLUCIÓN GENÉTICA: DESVELANDO LOS SECRETOS DE LA VIDA YA DEBERÍAS SABER Todos los seres vivos tenemos células. Nuestras células son eucariotas (núcleo verdadero) Todas tienen: membrana, citoplasma

Más detalles

FISIOLOGÍA GENERAL Jesús Merino Pérez y María José Noriega Borge

FISIOLOGÍA GENERAL Jesús Merino Pérez y María José Noriega Borge REPLICACIÓN DEL ADN INTRODUCCIÓN La unidad básica de información en los seres vivos es el gen, definido en células eucariotas como un segmento de ADN que lleva la información necesaria para la síntesis

Más detalles

Los nucleótidos están formados de: Una base nitrogenada Un azúcar de cinco carbonos Uno o más grupos fosfato

Los nucleótidos están formados de: Una base nitrogenada Un azúcar de cinco carbonos Uno o más grupos fosfato ACIDOS NUCLEICOS Los monómeros de los ácidos nucleicos son los nucleótidos Los nucleótidos están formados de: Una base nitrogenada Un azúcar de cinco carbonos Uno o más grupos fosfato Las bases nitrogenadas

Más detalles

Tipos de células madre

Tipos de células madre Biología Bachillerato IES Fuentesnuevas 1 CÉLULAS MADRE O TRONCALES (STEM CELLS) Las células madre son células que tienen capacidad de renovarse continuamente por sucesivas divisiones por mitosis y de

Más detalles



Más detalles

Fisiología de Guyton Capitulo 3

Fisiología de Guyton Capitulo 3 Fisiología de Guyton Capitulo 3 Introducción En general se conoce que los genes son el medio principal para la herencia de genes de padres a hijos, que se encuentra en el núcleo de las células de todo

Más detalles

Acidos Nucleicos. Cap.3 Dra. Millie L. González

Acidos Nucleicos. Cap.3 Dra. Millie L. González Acidos Nucleicos Cap.3 Dra. Millie L. González Acidos Nucleicos Los ácidos nucleicos son de suma importancia para las células, ya que almacenan, transmiten y expresan la información genética Son polímeros

Más detalles

Name Date Class. [Comienzo de Sección 11-1] Por favor pasa a la página 226 para empezar la Sección 11-1, La Ingeniería Genética.

Name Date Class. [Comienzo de Sección 11-1] Por favor pasa a la página 226 para empezar la Sección 11-1, La Ingeniería Genética. [Introducción] Por favor abre tu libro en la página 225. Capítulo 11: La Tecnología de Genes Los científicos trabajan día a día en búsqueda de nuevas formas para el uso de la tecnología genética en beneficio

Más detalles


NIVEL QUÍMICO DE ORGANIZACIÓN DEL CUERPO HUMANO NIVEL QUÍMICO DE ORGANIZACIÓN DEL CUERPO HUMANO 10. Defina macromolécula utilizando los términos polímero y monómero. Cite ejemplos. 11. Qué elementos químicos poseen los glúcidos y por qué reciben el

Más detalles

Trabajo realizado por : Álvaro Moya Víctor Moya Fran Moyano

Trabajo realizado por : Álvaro Moya Víctor Moya Fran Moyano Trabajo realizado por : Álvaro Moya Víctor Moya Fran Moyano ÍNDICE ADN - Historia del ADN - Qué es el ADN? - De qué está formado? - Qué función tiene? Ingeniería genética - Qué es la ingeniería genética?

Más detalles

La división celular. .Interfase

La división celular. .Interfase .Interfase La división celular El conjunto de procesos propios de la interfase hacen posible el mantenimiento o el incremento de las estructuras celulares, lo que conlleva, en principio, un incremento

Más detalles

Cortar y pegar ADN: arreglar las mutaciones mediante la "edición genómica" ADN, ARN y proteínas

Cortar y pegar ADN: arreglar las mutaciones mediante la edición genómica ADN, ARN y proteínas Novedades en la investigación de la EH. En lenguaje sencillo. Escrito por científicos. Para toda la comunidad EH. Cortar y pegar ADN: arreglar las mutaciones mediante la "edición genómica" Los científicos

Más detalles

ÁCIDOS NUCLEICOS. By Manuel Maria Morato Victor Barrios

ÁCIDOS NUCLEICOS. By Manuel Maria Morato Victor Barrios ÁCIDOS NUCLEICOS By Manuel Maria Morato Victor Barrios Los ácidos nucleicos son grandes polímeros formados por la repetición de monómeros denominados nucleótidos, unidos mediante enlaces fosfodiéster.

Más detalles


Capítulo 13 REPLICACIÓN DEL ADN REPLICACIÓN DEL ADN La reproducción necesita la correcta y precisa transmisión de la información genética de padres a hijos, por lo que resulta imprescindible la previa replicación o duplicación del ADN

Más detalles

Unidad 3: Organización molecular de la célula Proteínas

Unidad 3: Organización molecular de la célula Proteínas Proteínas Las proteínas son las biomoléculas más abundantes de las células, constituyendo el 50% de su peso seco aproximadamente. Estructuralmente, son polímeros de aminoácidos. Existe una enorme variedad

Más detalles

UNIDAD 1: Introducción a la biología


Más detalles



Más detalles


Proyecto GENOMA HUMANO CÉLULAS MADRE Proyecto GENOMA HUMANO PROYECTO GENOMA HUMANO PROYECTO GENOMA HUMANO TIPOS DE ADN EN EL GENOMA HUMANO Intrones, promotores y regiones reguladoras (40 %) DNA intergénico con funciones desconocidas(68,3

Más detalles


AVANCES EN TRANSGÉNESIS ANIMAL AVANCES EN TRANSGÉNESIS ANIMAL Dr. Pablo Bosch Laboratorio de Reprogramación Celular e Ingeniería Genética Departamento de Biología Molecular FCEFQyN, UNRC 1 de 33 Estructura de la presentación Definición

Más detalles

GENÉTICA: Herencia, Expresión génica, Replicación, biotecnología Selectividad: herencia

GENÉTICA: Herencia, Expresión génica, Replicación, biotecnología Selectividad: herencia GENÉTICA: Herencia, Expresión génica, Replicación, biotecnología Selectividad: herencia 5 JUN9.- Existen caracteres que no se comportan típicamente como los Mendelianos y sus patrones de herencia muestran

Más detalles

ÁCIDOS NUCLEICOS. Aguanten Gregor Mendel y los guisantes!

ÁCIDOS NUCLEICOS. Aguanten Gregor Mendel y los guisantes! ÁCIDOS NUCLEICOS Aguanten Gregor Mendel y los guisantes! ÁCIDOS NUCLEICOS caracts. grales. ADN y ARN son los mensajeros químicos de la información genética de los seres vivos. Son polímeros de nucleótidos,

Más detalles


17.- INGENIERÍA GENÉTICA 17.- INGENIERÍA GENÉTICA SECUENCIACIÓN DEL ADN Se puede hacer de todo el ADN o de genes sueltos. Sabiendo la secuencia de un gen se puede comparar con el gen de un individuo y saber si está mutado. 1.

Más detalles


III INFORMACIÓN CELULAR III INFORMACIÓN CELULAR POR QUÉ ES NECESARIA LA INFORMACIÓN CELULAR? En toda célula, tanto procariota como eucariota, se dan complejos procesos metabólicos y fisiológicos con la finalidad de obtener materiales

Más detalles

Genética molecular (II)

Genética molecular (II) Genética molecular (II) ESTRUCTURA DE UN GEN Cada molécula de ADN está formada por una sucesión de genes. Desde un punto de vista molecular un gen es una unidad de transcripción (desde el punto de vista

Más detalles

FISIOLOGÍA GENERAL Jesús Merino Pérez y María José Noriega Borge

FISIOLOGÍA GENERAL Jesús Merino Pérez y María José Noriega Borge REGULACIÓN DE LA EXPRESIÓN GENÉTICA INTRODUCCIÓN La transmisión de la información genética (transcripción), posibilita la formación de proteínas, cuyas funciones van a caracterizar la actividad y morfología

Más detalles


TEMA 6. LOS ÁCIDOS NUCLEICOS. TEMA 6. LOS ÁCIDOS NUCLEICOS. 1.-Importancia de los ácidos nucleicos. 2.-Componentes de los ácidos nucleicos. 2.1. Los nucleótidos. 2.2. Funciones de los nucleótidos. 3.- El enlace nucleotídico. 4.- El

Más detalles

Qué es un gen? EXPRESION GÉNICA 01/05/2013

Qué es un gen? EXPRESION GÉNICA 01/05/2013 Qué es un gen? Es una secuencia de nucleótidos en la molécula de ADN, equivalente a una unidad de transcripción. Contiene la información, a partir de la cual se sintetiza un polipéptido, una enzima, un

Más detalles

BLOQUE I. Reproducción Celular

BLOQUE I. Reproducción Celular BLOQUE I. Reproducción Celular Tipos de reproducción La importancia de la reproducción Principales actores de la reproducción Anomalías de la reproducción ESQUEMA DE CONTENIDOS REPRODUCCIÓN Es fundamental

Más detalles

7.012 Serie de ejercicios 5

7.012 Serie de ejercicios 5 Nombre Grupo 7.012 Serie de ejercicios 5 Pregunta 1 Al estudiar los problemas de esterilidad, usted intenta aislar un hipotético gen de conejo que explique la prolífica reproducción de estos animales.

Más detalles


EDICIÓN EDICIÓN Nº 123 Síntesis de proteínas Colágeno, insulina, hemoglobina, bilirrubina resultan nombres conocidos. Son proteínas que forman parte de la vida cotidiana. De hecho, son uno de los componentes principales de las

Más detalles

Bases moleculares de la herencia

Bases moleculares de la herencia Bases moleculares de la herencia I. Que moléculas son las portadoras de la información hereditaria? III. Como se preserva y trasmite la información hereditaria? V. Como se expresa esta información. Dogma

Más detalles

Guía para el docente Material genético y reproducción celular Mitosis. Guía para el docente

Guía para el docente Material genético y reproducción celular Mitosis. Guía para el docente Guía para el docente Descripción curricular: - Nivel: 2º Medio - Subsector: Biología - Unidad temática: Material Genético y Reproducción celular. - Palabras claves: ciclo celular, mitosis, cromosoma, cromátida,

Más detalles


MODELOS DE REPLICACIÓN PROPUESTOS REPLICACIÓN DEL ADN El significado genético de la replicación es el de conservar la información genética. La estructura del ADN en doble hélice permite comprender como dicha molécula puede dar lugar a

Más detalles

Investigación en genes. Tecnología del ADN recombinante

Investigación en genes. Tecnología del ADN recombinante Investigación en genes Tecnología del ADN recombinante Tecnología del ADN recombinante 1º parte: Conocimientos básicos que posibilitaron su desarrollo 2º parte: Instrumentos básicos 3º parte Ejemplos Conocimientos

Más detalles



Más detalles

En función de la relación existente entre el donante y el receptor se diferencian varios tipos de trasplantes:

En función de la relación existente entre el donante y el receptor se diferencian varios tipos de trasplantes: TEMA 4: AVANCES BIOMÉDICOS 1.- TRASPLANTES DE ÓRGANOS Trasplante o injerto en medicina es un tratamiento médico complejo que consiste en trasladar órganos, tejidos o células de una persona a otra. El órgano

Más detalles



Más detalles

Técnicas descritas en el curso 7.28

Técnicas descritas en el curso 7.28 Técnicas descritas en el curso 7.28 Técnica: Clase 1 Experimento de incorporación de dntps Ensayo de extensión del cebador Ensayo de unión en filtro Electroforesis en gel Análisis de ADN Helicasa Polaridad

Más detalles

Ingeniería Genética II

Ingeniería Genética II Ingeniería Genética II Expresión de proteínas recombinantes Vectores de expresión Características adicionales: - Promotor regulable - Terminador de la transcripción - Sitio de reconocimiento por el ribosoma

Más detalles


LA NUEVA BIOTECNOLOGÍA LA NUEVA BIOTECNOLOGÍA Ingeniería genética: técnicas que permiten manipular la información genética de un ser vivo. TECNOLOGÍA TRADICIONAL DEL ADN RECOMBINANTE CLONACIÓN DE GENES: Obtención de muchas copias

Más detalles

Guía de Biología I Medio Departamento de Ciencias Profesora NATALIA URQUIETA M.

Guía de Biología I Medio Departamento de Ciencias Profesora NATALIA URQUIETA M. COLEGIO SAN CRISTOBAL Av. Diego Portales N 1.520. La Florida Guía de Biología I Medio Departamento de Ciencias Profesora NATALIA URQUIETA M. MOLÉCULAS ORGANICAS. Los componentes orgánicos de la materia

Más detalles


DOGMA CENTRAL DE LA BIOLOGIA La única diferencia entre las moléculas de ADN de distintos individuos es el orden en el que se disponen sus nucleótidos; lo que se denomina secuencia. Los nucleótidos se ordenan a modo de palabras que

Más detalles

La síntesis de proteínas

La síntesis de proteínas La síntesis de proteínas La Transcripción La información para fabricar todas las proteínas está almacenada en las moléculas de ADN de los cromosomas. La sucesión de bases en las moléculas de ADN es un

Más detalles