1. Cuáles son las diferencias en los componentes químicos del ADN y ARN?

Tamaño: px
Comenzar la demostración a partir de la página:

Download "1. Cuáles son las diferencias en los componentes químicos del ADN y ARN?"

Transcripción

1 ACTIVIDADES TEMA 4 - BIOTECNOLOGÍA 1. Cuáles son las diferencias en los componentes químicos del ADN y ARN? Las cadenas de ADN están formadas por fosfato y desoxirribosa y la del ARN por fosfato y ribosa. Las bases nitrogenadas del ADN son Adenina, Guanina, Citosina y timina. Las del ARN son las mismas salvo que cambia el uracilo por la timina. El ADN tiene estructura de doble hélice y el ARN es monocatenario. 2. Cuáles son las bases púricas y las pirimidínicas en el ADN? Las bases púricas son la adenina y la guanina. Las pirimidínicas son la citosina y timina. 3. Cuántos ciclos tienen las bases púricas y pirimidínicas? Las púricas dos ciclos, uno hexagonal y otro pentagonal y las pirimidínicas uno hexagonal. 4. Describe las características químicas y estructurales del ADN Está formada por fosfato y desoxirribosa en las dos hebras o cadenas exteriores enrolladas en doble hélice. Ambas cadenas están conectadas por las bases púricas (Adenina y Guanina) que se enganchan con las bases pirimidínicas (Citosinas y Timina). La adenina se une con la Timina por un doble puente de hidrógeno. La guanina con la citosina por un triple enlace por puente de hidrógeno. Se dice que las dos hebras o cadenas enrolladas en hélice son complementarias.

2 5. En una molécula de ADN, la guanina constituye el 18% del total de bases nitrogenadas. Qué proporción habrá de cada una de las otras bases nitrogenadas A,C,T? Su complementaria, la citosina tendrá el mismo porcentaje, y el 64 % restante será para el par AT, a partes iguales. C 18%; A 32%; T 32%. 6. Qué diferencias existen entre los procesos de replicación, transcripción y traducción? Replicación: El ADN puede hacer copia exacta de si mismo, justo antes de la división celular. Por lo tanto la dotación genética de las células hijas es igual al de la célula madre. Transcripción: Síntesis de un ARNm en el núcleo, que saldrá a través de los poros de la membrana nuclear al citoplasma para ser traducido a proteínas por los ribosomas. Este acontecimiento sólo ocurre cuando la célula está en interfase y el ADN está abierto en forma de cromatina. Traducción: El ARNm sale del núcleo llevando el mensaje genético, la información, hasta los ribosomas, estos leen y traducen el mensaje del ARNm, para sintetizar las proteínas. El código genético asigna las equivalencias entre el lenguaje del ARNm (secuencia de bases) y el lenguaje de las proteínas (secuencia de aminoácidos). 7. Cuáles son las técnicas empleadas en biotecnología? Tecnología del ADN recombinante: permite aislar una región de ADN, crear muchas copias y saber su secuencia de nucleótidos. Este ADN recombinante puede ser introducido en un vector (un virus, por ejemplo) para crear un organismo transgénico con nuevas capacidades, por ejemplo una bacteria capaz de sintetizar una hormona humana.

3 Tecnología de ingeniería genética: permite transferir genes de unos organismos a otros consiguiendo organismos genéticamente modificados. Requiere enzimas de restricción, para cortar, enzimas ligasas, para unir extremos, un organismo receptor para introducir ese ADN recombinante y un medio adecuado de crecimiento para replicarlo. Tecnología de clonación celular: es la obtención de células exactamente iguales para reparar tejidos y órganos. Tecnología de cultivo de células y tejidos: permite mantener y crecer in vitro células y tejidos. Estos cultivos son la base de la experimentación en microbiología, y sirven también para procedimientos terapéuticos. 8. Qué es la huella genética? Mediante qué técnica se puede obtener? Es la huella digital del ADN de un individuo y sirve para averiguar su identidad. Se puede analizar el ADN mediante electroforesis, separando y estudiando fragmentos de ADN que, colocados en una lámina conectada con electrodos, se dirigen hacia el polo + a diferente velocidad en función de la masa y la carga del fragmento. 9. Qué es un chip de ADN? Para qué se usa esta tecnología? Son microscópicas celdillas de vidrio en donde se fijan pequeños fragmentos de ADN. Se utilizan para analizar miles de genes. 10. Qué es un organismo transgénico? Cuál es su utilidad? Son los que tienen algún gen procedente de otro organismo (transgen). Sus aplicaciones: aumentar la resistencia a enfermedades, diseñar organismos para experimentar con ellos, crear granjas farmacéuticas para obtener fármacos, obtener frutos que tarden en madurar y con mayor valor nutritivo. 11. Objetivo de la terapia génica y la clonación reproductiva?

4 Tratar, curar y prevenir enfermedades producidas por un gen defectuoso, introduciendo en el paciente un gen terapéutico. La clonación reproductiva pretende crear organismos exactamente iguales al original. 12. Qué son las células madre? Son células que pueden dividirse indefinidamente produciendo nuevas células madre o diferenciarse en diferentes tipos de células. 13. Qué tipo de células madre existen y cuáles son sus aplicaciones? Embrionarias: son pluripotentes, por sí solas no pueden originar cualquier célula, pero sí con la ayuda de la placenta. Adultas: son multipotentes, originan muchos tipos de células pero no todas. Fetales: procedentes del feto no nacido. Del cordón umbilical después del nacimiento: son equivalentes a los embrionarios. 14. Qué es el genoma humano? Conjunto de todos los genes de nuestra especie distribuidos entre los 23 pares de cromosomas que tienen nuestras células. 15. Qué significa que las dos cadenas del ADN son complementarias químicamente? Que las bases nitrogenadas de cada cadena están unidas de una forma determinada, la adenina con la timina, mediante dos enlaces por puentes de hidrógeno, y la citosina con la guanina, mediante tres enlaces por puentes de hidrógeno. 16. Qué son las mutaciones y cuales son sus consecuencias? Errores durante la replicación del ADN, que provocan enfermedades. En algunas ocasiones producen ventajas que, con el tiempo, se irán haciendo más abundantes en una población concreta. 17. Qué es la biotecnología? En qué campos tiene aplicaciones útiles? Es la manipulación del material genético para desarrollar nuevas plantas, mejores cultivos, desarrollar organismos para luchar contra las plagas, mejorar determinados tratamientos contra enfermedades, nuevas vacunas y fármacos, cuidado del medioambiente, etc. 18. La secuencia de bases que se indica a continuación corresponde a un fragmento de una de las cadenas de un gen que tiene la información para la síntesis de una proteína. ATGCCGTCGCAAACGTTGCACGTCAAATGG

5 a) Construye la secuencia de bases de su cadena complementaria. TACGGCAGCGTTTGCAACGTGCAGTTTACC b) A partir de la secuencia del apartado a, elabora la secuencia correspondiente al ARNm. AUGCCGUCGCAAACGUUGCACGUCAAAUGG c) Cómo se llama el proceso de síntesis del ARN y donde se produce? Trascripción y se realiza en el núcleo. d) Cuántos codones tiene dicho ARNm? 10 codones (cada triplete de bases es un codón). e) Cuántos aminoácidos tendrá la proteína sintetizada por traducción de este ARNm? 10 aminoácidos

6

TEMA 4 CMC BIOTECNOLOGÍA

TEMA 4 CMC BIOTECNOLOGÍA Conceptos Tema 4 TEMA 4 CMC BIOTECNOLOGÍA Células eucariotas: Células con núcleo. Núcleo: Un compartimento en el interior de la célula que alberga el material genético. Citoplasma: En una célula eucariota,

Más detalles

CÓDIGO GENÉTICO Y SÍNTESIS DE PROTEÍNAS

CÓDIGO GENÉTICO Y SÍNTESIS DE PROTEÍNAS CÓDIGO GENÉTICO Y SÍNTESIS DE PROTEÍNAS Sumario Mitosis y meiosis Código genético y síntesis de proteínas: 1. Concepto de gen 2. Estructura del ADN 3. La replicación del ADN 4. La transcripción 5. La traducción

Más detalles

ÁCIDOS NUCLEICOS. Por: Wilfredo Santiago

ÁCIDOS NUCLEICOS. Por: Wilfredo Santiago ÁCIDOS NUCLEICOS Por: Wilfredo Santiago Ácidos Nucleicos Formados por subunidades llamadas nucleótidos; pueden ser un solo nucleótido o una cadena larga de nucleótidos. Ácidos Nucleicos Nucleótidos individuales:

Más detalles

GENES Y MANIPULACIÓN GENÉTICA

GENES Y MANIPULACIÓN GENÉTICA GENES Y MANIPULACIÓN GENÉTICA El ADN, material de los genes La información que controla la aparición de los caracteres hereditarios se localiza en el interior del núcleo celular y se transmite de célula

Más detalles

Cultura Cientí fica 1 Bachillerato

Cultura Cientí fica 1 Bachillerato Cultura Cientí fica 1 Bachillerato 3. La revolución genética: biotecnología Actividades de consolidación 1. Cualquier molécula de ADN formada por la unión de segmentos de ADN de origen diferente es: a)

Más detalles

Biología Profundización

Biología Profundización UNIDAD 1: GENÉTICA SUB-UNIDAD 2: TRANSCRIPCIÓN Y TRADUCCIÓN Biología Profundización En esta sesión tú podrás: - Conocer el proceso transcripcional y post-transcripcional. - Reconocer los sucesivos procesos

Más detalles

Preguntas de selectividad en Andalucía. Ácidos nucleicos. Análisis e interpretación de imágenes, esquemas, figuras...

Preguntas de selectividad en Andalucía. Ácidos nucleicos. Análisis e interpretación de imágenes, esquemas, figuras... Año 2001 Describa las funciones más relevantes de los nucleótidos. Cite un ejemplo de nucleótido que participe en cada una de ellas [1,5]. Explique las funciones de los distintos tipos de RNA que participan

Más detalles

QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA. Julio A. Carrasco Vallejo Julio 2014

QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA. Julio A. Carrasco Vallejo Julio 2014 QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA Julio A. Carrasco Vallejo Julio 2014 Definiciones Biología Molecular: Estudio de los flujos de información genética en una célula Biotecnología: Uso de sistemas

Más detalles

REVOLUCIÓN GENÉTICA Y BIOTECNOLOGÍA

REVOLUCIÓN GENÉTICA Y BIOTECNOLOGÍA Tema 4 REVOLUCIÓN GENÉTICA Y BIOTECNOLOGÍA 1. ADN y ARN pág 92-93 -Composición química y conceptos: ADN, ARN, nucleótidos, bases nitrogenadas, ácido fosfórico. -Estructura: doble hélice, cadenas complementarias.

Más detalles

SESIÓN 7 DUPLICACIÓN Y TRANSMISIÓN DE LA INFORMACIÓN CONTENIDA EN EL ADN

SESIÓN 7 DUPLICACIÓN Y TRANSMISIÓN DE LA INFORMACIÓN CONTENIDA EN EL ADN SESIÓN 7 DUPLICACIÓN Y TRANSMISIÓN DE LA INFORMACIÓN CONTENIDA EN EL ADN I. CONTENIDOS: 1. Centro de control celular. 2. ADN: su estructura y función. 3. ADN y síntesis proteica. II. OBJETIVOS: Al término

Más detalles

Los elementos químicos más abundantes en los seres vivos son: Agua y proteínas. Carbono, oxígeno, hidrógeno, nitrógeno, fósforo y azufre.

Los elementos químicos más abundantes en los seres vivos son: Agua y proteínas. Carbono, oxígeno, hidrógeno, nitrógeno, fósforo y azufre. Los elementos químicos más abundantes en los seres vivos son: Agua y proteínas. Carbono, oxígeno, hidrógeno, nitrógeno, fósforo y azufre. Glúcidos, lípidos, proteínas, ácidos nucleicos. Oxígeno, calcio,

Más detalles

TEMA 4: DEL DESCUBRIMIENTO DE LOS ÁCIDOS NUCLEICOS A LA BIOTECNOLOGÍA

TEMA 4: DEL DESCUBRIMIENTO DE LOS ÁCIDOS NUCLEICOS A LA BIOTECNOLOGÍA TEMA 4: DEL DESCUBRIMIENTO DE LOS ÁCIDOS NUCLEICOS A LA BIOTECNOLOGÍA EL ADN, LA MOLÉCULA DE LA HERENCIA El ADN (ácido desoxirribonucleico) es la molécula portadora de la información genética que forma

Más detalles

ADN ARN Proteínas. La información genética es portada por el ADN y se hereda con él.

ADN ARN Proteínas. La información genética es portada por el ADN y se hereda con él. Todos los organismos contienen información que les permite coordinar sus procesos. Esta información, a fin de poder ser transferida a la descendencia, esta asentada en una molécula capaz de replicarse,

Más detalles

GLOSARIO. Ácido Desoxirribonucleico (ADN).- Molécula almacenadora de información hereditaria

GLOSARIO. Ácido Desoxirribonucleico (ADN).- Molécula almacenadora de información hereditaria GLOSARIO Ácido Desoxirribonucleico (ADN).- Molécula almacenadora de información hereditaria que se encuentra en el núcleo de la célula. Las bases del ADN son 4: Adenina, Timina, Citosina y Guanina representadas

Más detalles

J. L. Sánchez Guillén. IES Pando - Oviedo Departamento de Biología y Geología 1

J. L. Sánchez Guillén. IES Pando - Oviedo Departamento de Biología y Geología 1 J. L. Sánchez Guillén IES Pando - Oviedo Departamento de Biología y Geología 1 LOS ÁCIDOS NUCLEICOS CONCEPTO: Químicamente, los ácidos nucleicos son polímeros constituidos por la unión mediante enlaces

Más detalles

EL A.D.N. Existen 2 tipos de Acidos Nucleicos : ADN (Acido Desoxirribonucleico) y ARN (Acido Ribonucleico) Diferencias entre ADN y ARN

EL A.D.N. Existen 2 tipos de Acidos Nucleicos : ADN (Acido Desoxirribonucleico) y ARN (Acido Ribonucleico) Diferencias entre ADN y ARN EL A.D.N Existen 2 tipos de Acidos Nucleicos : ADN (Acido Desoxirribonucleico) y ARN (Acido Ribonucleico) Diferencias entre ADN y ARN Hay tres tipos netamente diferenciados de ARN, tanto en su estructura

Más detalles

CUESTIONES TEMA 4: La revolución genética y la biotecnología.

CUESTIONES TEMA 4: La revolución genética y la biotecnología. CUESTIONES TEMA 4: La revolución genética y la biotecnología. 1. El ADN no puede salir del núcleo: Cómo logra llevar a los ribosomas que están en el citoplasma la información que porta? 2. El individuo

Más detalles

EL ADN y la INGENIERÍA GENÉTICA

EL ADN y la INGENIERÍA GENÉTICA IES LAS VIÑAS MANILVA. MÁLAGA. CMC. Susana Serradilla EL ADN y la INGENIERÍA GENÉTICA EL GENOMA HUMANO GENOMA: Conjunto de genes de un ser vivo. GENOMA HUMANO: Conjunto de genes de la especie humana PROYECTO

Más detalles

III. Material genético. b. Composición y estructura del RNA.

III. Material genético. b. Composición y estructura del RNA. III. Material genético b. Composición y estructura del RNA. RNA (ácido ribonucléico) Polímero de nucleótidos La pentosa de los nucleótidos es la Ribosa: en la posición 2' del anillo del azúcar hay un grupo

Más detalles

Ácidos nucleicos: ADN y ARN

Ácidos nucleicos: ADN y ARN Unidad I Genética Ácidos nucleicos: ADN y ARN Definición Los ácidos nucleicos son compuestos orgánicos constituidos por unidades llamadas nucleótidos. Su función principal es transmitir las características

Más detalles

TEMA 4: LA REVOLUCIÓN GENÉTICA

TEMA 4: LA REVOLUCIÓN GENÉTICA TEMA 4: LA REVOLUCIÓN GENÉTICA 1. Introducción Los seres vivos son capaces de hacer copias de sí mismos, de tal modo que los hijos heredan los caracteres de sus padres. Para lograrlo a) Deben almacenar

Más detalles

Revolución genética (tema 4) Raquel Pascual, Paula Pardo y Jaime Parras

Revolución genética (tema 4) Raquel Pascual, Paula Pardo y Jaime Parras Revolución genética (tema 4) Raquel Pascual, Paula Pardo y Jaime Parras Diferencia entre los seres vivos 1. Pedruscos y bichos, Qué los diferencia? Dos tipos de objeto seres vivos (pueden hacer copias

Más detalles

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante BIOTECNOLOGÍA 1.- Ingeniería Genética, ADN recombinante Técnica del ADN recombinante: es la más usada en ingeniería genética, esta basada en el uso de las enzimas de restricción o endonucleasas de restricción

Más detalles

GENÉTICA MOLECULAR. El ADN, LA MOLÉCULA DE LA HERENCIA

GENÉTICA MOLECULAR. El ADN, LA MOLÉCULA DE LA HERENCIA GENÉTICA MOLECULAR El ADN, LA MOLÉCULA DE LA HERENCIA INTRODUCCIÓN: COMENCEMOS PREGUNTÁNDONOS Qué significan estas dos palabras? GENÉTICA MOLECULAR Estudio de la genética (genes) desde el punto de vista

Más detalles

cromátidas centrómero cromosoma

cromátidas centrómero cromosoma núcleo en interfase fibra de cromatina cromátidas centrómero cromosoma 2n = 46 cromátidas cromosomas homólogos Los genes están formados por genes alelos segmentos de ADN y se encuentran situados en los

Más detalles

LOS RETOS DE LA BIOMEDICINA: ENTRE LA CIENCIA Y LA ÉTICA

LOS RETOS DE LA BIOMEDICINA: ENTRE LA CIENCIA Y LA ÉTICA AULA DE MAYORES Y DE LA EXPERIENCIA F.Córdoba, R.Torronteras, A.Canalejo Departamento de Biología Ambiental y Salud Pública LOS RETOS DE LA BIOMEDICINA: ENTRE LA CIENCIA Y LA ÉTICA Tema 1.3. Los sistemas

Más detalles

Genoma bacteriano. Cromosoma circular 1 ó 2 moléculas/bacteria

Genoma bacteriano. Cromosoma circular 1 ó 2 moléculas/bacteria ADN Dogma BC Genoma bacteriano Cromosoma circular 1 ó 2 moléculas/bacteria Plásmidos: Ciculares ó Lineales 1 a 600 moléculas por bacteria Cromosoma lineal 1 ó 2 moléculas/bacteria Es haploide (n). Formado

Más detalles

REPLICACIÓN DEL ADN. 1. Completar el siguiente esquema con los conceptos: Gen, alelo, homocigoto, recesivo, heterocigoto

REPLICACIÓN DEL ADN. 1. Completar el siguiente esquema con los conceptos: Gen, alelo, homocigoto, recesivo, heterocigoto REPLICACIÓN DEL ADN 1. Completar el siguiente esquema con los conceptos: Gen, alelo, homocigoto, recesivo, heterocigoto 2. ESTRUCTURA DEL ADN: Indicar qué es lo que se observa en la figura y cómo se llaman

Más detalles

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri OBJETIVO Desarrollar un banco de datos a partir de plantas de origen indudable y del uso

Más detalles

Módulo III (Optativo) Ampliación de Biología-Geología Bloque 2. Unidad 6. Genes y manipulación genética.

Módulo III (Optativo) Ampliación de Biología-Geología Bloque 2. Unidad 6. Genes y manipulación genética. Módulo III (Optativo) Ampliación de Biología-Geología Bloque 2. Unidad 6. Genes y manipulación genética. En Unidades anteriores has estudiado que las características de un ser vivo se deben a sus genes

Más detalles

1) a) En la figura señale, englobando con un trazo continuo, lo siguiente:

1) a) En la figura señale, englobando con un trazo continuo, lo siguiente: CÁTEDRA: BIOQUÍMICA Carreras: Farmacia Profesorado en Química Licenciatura en Química Licenciatura en Alimentos ÁCIDOS NUCLEICOS 1) a) En la figura señale, englobando con un trazo continuo, lo siguiente:

Más detalles

Jesús G.C. Colegio Claret Segovia

Jesús G.C. Colegio Claret Segovia 1 UNIDAD 8 Documento elaborado por del de LA R E VO LU CI Ó N G EN É TI CA 1.- El ADN La célula es la unidad morfológica, funcional y genética de todos los seres vivos Todos los seres vivos están formados

Más detalles

NIVELES DE ORGANIZACIÓN DEL ADN.

NIVELES DE ORGANIZACIÓN DEL ADN. TEMA 4. Modos de información genética. Acidos nucleicos: ADN y ARN. Estructura polarizada del ADN. Cromatina, cromosomas, gen, cistrón, genotipo y fenotipo. Duplicación semiconservativa de la información

Más detalles

1. Motivación. 2. Introducción. Universidad Técnica Federico Santa María Departamento de Informática Campus Santiago

1. Motivación. 2. Introducción. Universidad Técnica Federico Santa María Departamento de Informática Campus Santiago Universidad Técnica Federico Santa María Departamento de Informática Campus Santiago Classification of Normal and Tumor Colon Tissues Using Linear Classifiers and Microarray Data Análisis Inteligente de

Más detalles

TEMA 2 LA INFORMACIÓN GENÉTICA COLEGIO LEONARDO DA VINCI BIOLOGÍA Y GEOLOGÍA 4º ESO CURSO 2014/15

TEMA 2 LA INFORMACIÓN GENÉTICA COLEGIO LEONARDO DA VINCI BIOLOGÍA Y GEOLOGÍA 4º ESO CURSO 2014/15 TEMA 2 LA INFORMACIÓN GENÉTICA COLEGIO LEONARDO DA VINCI BIOLOGÍA Y GEOLOGÍA 4º ESO CURSO 2014/15 OBJETIVOS DEL TEMA * Ácidos nucleicos. Composición. Estructura. Tipos. Funciones. * Procesos del dogma

Más detalles

GUÍA N 1: MATERIAL GENETICO Y REPLICACIÓN DE ADN

GUÍA N 1: MATERIAL GENETICO Y REPLICACIÓN DE ADN SUBSECTOR PROFESOR NIVEL AÑO UNIDAD SEMESTRE Biología Iris Gaete IVº medio Hum 2016 Información Génica y Proteínas I GUÍA N 1 MATERIAL GENETICO Y REPLICACIÓN DE ADN Nombre Curso I. ESTRUCTURA DEL MATERIAL

Más detalles

TEMA 6. ÁCIDOS NUCLEICOS

TEMA 6. ÁCIDOS NUCLEICOS TEMA 6. ÁCIDOS NUCLEICOS 1. Definición. 2. Composición química de los ácidos nucleicos. Nucleotidos Nucleósido 3. Nucleótidos no nucleicos Adenosín trifosfato (ATP) Adenosín monofosfato cíclico (AMP-c)

Más detalles

Textos de refuerzo. 2. Formación de ADN y ARN. 1. Principios de bioquímica. Proteínas. 1 Unidad 3

Textos de refuerzo. 2. Formación de ADN y ARN. 1. Principios de bioquímica. Proteínas. 1 Unidad 3 1. Principios de bioquímica 2. Formación de ADN y ARN 1. Principios de bioquímica La bioquímica estudia los componentes químicos de los seres vivos: proteínas, carbohidratos, lípidos y ácidos nucleicos.

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

IES Pando Departamento de Biología y Geología 1

IES Pando Departamento de Biología y Geología 1 IES Pando Departamento de Biología y Geología 1 2 Células en diversos estadios del ciclo celular en la raíz de ajo. 3 Diversos aspectos del núcleo durante el ciclo celular Ciclo celular 4 Repartición del

Más detalles

Técnicas de Biología Molecular

Técnicas de Biología Molecular Técnicas de Biología Molecular DNA I. Enzimas de restricción Análisis Las enzimas de restricción fueron aisladas de bacterias; su función natural es proteger contra DNA extraño II. Separación electroforética

Más detalles

FLUJO DE LA INFORMACIÓN GENÉTICA REPRODUCCIÓN CELULAR Biología General

FLUJO DE LA INFORMACIÓN GENÉTICA REPRODUCCIÓN CELULAR Biología General FLUJO DE LA INFORMACIÓN GENÉTICA REPRODUCCIÓN CELULAR Biología General 1- Diga si son falsas o verdaderas las siguientes afirmaciones con respecto al núcleo celular: I. La envoltura nuclear presenta dos

Más detalles

Ácidos nucléicos. Los ácidos nucleicos fueron descubiertos por Freidrich Miescher en Mirel Nervenis

Ácidos nucléicos. Los ácidos nucleicos fueron descubiertos por Freidrich Miescher en Mirel Nervenis Ácidos nucléicos Los ácidos nucleicos fueron descubiertos por Freidrich Miescher en 1869 La información genética o genoma, está contenida en unas moléculas llamadas ácidos nucleicos. Existen dos tipos

Más detalles

Acidos nucleícos. Técnico en masoterapia. Professor: Verónica Pantoja. Lic. MSP.

Acidos nucleícos. Técnico en masoterapia. Professor: Verónica Pantoja. Lic. MSP. Acidos nucleícos Professor: Verónica Pantoja. Lic. MSP. Técnico en masoterapia Objetivo: Identificar los ácidos nucleicos como biomolecula y reconocer su importancia biológica. CONCEPTOS GENERALES Los

Más detalles

PREGUNTAS TEST CORRESPONDIENTES A LOS TEMAS 1 AL 5

PREGUNTAS TEST CORRESPONDIENTES A LOS TEMAS 1 AL 5 PREGUNTAS TEST CORRESPONDIENTES A LOS TEMAS 1 AL 5 Las preguntas de test que le adjuntamos corresponden a exámenes de las últimas convocatorias. Una vez que finalicen el estudio de los cinco primeros capítulos,

Más detalles

La ingeniería genética

La ingeniería genética Objetivos Antes de empezar En esta quincena aprenderás a: Biotecnología moderna. tradicional Ingeniería genética y manipulación del genoma. Alimentos transgénicos. La clonación. El genoma humano Problemas

Más detalles

Características e importancia del código genético

Características e importancia del código genético Características e importancia del código genético Estudio del ADN como portador de la información genética. Concepto de gen. Mecanismos responsables de su transmisión y variación. Los procesos de transcripción-traducción

Más detalles

TEMA 4: ADN Y PROTEÍNAS. LA BIOTECNOLOGÍA

TEMA 4: ADN Y PROTEÍNAS. LA BIOTECNOLOGÍA TEMA 4: ADN Y PROTEÍNAS. LA BIOTECNOLOGÍA ADN e información genética Genes y control celular Mutaciones y su importancia biológica La biotecnología y sus aplicaciones La ingeniería genética Modificación

Más detalles

Lectura para aprender más

Lectura para aprender más Lectura para aprender más Estructura del ADN. Al ácido desoxirribonucleico (ADN) se le considera la base molecular de la vida, ya que constituye las unidades hereditarias que llamamos genes. El color de

Más detalles

REPARACIÓN DE LESIONES EN EL MATERIAL GENÉTICO

REPARACIÓN DE LESIONES EN EL MATERIAL GENÉTICO El ININ hoy REPARACIÓN DE LESIONES EN EL MATERIAL GENÉTICO Por Jorge Serment Guerrero, Departamento de Biología (josg@nuclear.inin.mx) Como sabemos, los seres vivos tienen la capacidad de transmitir sus

Más detalles

Microbiología General 2006-2007. Tema 5: Transmisión de la información genética

Microbiología General 2006-2007. Tema 5: Transmisión de la información genética Microbiología General 2006-2007 Tema 5: Transmisión de la información genética Transmisión de la información genética Reparto del material genético en procariontes y eucariontes. Transferencia horizontal

Más detalles

TEMA 5 ACIDOS NUCLEICOS

TEMA 5 ACIDOS NUCLEICOS Bioquímica-Lic. En Enfermería TEMA 5 ACIDOS NUCLEICOS Dra. María Gabriela Lacoste Área de Química Biológica FQByF-UNSL 2016 DESCUBRIMIENTO El descubrimiento de los ácidos nucleicos se debe a Friedrich

Más detalles

LA BIOTECNOLOGÍA HACE TU VIDA MEJOR Y MÁS FÁCIL

LA BIOTECNOLOGÍA HACE TU VIDA MEJOR Y MÁS FÁCIL LA BIOTECNOLOGÍA HACE TU VIDA MEJOR Y MÁS FÁCIL BIOTECNOLOGÍA APLICADA A LA SALUD La Biotecnología está presente en la Medicina y en la Salud animal, ya que participa en el diagnóstico y en el tratamiento

Más detalles

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas ELEMENTOS BÁSICOS DE LA INVESTIGACIÓN EN GENES Análisis

Más detalles

el ARN heterogéneo nuclear que cumple diferentes funciones en el núcleo de las células.

el ARN heterogéneo nuclear que cumple diferentes funciones en el núcleo de las células. Tema 4.- Genética microbiana. Elementos genéticos bacterianos. Transferencia horizontal de material genético en microorganismos: transformación, conjugación y transducción. Elementos genéticos de los virus.

Más detalles

TEMA: Ácidos Nucleícos

TEMA: Ácidos Nucleícos TEMA: Ácidos Nucleícos Son biopolimeros no ramificados formados por subunidades denominadas nucleótidos Nucleotidos Los nucleótidos están formados por una base nitrogenada, una pentosa y una molécula de

Más detalles

Medicina y Biología Molecular y Celular

Medicina y Biología Molecular y Celular Medicina y Biología Molecular y Celular Molecular Cell Biology is at the center of Modern Medicine Diseases such as cancer, heart disease, diabetes and arthritis all involve molecules and/or cells that

Más detalles

TEMA 5: LOS ÁCIDOS NUCLEICOS

TEMA 5: LOS ÁCIDOS NUCLEICOS TEMA 5: LOS ÁCIDOS NUCLEICOS 1. Características químicas 2. Nucleósidos y Nucleótidos 3. Estructura del ADN 4. Estructura y tipos de ARN 5. Importancia biológica de estos compuestos 1. CARACTERÍSTICAS

Más detalles

Name Date Class. [Comienzo de Sección 11-1] Por favor pasa a la página 226 para empezar la Sección 11-1, La Ingeniería Genética.

Name Date Class. [Comienzo de Sección 11-1] Por favor pasa a la página 226 para empezar la Sección 11-1, La Ingeniería Genética. [Introducción] Por favor abre tu libro en la página 225. Capítulo 11: La Tecnología de Genes Los científicos trabajan día a día en búsqueda de nuevas formas para el uso de la tecnología genética en beneficio

Más detalles

Genética molecular. 1. Qué son los genes? 2. En qué consiste. 3. Pueden los genes CUESTIONES. Dónde se encuentran?

Genética molecular. 1. Qué son los genes? 2. En qué consiste. 3. Pueden los genes CUESTIONES. Dónde se encuentran? 0S4BL_12_07 25/1/12 16:46 Página 150 ESIONES enética molecular 1. Qué son los genes? Dónde se encuentran? 2. En qué consiste la realización del mensaje genético? 3. Pueden los genes cambiarse o eliminarse,

Más detalles

Veamos rápidamente el ciclo celular

Veamos rápidamente el ciclo celular Replicación del adn Veamos rápidamente el ciclo celular Fase G1: Fase de crecimiento celular. Fase G2: la célula ya duplicó su material genético, y se prepara para la mitosis. Fase M: fase de división

Más detalles

Cortar y pegar ADN: arreglar las mutaciones mediante la "edición genómica" ADN, ARN y proteínas

Cortar y pegar ADN: arreglar las mutaciones mediante la edición genómica ADN, ARN y proteínas Novedades en la investigación de la EH. En lenguaje sencillo. Escrito por científicos. Para toda la comunidad EH. Cortar y pegar ADN: arreglar las mutaciones mediante la "edición genómica" Los científicos

Más detalles

TEMARIO PARA EL EXAMEN DE BIOQUÍMICA

TEMARIO PARA EL EXAMEN DE BIOQUÍMICA TEMARIO PARA EL EXAMEN DE BIOQUÍMICA PARTE I. ESTRUCTURA BIOLÓGICA Y QUÍMICA DE LAS PROTEÍNAS 1. CARACTERÍSTICAS QUÍMICAS DE LA MATERIA VIVA 1. La mayoría de los organismos están compuestos solamente de

Más detalles

La división celular. .Interfase

La división celular. .Interfase .Interfase La división celular El conjunto de procesos propios de la interfase hacen posible el mantenimiento o el incremento de las estructuras celulares, lo que conlleva, en principio, un incremento

Más detalles

- Polímeros por crecimiento en cadena, se obtienen por adición de monómeros. Los monómeros suelen ser alquénicos.

- Polímeros por crecimiento en cadena, se obtienen por adición de monómeros. Los monómeros suelen ser alquénicos. Tema 10 Se llaman macromoléculas a los productos orgánicos de elevada masa molecular. Polímeros son macromoléculas cuya masa molecular puede alcanzar millones de umas. Son compuestos muy simples químicamente,

Más detalles

J. L. Sánchez Guillén

J. L. Sánchez Guillén J. L. Sánchez Guillén 1 LOS ÁCIDOS NUCLEICOS CONCEPTO: Químicamente, los ácidos nucleicos son polímeros constituidos por la unión mediante enlaces químicos de unidades menores llamadas nucleótidos. Los

Más detalles

Fisiología de Guyton Capitulo 3

Fisiología de Guyton Capitulo 3 Fisiología de Guyton Capitulo 3 Introducción En general se conoce que los genes son el medio principal para la herencia de genes de padres a hijos, que se encuentra en el núcleo de las células de todo

Más detalles

ARAGÓN (ZARAGOZA) / JUNIO 02. LOGSE / BIOLOGÍA / EXAMEN COMPLETO

ARAGÓN (ZARAGOZA) / JUNIO 02. LOGSE / BIOLOGÍA / EXAMEN COMPLETO TIEMPO DISPONIBLE: 1 H. 30 M. Se valorará el uso de vocabulario y la notación científica. Los errores ortográficos, el desorden, la falta de limpieza en la presentación y la mala redacción, podrán suponer

Más detalles

Ácidos nucleicos. I. Qué es el ácido nucleico? 1. Un nucleótido

Ácidos nucleicos. I. Qué es el ácido nucleico? 1. Un nucleótido Ácidos nucleicos En todos los seres vivos se encuentran biomoléculas formadas por carbono, hidrógeno, oxigeno, nitrógeno y fósforo. En 1869 Miescher Friedrich, aisló del núcleo de leucocitos una sustancia

Más detalles

LA REVOLUCIÓN GENÉTICA: DESVELANDO LOS SECRETOS DE LA VIDA

LA REVOLUCIÓN GENÉTICA: DESVELANDO LOS SECRETOS DE LA VIDA LA REVOLUCIÓN GENÉTICA: DESVELANDO LOS SECRETOS DE LA VIDA YA DEBERÍAS SABER Todos los seres vivos tenemos células. Nuestras células son eucariotas (núcleo verdadero) Todas tienen: membrana, citoplasma

Más detalles

ACIDOS NUCLEICOS. Dra. Elena Alvarado León Área de Genética y Biología Celular Depto. De Morfología Humana Fac. de Medicina UNT

ACIDOS NUCLEICOS. Dra. Elena Alvarado León Área de Genética y Biología Celular Depto. De Morfología Humana Fac. de Medicina UNT ACIDOS NUCLEICOS Dra. Elena Alvarado León Área de Genética y Biología Celular Depto. De Morfología Humana Fac. de Medicina UNT ÁCIDOS NUCLEICOS Son las biomoléculas esenciales de un organismo Monómero:

Más detalles

Tipos de células madre

Tipos de células madre Biología Bachillerato IES Fuentesnuevas 1 CÉLULAS MADRE O TRONCALES (STEM CELLS) Las células madre son células que tienen capacidad de renovarse continuamente por sucesivas divisiones por mitosis y de

Más detalles

Acidos Nucleicos. Adenina + Ribosa Adenosina

Acidos Nucleicos. Adenina + Ribosa Adenosina Dr. Luis Rebolledo Acidos Nucleicos Prof. Iván Rebolledo Introducción Los ácidos nucleicos son macromoléculas orgánicas excepcionales por la cantidad considerable de fósforo que contienen y, sobre todo,

Más detalles

Capítulo 7.3. Resumen para no expertos

Capítulo 7.3. Resumen para no expertos Resumen para no expertos Comunicación bacteriana y síntesis de antibióticos La comunicación es un factor esencial para todos los seres vivos. Las bacterias, en concreto, se comunican utilizando pequeños

Más detalles

CAPÍTULO 2 FLUJO DE LA INFORMACIÓN BIOLÓGICA FACULTAD DE AGRONOMÍA CURSO DE BIOQUÍMICA

CAPÍTULO 2 FLUJO DE LA INFORMACIÓN BIOLÓGICA FACULTAD DE AGRONOMÍA CURSO DE BIOQUÍMICA CAPÍTULO 2 FLUJO DE LA INFORMACIÓN BIOLÓGICA FACULTAD DE AGRONOMÍA CURSO DE BIOQUÍMICA Contenido 2.1 Información biológica e interacciones no covalentes. 2.2 Almacenamiento de la información biológica

Más detalles

Capítulo 5: BIOMOLÉCULAS

Capítulo 5: BIOMOLÉCULAS Capítulo 5: BIOMOLÉCULAS De qué están hechas las células? Al analizar los átomos y moléculas presentes en las células, se observa que todas ellas se asemejan: una gran proporción es agua; el resto es un

Más detalles

Los nucleótidos están formados de: Una base nitrogenada Un azúcar de cinco carbonos Uno o más grupos fosfato

Los nucleótidos están formados de: Una base nitrogenada Un azúcar de cinco carbonos Uno o más grupos fosfato ACIDOS NUCLEICOS Los monómeros de los ácidos nucleicos son los nucleótidos Los nucleótidos están formados de: Una base nitrogenada Un azúcar de cinco carbonos Uno o más grupos fosfato Las bases nitrogenadas

Más detalles

Bioquímica ACIDOS NUCLEICOS. Tema:5. Dra. Silvia Varas.

Bioquímica ACIDOS NUCLEICOS. Tema:5. Dra. Silvia Varas. Bioquímica ACIDOS NUCLEICOS 2013 Tema:5 Dra. Silvia Varas bioquimica.enfermeria.unsl@gmail.com Descubrimiento El descubrimiento de los ácidos nucleicos se realiza en el año 1869. A partir de núcleos de

Más detalles

Qué sabemos de la naturaleza física del gen?

Qué sabemos de la naturaleza física del gen? LAS BASES MOLECULARES DE LA HERENCIA - Genes como entidades abstractas - Se duplican y pasan a la generación siguiente - De algún modo controlan los caracteres hereditarios HERENCIA DE LOS GENES ANÁLISIS

Más detalles

Acidos Nucleicos. Cap.3 Dra. Millie L. González

Acidos Nucleicos. Cap.3 Dra. Millie L. González Acidos Nucleicos Cap.3 Dra. Millie L. González Acidos Nucleicos Los ácidos nucleicos son de suma importancia para las células, ya que almacenan, transmiten y expresan la información genética Son polímeros

Más detalles

AUTOR/PRODUCCIÓN: España. Ministerio de Educación y Ciencia

AUTOR/PRODUCCIÓN: España. Ministerio de Educación y Ciencia TÍTULO DEL VIDEO: ADN AUTOR/PRODUCCIÓN: España. Ministerio de Educación y Ciencia DURACIÓN: 00:01:04 GÉNERO: Ficción AÑO: DESCRIPCIÓN: El video trata sobre el material genético o ADN de los seres vivos,

Más detalles

ADN, ARN E INFORMACIÓN

ADN, ARN E INFORMACIÓN ADN, ARN E INFORMACIÓN LOS ÁCIDOS NUCLEICOS Los ácidos nucleicos fueron descubiertos en 1869 por Miescher, en el pus de los vendajes de heridas, pero su papel en la herencia y control de la actividad celular

Más detalles

Capítulo 13 REPLICACIÓN DEL ADN

Capítulo 13 REPLICACIÓN DEL ADN REPLICACIÓN DEL ADN La reproducción necesita la correcta y precisa transmisión de la información genética de padres a hijos, por lo que resulta imprescindible la previa replicación o duplicación del ADN

Más detalles

Introducción a la Biología Molecular

Introducción a la Biología Molecular Introducción a la Biología Molecular Gonzalo Gómez ggomez@cnio.es Unidad de Bioinformática (CNIO) http://bioinfo.cnio.es/ Facultad de Informática, Ourense Mayo 2009 1 Niveles de organización DNA El ácido

Más detalles

FISIOLOGÍA GENERAL Jesús Merino Pérez y María José Noriega Borge

FISIOLOGÍA GENERAL Jesús Merino Pérez y María José Noriega Borge REPLICACIÓN DEL ADN INTRODUCCIÓN La unidad básica de información en los seres vivos es el gen, definido en células eucariotas como un segmento de ADN que lleva la información necesaria para la síntesis

Más detalles

7.012 Serie de ejercicios 5

7.012 Serie de ejercicios 5 Nombre Grupo 7.012 Serie de ejercicios 5 Pregunta 1 Al estudiar los problemas de esterilidad, usted intenta aislar un hipotético gen de conejo que explique la prolífica reproducción de estos animales.

Más detalles

NIVEL QUÍMICO DE ORGANIZACIÓN DEL CUERPO HUMANO

NIVEL QUÍMICO DE ORGANIZACIÓN DEL CUERPO HUMANO NIVEL QUÍMICO DE ORGANIZACIÓN DEL CUERPO HUMANO 10. Defina macromolécula utilizando los términos polímero y monómero. Cite ejemplos. 11. Qué elementos químicos poseen los glúcidos y por qué reciben el

Más detalles

Tema XI: Ácidos nucléicos (Introducción)

Tema XI: Ácidos nucléicos (Introducción) República Bolivariana de Venezuela Ministerio del Poder Popular para la Educación U.E. Colegio Santo Tomás de Villanueva Departamento de Ciencias Cátedra: Ciencias Biológicas 3 Año Tema XI: Ácidos nucléicos

Más detalles

Trabajo realizado por : Álvaro Moya Víctor Moya Fran Moyano

Trabajo realizado por : Álvaro Moya Víctor Moya Fran Moyano Trabajo realizado por : Álvaro Moya Víctor Moya Fran Moyano ÍNDICE ADN - Historia del ADN - Qué es el ADN? - De qué está formado? - Qué función tiene? Ingeniería genética - Qué es la ingeniería genética?

Más detalles

Unidad 3: Organización molecular de la célula Proteínas

Unidad 3: Organización molecular de la célula Proteínas Proteínas Las proteínas son las biomoléculas más abundantes de las células, constituyendo el 50% de su peso seco aproximadamente. Estructuralmente, son polímeros de aminoácidos. Existe una enorme variedad

Más detalles

ÁCIDOS NUCLEICOS. By Manuel Maria Morato Victor Barrios

ÁCIDOS NUCLEICOS. By Manuel Maria Morato Victor Barrios ÁCIDOS NUCLEICOS By Manuel Maria Morato Victor Barrios Los ácidos nucleicos son grandes polímeros formados por la repetición de monómeros denominados nucleótidos, unidos mediante enlaces fosfodiéster.

Más detalles

Proyecto GENOMA HUMANO

Proyecto GENOMA HUMANO CÉLULAS MADRE Proyecto GENOMA HUMANO PROYECTO GENOMA HUMANO PROYECTO GENOMA HUMANO TIPOS DE ADN EN EL GENOMA HUMANO Intrones, promotores y regiones reguladoras (40 %) DNA intergénico con funciones desconocidas(68,3

Más detalles

17.- INGENIERÍA GENÉTICA

17.- INGENIERÍA GENÉTICA 17.- INGENIERÍA GENÉTICA SECUENCIACIÓN DEL ADN Se puede hacer de todo el ADN o de genes sueltos. Sabiendo la secuencia de un gen se puede comparar con el gen de un individuo y saber si está mutado. 1.

Más detalles

TEMA 6. LOS ÁCIDOS NUCLEICOS.

TEMA 6. LOS ÁCIDOS NUCLEICOS. TEMA 6. LOS ÁCIDOS NUCLEICOS. 1.-Importancia de los ácidos nucleicos. 2.-Componentes de los ácidos nucleicos. 2.1. Los nucleótidos. 2.2. Funciones de los nucleótidos. 3.- El enlace nucleotídico. 4.- El

Más detalles

UNIDAD 1: Introducción a la biología

UNIDAD 1: Introducción a la biología UNIVERSIDAD DEL TOLIMA FACULTAD DE CIENCIAS BÁSICAS PROGRAMA DE MATEMÁTICAS CON ÉNFASIS EN ESTADÍSTICA MICROCURRICULO ASIGNATURA: OPTATIVA EN BIOLIGÍA CONTENIDOS UNIDAD 1: Introducción a la biología Explicar

Más detalles

UD 5: LOS ÁCIDOS NUCLEICOS

UD 5: LOS ÁCIDOS NUCLEICOS UD 5: LOS ÁCIDOS NUCLEICOS ÍNDICE: 1. COMPOSICIÓN QUÍMICA Y CLASIFICACIÓN 2. NUCLEÓTIDOS 3. ADN. COMPOSICIÓN QUÍMICA Y ESTRUCTURA Y PROPIEDADES. 4. ARN 1. ARN MENSAJERO 2. ARN TRANSFERENTE 3. OTROS ARNs

Más detalles

III INFORMACIÓN CELULAR

III INFORMACIÓN CELULAR III INFORMACIÓN CELULAR POR QUÉ ES NECESARIA LA INFORMACIÓN CELULAR? En toda célula, tanto procariota como eucariota, se dan complejos procesos metabólicos y fisiológicos con la finalidad de obtener materiales

Más detalles

Ingeniería Genética II

Ingeniería Genética II Ingeniería Genética II Expresión de proteínas recombinantes Vectores de expresión Características adicionales: - Promotor regulable - Terminador de la transcripción - Sitio de reconocimiento por el ribosoma

Más detalles

Investigación en genes. Tecnología del ADN recombinante

Investigación en genes. Tecnología del ADN recombinante Investigación en genes Tecnología del ADN recombinante Tecnología del ADN recombinante 1º parte: Conocimientos básicos que posibilitaron su desarrollo 2º parte: Instrumentos básicos 3º parte Ejemplos Conocimientos

Más detalles

Guía para el docente Material genético y reproducción celular Mitosis. Guía para el docente

Guía para el docente Material genético y reproducción celular Mitosis. Guía para el docente Guía para el docente Descripción curricular: - Nivel: 2º Medio - Subsector: Biología - Unidad temática: Material Genético y Reproducción celular. - Palabras claves: ciclo celular, mitosis, cromosoma, cromátida,

Más detalles